MASARYK UNIVERSITY
FACULTY OF MEDICINE
DEPARTMENT OF PHARMACOLOGY
THE ROLE OF CYTOCHROME P450 IN DRUG
SAFETY AND EFFICACY
Habilitation thesis
PharmDr. Ondřej Zendulka, Ph.D.
Brno 2018
Originality and Conflict of Interest Statement
The original data presented in this habilitation thesis were collected by the author together
with his colleagues, students, and members of cooperating research groups who are coauthors
of cited original manuscripts. The research was supported by following projects:
Specific University Research Grant Masaryk University: MUNI/A/1132/2017,
MUNI/A/1063/2016, MUNI/A/1284/2015, MUNI/A/1116/2014, MUNI/A/0886/2013
Czech Science Foundation: GA16-06106S, 525/06/1757
Internal Grant Agency of Czech Ministry of Health: NS 9676-4/2008
Ministry of Education, Youth and Sports of the Czech Republic: MSM 0021622404
I hereby declare that I have no conflict of interest.
Acknowledgements
First of all, I would like to thank to all my colleagues, students, and supervisors. The research
presented in this thesis would never have been done without their support, advice, and help. My
special acknowledgement goes to Gabriela Dovrtělová, Kristýna Nosková, Michaela Sabová, and Jan
Juřica, who are and always will be the core of our “pharmacokinetic research group”. Thank you for
the time spent in our lab as well as for the hundreds of hours consumed by the preparation of our
manuscripts. Gábi, thank you for enthusiasm and patience with all the microsomal and HPLC
methods. I would like to give many thanks to our laboratory technician Květoslava Sedlářová. You
have always been the spirit of the lab and the one who gives a helping hand at the critical moments.
I would like to express my gratitude to my PhD supervisor Jiří Totušek and Professor Alexandra
Šulcová who keep me motivated to continue with my research. Many thanks also go to the head of
the Department Regina Demlová for her comprehension of the importance of our research. Many of
the articles presented in this thesis would never have arisen without the co-operation of our
colleagues from other research institutions. I have to give special mention to Pavel Anzenbacher and
Anna W. Daniel, who are my cytochrome P450 step-parents. Thank you for your advice and
methodological help. My great thanks also go to Nataša Hlaváčová from the Slovak Academy of
Sciences and to Petr Pávek and his teammates from Charles University.
Finally, I would like to thank my family for their endless support and love. Thank you Lucia and Hugo.
Content
1 Annotation....................................................................................................................................... 1
2 Introduction..................................................................................................................................... 2
3 Drug-drug interactions on the level of P450................................................................................... 4
3.1 The interaction of memantine and fluoxetine in rats ............................................................. 5
4 The role of P450 in drug development and safety........................................................................ 13
4.1 Experimental testing of P450 interactions with natural substances..................................... 14
4.1.1 The influence of linalool and active compounds of saffron on P450 activity ............... 14
4.1.2 The influence of crocin and safranal on rat P450.......................................................... 15
4.1.3 The influence of linalool on rat P450 ............................................................................ 23
4.1.4 The influence of trans-resveratrol and quercetin on rat P450...................................... 30
4.1.5 Intersexual differences in the inhibitory effect of trans-resveratrol on rat P450......... 37
5 Endogenous regulation of P450 activity........................................................................................ 42
5.1 Bile acids and P450................................................................................................................ 42
5.2 Endocannabinoid system and P450 ...................................................................................... 58
5.2.1 The role of ECS in the regulation of P450 activity......................................................... 58
5.2.2 The effect of oleamide on the activity of rat and human P450 .................................... 82
6 P450 phenotyping in clinical practice............................................................................................ 95
6.1 Phenotyping of CYP1A2 with caffeine as a probe substrate................................................. 97
6.2 Phenotyping of CYP2D6 with dextromethorphan as a probe substrate............................. 107
7 Conclusions.................................................................................................................................. 113
8 References................................................................................................................................... 114
1 Annotation
This cumulative habilitation thesis consists of 8 original and 2 review articles published in the years
2008 – 2018. The work is thematically divided into four parts. My research work is focused on the
preclinical and clinical research of cytochrome P450 enzymes (P450), which is probably the most
important enzyme system involved in drug metabolism. Changes in its activity are therefore able to
influence the levels of its substrates in plasma and target sites. Therefore P450 activity is related to
the safety and efficacy of the administered drugs.
The P450 system is briefly reviewed in the introduction followed by a description of the mechanism
of drug-drug interactions at the P450 level, and possible clinical consequences are explained. A study
describing the co-administration of memantine and fluoxetine is given as an example of research in
this field.
Interactions with P450 are a standard part of drug development. Another field of interest of my
research is natural substances with promising potential for therapeutic use. The polyphenolic
substances resveratrol, quercetin, and psychotropic substances crocin, safranal, and linalool were
tested for their interactions with rat P450 in the second part of the thesis.
The activity of P450 is regulated by many endogenous factors including hormones, cytokines, and
bile acids, but the role of the endocannabinoid system, a promising target of new therapeutic
strategies, is unknown. Therefore the third part of the thesis summarises the state of the art of
interactions between cannabinoids and P450 and postulates a hypothesis of how this system can be
involved in the regulation of P450 activity. An experimental study with the endocannabinoid
substance oleamide reveals some possible aspects of this regulation.
The methods for clinical phenotyping of P450 developed in cooperation with the Department of
Psychiatry of University Hospital Brno are described in the final part of the work. The methods
illustrate the clinical use of research that I have been involved in.
1
2 Introduction
The effectiveness of pharmacotherapy depends on many factors. Besides the essential requirement –
to correctly diagnose the disease and select a suitable drug, the proper dose, route of administration,
dosing schedule, and especially patient’s adherence to the prescribed therapy determines the
outcomes of the therapy. Non-adherence is an age-old problem which is also reflected in a quote
from Hippocrates: “Keep a watch also on the faults of the patients, which often make them lie about
the taking of things prescribed (Hippocrates et al., 1923).” In fact, clinical studies document that the
number of patients with poor adherence to therapy is about 40% by the end of one year of therapy
(Blaschke et al., 2012). On the other hand we should ask the question: Why do patients not adhere to
their therapy? Why don’t they follow our instructions? It is obvious that in some cases it can be
caused by a complicated dosing regimen. Simplification of the dosing scheme with a reduced
numbers of doses (Coleman et al., 2012) or single-pill combinations (Vrijens et al., 2017) could be a
suitable solution for this problem. Another reason for drug discontinuation or irregular use can be
inefficacy or side effects of a drug (Ascher-Svanum et al., 2010).
In most drugs used in clinical practice, the safety and efficacy of pharmacotherapy depend on the
interaction between the molecule of a drug and its target structure. But what determines the quality
and quantity of the final effect of a drug, and why is the effect not always the same when the same
drug, in the same dose, and in the same form is administered via the same route of administration to
different patients? The answer is simple. It is caused by pharmacodynamic and pharmacokinetic
variability. In other words, the final effect is determined not only by the presence of the target
structure and drug affinity to it, but also by the concentration of the drug at the target site. Today,
we are able to measure the density of different receptors and other target structures as well as the
binding affinity of a drug in vivo. Unfortunately, the methods for such an assessment are timeconsuming
and too expensive to be used routinely for clinical practice (Ostad Haji et al., 2012). On
the other hand, pharmacokinetic variability can be easily measured by the assessment of drug
plasma levels. This could be used for the individualisation of drug dosing to limit adverse reactions
and to increase adherence. Therapeutic drug monitoring is used in drugs with a known relation
between their plasma level and effect (Ostad Haji et al., 2012) and especially for drugs with a narrow
therapeutic range (Kang and Lee, 2009). Pharmacokinetic variability seems to be easier to evaluate or
predict than pharmacodynamic variability.
One of the major causes of pharmacokinetic variability is the enzymatic system of cytochrome P450.
It consists of intracellular heme-binding enzymes found in all cellular living organisms, including
prokaryotes (Khmelevtsova et al., 2017). P450 enzymes are membrane-bound intracellular proteins
present mainly on the endoplasmic reticulum and to a minor extent also on plasma membranes and
2
mitochondria (Ahn and Yun, 2010). Their distribution in the human body varies in different tissues
and organs with the predominant activity in the liver (Lin and Lu, 2001).
P450 has extremely low substrate specificity and it participates both in the biosynthesis and
metabolism of various endogenous compounds (Gordeziani et al., 2016) and in the elimination of
xenobiotic substrates, including a myriad of drugs (Zanger et al., 2008). Generally, it belongs to the
Phase I enzymes of drug metabolism. The most common type of reaction catalysed by P450 is
monooxydation (Anzenbacher and Anzenbacherová, 2003). Nevertheless, other types of oxidation
are also catalysed by P450 (Hrycay and Bandiera, 2015). The catalytic apparatus of P450 is complex
and requires other co-factors and enzymes for its reactions.
The system of P450 is classified into families and subfamilies with respect to their primary structure.
There have been at least 18 human (Nelson, 2006), 62 plant (Xu et al., 2015), and 292 fungal (Moktali
et al., 2012) families of P450, amounting to thousands of described unique P450 genes which can be
found elsewhere (https://www.pharmvar.org/genes). The most clinically relevant P450 enzymes are
CYP3A4, CYP2D6, CYP2C9, CYP2C19, and CYP2B6. These five enzymes are involved in the metabolism
of over 90% of P450 drug substrates (Pelkonen et al., 2008). Another important P450 in drug
metabolism is also CYP1A2. Even though the number of drugs metabolized via this enzyme is not as
high, it is involved in the activation of some procarcinogens (He and Feng, 2015) and its activity can
be induced by tobacco smoke (Gunes et al., 2009).
3
3 Drug-drug interactions on the level of P450
The risk of drug-drug interactions rises with extensive drug metabolism via the P450 system and with
the number of drugs co-administered. In fact, the induction and more frequent inhibition of P450
metabolic activity are probably the most frequent causes of documented drug-drug interactions (Lin
and Lu, 1998). A review of drugs inhibiting and inducing P450 activity can be found elsewhere
(http://medicine.iupui.edu/clinpharm/ddis/main-table/). The basic principle of this mechanism is the
interaction of two drugs at the active site of the enzyme. Both of the drugs can be substrates of the
enzyme or one can be a substrate and the other an inhibitor/inducer of the enzyme.
Cytochromes P450 are involved not only in the pharmacokinetic process of drug elimination, but in
orally taken drugs also in their absorption in the intestine. Enterocytes together with the liver serve
as the first line of defence of the human body against xenobiotics from the diet. Therefore,
hepatocytes are rich in P450 enzymes and all substances absorbed from the gut enter the portal vein
and are transported into the liver prior to entering systemic circulation. Drugs with extensive
presystemic metabolism after oral use have increased bioavailability after P450 inhibition and
conversely an increase in P450 activity decreases their bioavailability and plasma levels. With P450
inhibition, toxicity symptoms of P450 substrates can occur, while with induction the drug can
become inefficient.
There are various mechanisms through which the drugs can interact at the P450 level. The induction
of gene transcription and increase in protein levels is the most common mode of P450 induction
(Waxman, 1999). A less frequently reported mechanism is positive cooperation, in which a substrate
binds to a binding site and causes a conformational change leading to an increase in the affinity of
other binding sites (Denisov et al., 2009). The dose of P450 substrates which induce their own
metabolism has to be increased over time, as their elimination gradually increases (Lynch and Price,
2007).
Inhibition is a more frequent type of interaction with P450. The clinical impact of P450 inhibition
depends mainly on the type of inhibition and the width of the therapeutic range of the substrate. The
competitive inhibition between substrates is usually clinically insignificant in terms of
pharmacokinetic variability in general. The seriousness of the interaction also exponentially declines
with the number of alternative metabolic pathways. Signs of toxicity should be expected only when
substrates of P450 with an extremely narrow therapeutic range are used. Such drugs are routinely a
subject of therapeutic drug monitoring and their dosaging is individualized to reach the target plasma
level and prevent adverse reactions and toxicity. Inhibitors of P450 enzymes can compete with the
enzymes or act in a non-competitive manner and can bind to an enzyme molecule reversibly or
4
irreversibly. For clinical purposes, inhibitors are sometimes classified into weak, mild, and moderate
or their strength of inhibition is compared with other known inhibitors. The same enzyme involved in
the drug’s metabolism can be inhibited by the drug or the drug can be metabolized by one P450 and
inhibit another one. In rare cases, a P450 inhibitor is combined with its substrate to increase its
plasma level (Lynch and Price, 2007).
Unlike inhibition, there is a delay between the beginning of inducer administration and the process of
P450 induction. This is caused by the mechanism of induction itself, which requires the transcription
of P450 genes to mRNA, subsequent synthesis of the protein structure, and time is also needed for
translational processes and protein accumulation. The drug’s half-life also plays a role in the speed of
induction (Michalets, 1998). It should be also taken into account that the inhibition of P450 activity
can persist even weeks after discontinuing administration of the inhibitor (Juřica and Žourková,
2013).
3.1 The interaction of memantine and fluoxetine in rats
Memantine is one the few antagonists of glutamatergic NMDA receptors used in pharmacotherapy.
Besides acetylcholine esterase inhibitors, it is used in the treatment of dementia and it is believed to
be a safe drug with a minimum of adverse effects in comparison to other NMDA blockers such as
phencyclidine or MK-801.The most frequently is memantine prescribed in elderly as the incidence of
cognitive impairment exponentially increases with age (Rocca, 2000). On the other hand comorbidities,
co-medications and risk of drug-drug interactions also rise in elderly patients. In our
study, we researched the possible interaction between memantine and known P450 inhibitor
fluoxetine in two different models in rats. Both drugs were administered intraperitoneally for 10 days
at the following doses: fluoxetine 5 mg/kg/day (used only for in vitro part of the experiment) and 20
mg/kg/day, combination of both memantine and fluoxetine 5 mg/kg/day, and memantine 5
mg/kg/day. The activity of rat CYP2D2 which is orthologue to human CYP2D6 was assessed by
dextromethorphan O-demethylation to dextrorphan (Yu, Dong, Lang, & Haining, 2001) in the model
of isolated perfused rat liver or in the in vivo rat pharmacokinetic model. Memantine in our
experiment significantly inhibited CYP2D2 activity as was documented by the decrease of
dextrorphan formation. The strength of the inhibition of both memantine alone and combination of
memantine and fluoxetine was comparable with the fluoxetine at the dose of 20 mg/kg/day.
Interestingly, the effect of memantine, fluoxetine, and its combination differs in the in vivo model.
Oppositely to perfused liver model the weakest inhibition of CYP2D6 activity was detected in animals
with fluoxetine 20 mg/kg/day treatment. Memantine and its combination with fluoxetine inhibited
CYP2D2 activity with similar potency.
5
Zendulka O., Juřica J., Zahradníková L., Sabová M., Šulcová A. Effects of combined treatment with
cognitive enhancer memantine and antidepressant fluoxetine on CYP2D2 metabolic activity in rats.
Neuroendocrinology Letters, 32, 727-732, 2011.
Impact factor: 1.296; Neurosciences Q4, Endocrinology & Metabolism Q4 Citations WoS: 0
Author’s contribution: 35%
6
To cite this article: Neuroendocrinol Lett 2011;32(5):727–732
ORIGINALARTICLE
Neuroendocrinology Letters Volume 32 No. 5 2011
Effects of combined treatment with cognitive
enhancer memantine and antidepressant
fluoxetine on CYP2D2 metabolic activity in rats
Ondrej Zendulka2, Jan Jurica1,2, Lucia Zahradnikova2,
Michaela Sabova1,2, Alexandra Sulcova1,2
1 Central European Institute of Technology (CEITEC), Masaryk University, Brno, Czech Republic
2 Department of Pharmacology, Faculty of Medicine, Masaryk University, Brno, Czech Republic
Correspondence to: Jan Juřica, PhD.
Central European Institute of Technology (CEITEC), Masaryk University,
Kamenice 5, 625 00 Brno, Czech Republic.
tel: +420-549 494 531; fax: +420-549 492 364; e-mail: jurica@med.muni.cz
Submitted: 2011-02-14 Accepted: 2011-03-05 Published online: 2011-11-12
Key words: cytochrome P450; memantine; fluoxetine; rat; inhibition
Neuroendocrinol Lett 2011;32(5):727–732 PMID: 22167136 NEL320511A11 ©2011 Neuroendocrinology Letters • www.nel.edu
Abstract OBJECTIVES: The drug-drug interactions can result in alterations of the therapeutical
responses. The present study was designed to investigate possible pharmacokinetic
interactions between the cognitive agent memantine and the antidepressant
fluoxetine combined often in treatments of cognitive disorders including
Alzheimer disease. The attention was focused on changes of the cytochrome
P450 2D2 isoenzyme activity in two animal models.
METHODS AND DESIGN: The tested drugs were administered alone or in a
combination to rat males and their effects on the 2D2 isoenzyme activity was
determined after in vivo administration. The levels of marker dextromethorphan,
its 2D2 specific metabolite dextrorphan were analyzed in plasma of rats and using
the model of isolated perfused rat liver in the perfusion medium. The dextromethorphan/dextrorphan
(DEM/DEX) metabolic ratios were determined as a
sign of inhibitory influences on CYP2D2.
RESULTS: The analyses showed elevation of DEM/DEX metabolic ratio after all
treatments: a) memantine, b) fluoxetine and c) memantine+fluoxetine, however
the results were not completely identical. The intensity of inhibitory effects on the
CYP2D2 activity were: memantine < memantine + fluoxetine < fluoxetine.
CONCLUSION: The results presented suggest that the clinical pharmacotherapeutical
approach to combine memantine with fluoxetine is from the point of view
of pharmacokinetic drug-drug interaction on the level of CYP2D2 isoenzyme
safe and even of benefit as memantine could elicit a suppression of the inhibitory
influence of fluoxetine.
Abbreviations:
AD - Alzeimer’s disease
DEM - dextromethorphan
DEX - dextrorphan
FLU - fluoxetine
HPLC - high-performance liquid chromatography
MEM - memantine
MR - metabolic ratio
NMDA - N-methyl-D-aspartic acid
INTRODUCTION
Alzheimer disease and other neuropsychiatric disorders
leading to dementia or cognitive deficits are supposed
to be the major health concern of the coming
decades (McDonald et al. 2010). The incidence of cognitive
impairment is rapidly rising as the life expectancy
is remarkably increasing over the last 50 years
7
728 Copyright © 2011 Neuroendocrinology Letters ISSN 0172–780X • www.nel.edu
Ondrej Zendulka, Jan Jurica, Lucia Zahradnikova, Michaela Sabova, Alexandra Sulcova
and the exponential risk of age-related dementias is
described (Rocca 2000). Although dementia is the
problem of high importance, only few substances are
approved and used in the therapy of this illness. Apart
from the inhibitors of acetylcholinesterase, memantine
(MEM) is still the only drug acting on glutamatergic
NMDA receptors. It was originally synthesized in
Eli Lilly Research Laboratories as an agent lowering
hyperglycemia, but it was completely devoid of such
effect and it was introduced into the therapy of cerebral
ischemia and Alzheimer’s dementia (AD) later on
(Parsons et al. 1999). Memantine is believed to be a
safe drug with a minimum of adverse effects in comparison
to other NMDA blockers such as MK-801 or
phencyclidine. The difference between these substances
and MEM lays probably in the pathway of influencing
the glutamate channels. Molecules with lower affinity,
faster blocking/unblocking kinetics and weaker
voltage-dependency (MEM, dextromethorphan, amantadine)
are not burdened with negative psychotropic
effects which are known to be associated with administration
of high affinity NMDA receptor blockers with
slow action (MK-801, phencyclidine) (Parsons et al.
1999). The most frequent side effect of memantine are
psychomimetic responses, which appear in the case that
a recommended starting dosing titration (5–20 mg over
3–4 weeks) is skipped or if MEM is co-administered
with dopaminergic agents (Parsons et al. 1999). The
same expectations were reviewed recently (Repantis
et al. 2010) on the basis of some stimulant-like effect
reports. Those reports on negative effects of MEM were
not a cause for treatment discontinuation as described
in the meta-analysis containing 6 trials in 2312 subjects
(Doody et al. 2007).
The most frequent MEM prescription can be found
in elderly with high probability of commorbidities
requiring other pharmacotherapeutical intervention.
Rather often with some other psychotropics, due to
apathy (Wuwongse et al. 2010) or depression (the incidence
from 3.2 up to 27% patients with AD) (Newman
1999, Castilla-Puentes & Habeych 2010). MEM is also
reported to enhance effects of antipsychotics on negative
symptoms (Krivoy et al. 2008), positively influence
treatment of substance abuse (alcohol, heroin) (Zdanys
& Tampi 2008) and it also showed the synergic effect
with fluoxetine (FLU) in the combined treatment of
obsessive compulsive disorder (Wald et al. 2009). The
proposed combination either with psychotropics or
with other drugs of other classes brings out the problem
of drug-drug interaction. MEM is believed to be a safe
drug. It is not metabolized via cytochrome P450 (CYP)
system and it is believed to produce irrelevant changes
in the activity of these enzymes, thus no pharmacokinetic
interactions on that level are expected (Nameda).
Nevertheless some discrepant reports can be found
(Keltner & Williams 2004, Micuda et al. 2003). There
was investigated in the present study the activity of rat
CYP2D2, which is an orthologue of human CYP2D6
(Zahradnikova et al. 2007), one of the most clinically
relevant CYP isoenzymes. The influences of MEM,
CYP2D2 inhibitor FLU, and MEM+FLU were analysed
in rats in vivo and in the isolated liver.
MATERIAL AND METHODS
Animals
The experiment was carried out on male Wistar albino
rats weighing 200±20g (Biotest, Czech Republic) at
the beginning of experiment. Animals were housed
under controlled conditions (temperature: 22±2°C;
air humidity 50–60%; light regime 12h light/12h dark,
lights on 6:00–18:00) in standard plastic cages with free
access to water and pellet diet and underwent a 7 day
long acclimatization before the start of the experiment.
Rats were randomly subdivided into 5 groups per 10
animals for the isolated liver experiment. Tested substances
were dissolved in saline and administered intraperitoneally,
1 bolus/day for 10 days according to the
following design: M5 (MEM 5mg/kg/day); FLU5 and
FLU20 (FLU 5 or 20mg/kg/day), MF5 (MEM+FLU
5mg/kg/day both) and C (saline in adequate volume
of 1ml/kg/day as a control). Another 4 groups per 18
animals served for the pharmacokinetic experiment
in vivo. These groups were administered identically as
the M5, MF5, F20 and C. All procedures of animal care
were approved by the Czech Central Commission for
Animal Welfare.
The model of perfused rat liver
The activity of CYP2D2 was assessed in the model
of isolated perfused rat liver as described elsewhere
(Zendulka et al. 2008). The animal was anesthetized
with the mixture of ketamine (100mg/kg) and xylazine
(16mg/kg), vena portae was cannulated and the
liver was isolated from the abdominal cavity. The liver
was perfused with tempered saline during the isolation.
Then, saline was changed for Williams medium E
(120ml) and liver was perfused in the modified recirculating
apparatus described by Miller (Miller et al. 1951)
for 120 minutes from the start time: the addition of
DEM (1.2mg) into the perfusion medium. The perfusion
medium samples were collected in the 30th, 60th
and 120th minute of perfusion.
The in vivo rat pharmacokinetic model
Animals were anesthetized with the same anesthetic
mixture of ketamine and xylazine as described in the
previous model. DEM was injected into the tail vein at
the dose of 10mg/kg. Experimental groups were subdivided
into three subunits per 6 animals. Three samples
were withdrawn from each animal to obtain nine sampling
intervals for each group at all. Blood was withdrawn
from plexus retrobulbaris by a heparinized glass
capillary tube in the following intervals after the DEM
injection: 10th; 20th; 40th; 60th; 90th; 120th; 180th; 240th
8
729Neuroendocrinology Letters Vol. 32 No. 5 2011 • Article available online: http://node.nel.edu
Memantine inhibits CYP2D2 in rats
Fig. 1. Levels of dextromethorphan in
the perfusion medium in animals
administered with memantine
5 mg/kg/day (M), fluoxetine 5
or 20 mg/kg/day (F5 and F20),
memantine+fluoxetine both 5 mg/kg/
day (MF5) and in control animals (C).
Experimental conditions are described
in Material and Methods. Data represent
mean ± S.E.M. * p≤0.05; ** p≤0.01; ***
p≤0.001 versus C group.
30 60 120
0
100
200
300
400
500
600
700
800
900
1000
C M5 MF5 F5 F20
**
***
**
***
** ***
***
*
time [min]
conc.[ug/L]
C M5 MF5 F5 F20
time [min]
conc.[ug/L]
30 60 120
0
500
1000
1500
2000
2500
3000
3500
4000
***
***
**
***
***
***
***
**
***
***
***
C M5 MF5 F5 F20
time [min]
MR[DEM/DEX]
30 60 120
0.01
0.1
1
10
*
***
***
**
*
**
**
*
**
***
*
Fig. 2. Levels of dextrorphan in the
perfusion medium in animals
administered with memantine 5 mg/kg/
day (M), fluoxetine 5 or 20 mg/kg/day
(F5 and F20), memantine+fluoxetine
both 5 mg/kg/day (MF5) and in control
animals (C). Experimental conditions
are described in Material and Methods.
Data represent mean ± S.E.M. ** p≤0.01;
*** p≤0.001 versus C group.
Fig. 3. Metabolic ratios of
dextromethorphan/dextrorphan in
animals administered with memantine
5 mg/kg/day (M), fluoxetine 5
or 20 mg/kg/day (F5 and F20),
memantine+fluoxetine both 5 mg/kg/
day (MF5) and in control animals (C).
Experimental conditions are described
in Material and Methods. Data represent
mean ± S.E.M. * p≤0.05; ** p≤0.01; ***
p≤0.001 versus C group.
and 300th minute. Coagulated
blood was then centrifuged to
obtain serum samples.
Sample analyses
Analyses of plasmatic and perfusion
medium samples were performed
after the incubation with
β-glucuronidase and a liquid/liquid
extraction using HPLC methods
described by Zimova (Zimova et al.
2001). Metabolic ratios (MRs) were
calculated using equation MR =
conc. DEM / conc. DEX.
Statistical analyses
Values of measured DEM and
DEX concentration were tested for
outliners with Dixon’s Q-test and
outliners were rejected (95% confidence
level). Remaining values
were statistically analyzed with the
F-test and Student’s t-test (Microsoft
Excel 2000). The level p≤0.05
was considered to be a statistically
significant difference.
Fig. 1.
Fig. 2.
Fig. 3.
9
730 Copyright © 2011 Neuroendocrinology Letters ISSN 0172–780X • www.nel.edu
Ondrej Zendulka, Jan Jurica, Lucia Zahradnikova, Michaela Sabova, Alexandra Sulcova
Tab. 1. Plasmatic levels of dextromethorphan [μg/L] in animals administered with memantine 5 mg/kg/day (M), fluoxetine 20 mg/kg/day
(F20), memantine+fluoxetine both 5 mg/kg/day (MF5) and in control animals (C), in the pharmacokinetic experiment in vivo. Experimental
conditions are described in Material and Methods. Data represent mean ± S.E.M. ** p≤0.01; *** p≤0.001 versus C group.
Time [min]
Group
C M5 MF5 F20
10 2089.0 ± 424.2 530.0 ± 20.1*** 285.9 ± 103.4*** 1017.0 ±123.0**
20 1746.3 ± 194.7 333.1 ± 41.4*** 176.6 ± 92.4*** 822.2 ± 57.3***
40 273.0 ± 34.1 217.1 ± 110.8 110.9 ± 19.2*** 535.5 ±96.6***
60 161.9 ± 27.2 130.4 ± 36.4 82.4 ± 20.6*** 440.3 ± 39.9***
90 91.8 ± 6.8 88.7 ± 35.3 60.4 ± 6.6*** 332.8 ± 72.7***
120 91.9 ± 41.3 66.1 ± 18.2 38.0 ± 7.3** 222.0 ± 83.3***
180 104.9 ± 45.0 25.4 ± 3.8** 31.7 ± 7.2** 191.4 ± 46.8***
240 69.5 ± 38.7 42.7 ± 24.2 12.8 ± 1.7** 122.6 ± 32.7**
300 25.2 ± 10.8 22.6 ± 7.3 20.5 ± 8.4 119.1 ± 46.2***
Tab. 2. Plasmatic levels of dextrorphan [μg/L] in animals administered with memantine 5 mg/kg/day (M), fluoxetine 20 mg/kg/day (F20),
memantine+fluoxetine both 5 mg/kg/day (MF5) and in control animals (C), in the pharmacokinetic experiment in vivo. Experimental
conditions are described in Material and Methods. Data represent mean ± S.E.M. * p≤0.05; ** p≤0.01; *** p≤0.001 versus C group.
Time [min]
Group
C M5 MF5 F20
10 1281.5 ± 486.6 142.7 ± 24.7** 37.4 ± 9.7** 442.7 ± 262.7**
20 2100,8 ± 373.1 160.6 ± 40.7*** 67.4 ± 41.2*** 841.1 ± 366.1***
40 546.5 ± 47.0 198.3 ± 105.0*** 87.8 ± 16.0*** 920.8 ± 401.5*
60 514.6 ± 161.8 169.4 ± 70.7** 83.7 ± 31.4*** 710.1 ±74.3*
90 328.0 ± 93.5 104.1 ± 32.0*** 78.5 ± 15.2*** 819.1 ± 466.9
120 424.1 ± 146.3 288.2 ± 216.6 59.7 ± 13.1*** 611.5 ± 160.0
180 1405.0 ± 608.7 104.2 ± 60.8*** 114.4 ± 68.7*** 1110.5 ± 425.6*
240 1483.1 ± 434.6 272.6 ± 103.8*** 389.4 ± 87.0*** 1071.1 ± 313.3
300 1550.3 ± 408.2 657.4 ± 196.2*** 327.1 ± 87.0 1241.3 ± 502.3
Tab. 3. Dextromethorphan/dextrorphan metabolic ratios in animals administered with memantine 5 mg/kg/day (M), fluoxetine
20 mg/kg/day (F20), memantine+fluoxetine both 5 mg/kg/day (MF5) and in control animals (C), in the pharmacokinetic experiment in vivo.
Experimental conditions are described in Material and Methods. Data represent mean ± S.E.M. * p≤0.05; ** p≤0.01; *** p≤0.001 versus C
group.
Time [min]
Group
C M5 MF5 F20
10 1.80 ± 0.64 3.79 ± 0.54*** 8.12 ± 3.78** 3.02 ± 1.64
20 0.85 ± 0.20 2.18 ± 0.54*** 2.87 ± 0.72** 1.30 ± 0.61
40 0.51 ± 0.03 1.19 ± 0.37** 1.30 ± 0.30*** 0.55 ± 0.15
60 0.34 ± 0.11 0.83 ± 0.19*** 1.04 ± 0.22*** 0.61 ± 0.08***
90 0.14 ± 0. 13 0.87 ± 0.06*** 0.85 ± 0.11*** 0.40 ± 0.14*
120 0.26 ± 0.13 0.38 ± 0.26 0.66 ± 0.16*** 0.43 ± 0.24
180 0.09 ± 0.06 0.34 ± 0.22** 0.44 ± 0.29* 0.20 ± 0.07**
240 0.05 ± 0.03 0.22 ± 0.22 0.04 ± 0.01 0.12 ± 0. 04**
300 0.02 ± 0.01 0.03 ±0.01** 0.06 ± 0.01*** 0.11 ± 0.05***
10
731Neuroendocrinology Letters Vol. 32 No. 5 2011 • Article available online: http://node.nel.edu
Memantine inhibits CYP2D2 in rats
RESULTS
The model of isolated perfused rat liver
Levels of DEM measured in the perfusion medium were
elevated during the whole perfusion in the F5 and MF5
and in the 60th and 120th min in F20 animals (Figure 1).
The administration of MEM did not influence levels of
DEM (M5) as they resembled those in the control (C)
group. In opposite DEX concentrations were lower than
in controls in all groups studied, independently on the
treatment regimen (Figure 2). The only insignificant
difference was measured in the F5 group in the 120th
minute (Figure 2). MRs were elevated in all groups at
all intervals with the exception of the 120th min in the
group M5, but a trend close to the level of significance
(p=0.077) was still present (Figure 3). The MRs increase
in the MF5, F5 and F20 was similar with no significant
differences between groups monitored.
The in vivo rat pharmacokinetic model
The influence of administered drugs on the levels of
DEM varied. In the MF5 group the amounts of DEM
were decreased. In opposite, FLU elicited in the F20
elevation of DEM and MEM (M5) showed practically
no influence (Table 1). Concentrations of DEX were
also altered, but did not reflected changes in DEM
levels. DEX levels were lowered in the M5 animals and
this effect was enhanced by FLU co-administration in
the MF5 group (Table 2). Amounts of DEX similar to
controls were found in the F20, where differences were
present mainly in the first 90 minutes. In all experimental
groups elevated values of MRs were found
(Table 3). The significant difference between the M5,
MF5 animals and controls lasted for the whole experiment
with the exception of the MR in the 240th min
interval. The F20 experimental group also showed
elevation of MRs with later upset (after 180 minutes).
All three experimental groups had elevated MRs in the
end of experiment and the groups differ among each
other. The highest MRs were calculated for the F20 and
it was higher compared to the MF5 value, which was
still more elevated than MRs of the M5.
DISCUSSION
The present study proved MEM as an inhibitor of
the rat CYP2D2 enzyme. This correlates with human
liver microsomes study (Micuda et al. 2004) which
described inhibition of CYP 2B6 (Ki=76.7μM ) and
2D6 (Ki=94.9μM ). The other published data available
report no drug-drug interactions on CYP level caused
by MEM (Sonkusare et al. 2005; Nameda 2010).
The results obtained from both our experimental
models are similar but not identical. On the contrary
to in vivo testing there was registered a time dependent
effect of MEM on CYP2D2 in the model of isolated
perfused rat liver. The inhibition caused by MEM was
detected only in the first two sampling intervals while
it was not present in the 120th min (the p-value (0.07)
was close to the level of significance – p=0.05). This
effect was more pronounced in the in vivo experiment
when MEM inhibited CYP2D2 activity even longer (up
to the 300th min). One could speculate that the higher
DEM concentration available at the beginning of the in
vivo experiment is the factor modulating the inhibition
capacity of MEM. Thus the similar DEM levels during
sampling in both models found could be a sign of higher
inhibition caused by MEM in vivo. (The relatively high
variability in DEM levels measured in vitro could probably
result in non-significant differences calculated.)
There was documented in our study an interesting
interaction between MEM and FLU changing
the inhibitory effect on the CYP2D2 activity. Despite
both drugs suppressed the enzyme activity with lower
impact of MEM the combined treatment MEM+FLU
showed milder effect than FLU alone. FLU is described
as a moderate competitive inhibitor of human CYP2D6
with Ki value 0.6μM (Pelkonen et al. 2008) and its
major metabolite norfluoxetine showed the same
activity (Otton et al. 1993, Crewe et al. 2004). The
inhibition of CYP2D after FLU treatment is observed
even after a single dose, is dose-dependent (Jeppesen
et al. 1996) and can vary among different tissues and
organs (Haduch et al. 2011). The mechanisms of the
interaction between FLU and MEM as modifiers of
CYP2D2 activity can be competitive, uncompetitive or
mixed-type according to binding to the enzyme target.
However the antagonism between enzyme modifiers
MEM and FLU desribed in our study belongs to
effects classified as rare and possible to be predicted
only under very particular circumstances (Schenker
& Baici 2009). Furthermore, the principles of interaction
between two enzyme inhibitors can depend on the
type of inhibition caused as well as on their concentrations
(Schenker & Baici 2009). In our case, comparable
amounts of MEM and FLU were administered (28μM/
kg/day and 16μ M/kg/day respectively) while Ki was
different. Additional experiments with various other
MEM and FLU doses applied can help to clarify this
drug-drug interaction.
There are six CYP2D isoenzymes that have been
genetically identified in rats compared to only one in
humans (Hiroi et al. 2002). The sequential similarity
between rat CYP2D2 and human CYP2D6 is over 70%
(Soucek & Gut 1992). DEM is biotransformed into DEX
exclusively via CYP2D2 enzyme in rats (Kobayashi et
al. 2002) and there are two more metabolites present
(Zendulka et al. 2009). The CYP2D2 catalyzes other
reactions specific for the human 2D6 isoenzyme,
too (Hiroi et al. 2002). Thus, the correlation between
results obtained in CYP2D2 rat models and in CYP2D6
human studies is usually high. The dose of 5 mg/kg/day
in our study was selected on the basis of MEM pharmacokinetic
properties to simulate drug plasmatic levels in
rats similar to those reached in humans treated with the
therapeutic doses of the drug. The MEM dose used in
11
732 Copyright © 2011 Neuroendocrinology Letters ISSN 0172–780X • www.nel.edu
Ondrej Zendulka, Jan Jurica, Lucia Zahradnikova, Michaela Sabova, Alexandra Sulcova
our work is likely to be sufficient to reach peak serum
concentrations at 20–30 min at the upper limit of doses
seen in serum of healthy volunteers and patients with
well tolerated doses of MEM (Parsons et al. 1999).
CONCLUSION
We conclude that the co-administration of therapeutically
relevant doses of MEM with CYP2D6 drug substrates
or even inhibitors of this enzyme would not be
rated as a risk of possible clinical drug-drug interaction
occurrence. The combination of MEM with CYP2D6
inhibitor could even be profitable, because MEM can
moderate FLU inhibitory influence as was documented
in the present study.
ACKNOWLEDGEMENTS
Authors gratefully thank to Mrs. Kvetoslava Sedlarova.
Declaration of interest statement
The work was financially supported by the Ministry of
Education, Youth and Sports of the Czech Republic (MSM
0021622404) and CEITEC - Central European Institute
of Technology” (CZ.1.05/1.1.00/02.0068) projects.
REFERENCES
1 Castilla-Puentes RC & Habeych ME (2010). Subtypes of depression
among patients with Alzheimer’s disease and other dementias.
Alzheimers & Dementia. 6: 63–69.
2 Crewe HK, Lennard MS, Tucker GT, Woods FR & Haddock RE
(2004). The effect of selective serotonin re-uptake inhibitors on
cytochrome P4502D6 (CYP2D6) activity in human liver microsomes
(Reprinted from Br J Clin Pharmacol (1992). 34: 262–265).
Br J Clin Pharmacol. 58: S744–S747.
3 Doody RS, Tariot PN, Pfeiffer E, Olin JT & Graham SM (2007).
Meta-analysis of six-month memantine trials in Alzheimer’s disease.
Alzheimers & Dementia. 3: 7–17.
4 Haduch A, Bromek E & Daniel WA (2011). The effect of psychotropic
drugs on cytochrome P450 2D (CYP2D) in rat brain. Eur J
Pharmacol. 651: 51–58.
5 Hiroi T, Chow T, Imaoka S & Funae Y (2002). Catalytic specificity
of CYP2D isoforms in rat and human. Drug Metab Dispos. 30:
970–976.
6 Jeppesen U, Gram LF, Vistisen K, Loft S, Poulsen HE & Brosen K
(1996). Dose dependent inhibition of CYP1A2, CYP2C19 and
CYP2D6 by citalopram, fluoxetine, fluvoxamine and paroxetine.
Eur J Clin Pharmacol. 51: 73–78.
7 Keltner NL & Williams B (2004). Memantine: A new approach to
Alzheimer’s disease. Perspec Psych C. 40: 123–124.
8 Kobayashi K, Urashima K, Shimada N & Chiba K (2002). Substrate
specificity for rat cytochrome P450 (CYP) isoforms: screening
with cDNA-expressed systems of the rat. Biochem Pharmacol.
63: 889–896.
9 Krivoy A, Weizman A, Laor L, Hellinger N, Zemishlany Z & Fischel
T (2008). Addition of memantine to antipsychotic treatment in
schizophrenia inpatients with residual symptoms: A preliminary
study. EurNeuropsychopharmacol. 18: 117–121.
10 Liston HL, DeVane CL, Boulton DW, Risch SC, Markowitz JS &
Goldman J (2002). Differential time course of cytochrome P450
2D6 enzyme inhibition by fluoxetine, sertraline, and paroxetine
in healthy volunteers. J Clin Psychopharmacol. 22: 169–173.
11 McDonald RJ, Craig LA & Hong NS (2010). The etiology of agerelated
dementia is more complicated than we think. Behav
Brain Res. 214: 3–11.
12 Micuda S, Mundlova L, Anzenbacherova E, Anzenbacher P,
Chladek J, Fuksa L, et al. (2004). Inhibitory effects of memantine
on human cytochrome P450 activities: prediction of in vivo drug
interactions. Eur J Clin Pharmacol. 60: 583–589.
13 Micuda S, Mundlova L, Anzenbacherova E, Anzenbacher P,
Chladek J & Martinkova J (2003). Effect of memantine on in vitro
cytochrome P450-mediated metabolic activities in human liver
microsomes. Cytochromes P450, Biochemistry, Biophysics and
Drug Metabolism, Proceedings of the 13th International Conference
on Cytochrome P450; Jun 29– Jul 3, 2003; Prague, Czech
Republic. Bologna, Monduzzi.
14 Miller LL, Bly CG, Watson ML & Bale WF (1951). The Dominant
Role of the Liver in Plasma Protein Synthesis – a Direct Study of
the Isolated Perfused Rat Liver with the Aid of Lysine-Epsilon
C-14. J Exp Med. 94: 431–453.
15 Nameda [package insert]. St. Louis, Missouri, Forest Pharmaceuticals;
2007.
16 Newman SC (1999). The prevalence of depression in Alzheimer’s
disease and vascular dementia in a population sample. J Affect
Disord. 52: 169–176.
17 Otton SV, Wu DF, Joffe RT, Cheung SW & Sellers EM (1993). Inhibition
by Fluoxetine of Cytochrome-P450 2d6 Activity. Clin Pharmacol
Ther. 53: 401–409.
18 Parsons CG, Danysz W & Quack G (1999). Memantine is a
clinically well tolerated N-methyl-D-aspartate (NMDA) receptor
antagonist – a review of preclinical data. Neuropharmacology.
38: 735–767.
19 Pelkonen O, Turpeinen M, Hakkola J, Honkakoski P, Hukkanen J &
Raunio H (2008). Inhibition and induction of human cytochrome
P450 enzymes: current status. Arch Toxicol. 82: 667–715.
20 Repantis D, Laisney O & Heuser I (2010). Acetylcholinesterase
inhibitors and memantine for neuroenhancement in healthy
individuals: A systematic review. Pharmacol Res. 61: 473–481.
21 Rocca WA (2000). Dementia, Parkinson’s disease, and stroke in
Europe: A commentary. Neurology. 54: S38–S40.
22 Schenker P & Baici A (2009). Simultaneous interaction of
enzymes with two modifiers: Reappraisal of kinetic models and
new paradigms. Journal of Theoretical Biology. 261: 318–329.
23 Sonkusare SK, Kaul CL & Ramarao P (2005). Dementia of Alzheimer’s
disease and other neurodegenerative disorders – memantine,
a new hope. Pharmacol Res. 51: 1–17.
24 Soucek P & Gut I (1992). Cytochromes P-450 in Rats - Structures,
Functions, Properties and Relevant Human Forms. Xenobiotica.
22: 83–103.
25 Wald R, Dodman N & Shuster L (2009). The Combined Effects of
Memantine and Fluoxetine on an Animal Model of Obsessive
Compulsive Disorder. Exper Clin Psychopharmacol. 17: 191–197.
26 Wuwongse S, Chang RCC & Law ACK (2010). The putative neurodegenerative
links between depression and Alzheimer’s disease.
Prog Neurobiol. 91: 362–375.
27 Zahradnikova L, Zendulka O, Jurica J & Hadasova E (2007).
Gender-dependent influence of bupropion pretreatment on
locomotor activity and the activity of hepatic CYP2D2 in rats. Eur
Neuropsychopharmacol. 17: S247–S248.
28 Zdanys K & Tampi RR (2008). A systematic review of off-label uses
of memantine for psychiatric disorders. Prog in Neuropsychopharmacol
Biol Psychiatry. 32: 1362–1374.
29 Zendulka O, Zahradnikova L, Jurica J & Totusek J (2008). The
Influence of Trans-resveratrol and Quercetin on the Activity of
CYP1A2 in Rat. CJFS. 26: S60–S64.
30 Zendulka O, Totusek J, Sulcova A (2009). Intersexual differences
in inhibitory influence of trans-resveratrol on activity of cytochrome
P450 2D2 in rats. Neuroendocrinol Lett. 30: 88–91.
31 Zimova G, Chladek J, Martinkova J & Beranek M (2001). HPLC
determination of dextromethorphan and its metabolites in
plasma. Chem Listy. 95: 306–309.
12
4 The role of P450 in drug development and safety
The development of new drugs includes a number of preclinical tests in different models to describe
the pharmacodynamics and basic pharmacokinetic characteristics of the tested compound prior to
phase I of clinical tests. A description of the influence of the tested compound on the activity of P450
is part of standard testing. The U.S. Food and Drug Administration (FDA) provides lists of
recommended P450 substrates, inducers, and inhibitors for both in vitro testing and clinical
implications (FDA, 2017b). There is also a draft guidance for clinical drug interaction studies with a
chapter on P450 interaction testing released by the FDA in 2017 (FDA, 2017a). A similar document
applies for European countries. The European Medicines Agency (EMA) issued a guideline on the
investigation of drug interactions, where P450 in vitro inhibition and induction testing are described
(EMA, 2012).
Experimental drug testing for P450 interactions includes in vitro tests with human recombinant P450
enzymes. In such experiments, the tested molecule can be investigated for its ability to change the
catalytic activity of P450 enzymes and compared with known inducers and inhibitors. Molecules
causing a strong inhibition or induction of P450 activity can be disqualified from subsequent clinical
testing because of high drug-drug interaction potential. The involvement of P450 in the metabolism
of the investigated drug can be assessed as well.
On the other hand, the activity of P450 can be changed not only by direct inactivation of the enzyme
molecule, but also via regulation of the amount of enzyme or its gene transcription, respectively
(Zanger and Schwab, 2013). The transcription of P450 genes is regulated through specific nuclear
receptors, namely constitutive androstane receptor (CAR), pregnane X receptor (PXR), aryl
hydrocarbon receptor (AhR), peroxisome proliferator activated receptor (PPAR), retinoic acid
receptor (RXR), or vitamin D receptor (VDR) (Kawase et al., 2007; Terashima et al., 2018; Wang et al.,
2008). MicroRNAs (miRNAs) are a mechanism of post-transcriptional regulation of the amount of
P450. Different miRNAs are involved directly in the regulation of P450 levels (Dluzen and Lazarus,
2015) and indirectly via the regulation of nuclear receptors (Takagi et al., 2008). These types of
interactions cannot be simply evaluated, as they require preserved intracellular P450 regulation
mechanisms. Therefore primary screening with recombinant human P450 should be supplemented
with experiments on primary human hepatocytes or with in vivo animal testing to obtain more
detailed information about the effects of the investigated drug on P450 activity.
Although animal in vivo testing in preclinical pharmacology is common, the results are not simply
transferable to humans. The problem of P450 activity testing is not in the sequential homology
13
between animal and human enzymes, which is as high as 60 to 80% for rats (Soucek and Gut, 1992),
but lies in the substrate specificity, P450 distribution, and proportional representation (Hiroi et al.,
2002; Nedelcheva and Gut, 1994).
4.1 Experimental testing of P450 interactions with natural substances
My experimental research in the field of natural substances and their interaction with P450 was
focused on two main types of molecules. The first is natural substances with psychotropic activity.
These are not a part of a common diet, but are sold as food supplements and nutraceuticals and
marketed as an alternative to synthetic drugs. The second group are polyphenols – a common part of
the human diet and known for many protective effects including antioxidative (Pandey and Rizvi,
2009), anti-inflammatory (Joseph et al., 2016), antiproliferative (Kawaii et al., 2001), antimutagenic
(Valdez-Morales et al., 2014), and antiatherogenic activities (Rosenblat et al., 2015).
4.1.1 The influence of linalool and active compounds of saffron on P450 activity
There is a schizophrenic situation in the field of neuropsychopharmacology today. The use of
psychotropics is increasing worldwide on one side (Curkovic et al., 2016; Steinhausen, 2015) while
pharmaceutical companies have sidelined the research of new molecules on the other side (Hyman,
2013). The group of psychotropics is still stigmatized among patients and also some physicians as
drugs with many side effects. This is partially a remnant of the past, because the first antipsychotics
and antidepressant really evoked a variety of side effects. Despite new drugs and new treatment
strategies including therapeutic drug monitoring and personalized/tailored medicine being available
today, some “old school” measures leading to the adverse effects of psychotropics persist. A classic
example is the use of benzodiazepines in anxiety and insomnia, especially in elderly people. Even the
newest drugs are still not free of adverse effects. Therefore there is a significant interest in the
search for new psychoactive drugs with better safety profiles. Using natural molecules isolated from
herbs appears to be a promising approach. It seems that patients found natural substances to be
safer in contrast to synthetic drugs in general. The demand for these molecules is met by a range of
nutraceuticals and food supplements containing different herbs and herbal extracts. Such
preparations are then frequently combined with pharmacotherapy. Some of these herbal
psychoactive substances are known to cause drug-drug interactions at the P450 level (Zhou et al.,
2004b). Therefore, knowledge of whether new constituents of these preparations influence P450
activity could improve the safety and efficacy of co-administered drugs.
Saffron, a spice prepared from Crocus sativus L., is a herb used in traditional medicine, besides others
things, for its antidepressant properties. The effect of extract of saffron on mild to moderate
depression is comparable with the effect of the synthetic antidepressant fluoxetine (Akhondzadeh
Basti et al., 2007) or imipramine (Akhondzadeh et al., 2004). The chemical analysis of saffron extracts
14
reported more than 150 different chemical entities (Bathaie and Mousavi, 2010). Crocin is the watersoluble
carotenoid that gives saffron its characteristic colour (Lage and Cantrell, 2009), while terpene
safranal is the major constituent of the essential oil from saffron stigmas and is responsible for
saffron’s aroma (Tarantilis and Polissiou, 1997). Besides its antidepressant activity, safranal also has
anxiolytic, hypnotic, and anticonvulsant activity, and a protective effect on the brain, skin, and
respiratory tract were also proved (Rezaee and Hosseinzadeh, 2013). Crocin is reported to have a
wide range of biological activities, especially in the central nervous and cardiovascular systems
(Alavizadeh and Hosseinzadeh, 2014).
The monoterpenic alcohol linalool is present in the essential oils of flowers from the Lamiaceae
(Nascimento et al., 2014), Lauraceae (Simić et al., 2004), and Rutaceae (Md Othman et al., 2016)
families. Many herbs including essential oils with linalool are used in traditional medicine for various
purposes. Besides its anxiolytic (Souto-Maior et al., 2011) and sedative (Linck et al., 2009) activities,
linalool was proven to have other biological activities including analgesic (Peana et al., 2003), local
anaesthetic (Zalachoras et al., 2010), antimicrobial (Herman and Tambor, 2016), anti-inflammatory
(Peana et al., 2002), and antioxidant (Seol et al., 2016) activities. A clinical trial with linalool in the
therapy of anxiety was conducted (Kasper et al., 2010), and a herbal medicinal product with linalool
was licensed for this indication in Germany (Uehleke et al., 2012).
4.1.2 The influence of crocin and safranal on rat P450
We tested the effect of safranal and crocin on the activity of P450 in rat liver microsomes (RLM). The
microsomes were both prepared from male Wistar albino rats after repeated doses of safranal given
intragastrically and from animals administered repeated doses of crocin via intraperitoneal injection
at doses of 4, 20 or 100 mg/kg/day. The different routes of administration for these two substances
arose from knowledge of the poor bioavailability of crocin after oral use (Singla and Bhat, 2011). With
safranal, we used intragastric injections as an alternative to oral use. This measure enables us to
administer an accurate dose of the drug while the natural way in which the drug is taken up in the
form of spice or dietary supplements remained preserved. The activity of CYP2C11, CYP3A, CYP2B,
and CYP2A were assessed with testosterone as a probe substrate. Its conversion to 2β-, 2α-, 7α-, 6β-,
16α-, and 16β-hydroxytestosterone is selectively catalysed by distinct P450 enzymes. An overview of
testosterone’s metabolite and the involved P450 enzyme can be found in Table 1. The activities of
P450 were compared with control animals treated with solvents alone.
To the best of our knowledge, our study is the first to describe the influence of safranal and crocin on
P450 content and activity. Both tested substances increased the total protein content and total P450
content in RLM. The effect was significant at a dose of 100 mg/kg/day for safranal and 4 and 20
15
mg/kg/day for crocin. Such a change also indicates an increase in the metabolic activity of P450
which was measured for CYP 2B1 and CYP3A1 in animals with the highest dose of safranal and for
CYP2C11 with a significant effect at the lowest dose. Surprisingly, the activity of all tested P450 after
crocin treatment was decreased, despite increased protein and P450 levels. The actual metabolic
activity, not the amount of total protein or P450, determines the risk of a drug-drug interaction,
therefore the exact mechanism of this interesting effect was not further studied. Both tested
substances were found to interact with P450 enzymes and were able to change the plasma levels of
co-administered P450 drug substrates. Decreased plasma levels and efficacy of CYP3A1, CYP2B1, and
2C11 substrates are possible and also depend on the dose of the administered drug. In contrast, signs
of toxicity and increased plasma levels should be expected when crocin is combined with substrates
of the tested P450 enzymes.
Table 1: Overview of testosterone P450 probe reactions
P450 Reaction Reference
2A1 7α-hydroxylation (Yamazaki et al., 1994)
2B1 16β-hydroxylation (Donato et al., 1994)
2C11
2α-hydroxylation
(Wójcikowski et al., 2013)
16 α-hydroxylation
3A1
2β-hydroxylation
(Eberhart et al., 1992)
6β-hydroxylation
Dovrtělová G., Nosková K., Juřica J., Turjap M., Zendulka O. Can bioactive compounds of Crocus
sativus L. influence the metabolic activity of selected CYP enzymes in the rat? Physiological Research,
64 (Supp. 4), S453-S458, 2015.
Impact factor: 1.643; Physiology Q3 Citations WoS: 3
Author’s contribution: 30%, corresponding author
16
PHYSIOLOGICAL RESEARCH • ISSN 0862-8408 (print) • ISSN 1802-9973 (online)
 2015 Institute of Physiology v.v.i., Academy of Sciences of the Czech Republic, Prague, Czech Republic
Fax +420 241 062 164, e-mail: physres@biomed.cas.cz, www.biomed.cas.cz/physiolres
Physiol. Res. 64 (Suppl. 4): S453-S458, 2015
Can Bioactive Compounds of Crocus sativus L. Influence the
Metabolic Activity of Selected CYP Enzymes in the Rat?
G. DOVRTĚLOVÁ1,2
, K. NOSKOVÁ1,2
, J. JUŘICA1,2
, M. TURJAP1,3
, O. ZENDULKA1,2
1
Department of Pharmacology, Faculty of Medicine, Masaryk University, Brno, Czech Republic,
2
CEITEC (Central European Institute of Technology) Masaryk University, Brno, Czech Republic,
3
Department of Clinical Pharmacy, University Hospital, Ostrava, Czech Republic
Received September 14, 2015
Accepted September 25, 2015
Summary
Safranal and crocin are biologically active compounds isolated
from Crocus sativus L., commonly known as saffron. Clinical trials
confirm that saffron has antidepressant effect, thus being
a potential valuable alternative in the treatment of depression.
The aim of the present study was to determine, whether
systemic administration of safranal and crocin can influence the
metabolic activity of CYP3A, CYP2C11, CYP2B, and CYP2A in rat
liver microsomes (RLM). The experiments were carried out on
male Wistar albino rats intragastrically administered with safranal
(4, 20, and 100 mg/kg/day) or with intraperitoneal injections of
crocin (4, 20, and 100 mg/kg/day). Our results demonstrate the
ability of safranal and crocin to increase the total protein content
and to change the metabolic activity of several CYP enzymes
assessed as CYP specific hydroxylations of testosterone in RLM.
Crocin significantly decreased the metabolic activity of all
selected CYP enzymes, while safranal significantly increased the
metabolic activity of CYP2B, CYP2C11 and CYP3A enzymes.
Therefore, both substances could increase the risk of interactions
with co-administered substances metabolized by cytochrome
P450 enzymes.
Key words
Crocin • Safranal • CYP • Rat liver microsomes
Corresponding author
O. Zendulka, Department of Pharmacology, Faculty of Medicine,
Masaryk University, Kamenice 5, 625 00 Brno, Czech Republic.
E-mail: zendulka@med.muni.cz
Introduction
Crocus sativus L. is a perennial flowering plant
and a member of the Iridaceae family. Saffron, the dried
stigmas of Crocus sativus flowers, is a well-known spice.
Chemical analysis of saffron extracts has revealed about
150 different compounds from which the most studied are
crocin, safranal, and picrocrocin (Winterhalter and
Straubinger 2000, Bathaie and Mousavi 2010). Crocin as
a water-soluble carotenoid gives saffron its typical
reddish or yellowish color. Safranal is a monoterpenic
aldehyde responsible for saffron's characteristic odour,
and the bitter taste of saffron is attributed to picrocrocin,
which is also a precursor of safranal (Tarantilis et al.
1995, Melnyk et al. 2010). Saffron has not always been
primarily a spice (for flavoring and coloring of food), but
rather a medicinal plant, which was used in traditional
medicine as e.g. sedative, anxiolytic, expectorant,
aphrodisiac, antispasmodic, and for the treatment of
premenstrual syndrome, asthma, or pain (Schmidt et al.
2007, Ríos et al. 1996).
Several food supplements containing saffron
extracts are already available worldwide. The
antidepressant effect of saffron extract was described in
several double blind, randomized, placebo-controlled
clinical trials (Moshiri et al. 2006, Akhondzadeh et al.
2005) and its activity was comparable to the effect of
clinically used antidepressants, namely fluoxetine (Basti
et al. 2007, Noorbala et al. 2005) and imipramine
(Akhondzadeh et al. 2004). Thus, saffron may become
a valuable alternative to classical antidepressants.
Safranal and crocin have been intensively studied in the
17
S454 Dovrtělová et al. Vol. 64
last few years also for other biological effects, such as
antiproliferative, antioxidative, hypnosedative, etc.
(Rezaee and Hosseinzadeh 2013, Alavizadeh and
Hosseinzadeh 2014, Hosseinzadeh and Noraei 2009,
Moshiri et al. 2014).
It was described that the metabolic activity of
cytochrome P450, which is one of the most important
enzymatic systems for xenobiotic biotransformation, is
influenced by a large number of natural substances,
including carotenoids. The modulation of CYP metabolic
activity could lead to clinically relevant changes in
plasma concentrations of concurrently administered
drugs, and thus also to changes in their pharmacological
properties. The knowledge of the influence of saffron or
its compounds on CYP enzymes is lacking. Therefore, it
is important to reveal whether the activity of CYP
enzymes could be affected. The aim of the present study
is to determine the effect of systemic administration of
safranal and crocin on the metabolic activity of
CYP2C11, CYP3A, CYP2B, and CYP2A, and the total
protein and total cytochrome P450 (CYP) content in rat
liver microsomes (RLM).
Methods
Chemicals
Crocin and safranal were purchased form SigmaAldrich
(St. Louis, MO, USA). Other compounds used in
the study were following: NADP, glucose-6-phosphate
dehydrogenase, glucose-6-phosphate, MgCl2, EDTA,
prednisone, testosterone, KH2PO4, NA2HPO4, sucrose,
and KCl, all of them provided by Sigma-Aldrich
(St. Louis, MO, USA). The metabolites of testosterone,
namely 2β-, 2α-, 7α-, 6β-, 16α-, and 16β-hydroxytestosterone
were purchased from Steraloids Inc.
(Newport, RI, USA). Chemicals and organic solvents for
HPLC analysis (acetonitrile, methanol, and
dichloromethane) were provided by Lach-ner
(Neratovice, CZ).
Animal procedures
The experiments were carried out on male
Wistar albino rats (280±20 g), which were housed
under standard laboratory conditions (22±2 °C room
temperature; 55±5 % room humidity; 12:12 h light/dark
cycle). Animals had free access to water and food
and they were sacrificed 24 h after the last drug
administration. All experiments were performed in
accordance with the Czech act No. 246/1992 and with the
approval of both the local and national Czech Central
Commission for Animal Welfare.
In the Experiment I, after 5 days of
acclimatization, rats were randomly divided into four
groups per 9-10 animals and were treated intragastrically
with safranal dissolved in a mixture of propylene glycol
and 5 % glucose (1:1) at the doses of 4, 20, and
100 mg/kg/day. The administrations were repeated for
10 consecutive days. The control group was administered
with appropriate volume of vehicle (2 ml/kg). Safranal
was administered intragastrically to simulate the same
route of administration of food supplements and due to its
poor solubility in aqueous solvents and thus inability to
prepare appropriate parenteral solution.
In the Experiment II, after 5 days of
acclimatization, rats were randomly divided into four
groups per 9-10 animals and were treated intraperitoneally
with crocin dissolved in saline at the doses of 4,
20, and 100 mg/kg/day for 9 consecutive days. The
control group was administered with appropriate volume
of vehicle (1 ml/kg). Crocin was administered
intraperitoneally due to its poor absorption through the
gastrointestinal tract (Singla and Bhat 2011).
Preparation of rat liver microsomes
The RLM were isolated from 3 grams of liver
tissue of individual animals by differential
ultracentrifugation (19 000 × g and 105 000 × g) in
20 mM Tris/KCl buffer (pH=7.4) including washing with
0.15 M KCl and finally diluted in 0.25 M Tris/sucrose
buffer (pH=7.4). The total protein content in the
microsomal preparations was assessed according to
Lowry et al. (1951) using bovine serum albumin as
a standard. Determination of total CYP content was
assessed using CO-difference spectroscopy method
according to Omura et al. (1964).
Determination of cytochrome P450 activity in rat liver
microsomes
Assessment of the activity of CYP2A, CYP2B,
CYP2C11, and CYP3A enzymes was based on the rate of
testosterone biotransformation in RLM with a NADPH
generating system according to the previously described
method of Wójcikowski et al. (2008) with a slight
modification. The incubation mixture of final volume of
0.5 ml contained phosphate buffer (50 mM; pH=7.4),
EDTA (1.1 mM), NADP (1.2 mM), glucose-6-phosphate
(4.4 mM), MgCl2 (3.2 mM), glucose-6-phosphate
dehydrogenase (0.5 U in 0.5 ml), RLM (25 µl), and
18
2015 Bioactive Compounds of Crocus sativus L. and CYP S455
testosterone, which was added to be in the final
concentration of 400 µM. The reaction was stopped after
15 min of incubation at 37 °C by adding 50 µl of
methanol and by cooling down in ice.
Table 1. CYP specific metabolites of testosterone (modified from
Wójcikowski et al. 2008, Kot and Daniel 2008, Chovan et al.
2007, Kobayashi et al. 2002).
CYP Metabolites of testosterone
2A 7α-hydroxytestosterone
2B 16β-hydroxytestosterone
2C11 2α-hydroxytestosterone
2C11 16α-hydroxytestosterone
3A 2β-hydroxytestosterone
3A 6β-hydroxytestosterone
The concentrations of testosterone and its
specific metabolites were measured by a HPLC system
(Shimadzu LC-10) with the UV detector (Shimadzu SPDM10AVP)
by the modified method of Haduch et al.
(2006). After addition of the internal standard
(prednisone), the analytes were extracted from the
microsomal suspension with dichloromethane (4 ml), and
the residue obtained after evaporation of extracts was
dissolved in 200 µl of 50 % methanol. An aliquot (45 µl)
was injected into the HPLC system, and the mobile phase
was used in the following gradient mode: time 0 to
12 min 1:59:40 (v/v/v acetonitrile/water/methanol), from
12:00 to 17:50 min 1:48:51 and from 17:50 to the end of
the analysis in the 25:00 min 1:59:40. The flow rate was
0.8 ml/min. Analytical column (Kinetex 2.6u PFP 100A,
150 × 4.60 mm) was purchased from Phenomenex
(Torrance, CA, USA), and the absorbance was measured
with DAD detector at the wavelength 245 nm. Metabolic
activities of all CYP enzymes were studied by measuring
the rates of CYP specific reaction (Table 1) and
expressed as the metabolite molar concentration/min/mg
of total protein in RLM.
Statistical analysis
The results were statistically evaluated using the
non-parametric Kruskal-Wallis test, and performed using
the Statistica 12 software (StatSoft, Inc. 2013). Results
were regarded as statistically significant when p≤0.05.
Results
Experiment I (safranal)
The analysis revealed that the systemic
administration of the highest dose (100 mg/kg) of
safranal significantly increased the total protein content
(149 % of the control group value) and also the total CYP
content (151 % of the control group value) (Fig. 1A).
Other doses of safranal did not show any significant
changes at the levels of the total protein and CYP content
in RLM. However, both parameters were slightly
elevated in comparison to the controls.
Changes in the metabolic activity were detected
in all selected CYP enzymes except CYP2A (measured as
a rate of 7α-hydroxylation of testosterone) (Fig. 2). The
metabolic activity of CYP2B (measured as a rate of the
16β-hydroxylation of testosterone) was significantly
increased only at the highest dose of safranal. The effect
of safranal on CYP3A is not convincing because the rate
of 6β-hydroxylation was significantly increased, while
2β-hydroxylation of testosterone was not changed (both
believed to reflect CYP3A metabolic activity). The
lowest dose of safranal significantly increased the rate of
2α- and 16α-hydroxylation of testosterone, which is
considered as CYP2C11 specific reaction.
Fig. 1. The effect of systemic administration of safranal (A) and crocin (B) on the total protein and the total CYP content in RLM. All
values are expressed as box plots with median (box 25 % – 75 %; whiskers Min-Max without outliers). Statistical significance with
respect to the control group is indicated with **p≤0.01, ***p≤0.001.
19
S456 Dovrtělová et al. Vol. 64
Experiment II (crocin)
The obtained results showed that the systemic
administration of crocin significantly increased the level
of both the total protein and the total CYP content, at the
doses 4 mg/kg (up to 259 % and 280 % of the control,
respectively) and at 20 mg/kg (up to 278 % and 343 % of
the control, respectively) (Fig. 1B). The amount of total
protein and the total CYP content remained unchanged at
the highest dose of crocin.
The administration of crocin, unlike safranal,
caused reduction of the metabolic activity of selected
CYP enzymes (Fig. 3). The determination of CYP2B
metabolic activity revealed significant decrease at the
doses of 4 and 20 mg/kg and the same result was
observed in the metabolic activity of CYP2A. All doses
of crocin significantly decreased the metabolic activity of
CYP2C11. In the case of CYP3A, significant decrease
was observed in the rate of both 6β-hydroxylation and
2β-hydroxylation of testosterone at the doses of 4 and
20 mg/kg.
Discussion
Our results demonstrate the ability of systemic
administration of safranal and crocin to increase the total
protein and the total CYP content in RLM and to change
the metabolic activity of different CYP enzymes.
Thereby, tested substances could raise the risk of
Fig. 2. The metabolic activity of selected CYP enzymes in RLM after safranal systemic administration, measured as the rate of
testosterone hydroxylation. (A) The metabolic activity of CYP2A, CYP2B and CYP3A (2β-hydroxylation). (B) The metabolic activity of
CYP3A (6β-hydroxylation) and CYP2C11. All values are expressed as box plots with median (box 25 % – 75 %; whiskers Min-Max
without outliers). Statistical significance with respect to the control group is indicated with *p≤0.05, **p≤0.01, ***p≤0.001.
Fig. 3. The metabolic activity of selected CYP enzymes in RLM after crocin systemic administration, measured as a rate of testosterone
hydroxylation. (A) The metabolic activity of CYP2A, CYP2B and CYP3A (2β-hydroxylation). (B) The metabolic activity of CYP3A
(6β-hydroxylation) and CYP2C11. All values are expressed as box plots with median (box 25 % – 75 %; whiskers Min-Max without
outliers). Statistical significance with respect to the control group is indicated with *p≤0.05, **p≤0.01, ***p≤0.001.
20
2015 Bioactive Compounds of Crocus sativus L. and CYP S457
interactions with co-administered drugs metabolized by
the same pathway. Several clinical trials confirmed that
saffron may be of therapeutic benefit especially in the
treatment of mild to moderate depression (Basti et al.
2007, Akhondzadeh et al. 2004, Moshiri et al. 2006).
This is of interest because currently psychiatric patients
with depression are treated by a wide range of synthetic
antidepressants, but up to 30 % of them are
pharmacoresistant without a significant clinical
improvement (Micale et al. 2013). Food supplements
containing saffron extract are relatively safe, and so they
are a viable alternative to the conventional drugs. The
daily dose of saffron extract is 30 mg according to
clinical trials recommendations (Basti et al. 2007,
Akhondzadeh et al. 2004, Moshiri et al. 2006).
To the best of our knowledge, no studies exist up
to date dealing with the effects of safranal or crocin on
CYP3A, CYP2C11, CYP2B, and CYP2A enzymes.
However, it was described that metabolic activity of CYP
enzymes is influenced by a large number of natural
carotenoids, and the authors reported either decreased or
increased CYP metabolic activity (Louisa et al. 2009,
Jewell and O’Brien 1999, Satomi and Nishino 2013,
Wang and Leung 2010). Our experiment showed that the
metabolic activity of CYP2A, CYP2B, CYP2C11, and
CYP3A was decreased after administration of carotenoid
crocin. Safranal significantly increased the metabolic
activity of CYP2B and CYP2C11, while the metabolic
activity of CYP2A enzyme was without any significant
changes. The effect of safranal on the testosterone
hydroxylation via CYP3A was uncertain because
6β-hydroxylation was significantly increased, while
2β-hydroxylation of testosterone was not changed.
Therefore, in our future experiments, we aim to use other
probe substrates (nifedipine or midazolam) to determine
the influence of safranal on CYP3A.
Interestingly, the total protein content was
increased by safranal as well as by crocin. However, the
metabolic activity of CYP2B, CYP2C11 and CYP3A
enzymes was increased in the case of safranal and
decreased in the case of crocin and CYP2A, CYP2B,
CYP2C11, and CYP3A. The specific mechanism by
which safranal or crocin influence CYP enzymes is
unknown and we can therefore only hypothesize that this
discrepancy could be explained by increase in CYP
content including those CYP enzymes whose activity was
not assessed in this study. Thus, we have observed
apparent decrease in the CYP activity when the activity
was calculated per mg of total protein or per nmol of total
CYP. Other explanations could also exist, such as the
negative feedback on reduced activity of main metabolic
enzyme system. It is essential to carry out further
experiments to confirm or reject these hypotheses.
To conclude, the obtained results showed that
safranal and crocin influence the apparent metabolic
activity of CYP enzymes in RLM. It would be necessary
to take into account the risk of possible interactions with
substances metabolized by CYP enzymes in the case of
use of these substances in the clinical practice. This risk
becomes more serious as food supplements containing
saffron extracts are already available and their influence
on the human CYP enzymes is not estimated yet. We
report the ability of safranal and crocin to influence the
activity at least of some rat liver CYP enzymes.
Nevertheless, the daily intake of crocin and safranal from
the food supplements is much lower in comparison to the
doses administered to rats in our study and the substrate
specificity of the rat CYP enzymes is not fully identical
to human enzymes.
Conflict of Interest
There is no conflict of interest.
Acknowledgements
This work was supported by projects MUNI/A/1116/2014
and CZ.1.05/1.1.00/02.0068.
References
AKHONDZADEH S, FALLAH-POUR H, AFKHAM K, JAMSHIDI AH, KHALIGHI-CIGAROUDI F: Comparison of
Crocus sativus L. and imipramine in the treatment of mild to moderate depression: a pilot double-blind
randomized trial [ISRCTN45683816]. BMC Complement Altern Med 4: 12, 2004.
ALAVIZADEH SH, HOSSEINZADEH H: Bioactivity assessment and toxicity of crocin: a comprehensive review.
Food Chem Toxicol 64: 65-80, 2014.
BASTI AA, MOSHIRI E, NOORBALA AA, JAMSHIDI AH, ABBASI SH, AKHONDZADEH S: Comparison of petal
of Crocus sativus L. and fluoxetine in the treatment of depressed outpatients: a pilot double-blind randomized
trial. Prog Neuropsychopharmacol Biol Psychiatry 31: 439-442, 2007.
21
S458 Dovrtělová et al. Vol. 64
BATHAIE SZ, MOUSAVI SZ: New applications and mechanisms of action of saffron and its important ingredients.
Crit Rev Food Sci Nutr 50: 761-786, 2010.
CHOVAN JP, RING SC, YU E, BALDINO JP: Cytochrome P450 probe substrate metabolism kinetics in Sprague Dawley
rats. Xenobiotica 37: 459-473, 2007.
HADUCH A, WÓJCIKOWSKI J, DANIEL WA: The effect of tricyclic antidepressants, selective serotonin reuptake
inhibitors (SSRIs) and newer antidepressant drugs on the activity and level of rat CYP3A.
Eur Neuropsychopharmacol 16: 178-186, 2006.
HOSSEINZADEH H, NORAEI NB: Anxiolytic and hypnotic effect of Crocus sativus aqueous extract and its constituents,
crocin and safranal, in mice. Phytother Res 23: 768-774, 2009.
JEWELL C, O’BRIEN NM: Effect of dietary supplementation with carotenoids on xenobiotic metabolizing enzymes in
the liver, lung, kidney and small intestine of the rat. Br J Nutr 81: 235-242, 1999.
KOBAYASHI K, URASHIMA K, SHIMADA N, CHIBA K: Substrate specificity for rat cytochrome P450 (CYP)
isoforms: screening with cDNA-expressed systems of the rat. Biochem Pharmacol 63: 889-896, 2002.
KOT M, DANIEL WA: The relative contribution of human cytochrome P450 isoforms to the four caffeine oxidation
pathways: an in vitro comparative study with cDNA-expressed P450s including CYP2C isoforms.
Biochem Pharmacol 76: 543-551, 2008.
LOUISA M, SUYATNA FD, SETIAWATI A, JUSMAN SWA: The effect of lycopene on the total cytochrome P450,
CYP1A2 and CYP2E1. Med J Indonesia 18: 233-238, 2009.
LOWRY OH, ROSEBROUGH NJ, FARR AL, RANDALL RJ: Protein measurement with the folin phenol reagent.
J Biol Chem 193: 265-275, 1951.
MELNYK JP, WANG S, MARCONE MF: Chemical and biological properties of the world’s most expensive spice:
saffron. Food Res Int 43: 1981-1989, 2010.
MICALE V, DI MARZO V, SULCOVA A, WOTJAK CT, DRAGO F: Endocannabinoid system and mood disorders:
priming a target for new therapies. Pharmacol Ther 138: 18-37, 2013.
MOSHIRI E, BASTI AA, NOORBALA AA, JAMSHIDI AH, HESAMEDDIN ABBASI S, AKHONDZADEH S: Crocus
sativus L. (petal) in the treatment of mild-to-moderate depression: a double-blind, randomized and placebocontrolled
trial. Phytomedicine Int J Phytother Phytopharm 13: 607-611, 2006.
MOSHIRI M, VAHABZADEH M, HOSSEINZADEH H: Clinical applications of saffron (Crocus sativus) and its
sonstituents: a review. Drug Res 65: 287-295, 2015.
NOORBALA AA, AKHONDZADEH S, TAHMACEBI-POUR N, JAMSHIDI AH: Hydro-alcoholic extract of Crocus
sativus L. versus fluoxetine in the treatment of mild to moderate depression: a double-blind, randomized pilot
trial. J Ethnopharmacol 97: 281-284, 2005.
OMURA T, SATO R: The carbon monoxide-binding pigment of liver microsomes I. Evidence for its hemoprotein nature.
J Biol Chem 239: 2370-2378, 1964.
REZAEE R, HOSSEINZADEH H: Safranal: from an aromatic natural product to a rewarding pharmacological agent.
Iran J Basic Med Sci 16: 12-26, 2013.
RÍOS JL, RECIO MC, GINER RM, MÁÑEZ S: An update review of saffron and its active constituents. Phytother Res 10:
189-193, 1996.
SATOMI Y, NISHINO H: Inhibition of the enzyme activity of cytochrome P450 1A1, 1A2 and 3A4 by fucoxanthin,
a marine carotenoid. Oncol Lett 6: 860-864, 2013.
SCHMIDT M, BETTI G, HENSEL A: Saffron in phytotherapy: pharmacology and clinical uses. Wien Med Wochenschr
157: 315-319, 2007.
SINGLA RK, BHAT VG: Crocin: an overview. Indo Glob J Pharm Sci 4: 281-286, 2011.
TARANTILIS PA, TSOUPRAS G, POLISSIOU M: Determination of saffron (Crocus sativus L.) components in crude
plant extract using high-performance liquid chromatography-UV-visible photodiode-array detection-mass
spectrometry. J Chromatogr A 699: 107-118, 1995.
WANG H, LEUNG LK: The carotenoid lycopene differentially regulates phase I and II enzymes in
dimethylbenz[a]anthracene-induced MCF-7 cells. Nutrition 26: 1181-1187, 2010.
WINTERHALTER P, STRAUBINGER M: Saffron – renewed interest in an ancient spice. Food Rev Int 16: 39-59, 2000.
WÓJCIKOWSKI J, GOŁEMBIOWSKA K, DANIEL WA: Regulation of liver cytochrome P450 by activation of brain
dopaminergic system: physiological and pharmacological implications. Biochem Pharmacol 76: 258-267, 2008.
22
4.1.3 The influence of linalool on rat P450
Two different enantiomers of linalool exist, and we investigated the effects of (-)-linalool on P450
activity in the model of RLM. Male Wistar albino rats were treated intragastrically with (-)-linalool at
doses of 40, 120, and 360 mg/kg/day for 13 days. The total protein, total P450 content, and activities
of CYP2A, CYP2B, CYP2C11, and CYP3A were assessed with testosterone as a probe substrate. For the
measurement of CYP2C6 activity, the 4’-hydroxylation of diclofenac was used as a marker reaction.
The interaction of (-)-linalool with CYP2C6 in naïve RLM was also tested. Neither total protein nor the
total P450 content was changed in the RLM of (-)-linalool treated animals. The increase in activities of
CYP2A, CYP2B, CYP3A, and CYP2C6 were insignificant except for the highest dose of (-)-linalool, which
increased the activity of CYP2A significantly. The activity of CYP2C11 was in contrast inhibited, and
this effect of (-)-linalool was again insignificant. (-)-linalool also exhibited a weak inhibition of rat
CYP2C6 in direct in vitro inhibition studies. The IC50 was calculated to be 84 µM. With regard to the
obtained results, (-)-linalool probably does not significantly influence P450 metabolic activity, and its
effect on human P450 should be tested to confirm our findings for clinical practice.
Nosková K, Dovrtělová K., Zendulka O., Řemínek R., Juřica J. The effect of (-)-linalool on the metabolic
activity of liver CYP enzymes in rats. Physiological Research, 65 (Supp. 4), S427-S440, 2016.
Impact factor: 1.643; Physiology Q4 Citations WoS: 2
Author’s contribution: 15%
23
PHYSIOLOGICAL RESEARCH • ISSN 0862-8408 (print) • ISSN 1802-9973 (online)
 2016 Institute of Physiology of the Czech Academy of Sciences, Prague, Czech Republic
Fax +420 241 062 164, e-mail: physres@biomed.cas.cz, www.biomed.cas.cz/physiolres
Physiol. Res. 65 (Suppl. 4): S499-S504, 2016
The Effect of (-)-Linalool on the Metabolic Activity of Liver CYP
Enzymes in Rats
K. NOSKOVÁ1
, G. DOVRTĚLOVÁ1
, O. ZENDULKA1
, R. ŘEMÍNEK2
, J. JUŘICA1,2
1
Department of Pharmacology, Faculty of Medicine, Masaryk University, Brno, Czech Republic,
2
Department of Biochemistry, Faculty of Science, Masaryk University, Brno, Czech Republic
Received August 26, 2016
Accepted October 6, 2016
Summary
(-)-Linalool is the major floral scent occurring mainly in families
Lamiaceae, Lauraceae and Rutaceae and is the main active
compound of lavender oil. The purpose of this study was to
reveal the influence of subchronic systemic treatment with
(-)-linalool on the metabolic activity of CYP2A, 2B, 2C6, 2C11 and
3A in rat liver microsomes (RLM). The second aim was to reveal
possible inhibitory effect of (-)-linalool on CYP2C6 in vitro. Wistar
albino male rats were treated with (-)-linalool intragastrically at
the doses of 40, 120, and 360 mg/kg/day for 13 days. Treatment
with (-)-linalool at the dose of 360 mg/kg increased the
metabolic activity of CYP2A assessed with testosterone as
a probe substrate. (-)-Linalool showed weak competitive
inhibition of CYP2C6 in rat liver microsomes, with IC50 of 84 μM
with use of diclofenac as a probe substrate.
Key words
(-)-Linalool • Rat liver microsomes • CYP450 • Metabolic activity
Corresponding author
J. Juřica, Department of Pharmacology, Faculty of Medicine,
Masaryk University, 625 00 Brno, Czech Republic. E-mail:
jurica@med.muni.cz
Introduction
Linalool is a monoterpenic alcohol present
either in monocotyledonous and dicotyledonous plants.
There were identified two enantiomers in plants.
(3S)-(+)-Linalool, also known as coriandrol, is the main
component of essential oils of Coriandrum sativum
seeds. (3R)-(-)-Linalool, known as licareol, is the main
component of essential oil of Lavandula officinalis
flowers. Except of the distribution, the enantiomers
differ in a fragrance and biological activity. (+)-Linalool
is described as sweet, floral and herbaceous while
(-)-linalool as a woody, lavender-like aroma
(Aprotosoaie et al. 2014). The subject of this study is
(-)-linalool, the main active substance of Lavandula spp.
which is used in traditional medicine to treat anxiety or
mild depression (EMA/HPMC 2012). Many biological
activities of (-)-linalool have been proven, for example
anti-inflammatory (Peana et al. 2002), antimicrobial
(Park et al. 2012) and antioxidant activity (Liu et al.
2012). Many studies have also shown diversity of other
pharmacological properties such as sedative (Sugawara
et al. 1998), anxiolytic (Souto-Maior et al. 2011),
anticonvulsant (Elisabetsky et al. 1999), analgesic (Li et
al. 2016) and local anesthetic activity (Zalachoras et al.
2010). Food supplements containing (-)-linalool whose
efficacy in treatment of anxiety disorders was confirmed
by clinical trial (Kasper et al. 2010) are available in
Central Europe. Furthermore, lavender oil preparation
has been licensed in Germany as a herbal medicinal
product for the treatment of restlessness in anxiety
disorders (Uehleke et al. 2012).
According to the increasing popularity of
alternative medicine and rising use of herbal
preparation, knowledge on pharmacodynamic and
pharmacokinetic herbal-drug interactions are needed
and required by state authorities in the registration
procedure of herbal medication. The aim of this study
was to evaluate the influence of subchronic
administration of (-)-linalool on the metabolic activity
of liver CYP2A, CYP2B, CYP2C6, CYP2C11 and
24
S500 Nosková et al. Vol. 65
CYP3A enzymes in rats and to determine their IC50 for
a purpose to predict possible herbal-drug interactions.
Methods
Animals
Male Wistar albino rats (280±20 g, 8 weeks old)
were housed in groups of 5 under standard laboratory
conditions (12/12 h light-dark regime at the temperature
22±2 °C and room humidity 55±5 %). Water and pelleted
diet were provided ad libitum. All experiments were
performed in accordance with the Czech act
No. 246/1992 and with the approval of both the local and
national Czech Central Commission for Animal Welfare.
Experimental design
After 5 days of acclimatization, rats were
randomly divided into four groups per 10 animals.
Animals were treated intragastrically with (-)-linalool
dissolved in a 1 % Tween 20 at the doses of 40, 120 and
360 mg/kg/day. The control group was administered with
appropriate volume of vehicle (5 % glucose + 1 %
Tween 20, 1 ml/kg). The administration was carried out
for 13 consecutive days. Animals were sacrificed by
decapitation 24 h after the last drug administration and
the liver was sampled and frozen until microsomes
isolation.
Chemicals
(-)-Linalool, NADP, glucose-6-phosphate,
glucose-6-phosphate-dehydrogenase, MgCl2 . 6 H2O,
EDTA, KH2PO4, Na2HPO4, HCl, prednisone, ibuprofen,
testosterone, diclofenac, Tween 20, KCl, Tris,
4´-hydroxydiclofenac and sucrose were provided by
Sigma-Aldrich (St. Louis, MO, USA). Metabolites of
testosterone (2β-, 2α-, 7α-, 6β-, 16α-, 16β- hydroxyltestosterone)
were purchased from Steraloids Inc.
(Newport, RI, USA). All the organic solvents were of
HPLC purity (acetonitrile, methanol, dichloromethane
and diethyl ether) and were supplied by Lach-Ner
(Neratovice, CZ).
Preparation of RLM
Microsomes were isolated from 3 grams of liver
tissue of individual animals by differential
ultracentrifugation (19000 g for 20 min and
2 × 105000 g) in 20 mM Tris/KCl and finally diluted in
0.25 M Tris/sucrose buffer (pH=7.4). The total protein
content in the microsomal preparations was assessed
according to Lowry et al. (1951) method using the bovine
serum albumin as a standard. Total CYP content was
assessed by CO-difference spectroscopy according to
Omura et al. (1964) method.
Determination of Cytochrome P450 activity in RLM
The activities of CYP2A, 2B, 2C11 and 3A were
assessed by measuring the rate of testosterone
hydroxylation in positions: 7α (CYP2A), 16β (CYP2B),
2α and 16α (CYP2C11), 2β and 6β (CYP3A) according
to the modified method of Wójcikowsky et al. (2008)
with slight modifications (Turjap et al. 2014) as was
described previously (Dovrtělová et al. 2015). The
activity of CYP2C6 was assessed by measuring the rate
of 4´-hydroxylation of diclofenac. Incubation mixture of
final volume 0.5 ml containing phosphate buffer (50 mM,
pH=7.4), EDTA (1.1 mM), NADP (1.2 mM), glucose-6phosphate
(4.4 mM), MgCl2 . 6 H2O (3.2 mM), glucose-
6-phosphate-dehydrogenase (0.5 U in 0.5 ml), 50 µl of
RLM (1 mg/ml of protein) and diclofenac (100 μM).
Drugs’ effects were evaluated in the range of linear
dependence of the product formation on time and
concentrations of substrates. The reaction was carried out
at 37 °C on horizontal vortex at 180 rpm and stopped
after 20 min by addition of 50 µl of ice cold methanol and
cooling down on the ice. Metabolites formed during
activity assays were measured by HPLC (Shimadzu
LC-10) with the DAD detector (Shimadzu
SPD-M10AVP). Internal standard (ibuprofen) was added
to the analytes and 4´-hydroxydiclofenac was extracted
by 10 min of vortexing with diethyl ether (4 ml). The
residue obtained after evaporation of extracts was
dissolved in 250 µl of mobile phase. An aliquot of 20 µl
was injected into the HPLC system and the mobile phase
was used in following isocratic mode: 57:43 v/v KH2PO4
(20 mM, adjusted to pH=2.8)/acetonitrile. The flow rate
was 0.55 ml/min. Analytical column (Kinetex C18 2.6u,
150 x 4.6 mm) was purchased from Phenomenex
(Torrance, CA, USA). The absorbance was measured
with DAD detector at the wavelength 225 nm (ibuprofen)
and 276 nm (diclofenac and 4´-hydroxydiclofenac).
Metabolic activities of all CYP enzymes were expressed
as the metabolite molar concentration/min/mg of total
protein in RLM. Inhibitory potency of (-)-linalool on
CYP2C6 metabolic activity was evaluated in RLM
incubated with diclofenac after 10 min of pre-incubation
with (-)-linalool (1 μM – 1 mM).
25
2016 Effect of (-)-Linalool on Metabolic Activity of CYP S501
Data analysis
Data were statistically evaluated with the
Statistica 12 software (StaSoft, Inc. 2013) using nonparametric
Kruskal-Wallis test. Results were regarded as
statistically significant when p≤0.05. IC50 value was
determined through nonlinear regression of relative
reaction rate at single substrate concentration (25 μM)
and 0.25 mg/ml of total protein in the presence of varying
inhibitor concentrations (1 nM – 1 mM) and calculated by
using SigmaPlot (SPSS, Inc., Chicago).
Results
Neither total protein content nor total CYP
content in RLM were affected by any of treatments
(Fig. 1). Treatment with (-)-linalool showed insignificant,
dose dependent tendency with increase in the rate of
testosterone 7α-(CYP2A), 6β-(CYP3A), and
16β-hydroxylation (CYP2C11) but only dose 360 mg/kg
exhibited statistically significant increase in the rate of
7α-hydroxylation of testosterone (CYP2A) (Fig. 2).
(-)-Linalool exhibited also dose-dependent trend on the
rate of 4´-hydroxylation of diclofenac (CYP2C6) which
did not reach statistical significance at any of treatment
regimes (Fig. 2). Within 1 nM – 1 mM (-)-linalool
exhibited weak competitive inhibition of CYP2C6, with
IC50 of 84 μM (Fig. 3).
Fig. 1. The effect of subchronic administration of (-)-linalool on total protein (A) and total CYP content (B) in RLM. Values expressed as
box plots with median (box 25 – 75 %, whiskers min – max outliers).
Fig. 2. The metabolic activity of selected CYP enzymes in RLM after systemic subchronic administration of (-)-linalool expressed as
nmol/min/mg of total protein (OHT = hydroxytestosterone, 4´-OH-DCF = 4´-hydroxydiclofenac). All values are expressed as box plots
with median (box 25 – 75 %, whiskers min-max without outliers). Statistical significance with respect to the control group is indicated
with *
p≤0.05.
A B
A B
26
S502 Nosková et al. Vol. 65
Fig. 3. Effect of (-)-linalool on the in vitro biotransformation of
diclofenac to 4´-hydroxydiclofenac by RLM with NADPH
generating system. A fixed concentration of diclofenac (25 μM)
was incubated with various concentrations of (-)-linalool
(1 nM – 1 mM). The IC50 value was determined by nonlinear
regression analysis.
Discussion
The objective of this study was to assess in vitro
metabolic activity of selected CYP enzymes in RLM after
subchronic administration of (-)-linalool to rats. The
metabolic activity of CYP2A, CYP2B, CYP2C11 and
CYP3A was assessed with the use of testosterone and the
metabolic activity of CYP2C6 with diclofenac as a probe
substrate. The results from the study demonstrate that
dose 360 mg/kg of (-)-linalool significantly increased the
rate of 7α-hydroxylation of testosterone, which
correspond to increased metabolic activity of CYP2A. In
rat, the CYP2A family includes CYP2A1, CYP2A2
occurring in hepatic tissue and CYP2A3 occurring in
lungs. The rat CYP2A show about 60 % homology in
amino acid sequence to human CYP2A6 (Martignoni et
al. 2006). There are only few drugs which are
predominantly metabolized via CYP2A (coumarin,
nicotine), whereas for the most of xenobiotic substrates
CYP2A represents only minor pathway of their
biotransformation (halothane, methoxyflurane, valproic
acid etc.). However, CYP2A displays restricted substrate
specificity, it was found that can metabolically activate
a number of carcinogens including nitrosamines and
aflatoxins (Raunio et al. 2008).
To the best of our knowledge, up to date there is
no study which tested the effect of (-)-linalool on CYP
enzymes. Doroshyenko et al. (2013) evaluated effect of
lavender oil preparation in 16 humans with result that
160 mg/day of lavender oil preparation had no clinically
relevant effect on CYP1A2, CYP2C9, CYP2C19,
CYP2D6 and CYP3A4 enzymes in vivo. Kasper et al.
(2013) reviewed 7 clinical trials investigating the
anxiolytic efficacy of lavender oil preparation, which
generally confirmed that doses 80 – 160 mg/day have the
anxiolytic effect in patients with subsyndromal anxiety
and generalised anxiety disorder. The doses tested by
ours in the experiment with subchronic administration of
(-)-linalool to rats were much higher, and therefore we
assume that possible influence of linalool on drug
metabolizing enzymes is not clinically relevant.
Conclusions
In the light of our results, (-)-linalool could be
considered as safe anxiolytic/antidepressant adjuvant to
conventional treatment in the light of drug-drug
interactions. For confirmation of our results, it is
necessary to replicate our results in other experimental
system, e.g. human liver microsomes or immobilized
CYP microreactor system (Schejbal et al. 2016) which
could enable repeated use of human CYP enzymes with
series of CYP probe substrates.
Conflict of Interest
There is no conflict of interest.
Acknowledgements
This work was supported by the grant of Grant agency of
Czech Republic No. GA16-06106S and written at
Masaryk university as a part of the project „Experimental
pharmacological development in neuropsychopharmacology
and oncology“ number MUNI/A/1284/2015 with the
support of the Specific University Research Grant, as
provided by the Ministry of Education, Youth and
Sports of the Czech Republic in the year 2016.
References
APROTOSOAIE AC, HĂNCIANU M, COSTACHE II, MIRON A: Linalool: a review on a key odorant molecule with
valuable biological properties. Flavour Fragr J 29: 193-219, 2014.
Committee on Herbal Medicinal Products (HMPC): Assessment report on Lavandula angustifolia Miller, aetheroleum
and Lavandula angustifolia Miller, flos. European Union herbal monograph. 2012.
27
2016 Effect of (-)-Linalool on Metabolic Activity of CYP S503
DOROSHYENKO O, ROKITTA D, ZADOYAN G, KLEMENT S, SCHLÄFKE S, DIENEL A, GRAMATTÉ T,
LÜCK H, FUHR U: Drug cocktail interaction study on the effect of the orally administered lavender oil
preparation silexan on cytochrome P450 enzymes in healthy volunteers. Drug Metab Dispos 41: 987-993,
2013.
DOVRTĚLOVÁ G, NOSKOVÁ K, JUŘICA J, TURJAP M, ZENDULKA O: Can bioactive compounds of Crocus
sativus L. influence the metabolic activity of selected CYP enzymes in the rat? Physiol Res 64 (Suppl. 4):
S453-S458, 2015.
ELISABETSKY E, BRUM LF, SOUZA DO: Anticonvulsant properties of linalool in glutamate-related seizure models.
Phytomedicine 6: 107-113, 1999.
KASPER S, GASTPAR M, MÜLLER WE, VOLZ HP, MÖLLER HJ, DIENEL A, SCHLÄFKE S: Efficacy and safety
of Silexan, a new, orally administered lavender oil preparation, in subthreshold anxiety disorder - evidence
from clinical trials. Wien Med Wochenschr 160: 547-556, 2010.
KASPER S: An orally administered lavandula oil preparation (Silexan) for anxiety disorder and related conditions: an
evidence based review. Int J Psychiatry Clin Pract 17 (Suppl. 1): 15-22, 2013.
LIU K, CHEN Q, LIU Y, ZHOU X, WANG X: Isolation and biological activities of decanal, linalool, valencene, and
octanal from sweet orange oil. J Food Sci 77: C1156-C1161, 2012.
LI XJ, YANG YJ, LI YS, ZHANG WK, TANG HB: α-Pinene, linalool, and 1-octanol contribute to the topical antiinflammatory
and analgesic activities of frankincense by inhibiting COX-2. J Ethnopharmacol 179: 22-26,
2016.
LOWRY OH, ROSEBROUGH NJ, FARR AL, RANDALL RJ: Protein Measurement with the Folin Phenol Reagent.
J Biol Chem 193: 265-275, 1951.
MARTIGNONI M, GROOTHUIS GMM, DE KANTER R: Species differences between mouse, rat, dog, monkey and
human CYP-mediated drug metabolism, inhibition and induction. Expert Opin Drug Metab Toxicol 2:
875-894, 2006.
OMURA T, SATO R: The carbon monooxide-binding pigment of liver microsomes. I. Evidence for its hemoprotein in
nature. J Biol Chem 239: 2370-2378, 1964.
PARK SN, LIM YK, FREIRE MO, CHO E, JIN D, KOOK JK: Antimicrobial effect of linalool and α-terpineol against
periodontopathic and cariogenic bacteria. Anaerobe 18: 369-372, 2012.
PEANA AT, D’AQUILA PS, PANIN F, SERRA G, PIPPIA P, MORETTI MDL: Anti-inflammatory activity of
linalool and linalyl acetate constituents of essential oils. Phytomedicine 9: 721-726, 2002.
RAUNIO H, HAKKOLA J, PELKONEN O: The CYP2A Subfamily. In: Cytochromes P450: Role in the Metabolism
and Toxicity of Drugs and Other Xenobiotics. IOANNIDES C (ed.), Royal Society of Chemistry, Cambridge,
2008, pp 150-177.
SCHEJBAL J, ŘEMÍNEK R, ZEMAN L, MÁDR A, GLATZ Z: On-line coupling of immobilized cytochrome P450
microreactor and capillary electrophoresis: A promising tool for drug development. J Chromatogr A 1437:
234-240, 2016.
SOUTO-MAIOR FN, DE CARVALHO FL, DE MORAIS LC, NETTO SM, DE SOUSA DP, DE ALMEIDA RN:
Anxiolytic-like effects of inhaled linalool oxide in experimental mouse anxiety models. Pharmacol Biochem
Behav 100: 259-263, 2011.
SUGAWARA Y, HARA C, TAMURA K, FUJII T, NAKAMURA K, MASUJIMA T, AOKI T: Sedative effect on
humans of inhalation of essential oil of linalool: Sensory evaluation and physiological measurements using
optically active linalools. Anal Chim Acta 365: 293-299, 1998.
TURJAP M, DOVRTĚLOVÁ G, NOSKOVÁ K, ZENDULKA O, JUŘICA J: Determination of testosterone and its
5 metabolites in the incubation media as a measure of cytochrome P450 metabolic activity. In: 11th
International Interdisciplinary Meeting on Bioanalysis. FORET F, KŘENKOVÁ J, DROBNÍKOVÁ I,
GUTTMAN A, KLEPÁRNÍK K (eds), Institute of Analytical Chemistry of the CAS, Brno, 2014, pp 270-273.
UEHLEKE B, SCHAPER S, DIENEL A, SCHLAEFKE S, STANGE R: Phase II trial on the effects of Silexan in
patients with neurasthenia, post-traumatic stress disorder or somatization disorder. Phytomedicine 19: 665-671,
2012.
28
S504 Nosková et al. Vol. 65
WÓJCIKOWSKI J, GOŁEMBIOWSKA K, DANIEL WA: Regulation of liver cytochrome P450 by activation of brain
dopaminergic system: Physiological and pharmacological implications. Biochem Pharmacol 76: 258-267,
2008.
ZALACHORAS I, KAGIAVA A, VOKOU D, THEOPHILIDIS G: Assessing the local anesthetic effect of five
essential oil constituents. Planta Med 76: 1647-1653, 2010.
29
4.1.4. The influence of trans-resveratrol and quercetin on rat P450
Polyphenolic compounds seem to be promising molecules for the prevention of diseases because of
their pleiotropic protective effects on the human body. There was a surge in their research after
articles describing the “French paradox” were released in the 1980s. Trans-resveratrol was thought
to be at least one of the most active if not the most important molecule of the described paradoxical
situation between the high fat intake and low incidence of atherosclerosis in France. Despite the fact
that the existence of the “French paradox” is disputable, the research of trans-resveratrol provided
some interesting findings on its broad protective effects which have been reviewed elsewhere (Tsai
et al., 2017).
Quercetin is another common polyhenolic compound with the flavonol structure, and is abundant in
various types of fruits and vegetables (Nishimuro et al., 2015). Similarly to trans-resveratrol, it
possesses a wide range of biological activities (Anand David et al., 2016). A controversy about its
possible mutagenic and genotoxic effects detected in in vitro studies was discussed. Nevertheless, it
seems that quercetin at estimated dietary intake levels is safe and produces only positive health
effects in vivo (Harwood et al., 2007).
In one of my experiments, we tested the influence of trans-resveratrol and quercetin on the
metabolic activity of CYP1A2 in Wistar albino rats. The activity of P450 was measured in the model of
isolated perfused rat liver with phenacetin as a probe substrate. The principle of the assessment is
phenacetin O-deethylation to paracetamol, a reaction characteristic for CYP1A2 (von Moltke et al.,
1996). CYP1A2 was selected due to its role in the activation of procarcinogens (Guengerich and
Shimada, 1998), to reveal one of the possible modes of the anticarcinogenic effects of the tested
compounds. The effect of trans-resveratrol was tested in both male and female rats while quercetin
was only administered to male rats. The difference in the experimental design was based on the
knowledge that trans-resveratrol is able to interact with estrogenic receptors (Henry and Witt, 2002),
which are known to also modulate CYP activity (Tsuchiya et al., 2005). Both substances were
administered intraperitoneally for ten days because of poor bioavailability from the intestine
(Biasutto et al., 2010).
The tested substances differed in their effects on the P450 activity. Our results documented that
trans-resveratrol at a dose of 5 mg/kg/day administered intraperitoneally did not influence the
activity of CYP1A2 regardless of sex. On the other hand, a significant difference in the activity of
CYP1A2 between male and female rats was detected. Higher levels of paracetamol were found in
female rats, indicating higher CYP1A2 metabolic activity than in males. Quercetin, on the other hand,
inhibited the activity of the studied enzyme.
30
Zendulka O., Zahradníková L., Juřica J., Totušek J. The influence of trans-resveratrol and quercetin on
the activity of CYP1A2 in rat. Czech Journal of Food Sciences, 26, S60-S64, 2008.
Impact factor: 0.472; Food Science & Technology Q3 Citations WoS: 6
Author’s contribution: 60%
31
S60	
Vol. 26, Special Issue: S60–S64	 Czech J. Food Sci.
The Influence of Trans-resveratrol and Quercetin
on the Activity of CYP1A2 in Rat
Ondřej ZENDULKA1
, Lucia ZAHRADNÍKOVÁ1
, Jan JUŘICA1
and Jiří TOTUŠEK2
1
Department of Pharmacology and 2
Department of Preventive Medicine,
Faculty of Medicine, Masaryk University, Brno, Czech Republic
Abstract: Polyphenolic compounds are widely distributed in plants and are a common part of human diet. Polyphenols
are known to be potent bioactive molecules, predominantly with protective effects. Many of xenobiotics, including
polyphenols, influence the activities of various enzymatic systems. Such interactions can modulate the activities of
co-administered drugs. The identification of polyphenols’ potential for the interactions based on metabolic changes is
thus necessary. Cytochrome P450, which takes part in the metabolism of more than 90% of used drugs, is an important
enzymatic system which can be influenced. We therefore determined the influence of quercetin and trans-resveratrol
on the activity of cytochrome P450 1A2 in rats. A perfused rat liver model and phenacetin as a marker of 1A2 activity
were used. Moreover, we studied the dependence of trans-resveratrol’s activity on sex in both sexes. Trans-resveratrol
did not influence the 1A2 activity, but it enhanced sexual differences in the metabolic activity. Our results also
confirmed different metabolic activities between sexes. Female rats metabolised faster through 1A2. Based on our
results, we suggest that quercetin is an inhibitor of cytochrome P450 1A2 isoenzyme.
Keywords: trans-resveratrol; quercetin; CYP 1A2; rat
Supported by the Czech Science Foundation (Grant No. GA 525/06/1757) and by the Ministry of Education, Youth
and Sports of the Czech Republic (Project No. 0021622404).
Human health has been influenced by many
factors. One of the most important ones, which
cannot be excluded from our lives, is a diet. The
amount and composition of food can prevent human
body from many diseases. On the other hand,
improper diet can be a risk factor or a promotor
of many serious diseases including obesity (Terra
et al. 2008), diabetes mellitus (Sabu et al. 2002),
and illnesses of cardiovascular system (Sesso et
al. 2003). From this point of view, the modulation
of diet composition is desirable for the prevention
of these illnesses.
Positive effects of diet on human health are
caused by many biologically active substances.
However, the characterisation of such molecules
is problematic because of the variability in their
chemical structures and differences in biological
activity. Generally, these compounds are mainly
of non-nutritive character and often act as antioxidants.
Many such molecules belong to the
group of polyphenolic compounds. Polyphenols
are widely distributed in plants (Bravo 1998) and
their protective effects were proved in many in
vitro and in vivo studies (Rechner et al. 2002).
Their good availability from natural sources as
well as high biological activity determine them to
be a perfect highly valuable diet component. High
amounts of fruits and vegetables in diet guarantee
a high polyphenolic intake. Recent lifestyle and
people’s reluctance to change their diet habits lead
to the formulation of many dietary supplements
containing polyphenols, and to the production
of polyphenol-enriched foods. Such preparations
contain either polyphenolic extracts from various
32
	 S61
Czech J. Food Sci.	 Vol. 26, Special Issue: S60–S64
plants or single polyphenolic compounds. Transresveratrol
(t-res) and quercetin (Q) are often used
in dietary supplements.
Biological activities of polyphenolic compounds
are presented at different levels of human organism
including changes in metabolic activity of
specific enzymatic systems (He et al. 2007). This
action can be crucial for the metabolism of other
substrates of the goal enzyme. These interactions
can have either a positive or negative influence.
The inhibition of the enzyme action can decrease
the conversion of xenobiotics to their toxic forms
(e.g. procarcinogens to carcinogens) or, vice versa,
the induction can stimulate the same reaction. A
strong probability also exists of combining polyphenols
(dietary supplements, high diet intake) and
medication. The interactions between polyphenols
and drugs at the enzymatic level can play a crucial
role in the drug effectiveness and toxicity.
One of the major metabolic systems in organism
is cytochrome P450 (CYP450). It consists of many
substrate and reaction specific isoenzymes, which
are localised at different sites of the organism,
but predominantly in liver (Seliskar & Rozman
2007). The majority of the intaken xenobiotics, as
well as some endogenous molecules, are substrates
for this enzyme and many of them are able to
change its activity. Clinically the most important
isoenzymes of CYP450 are: 1A2, 2C9, 2D6 and
3A4. More than 95% of drugs are metabolised by
these four isoenzymes (Anzenbacher & Anzenbacherova
2001). Isoenzyme 1A2, which metabolic
activity was determined in this study, plays
a significant role in the conversion of promutagens
and procarcinogens into their active forms
(Hammons et al. 2001). Flavonoids are usually
described as inhibitors of CYP450 (Piver et al.
2003) and inhibition of CYP1A2 is believed to be
a part of their cancer preventive action. On the
other hand, some authors showed data indicating
the inductive activity of polyphenols on CYP450
(Rahden-Staron et al. 2001).
The aim of our recent work was to determine the
influence of polyphenols t-res and Q on the activity
of hepatic CYP450 1A2 (CYP1A2) isoenzyme
in rats. Trans-resveratrol has a phytoestrogenic
activity (Bowers et al. 2000). That is why we
tested the activity of t-res in male and female rats
together. The differences in the metabolic activity
of CYP1A2 between sexes and the influence
of sex on t-res activity have not been reported
either until now.
Material and Methods
Animals. The experiments were carried out on
male and female Wistar albino rats (Biotest, Czech
Republic) weighing 200 ± 40 g. The rats were randomly
divided into groups of 10 animals and were
housed in a room with controlled standard conditions.
The rats were acclimatised for 5 days before
the start of the experiment. Trans-resveratrol and
Q (both Sigma-Aldrich, USA) were dissolved in
30% DMSO/saline solution. The solutions were
administered to the animals by intraperitoneal
injections. One group of male and female rats
was treated with t-res in the dose of 5 mg/kg/day.
Quercetin in the same dose was administered to
one group of male rats. To the control groups,
the male and the female ones, 30% DMSO/saline
solution in an adequate volume (1.0 ml/kg/day)
was administered. Animals were used for liver
perfusion after 10-day premedication. All experimental
procedures were approved by the Czech
Central Commission for Animal Welfare.
Model of isolated perfused rat liver. The rats
were anesthetised with intraperitoneal injection
of a mixture of ketamin – 2 ml/kg and xylazine
– 0.8 ml/kg live weight (both Spofa, Czech Republic).
The liver was isolated from the donors using
a standard surgical technique. A plastic cannula
was inserted into the portal vein after opening the
abdominal cavity by wide laparotomy. The liver
was shortly washed out by tempered (38°C) saline
equilibrated with Carbogen – 95% O2
and 5% CO2
(Linde Technoplyn, Czech Republic). The saline
solution was changed for tempered and Carbogen
equilibrated William’s medium (Sigma-Aldrich,
USA) in a short time. A recirculating apparatus
was constructed according to the principles described
by Miller (1951). The marker substance
phenacetin (Sigma-Aldrich, USA), in the final
concentration of 10 mg/l was added as a bolus into
the perfusion medium after 20 min of preperfusion.
The samples of perfusate (1.0 ml) were collected
in the 30th
, 60th
and 120th
min of perfusion and
were stored at –75°C until the analysis.
Extraction and determination of phenacetin
and paracetamol. Quantitative analysis of phenacetin
(PHE) and its CYP1A2 specific metabolite
paracetamol (PAR) levels in the perfusate samples
was performed after liquid-liquid extraction.
Briefly, 500 μl of sample was mixed with
100 μl of internal standard – chlorpropamide
(40 mg/l) (Sigma-Aldrich, USA). After the addition
33
S62	
Vol. 26, Special Issue: S60–S64	 Czech J. Food Sci.
Figure 2. Levels of paracetamol in control male rats (CM),
control female rats (CF), trans-resveratrol male rats (RM)
and trans-resveratrol female rats (RF)
Figure 1. Levels of phenacetin in control male rats (CM),
control female rats (CF), trans-resveratrol male rats (RM)
and trans-resveratrol female rats (RF)
0.0
0.2
0.4
0.6
0.8
1.0
30 60 120
CM RM
CF RF
0
4
8
12
30 60 120
CM RM
CF RF
of diethyl ether, the samples were shaken for 10
min and then centrifuged. The organic phase was
separated, evaporated, and reconstituted in 250
μl of mobile phase for HPLC analysis. The levels
of PHE and PAR were analysed using Shimadzu
LC10 series (Japan) HPLC system. The mixture of
10mM KH2
PO4
and acetonitrile in the 60:40 (v:v)
ratio was used as the mobile phase. The separation
was performed on Luna C18 (150 × 4.6 mm,
5 μm) column and the detection of the analysed
molecules was performed on UV-VIS detector.
Statistical analysis. For statistical calculations,
F-test and Student’s t-test (Microsoft Excel 2000)
were used, P ≤ 0.05 was considered to be a statistically
significant difference.
Results and Discussion
The influence of sex on the activity
of CYP1A2
The concentration curve courses of the markers
and metabolites in the control groups did not
differ from the expected ones. The levels of PHE
decreased, while PAR levels increased with the
ongoing perfusion time. The difference between
the male and female groups was observed in the
speed rate of PHE-PAR metabolic transformation.
The concentrations of PHE were significantly
increasing (P ≤ 0.01) in females only in the 30th
min (Figure 1), while PAR levels were increased (P
≤ 0.05) during the whole perfusion as compared
to the male control rats (Figure 2). The higher
metabolic activity of CYP1A2 in the female rats
confirms the results obtained with humans (Scandlyn
et al. 2008).
The clinical relevance of different metabolic activities
between sexes is usually insignificant due
to the safety of the majority of the administered
drugs. Higher metabolic activity of CYP1A2 in
females should be taken into account when drugs
with narrow therapeutic index are used.
The influence of trans-resveratrol
on the activity of CYP1A2
The speed of conversion between t-res treated
male and female rats was different, as well as in
the control animals. The concentrations of PHE
did not differ between sexes (Figure 1), but PAR
was elevated (P ≤ 0.001) in females for the whole
perfusion time again (Figure 2). The data obtained
with t-res pre-treated animals resembled the data
obtained with the controls and no statistical difference
was found. In our opinion, t-res at the dose
of 5 mg/kg l.w. for 10 days did not influenced the
activity of CYP1A2 in rats. On the other hand, the
literature sources describe its diverse influence on
various CYP 450 isoenzymes. Chan and Delucchi
(2000) and other authors (Piver et al. 2003; RegevShoshani
et al. 2004) described the inhibition of
CYP3A4 and 2E1, while Kluth et al. (2007) defined
t-res as an inducer of hepatal CYP450. None of the
experiments cited was carried out using the methods
with whole animals or organs, so their conclusions
may be incongruous with reality.
The comparison between the sexes of t-res administered
animals was again similar to that in the
34
	 S63
Czech J. Food Sci.	 Vol. 26, Special Issue: S60–S64
0
0.1
0.2
0.3
0.4
0.5
30 60 120
CM QM
0
2
4
6
8
10
30 60 120
CM QM
Figure 4. Levels of paracetamol in quercetin male rats
(QM) and male control rats (CM)
Figure 3. Levels of phenacetin in quercetin male rats (QM)
and male control rats (CM)
controls. The females metabolised via CYP1A2
faster, which was confirmed by the elevation of
PAR levels in them. This difference was statistically
more significant (P ≤ 0.001) than that in the
controls (P ≤ 0.05). In our opinion, t-res at the
dose of 5 mg/kg l. w. enhances intersexual differences
in rats. The possible explanation consists
in the estrogenic effect of t-res which can bind
to estrogenic receptors. Its agonistic effect on
β-estrogen receptor was described (Bowers et
al. 2000). Estrogens influence the activity of some
CYP450 isoenzymes by various mechanisms (van
Lipzig et al. 2005).
The influence of quercetin on the activity
of CYP1A2
The administration of Q led to a decrease of both
PHE and PAR levels. The concentrations of PHE
as well as those of PAR in Q treated males were
lower in the 60th
(P ≤ 0.001) and 120th
min (P ≤
0.01) of perfusion as compared to the male control
(Figures 3 and 4). The decrease of metabolite
levels is a signal for CYP1A2 activity inhibition.
Oppositely, the marker levels should be increased
in the case of a slower biotransformation. Our
explanation is that Q can change the activity of
other pathways for the metabolic conversion of
PHE, like CYP 2A enzymes (Devore et al. 2008).
The induction of this enzymatic subfamily can
cause a decrease in the levels of PHE in the perfusate,
and consequently a lack of the substrate
for CYP1A2, followed by the reduction of PAR
production. We conclude that Q probably acts as
an inhibitor of isoenzyme 1A2 and simultaneously
induces other CYP isoenzymes, predominantly of
2A family. Ciolino et al. (1999) referred on the
bindings of Q to arylhydrocarbon receptor and
the induction of CYP1A2. However, a majority of
works (Tsyrlov et al. 1994; Obach 2000) resulted
in the inhibition of CYP1A2 activity by Q. The
inhibition of CYP1A2 by polyphenols is frequently
mentioned in relation to their antimutagenic and
tumour protective effects.
Conclusion
It can be concluded from our results that the
metabolic activity of cytochrome P450 in rats is
sex dependant. Female rats metabolise phenacetin
faster than male rats do. This sexual difference
is enhanced by the administration of trans-resveratrol.
Resveratrol alone does not influence
the activity of CYP1A2. Quercetin is probably
an inhibitor of CYP1A2 and the induction of 2A
subfamily is possible.
References
Anzenbacher P., Anzenbacherova E. (2001): Cytochromes
P450 and metabolism of xenobiotics. Cellular
and Molecular Life Sciences, 58: 737–747.
Bowers J.L., Tyulmenkov V.V., Jernigan S.C., Klinge
C.M. (2000): Resveratrol acts as a mixed agonist/antagonist
for estrogen receptor alpha and beta. Endocrinology,
141: 3657–3667.
Bravo L. (1998): Polyphenols: chemistry, dietary sources,
metabolism, and nutritional significance. Nutrition
Reviews, 56: 317–333.
Chan W.K., Delucchi A.B. (2000): Resveratrol, a red
wine constituent, is a mechanism-based inactivator of
cytochrome P450 3A4. Life Sciences, 67: 3103–3112.
Ciolino H.P., Daschner P.J., Yeh G.C. (1999): Dietary
flavonols quercetin and kaempferol are ligands of the aryl
35
S64	
Vol. 26, Special Issue: S60–S64	 Czech J. Food Sci.
Corresponding author:
PharmDr. Ondřej Zendulka, Ph.D., Masarykova universita, Lékařská fakulta, Farmakologický ústav, Tomešova 12,
602 00 Brno, Česká republika
tel.: + 420 549 498 280, fax: + 420 549 492 364, e-mail: zendulka@med.muni.cz
hydrocarbon receptor that affect CYP1A1 transcription
differentially. Biochemical Journal, 340: 715–722.
DevoreN.M.,SmithB.D.,UrbanM.J.,ScottE.E.(2008):
Key residues controlling phenacetin metabolism by human
cytochrome P450 2A enzymes. Drug metabolism
and disposition, in press, http://dmd.aspetjournals.
org/cgi/reprint/dmd.108.023770v1 2.10.2008
Hammons G.J., Yan-Sanders Y., Jin B., Blann E.,
Kadlubar F.F., Lyn-Cook B.D. (2001): Specific site
methylation in the 5’-flanking region of CYP 1A2 interindividual
differences in human livers. Life Sciences,
69: 839–845.
He Q., Lv Y., Yao K. (2007): Effects of tea polyphenols on
the activities of α amylase, pepsin, trypsin and lipase.
Food Chemistry, 101: 1178–1182.
KluthD.,BanningA.,PaurI.,BlomhoffR.,BrigeliusFlohe
R. (2007): Modulation of pregnane X receptor
and electrophile responsive element-mediated gene
expression by dietary polyphenolic compounds. Free
Radical Biology & Medicine, 42: 315–325.
Miller L.L., Bly C.G., Watson N.M., Bale W.F. (1951):
The dominant role of the liver in plasma protein synthesis;
a direct study of the isolated perfused rat liver with
the aid of lysin-epsilon-C14. Journal of Experimental
Medicine, 94: 431–453.
Obach R.S. (2000): Inhibition of human cytochrome
P450 enzymes by constituents of St. John’s Wort, an
herbal preparation used in the treatment of depression.
Journal of Pharmacology and Experimental Therapeutics,
294: 88–95.
Piver B., Berthou F., Dreano Y., Lucas D. (2003): Differential
inhibition of human cytochrome P450 enzymes
by epsilon-viniferin, the dimer of resveratrol: comparison
with resveratrol and polyphenols from alcoholized
beverages. Life Sciences, 73: 1199–1213.
Rahden-Staron I., Czeczot H., Szumilo M. (2001):
Induction of rat liver cytochrome P450 isoenzymes
CYP1A and CYP2B by different fungicides, nitrofurans,
and quercetin. Mutation Research/Genetic Toxicology
and Enviromental Mutagenesis, 498: 54–66.
Regev-Shoshain G., Shosheyov O., Kerem Z. (2004):
Influence of liphophilicity on the interactions of hydroxy
stilbenes with cytochrome P450 3A4. Biochemical
and Biophysical Research Communications, 323:
668–673.
Rechner A.R., Kuhnle G., Bremner P., Hubbard G.P.,
Moore K.P., Rice-Evans C.A. (2002): The metabolic
fate of dietary polyphenols in humans. Free Radical
Biology and Medicine, 33: 220–235.
Sabu M.C., Smitha K., Kuttan R. (2002): Anti-diabetic
activity of green tea polyphenols and their role in reducing
oxidative stress in experimental diabetes. Journal
of Ethnopharmacology, 83: 109–116.
Scandlyn M.J., Stuart E.C., Rosengren R.J. (2008):
Sex-specific differences in CYP450 isoforms in humans.
Expert Opinion on Drug Metabolism and Toxicology,
4: 413–424.
Seliskar M., Rozman D. (2007): Mammalian cytochromes
P450-importance of tissue specificity. Biochimica
et Biophysica Acta, 1770: 458–466.
Sesso H.D., Gaziano J.M., Liu S., Buring J.E. (2003):
Flavonoid intake and the risk of cardiovascular disease
in women. American Journal of Clinical Nutrition, 77:
1400–1408.
Terra X., Montagut G., Bustos M., Llopiz N., Ardevoll
A., Blade C., Fernandez-Larrea J., Pujadas
G., Salvado J., Arola L., Blay M. (2008):
Grape-seed procyanidins prevent low grade inflammation
by modulating cytokine expression in
rats fed a high-fat diet. Journal of Nutritional Biochemistry,
in press, http://www.sciencedirect.com/
science?_ob=ArticleURL&_udi=B6T8P-4SXRTM1-
4&_user=835458&_rdoc=1&_fmt=&_orig=search&_
sort=d&view=c&_acct=C000045159&_version=
1&_urlVersion=0&_userid=835458&md5=7976551a0
25292e0df0791924c3160a7 – 2.10.2008
Tsyrlov I.B., Mikhailenko V.M., Gelboin H.V. (1994):
Isozyme- and species-specific susceptibility of cDNAexpressed
CYP 1A P-450s to different flavonoids. Biochimical
et Biophysical Acta, 1205: 325–335.
van Lipzig M.M.H., Vermeulen, N.P.E., Gusinu R.,
LeglerJ.,FrankH.,SeidelA.,Meerman,J.H.N.(2005):
Formation of estrogenic metabolites of benzo[a]pyrene
and chrysene by cytochrome P450 activity and their
combined and supra-maximal estrogenic activity. Environmental
Toxicology and Pharmacology, 19: 41–55.
36
4.1.5 Intersexual differences in the inhibitory effect of trans-resveratrol on rat P450
Sex-based differences in the pharmacokinetics of drugs are well known and can lead to individual
differences in drug response. The variations in pharmacokinetics of drugs between males and
females arises mainly from different body weight, proportion of body fat, organ perfusion, or plasma
volume (Waxman and Holloway, 2009). Differences in hepatic metabolism between the sexes arise
from the difference in hormonal levels between males and females. It is known that the expression
of some P450 enzymes is sex-dependent in both humans (Scandlyn et al., 2008) and rats (Kato and
Yamazoe, 1992). We demonstrated a difference in the metabolic activity of CYP1A2 between male
and female rats (Zendulka et al., 2008). Nevertheless, the clinical impact of these differences seems
to be irrelevant, as few drugs exhibited pharmacokinetic sex-related differences that resulted in a
different pharmacodynamic response (Fadiran and Zhang, 2014). The pharmacokinetic variability
between the sexes is instead dependent on the other factors mentioned above than on P450 sexbased
differences.
In the following experiment we tested the sex-based differences in the metabolic activity of CYP2D2
in rats together with the effect of trans-resveratrol premedication (5 mg/kg/day i.p.). The activity of
rat CYP2D2, which is an orthologue to human CYP2D6, was assessed by dextromethorphan Odemethylation
to dextrorphan (Yu et al., 2001). The results of this study also documented sex-related
differences in the activity of the tested enzyme. In contrast to the previous experiment, the
metabolic activity of CYP2D2 was decreased. Trans-resveratrol inhibited the formation of
dextromethorphan in both males and females, but with a greater impact in males. The data
documents sex-based differences in the effect of trans-resveratrol. Extrapolation of the data to
humans is difficult due to known interspecies differences in P450 between rats and humans.
Zendulka O., Totušek J., Šulcová A. Intersexual differences in inhibitory influence of trans-resveratrol
on activity of cytochrome P450 2D2 in rats. Neuroendocrinology Letters, 30, 88-91, 2009.
Impact factor: 1.047; Neurosciences Q4, Endocrinology & Metabolism Q4 Citations WoS: 4
Author’s contribution: 75%
37
To cite this article: Neuroendocrinol Lett 2009; 30(Suppl 1):88–91
ORIGINALARTICLE Neuroendocrinology Letters  Volume 30  Suppl. 1  2009
Intersexual differences in inhibitory influence of
trans-resveratrol on activity of cytochrome P450
2D2 in rats
Ondrej Zendulka 1, Jiri Totusek 2, Alexandra Sulcova 1
Department of Pharmacology, Faculty of Medicine, Masaryk University, Czech Republic1.	
Department of Preventive medicine, Faculty of Medicine, Masaryk University, Czech Republic2.	
Correspondence to: Ondřej Zendulka, Ph.D., Masaryk University, Komenského nám. 2, 662 43 Brno,
Czech Republic, phone: + 420-549 493 971, fax: + 420-549 492 364,
e-mail: zendulka@med.muni.cz
Submitteed: 2009-07-07	 Accepted: 2009-08-24	 Published online: 2009-11-15
Key words: cytochrome P450; trans-resveratrol; intersexual difference;
isolated perfused rat liver
Neuroendocrinol Lett 2009; 30(	Suppl 1): 88–91  PMID: 20027150   NEL300709A13  © 2009 Neuroendocrinology Letters • www.nel.edu
Abstract OBJECTIVES: Differences in the metabolism between males and females have been
seen over time. Hormonal regulation of cytochrome P450 activity is understood
to be involved. Trans-resveratrol (RES) is an estrogenically active plant polyphenol
with many protective biological activities including neuroprotection. The present
report studied the influence of sex and RES on variances in rat’s cytochrome P450
2D2 hepatic metabolic activity.
METHODS AND DESIGN: Isolated perfused rat liver was used for determination of
cytochrome P450 2D2 activity. Wistar albino rats of both sexes were treated with
RES at the dose of 5 mg/kg/day for 10 days prior to liver isolation. Levels of marker
substance dextromethorphan (DEM) and its 2D2 specific metabolite dextrorphan
(DEX) were measured during perfusion. The metabolic ratios (DEM/DEX) and
the levels of DEM and DEX in perfusate were compared.
RESULTS: In the controls, the activity of CYP2D2 was found to be higher in male
rats compared to females. RES produced inhibition of CYP2D2, expressed by
significant changes of both DEM and DEX levels in males and significant increase
of only DEM levels in females. There were no gender changes in DEX levels in
RES treated animals whilst DEM levels were significantly increased during the
whole perfusion in females.
CONCLUSION: The results confirmed gender differences in the metabolic activity
of CYP450 2D2 with a higher rate in male rats. RES acted as an inhibitor, however
again with greater impact in males than in females. This metabolic divergence
could be a cause for different sensitivity or even toxicity of drugs metabolized by
the CYP450 2D2.
INTRODUCTION
Intersexual metabolic differences in humans are
known in general, but specific divergences are
usually not described in details. Such variance
can influence biotransformation of xenobiotics
including drugs. Appropriate data describing
particular differences can improve drug dosing
optimization or prevent adverse effects. It can also
clarify higher sensitivity to diseases caused by different
xenobiotic polutants metabolized in human
body. Enzymatic transformation of xenobiotics is
usually involved in detoxification Phase I and II
processes. One of the major systems of Phase I is
cytochrome P450. Its activity is not rigid and can
be regulated by many endogenous systems and
38
89Neuroendocrinology Letters  Vol. 30  Suppl. 1,  2009  •  Article available online: http://node.nel.edu
Influence of resveratrol on rat CYP2D2
Abbreviations & units
CYP450	 – cytochrome P450
DEM	 – dextrometorphan
DEX	 – dextrorphan
DMSO	 – dimethylsulfoxide
MR	 – metabolic ratio
RES	 – trans-resveratrol
ity 50-60%; light regime – 12h light/12h dark (lights on
from 6:00 to 18:00). Male and female rats were randomly
subdivided into 2 groups per 8 animals and underwent
a 7 day acclimatization before experiment. RES (SigmaAldrich,
Czech Republic) was dissolved in 30% DMSO/
saline solution and administered intraperitoneally at
the dose of 5 mg/kg/day for 10 days prior to liver isolation.
All experimental procedures were approved by the
Czech Central Commission for Animal Welfare.
The model of isolated perfused rat liver was used
for CYP450 2D2 activity assessment as described elsewhere
(Zendulka et al. 2008). The animal was anesthetized
(ketamine+xylazine), vena portae was cannulated
and the liver was isolated from the abdominal cavity.
Liver was perfused in modified recirculating apparatus
described by Miller (Miller et al. 1951) with tempered
and oxygenated William’s medium E. Levels of 2D2
isoenzyme specific marker dextromethorphan (DEM)
and its 2D2 specific metabolite dextrorphan (DEX)
(Fig.1) were measured in withdrawn samples in the 30th,
60th and 120th minute of perfusion. Analyses of samples
were performed after incubation with β-glucuronidase
and liquid/liquid extraction using HPLC methods
described by Zimova (Zimova et al. 2001). Metabolic
ratios (MR) were calculated using the formula MR =
conc. DEM / conc. DEX.
F-test and Student’s t-test (Microsoft Excel 2000)
were used for statistical calculations. p values lower
than 0.05 were considered to be a statistically significant
difference.
influenced by various exogenous factors. Beyond age,
genetic polymorphism and xenobiotic influence, the
hormonal regulation also takes a part, including sexual
hormons what may be a reason for gender differences
in CYP450 metabolism. Estrogens are proved to influence
the amounts of some CYP450 isoenzymes in liver
(Williams et al, 2004). Phytoestrogens are natural substances
with estrogenic activity found in plants. Their
ability to activate the estrogenic receptors can also be
manifested in changes of CYP activity. Trans-resveratrol
(RES) is a plant polyphenol with many protective
effects on human organism including neuroprotection
(Athar et al. 2007). RES is structurally similar to estrogens
with phytoestrogenic activity. It binds to estrogen
receptors probably in partial agonistic manner (Bowers
et al. 2000). Influence of RES on some CYP450 isoenzymes
has been also described (Piver et al. 2001). The
use of RES in different food supplements declared as
a neuroprotective agents can probably lead to changes
in CYP450 activity in clinical practice. Among many of
CYP450 isoenzymes CYP2D6 metabolizes a variety of
drugs with psychotropic effects (antidepressant, antipsychotic).
Some of them (fluoxetine or paroxetine)
are also inhibitors of this isoenzyme and
can even cause a switch from an extensive to
poor metabolizer phenotype (Zourkova et al.
2008). There is a strong probability of changes
in the metabolism of drugs which are CYP2D6
substrates when combined with RES treatment.
In this study the activity of rat CYP2D2
(an orthologue of human CYP2D6) enzyme
(Zahradnikova et al. 2007) was studied. The
aims were to investigate possible intersexual
differences in CYP2D2 activity and the influence
of estrogenically active polyphenol RES
in rats.
MATERIAL AND METHODS
Experiment was carried out on male and
female Wistar albino rats weighing 200 ± 20
g (Biotest, Czech Republic). Animals were
housed in standard plastic cages (540 x 320
x 200 mm) with wood shavings and with
free access to water and commercial pelleted
diet. Controlled conditions were kept in the
animal room: temperature 21-22 °C; humidFigure
1. Dextromethorphan’s metabolic pathways
39
90 Copyright © 2009  Neuroendocrinology Letters  ISSN 0172–780X  •  www.nel.edu
Ondrej Zendulka, Jiří Totusek, Alexandra Sulcova 
RESULTS
The intersexual differences in CYP2D2 activity.
Measured values of DEM in samples were different
between male and female animals (Fig. 2), but
statistical significance was found only in the 120th
minute of perfusion (p≤0.01). The concentration
of DEM was increased by 53% in females. On the
other hand amounts of DEX were significantly
increased in males (Fig. 3). Levels were changed
in the 30th (p≤0.01) and 120th minute (p≤0.05).
These results corresponded with DEM levels and
declare a higher metabolic activity of CYP2D2 in
male rats than in females and a faster conversion
of DEM to DEX. Furthermore MR values confirmed
this finding (Fig. 4). MR was significantly
higher (p≤0.01) in females in the 30th minute and
in other two intervals (60th and 120th min) the p
values were close to significance (p=0.06 and 0.08
respectively).
The influence of RES on CYP2D2 activity
The administration of RES caused an inhibition
of CYP2D2 activity. This was demonstrated
by an increase in levels of DEM and a decrease
in amounts of DEX in both sexes. Compared to
controls in RES treated males the concentrations
of DEM were significantly raised (Fig. 2) by 26%
in the 30th min up to 65% in the end of perfusion
and associated with lower levels of DEX (Fig. 3),
which were significantly changed only in the 120th
min. These results correlate with lower values of
MR in the control males (Fig. 4), specifically in
the 120th min (p≤0.001). The data obtained from
females administered with RES resemble DEM
levels changes in males with significant due time
increase from 41% to 62%.
The intersexual differences in influence of RES on
CYP2D2.Differences between RES administered
males and females correlate with controls only in
the 120 min.
As shown in the Fig. 2, DEM levels were significantly
elevated in females and there were registered
no sex differences in changes of DEX levels (Fig. 3).
Metabolic ratios were significantly higher in female
rats (Fig. 4) during the whole perfusion (p≤0.05).
DISCUSSION
The working hypothesis that there could exist sex
differences in the activity of CYP2D2 isoenzyme
postulated in the view of our earlier results describing
sex dependent activity of CYP1A2 in rats
(Zendulka et al. 2008) was confirmed in the present
study. Conversely to 1A2 isoenzyme, male rats
metabolized substrates of 2D2 faster than females.
Approximation of our results to humans is difficult,
while there are some interspecies (Langsch et
al. 2009) and even interstrain (Schulz-Untermoehl
Figure 2. Levels of DEM in perfusion medium in male and female controls
and trans-resveratrol pretreated animals (5 mg/kg/day, 10 days). Data
represent mean ± S.E.M. * p≤0.05; ** p≤0.01; *** p≤0.001.
Figure 3. Levels of DEX in perfusion medium in male and female controls
and trans-resveratrol pretreated animals (5 mg/kg/day, 10 days). Data
represent mean ± S.E.M. * p≤0.05; ** p≤0.01.
Figure 4. DEM/DEX metabolic ratios in male and female controls and
trans-resveratrol pretreated animals (5 mg/kg/day, 10 days). Data
represent mean ± S.E.M. * p≤0.05; ** p≤0.01.
40
91Neuroendocrinology Letters  Vol. 30  Suppl. 1,  2009  •  Article available online: http://node.nel.edu
Influence of resveratrol on rat CYP2D2
et al. 1999) differences in CYP450 activities and data
describing intersexual differences on CYP2D6 are
inconsistent (Scandlyn et al. 2008; Zahradnikova et al.
2007). Some studies on humans resulted in no CYP2D6
sex specific difference (Aichhorn et al. 2005), however
others found either higher metabolic rate in males
(Gexfabry et al. 1990, Pritchard et al. 1992) or faster
metabolization via CYP2D6 by females (Tamminga
et al. 1999). We suggest that results of human studies
focused on gender differences in CYP2D6 activity are
probably highly dependent on the marker substance
used and methodology of CYP450 activity assessment.
The second outcome of the present study is that the
phytoestrogen RES produced an inhibition of CYP2D2
activity with at least some sex differences suggesting
greater susceptibility of males. However, this effect was
weaker comparing to some other CYP2D2 inhibitors
we have studied previously, e.g. fluoxetine (Zendulka et
al. 2009) as the significant changes were measured only
at the end of perfusion.
Although the influence of polyphenolic compounds
on the CYP450 metabolic system is extensively studied,
the influence of RES on human 2D6 or rat 2D2
isoenzyme was not according to the literature available
described yet. RES is reported to be an inhibitor of 1A2
and 3A4 isoenzymes (Piver et al. 2001). Mechanism of
1A subfamily inhibition by RES is believed to be present
due to RES biotransformation via this metabolic pathway
(Piver et al. 2004), which cannot be the case of 3A4
and 2D6 isoenzymes. RES estrogenic activity might be
involved in sex differential regulation of 2D2 isoenzyme.
RES perhaps can enhance intersexual difference
by influencing the activity of 2D2 more in males than
in females, similarly as described with 1A2 isoenzyme
(Zendulka et al. 2008).
It can be concluded that metabolic activity of 2D2
isoenzyme is higher in male rats and is inhibited by RES
administration. The effect of RES is sex dependent with
greater impact on male rats.
Acknowledgements
The work was financially supported by the Ministry
of Education, Youth and Sports of the Czech Republic
(MSM 0021622404) and by the Czech Science Foundation
(525/06/1757).
REFERENCES
Aichhorn W, Weiss U, Marksteiner J, Kemmler G, Walch T, Zernig G,1 	
et al. (2005). Influence of age and gender on risperidone plasma
concentrations. J Psychopharmacol, 19: 395–401.
Athar M, Back JH, Tang X, Kim KH, Kopelovich L, Bickers DR,2 	 et
al. (2007). Resveratrol: a review of preclinical studies for human
cancer prevention. Toxicol Appl Pharmacol, 224: 274–83.
Bowers JL, Tyulmenkov VV, Jernigan SC, Klinge CM (2000). Res-3 	
veratrol acts as a mixed agonist/antagonist for estrogen receptors
alpha and beta. Endocrinology, 141: 3657–3667.
Gexfabry M, Balantgorgia AE, Balant LP, Garrone G (1990). Clo-4 	
mipramine Metabolism - Model-Based Analysis of Variability
Factors from Drug-Monitoring Data. Clin Pharmacokinet, 19:
241–255.
Langsch A, Giri S, Acikgoz A, Jasmund I, Frericks B, Bader A5 	
(2009). Interspecies difference in liver-specific functions and
biotransformation of testosterone of primary rat, porcine and
human hepatocyte in an organotypical sandwich culture. Toxicol
Lett, 188: 173–179
Miller LL, Bly CG, Watson ML, Bale WF (1951). The Dominant Role6 	
of the Liver in Plasma Protein Synthesis - a Direct Study of the
Isolated Perfused Rat Liver with the Aid of Lysine-Epsilon C-14.
Journal of Experimental Medicine, 94: 431–453.
Piver B, Berthou F, Dreano Y, Lucas D (2001). Inhibition of CYP3A,7 	
CYP1A and CYP2E1 activities by resveratrol and other non volatile
red wine components. Toxicol Lett, 125: 83–91.
Piver B, Fer M, Vitrac X, Merillon JM, Dreano Y, Berthou F,8 	 et al.
(2004). Involvement of cytochrome P450 1A2 in the biotransformation
of trans-resveratrol in human liver microsomes. Biochem
Pharmacol, 68: 773–782.
Pritchard JF, Bryson JC, Kernodle AE, Benedetti TL, Powell JR9 	
(1992). Age and gender effects on ondansetron pharmacokinetics:
evaluation of healthy aged volunteers. Clin Pharmacol Ther,
51: 51–5.
Scandlyn MJ, Stuart EC, Rosengren RJ (2008). Sex-specific differ-10 	
ences in CYP450 isoforms in humans. Expert Opin Drug Metab
Toxicol, 4: 413–424.
Schulz-Untermoehl T, Bennett AJ, Ellis SW, Tucker GT, Boobis AR,11 	
Edwards RJ (1999). Polymorphic debrisoquine 4-hydroxylase
activity in the rat is due to differences in CYP2D2 expresion.
Pharmacogen, 9: 357–366
Tamminga WJ, Wemer J, Oosterhuis B, Wieling J, Wilffert B, de12 	
Leij LFMH, et al. (1999). CYP2D6 and CYP2C19 activity in a large
population of Dutch healthy volunteers: indications for oral
contraceptive-related gender differences. European J Clin Pharmacol,
55: 177–184.
Williams ET, Leyk M, Wrighton SA, Davies PJ, Loose DS, Shipley13 	
GL, et al. (2004). Estrogen regulation of the cytochrome P450 3A
subfamily in humans. J Pharmacol Exp Ther, 311: 728–35.
Zahradnikova L, Zendulka O, Jurica J, Hadasova E (2007). Gender-14 	
dependent influence of bupropion pretreatment on locomotor
activity and the activity of hepatic CYP2D2 in rats. Eur Neuropsychopharmacol,
17: S247–S248.
Zendulka O, Zahradnikova L, Jurica J, Sulcova A (2009). Meman-15 	
tine Inhibits CYP2D2 in Rat Liver - Comparison with Inhibitory
Influence of Fluoxetine. Drug Metab Rev, 41: 31–32.
Zendulka O, Zahradnikova L, Jurica J, Totusek J (2008). The16 	
Influence of Trans-resveratrol and Quercetin on the Activity of
CYP1A2 in Rat. Czech J Food Sci, 26: S60–S64.
Zimova G, Chladek J, Martinkova J, Beranek M (2001). HPLC17 	
determination of dextromethorphan and its metabolites in
plasma. Chem Listy, 95: 306–309.
Zourkova A, Jurica J, Hadasova EM, Pulkrabkova L (2008). Fading18 	
of the inhibition of CYP2D6 after paroxetine treatment discontinuation.
Eur Neuropsychopharmacol, 18: S328–S329.
41
5. Endogenous regulation of P450 activity
The metabolism of xenobiotics is just one function of the P450 enzymes. They protect the human
body against possible harm from the chemicals of the environment. On the other hand, the same
importance should be attached to the role of P450 in the metabolism of endogenous substrates.
Many products of reactions catalysed by P450 are involved in various physiological roles in the
human body. Most of the P450 enzymes involved in drug elimination are different from those
involved in the synthesis and metabolism of endogenous substances. However, some overlap
between them can be found. Both CYP3A4 and CYP1A2 are extensively involved in the metabolism of
drugs and also in the biotransformation of estrogens (Guengerich, 2017). A change in their activity
can consequently lead not only to a change in the metabolism of drugs, but also to side effects due
to changes in the level of their endogenous substrates.
Xenobiotics, namely drugs, are systematically tested to identify their potential to influence the
activity of P450. The results of such research are obligatory and required by national authorities for
the approval of the drug for clinical use. On the other hand, the research of endogenous regulators
and regulatory pathways of P450 activity is mostly academic. It is not surprising that unlike
xenobiotic regulators of P450 activity, some of the endogenous regulatory pathways are still not fully
understood.
The mechanism of endogenous regulation of P450 activity is different from the simple substrateenzyme
interaction often found in drug inhibitors. The essential mode of regulation seems to be a
change in the enzyme amount and in the regulation of gene expression. The mechanism of P450
gene expression via nuclear receptors and regulation of post-translational processes via microRNA is
mentioned in chapter 4 of this thesis. Different steroid hormones serve as ligands of these receptors
(Sever and Glass, 2013), while the effect of cytokines is probably mediated by another mechanism
(Richardson and Morgan, 2005).
5.1 Bile acids and P450
Bile acids are essential for the digestion of lipids from the diet. Their amphiphilic character gives
them the emulsifying activity necessary for the formation of micelles. Moreover, bile acids are also
involved also in some physiological processes, including glucose and lipid metabolism,
thermoregulation, or immune response (Claudel et al., 2011). The regulatory role of bile acids
involves interaction with several nuclear receptors (Chiang, 2009). Because of their involvement in
many important processes of homeostasis, some bile acids may be used as therapeutic agents for
cholestatic liver disease, inflammatory bowel disease, diabetes mellitus, or other metabolic disorders
42
(Camilleri and Gores, 2015; Gadaleta et al., 2010; Mudaliar et al., 2013). Besides this, bile acids are
involved in the regulation of P450 activity.
We have focused on different types of interactions between bile acids, P450, and nuclear receptors
in our review article. In the first part of the article, bile acids are described as ligands of various
nuclear receptors and the influence of stimulation of these receptors on the P450 is summarized. In
general, the activation of nuclear receptors by bile acids is related to a restriction of their synthesis
and increase in their elimination. Bile acids are ligands of the farnesoid X receptor (FXR), vitamin D
receptor, liver X receptor (LXR), PXR, and CAR. The activity of both P450 involved in the biosynthesis
of bile acids and P450 of drug metabolism can be regulated.
The second part of the article is dedicated to the regulation of P450 associated with bile acid
synthesis. CYP7A1 is identified as the rate-limiting step of bile acid synthesis (Chiang, 2013), and bile
acids are recognized as its negative regulators (Gupta et al., 2001). The role of single nuclear
receptors in this process is also described. Finally, the regulation of P450 involved in the metabolism
of xenobiotics by bile acids is reviewed in the final part. Specifically, CYP3A4 regulation by
ursodeoxycholic acid and the role of PXR and FXR are described.
Juřica J., Dovrtělová G., Nosková K., Zendulka O. Bile acids, nuclear receptors and cytochrome P450.
Physiological Research, 65, S499-S504, 2016.
Impact factor: 1.461; Physiology Q4 Citations WoS: 2
Author’s contribution: 35%, corresponding author
43
PHYSIOLOGICAL RESEARCH • ISSN 0862-8408 (print) • ISSN 1802-9973 (online)
 2016 Institute of Physiology of the Czech Academy of Sciences, Prague, Czech Republic
Fax +420 241 062 164, e-mail: physres@biomed.cas.cz, www.biomed.cas.cz/physiolres
Physiol. Res. 65 (Suppl. 4): S427-S440, 2016
REVIEW
Bile Acids, Nuclear Receptors and Cytochrome P450
J. JUŘICA1,2
, G. DOVRTĚLOVÁ1
, K. NOSKOVÁ1
, O. ZENDULKA1
1
Department of Pharmacology, Faculty of Medicine, Masaryk University, Brno, 2
Department of
Biochemistry, Faculty of Science, Masaryk University, Brno
Received August 13, 2016
Accepted October 13, 2016
Summary
This review summarizes the importance of bile acids (BA) as
important regulators of various homeostatic mechanisms with
detailed focus on cytochrome P450 (CYP) enzymes. In the first
part, synthesis, metabolism and circulation of BA is summarized
and BA are reviewed as physiological ligands of nuclear receptors
which regulate transcription of genes involved in their
metabolism, transport and excretion. Notably, PXR, FXR and VDR
are the most important nuclear receptors through which BA
regulate transcription of CYP genes involved in the metabolism of
both BA and xenobiotics. Therapeutic use of BA and their
derivatives is also briefly reviewed. The physiological role of BA
interaction with nuclear receptors is basically to decrease
production of toxic non-polar BA and increase their metabolic
turnover towards polar BA and thus decrease their toxicity. By
this, the activity of some drug-metabolizing CYPs is also
influenced what could have clinically relevant consequences in
cholestatic diseases or during the treatment with BA or their
derivatives.
Key words
Bile acids • FXR • PXR • Cytochrome P450
Corresponding author
O. Zendulka, Department of Pharmacology, Faculty of Medicine,
Masaryk University, Kamenice 5, 625 00 Brno, Czech Republic.
Fax: +420 549 493 971. E-mail: zendulka@med.muni.cz
Introduction
The essential physiological role of bile and bile
acids (BA) in digestion is to neutralize chyme and serve
as emulsifiers of fat in small intestine. Thanks to their
amphiphilic nature, BA are emulsifiers which enable
absorption of lipids and lipid soluble vitamins. The
production and secretion of bile is regulated by intestinal
paracrine hormones cholecystokinin and secretin and
moreover autoregulation via negative feedback exists,
too. BA and phospholipids stabilize micellar dispersion
of cholesterol in the bile and facilitate cholesterol
excretion as well as excretion of hydrophobic metabolites
of xenobiotics, toxins and metals. In past decade, it has
been postulated that bile acids may also regulate lipid and
glucose homeostasis, thermoregulation, and immune
response (Claudel et al. 2011). Especially the role of BA
in immune response is undoubtedly involved in the
therapeutic effects of some BA in cholestatic liver
diseases (Roma et al. 2011, Buryova et al. 2013).
The most common human BA (Fig. 1) are cholic
acid (CA), chenodeoxycholic acid (CDCA), in much less
proportion also glycocholic acid, taurocholic acid (TCA),
lithocholic acid (LCA), deoxycholic acid (DCA), and
ursodeoxycholic acid (UDCA). BA and oxysterols are
natural ligands of several nuclear receptors (NRs),
membrane receptors and regulators of metabolism of
lipids and glucose (Chiang 2004, Chiang 2009). At least,
some of BA regulate above mentioned pathways via their
farnesoid X receptor (FXR) agonistic activity. In
particular, FXR agonists probably via production of
glucagon-like peptides 1 and 2 increase insulin
sensitivity, glucose uptake, and adipogenesis in
extrahepatic tissues. Meanwhile, they increase fatty acid
oxidation, decrease triglyceride, fatty acid, and
cholesterol synthesis in the liver and increase insulin
production in beta cells (Camilleri and Gores 2015,
Adorini et al. 2012). BA as FXR agonists also decrease
44
S428 Juřica et al. Vol. 65
activity of phosphoenolpyruvate carboxykinase and
glucose 6-phosphatase and thus, together with all above
mentioned effects increase glucose tolerance and insulin
sensitivity (Chiang 2013). BA also promote gut motility
through TGR5 activation (Camilleri and Gores 2015)
which is in agreement with reported adverse effects of
therapeutically used BA (American Society of Health
System Pharmacists 2016a, American Society of Health
System Pharmacists 2016b). Primary BA are
deconjugated and dehydroxylated by microflora, and
these BA metabolites exert antimicrobial properties
(Begley et al. 2005). Another physiological consequence
of BA binding on FXR is increased synthesis of
fibroblast growth factor-19 (FGF-19), which may reduce
glycolysis and lipogenesis, improved insulin sensitivity,
and reduce bile acid synthesis (Camilleri and Gores
2015).
Fig. 1. Unconjugated primary and secondary bile acids in
humans.
In agreement with above mentioned
physiological roles of BA, some BA may be also
exploited or tested as therapeutic agents, mostly in
cholestatic liver diseases, inflammatory bowel disease
(Gadaleta et al. 2010), diabetes mellitus and metabolic
disorders (part Therapeutic use of BA).
This review summarizes the importance of BA
as important regulators of various homeostatic
mechanisms with detailed focus on cytochrome P450
(CYP) enzymes.
Synthesis, metabolism and circulation of bile
acids
BA are synthetized in the liver from cholesterol
(“classical pathway”) in multiple steps catalyzed via
CYPs, hydroxy-delta-5-steroid dehydrogenase
(HSD3B7), Δ4–3
-oxosteroid-5β-reductase (AKR1D1) and
3α-hydroxysteroid dehydrogenase (AKR1C4) to form
5β-cholestan-3α,7α,12α-triol. Biosynthetic pathway of
CDCA leads directly to 5β-cholestan-3α, 7α-diol via
AKR1D1 and AKR1C4. Subsequently, those by products
are hydroxylated in the position 27 and the hydroxylic
group is then oxidized to aldehydic and carboxylic group.
The products are further ligated to coenzyme A (CoA)
and the side chain is shortened by β-oxidation to release –
propionyl-CoA and cholyl-CoA or chenodeoxycholylCoA.
Under physiological conditions, CA and CDCA
occurs as Na+
salts („bile salts“) (Chiang 2004). Then,
primary BA are conjugated with glycine and taurine.
UDCA is 7-epimer of chenodeoxycholic acid and
therefore is more hydrophilic than its structural analogue
CDCA (Fig. 1) and forms about 4 % of BA pool (Roma
et al. 2011). Hydroxylation in the positions 6α/β or 7β
increases water solubility and decrease toxicity of BA
(Chiang 2013).
Apart from this “classic pathway”, alternative
(“acidic”) biosynthetic pathway exists in humans, which
forms less than 10 % of total BA. In this pathway, which
is believed to occur also in extrahepatic tissues,
cholesterol is hydroxylated by series of steps
(e.g. CYP27A1, CYP46A1, HSD3B7, 3βHSD), but
finally has to be transported into the liver to complete
synthesis of CA and CDCA (Chiang 2004, 2009; Russell
2000).
Conjugated BA are stored in gall bladder and
secreted into the duodenum in response to ingestion of
meal. Then, about 95 % of BA is reabsorbed in ileum,
mostly by apical Na+
-dependant bile salt transporter
(SLC10A2 or ASBT) (Camilleri and Gores 2015b).
Resorbed BA are transported to the liver in blood through
vena portae (Chiang 2013). BA which are not reabsorbed
undergo deconjugation and dehydroxylation by intestinal
flora to form secondary BA, LCA, and DCA, of which the
most is excreted in faeces (Chiang 2009, Chiang 2013).
Bile acids – ligands of nuclear receptors
For many years, BA were thought to be fat
emulsifiers and digestive surfactants as the only function of
45
2016 Bile Acids and Cytochrome P450 S429
the BA in the human body. However, recent observations
in the last decade documented that BA are involved in the
regulation of more complex processes including bile
production, glucose and lipid metabolism, and in the
modulation of immune response (Renga et al. 2013,
Trauner et al. 2010, Claudel et al. 2005). The regulatory
role of BA is a result of their interaction with various types
of receptors including both intracellular nuclear receptors
(NR) and cell surface membrane receptors (MR). BA acids
vary in their ability to bind and activate different types of
receptors. CDCA together with DCA are the most potent
activators of FXR (Parks et al. 1999, Makishima et al.
1999), while LCA is the most potent activator of
membrane G-protein coupled receptor TGR5 (Sato et al.
2008). Except of regulation of energy metabolism and
immune system reactions, stimulation of different NRs and
MRs by BA helps to maintain bile acid homeostasis via
targeting the processes of their synthesis, release,
reabsorption or metabolism (Copple and Li 2016).
BA are activators/ligands of various NRs, at
least their ability to influence FXR, pregnane X receptor
(PXR), vitamin D receptor (VDR), and liver X receptor
(LXR) is well documented (Table 1, Chiang 2013, Song
and Liao 2000). On the other hand some NRs which do
not interact with BA, such as constitutive androstane
receptor (CAR), can significantly influence the
metabolism of BA. Most of these NRs are highly
expressed in tissues exposed to high levels of BA like are
liver or intestine (Kliewer et al. 1998, Forman et al. 1995,
Gascon-Barré et al. 2003, Qatanani and Moore 2005).
NRs are ligand activated transcription factors
consisting of N-terminal DNA binding domain (DBD)
necessary to recognize the DNA response element in the
target genes and C-terminal ligand-binding domain
(LBD) interacting usually with small hydrophobic
molecules. Activation of NRs by bile acids results in
restriction of BA synthesis and increase of their
degradation and excretion.
Table 1. Bile acids, their derivatives and metabolites as ligands of nuclear receptors.
Receptor Ligands Reference
FXR CDCA>DCA≈LCA>CA>UDCA Makishima et al. 1999, Parks et al. 1999)
Bile alcohols, 6α-ethylCDCA Pellicciari et al. 2002
5β-cholanoic acid, 5β-norcholanoic acid, and
5α-cholanoic acid
Sepe et al. 2016
PXR 3-keto-LCA>LCA>CDCA>DCA>CA Taudinger et al. 2001
7α-OH-4-cholesten-3-one Goodwin et al. 2003
VDR LCA, 3-keto LCA Makishima et al. 2002
LXR Cholestenoic acid Song and Liao 2000
6α-hydroxylated BA Song et al. 2000
Oxysterols Janowski et al. 1996, Lehmann et al. 1997
Farnesoid X receptor (FXR; NR1H4)
There are two genes (FXRα and FXRβ) coding
the FXR. FXRβ represents a functional NR in
mammalian species except of primates and humans,
where the gene encodes the non-functional protein (Otte
et al. 2003). FRXα encodes four isoforms of FXR
different either in the use of promoters or in alternative
splicing (Zhang et al. 2003). The structure of FXR
corresponds with the general structure of NR with the
LBD allowing receptor heterodimerization with retinoid
X receptor (RXR) and interactions with co-regulators.
After interaction with agonist, FXR binds with FXR
response elements as heterodimer FXR/RXR or as
a monomer and regulates the gene expression (Ding et al.
2015).
FXR is mainly found in hepatocytes, enterocytes
(Forman et al. 1995) and acts as a sensor in the
enterohepatic system regulating BA homeostasis. BA are
potentially toxic and their levels have to be strictly
controlled. In the hepatocytes, FXR controls BA
synthesis (via CYP7A1, CYP8B1), sinusoidal uptake, and
canalicular secretion of BA. In the intestine, FXR
regulates the absorption, trafficking from the apical to the
basolateral membrane and basolateral efflux (Modica and
Moschetta 2006). FXR plays a protective role against BA
toxicity by feedback inhibition of CYP7A1, CYP8B1, and
46
S430 Juřica et al. Vol. 65
CYP27A1 expression (Copple and Li 2016). The
regulation of expression of above mentioned genes is not
direct, but mediated via small heterodimer partner (SHP)
interacting with liver-related homolog-1 (LRH-1) or
hepatocyte nuclear factor 4α in the liver (Kwong et al.
2015) and fibroblast growth factor 19 (FGF19) binding to
FGF receptor 4 in the intestine (Kir et al. 2011).
BA can activate the FXR in their free and
conjugated forms. The most powerful ligand of FXR is
CDCA with the EC50 approximately 10 μmol/l (Ding et
al. 2015). Other endogenous BA bind to FRX with lower
affinity as follows: CDCA>DCA≈LCA>CA>UDCA
(Makishima et al. 1999, Parks et al. 1999).
Pregnane X receptor (PXR; NR1I2)
PXR acts mainly as a xenobiotic sensor. It is
activated by steroidal substances including
glucocorticoids and its main role is to form a barrier
protecting inner environment from xenobiotics.
Therefore, its highest expression was found within liver
and intestine (Kliewer et al. 1998).
The PXR LBC is substantially larger than in
other NRs and is poor in the number of polar groups.
Such characteristic explains the high promiscuity and
variability of its ligands (Handschin and Meyer 2005).
PXR is activated for example by glucocorticoids,
steroids, macrolide antibiotics, antifungals, and some
herbal extracts (Jones et al. 2000, Lehmann et al. 1998,
Ihunnah et al. 2011). From bile acids the most potent
ligand of PXR is LCA with the EC50~10 μmol/l
(Staudinger et al. 2001). It is questionable whether BA
can activate the receptor under physiologic conditions
when their plasma levels are below 100 nmol/l. It is
hypothesized, that sufficient concentration can be reached
after rupture of intrahepatic bile duct in cholestasis, when
PXR can increase BA clearance by CYP3A induction and
decrease its biosynthesis by suppression of CYP7A1
expression (Copple and Li 2016). After binding the
ligand it is translocated into nucleus and associated with
RXR to form a heterodimer activating gene transcription.
The range of regulated genes is wide including
many of phase I (Table 2) and II enzymes, or uptake and
efflux transporters. The role of PXR in the expression of
drug metabolizing enzymes is well documented by the
study of Kandel et al. (2016), who treated human
hepatocytes from 6 donors with rifampicin, a well proved
human PXR agonist. Results confirmed the protective
role of PXR against BA toxicity as expression of most of
the CYP biotransformation enzymes genes were
increased (Table 2) while the CYP7A1, involved in BA
synthesis, was decreased to 0.32-fold in comparison to
control (Kandel et al. 2016).
Table 2. The role of NRs in the regulation of CYP genes
expression.
CYP
Receptor
Reference
FXR PXR VDR CAR LXR
1A1 ↑ 1
1A2 ↑ 1
2A6 ↑ ↑ 1, 2
2A7 ↑ 1
2A9 ↑ 2
2A13 ↑ 1
3A1 ↑ 3
3A2 ↑ 3
3A4*
↑ ↑ ↑ ↑ 1, 4, 5, 6, 7, 8, 9
3A7 ↑ ↑ 1
7A1 ↓ ↓ ↓ ↑ 1, 10, 11, 12, 13
27A1 ↓ 10
2B6 ↑ ↑ 1, 4, 9, 14
2B7 ↑ ↑ 1
8B1 ↓ ↑ 10
2C8 ↑ ↑ 1
2C9 ↑ ↑ 1, 4
2E1 ↓ 1
↑ – expression increased, ↓ – expression decreased, *
– human
CYP3A4 is orthologue of mice CYP 3A11, therefore results from
animal models are represented as change in CYP3A4 expression.
Ref.: 1 – Kandel et al. 2016, 2 – Drocourt et al. 2002, 3 – Kliewer
et al. 1998, 4 – Drocourt et al. 2001, 5 – Gnerre et al. 2004,
6 – Goodwin et al. 2002, 7 – Goodwin et al. 2000, 8 – Makishima
et al. 2002, 9 – Sberna et al. 2011, 10 – Eloranta and KullakUblick
2005, 11 – Han et al. 2010, 12 – Lehmann et al. 1997,
13 – Staudinger et al. 2001, 14 – Xie et al. 2000.
Vitamin D receptor (VDR; NR1I1)
In spite of the fact that hepatocytes do not
express VDR, its significant levels are found in nonparenchymal
liver cells such as Kupffer cells or
sinusoidal endothelial cells (Gascon-Barré et al. 2003).
The typical ligand of VDR is cholecalciferol, while most
of the BA including CDCA, CA, DCA, or muricholic
acid does not activate VDR. Similarly to ligands of PXR,
VDR can be activated by LCA and its metabolite 3-ketoLCA
with the EC50≈8 μM and 3 μM, respectively
(Makishima et al. 2002). It could be of clinical
importance that therapeutically used UDCA can be
converted to LCA (VDR and PXR agonist) by intestinal
microflora (Xie et al. 2001, Staudinger et al. 2001).
47
2016 Bile Acids and Cytochrome P450 S431
The role of VDR to promote calcium and
phosphate absorption is well known. Its protective role
against BA toxicity similar to PXR or against infection of
bile duct was documented in the past decade. Stimulation
of VDR by both vitamin D and LCA induces production
of antimicrobial peptide cathelicidin in the bile duct
epithelial cells (D'Aldebert et al. 2009). Both ligands can
also increase the expression of CYP3A4 leading to
elevated BA clearance (Makishima et al. 2002) while the
expression of CYP7A1 can be reduced through VDR
activation (Han et al. 2010). Moreover, there is
documented interaction between VDR and LXRα with
antagonizing effects on the CYP7A gene, too (Jiang et al.
2006).
Liver X receptor alpha (LXRα; NR1H3)
This NR can be found in the tissues with high
metabolic activity such as liver, small intestine, kidney or
adipocytes (Sato and Kamada 2011), in comparison to
LXRβ, which is ubiquitously expressed in all tissues
(Teboul et al. 1995). LXR binds to its responsive
elements as heterodimer associated with RXR and its
influence on gene expression is tissue specific (Moschetta
2015).
Its known endogenous ligands are oxysterols and
its physiologic role is the regulation of cholesterol, fatty
acid, and glucose homeostasis (Zelcer and Tontonoz
2006). Oppositely to other mentioned NR, LXR
activation leads to increased activity of CYP7A1, thus the
formation of BA is increased. Together with increased
cholesterol transport to bile via specific transporters and
restriction of its absorption from intestine, the level of
total plasma cholesterol is decreased. However, reduction
in cholesterol levels via activation of LXR is associated
with fatty liver and hypertriglyceridemia development
(Moschetta 2015).
LXR is activated by cholestenoic acid with ED50
of 200 nmol/l (Song and Liao 2000) and also by different
oxysterols (Lehmann et al. 1997, Janowski et al. 1996)
and 6α-hydroxylated BA (Song et al. 2000) within the
range of their physiologic levels.
Constitutive androstane receptor (CAR; NR1I3)
CAR is closely related to PXR, this NR acts
similarly as xenobiotic sensors which regulate expression
of genes significant for biotransformation and excretion
of exogenous compounds. Both receptors are activated by
toxic derivatives of endobiotic metabolism, too.
However, CAR seems to be more sensitive to
endogenous stimuli (Bing et al. 2014). Typical
exogenous ligands of CAR represent phenobarbital,
3,3′,5,5′-Tetrachloro-1,4-bis(pyridyloxy)benzene
(TCOBOP) (Timsit and Negishi 2007). When activated,
it is translocated into nucleus via protein phosphate PP2A
and association with RXR precede to binding to DNA
(Timsit and Negishi 2007). BA do not seem to be direct
ligands of CAR, nevertheless activation of this receptor
increases activity of enzymes producing more hydrophilic
and thus less hepatotoxic metabolites of BA (Beilke et al.
2009) and activates their excretion from hepatocytes
(Wagner et al. 2005).
The genome-wide screening in the liver cells of
human donors treated by CAR prototype ligand CITCO
(6-(4-Chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde
O-(3,4-dichlorobenzyl)oxime) revealed 11 CYP
genes among top 25 influenced genes. In all cases CITCO
increased gene expression in the range between 1.28- and
2.19-fold in ascending order as follows: 2C9<
1A2<3A7<3A4<2C8<2A6<2A13<1A1<2A7<2B6<2B7
(Kandel et al. 2016). On the other hand, CYP2E1 was
downregulated with 0.86-fold decrease of its expression
(Kandel et al. 2016).
Besides binding to nuclear receptors, BA are
also ligands of other types of receptors, including
membrane G protein-coupled receptors. The first
G-protein coupled receptor known to interact with BA
was TGR5, GP-BAR1, or M-BAR. This receptor is
widely distributed in different tissues and stimulation
leads to different effects depending on the tissue and
signalling cascade mediating the signal (Duboc et al.
2014). TGR5 is involved in energy metabolism; it
protects liver and intestine from inflammation and
steatosis, and improves insulin sensitivity (Chiang 2013,
Li and Chiang 2015). The influence of some of BA on the
immune response is also essential in their therapeutic
effect in cholestatic liver diseases (Poupon 2012, Poupon
2014). This effect is in case of UDCA probably mediated
by interaction with toll-like receptors TLR4 and TLR9
and glucocorticoid receptors (Poupon 2012).
Regulation of CYP enzymes involved in the
metabolism of bile acids
The synthesis of BA is limited mainly through
activity of cholesterol 7α-hydroxylase (CYP7A1), which
is believed to be the only rate-limiting step in BA
synthesis (Chiang 2013). The protein content and
metabolic activity of CYP7A1 is regulated by variety of
48
S432 Juřica et al. Vol. 65
factors. CYP7A1 metabolic activity is limited mainly by
availability of its substrate cholesterol. Feeding the
experimental animals with cholesterol lead to increase
expression of CYP7A1, suggesting the stimulatory effect
of substrate (“Km effect”) on CYP7A1 (Chiang 2013).
On the other hand, negative feedback exists and most of
BA are negative regulators of CYP7A1 (Gupta et al.
2001). CDCA, DCA and with much lesser potency also
other BA, such as UDCA and LTA, inhibit transcription
of CYP7A1 gene. Minor BA, UDCA, which is used
therapeutically, increases expression of murine CYP3A11,
CYP2B10 and human CYP3A4 – these enzymes catalyze
hydroxylation of primary BA towards less toxic
(hydrophilic) BA (Roma et al. 2011, Schuetz et al. 2001).
As mentioned above, BA are ligands of several
NR, including FXR and it seems that BA downregulate
CY7A1 probably through activation of RXRα/FXR
(Chiang 2013). FXR decreases CYP7A1 expression by
several indirect mechanisms, by induction of SHP, which
in turn inhibits transactivation of CYP7A1 and CYP8B1
by hepatocyte nuclear factor 4αHNF4α) and liver-related
homolog-1 (LRH-1). This is in line with finding of Peng
et al. (2016), who reported that CYP7A1 is upregulated
in young FXR nullizygous mice.
Moreover, activation of FXR further decreases
intracellular BA content by increase of expression of
canalicular BSEP (bile salt efflux pump, ABCB11).
These feedback mechanisms seem to protect inner
environment of hepatocytes from BA toxicity and liver
damage. Taurodeoxycholic acid also downregulates
CYP27A1 via activation of HNF1α (Rao et al. 1999).
The regulation of BA synthesis and metabolism
seems to be very complex and some pathways are
anticipatory, since activation of VDR may trigger
decrease of SHP and this leads to induction of CYP7A1
(Chow et al. 2014). The expression of VDR itself in rat
ileum and liver is regulated (among others) by some of
BA (at least by CDCA), but not LCA. The VDR
activation by 1,25-dihydroxycholecalciferol or LCA then
leads to increase in transcription of CYP3A1 and CYP3A2
genes as well as CDCA treatment. However, when
combined together with LCA the expression of CYP3A1
and CYP3A2 is reduced (Khan et al. 2010). It was also
reported by the same team of authors that CDCA
decreases expression of CYP3A1, CYP3A2, and
CYP3A9 mRNA in rat liver, whereas the expression of
CYP3A1 in the rat ileum is increased and CYP3A2 and
CYP3A9 are not influenced within the whole rat intestine
(Khan et al. 2009). This means that unlike UDCA,
CDCA could decrease the metabolism and increase the
liver toxicity of hydrophobic BA (Khan et al. 2010).
Moreover, the same team of authors reported that CDCA
induced CYP3A4 in human liver (Khan et al. 2009). In
another study with the primary culture of human
hepatocytes, CDCA decreased expression of CYP3A4,
CYP7A1, CYP2C8, CYP1A1, CYP2E1 and CYP1A2
genes after 48 hours of incubation, as well as it decreased
expression of the AHR and PPARγ gene (Krattinger et al.
2016). The overview of BA influence on CYP enzymes is
summarized in the Table 3. The results of experiments
focused on the regulatory role of BA in the CYP
expression seem to be highly variable and dependent on
the model used. Moreover, the effects of hydrophobic and
hydrophilic BA may differ, as there are differences in
Table 3. Bile acids as regulators of CYP expression.
Bile acid
CYP
1A1 1A2 3A1 3A2 3A4+
3A7 3A9 7A1 27A1 2B6+
2C8 2E1
CDCA ↓7
↓7
↑5,6
↓6*
↑5
↓6*
↑3,6
↓7
↓6*
↓1,7
↓7
↓7
DCA ↑3
↓1
UDCA ↑2,3
↓1,2
↑2
LCA ↑5
↑5
↓1
CA ↑2,3
↓2
↑2
TUDCA ↑3
TDCA ↓4
↑ – expression increased, ↓ – expression decreased, 1
– Roma et al. 2011, 2
– Zollner et al. 2006, 3
– Schuetz et al. 2001, 4
– Rao et al.
1999, 5
– Khan et al. 2010, 6
– Khan et al. 2009, 7
– Krattinger et al. 2016. *
– only in rat liver, +
– human CYP3A4 and CYP2B6 are
orthologue of mice CYP3A11 and CYP2B10, respectively. Therefore results from animal models are represented as change in CYP3A4
and CYP2B6 expression.
49
2016 Bile Acids and Cytochrome P450 S433
their selectivity and affinity to nuclear receptors
(Table 1). This is also resembled by different clinical
effects of DCA and CA on one hand and UDCA,
TUDCA and nor-UDCA on the other hand. While CA
and CDA appear to be hepatotoxic, UDCA prevents from
liver damage. Surprisingly, the genetic polymorphisms of
CYP7A1 do not seem to influence the production of BA
(Xiang et al. 2012).
Other endogenous regulators seem to play
a significant role in BA synthesis, such as blood glucose
levels, insulin, thyroid hormone, glucocorticoids and
glucagon (Siljevik Ellis 2006, Twisk et al. 1995, Chiang
2009, Xiao et al. 2016). Glucose increases both CYP7A1
transcription (Li et al. 2010) and CYP7A1 metabolic
activity by histone acetylation of gene promoter. The
latter mechanism is also mediated by insulin (Li et al.
2012). Glucagon inhibits BA synthesis via block of
CYP7A1 expression (Song and Chiang 2006). In overall,
fasting state seem to downregulate CYP7A1, while
elevated glucose and insulin seems to increase expression
or metabolic activity of CYP7A1 (Chiang 2009, Chiang
2013).
Bile acids as regulators of CYP enzymes
involved in the metabolism of xenobiotics
Through activation of FXR and PXR, BA are
regulating rate-limiting step in their biosynthetic pathway
(CYP7A1), as well as several transporters involved in BA
elimination from hepatocytes, as mentioned above.
BA may also influence CYP enzymes, which are
primarily involved in the drug metabolism, such as
CYP3A4, CYP2C8, CYP2E1 or CYP1A2.
Although PXR and CAR are primary regulators
of CYP enzymes, other nuclear receptors of different
types are also known to be involved in their regulation.
With respect to the proposed binding ability to the
nuclear receptors, namely FXR, it is not surprising that BA
may induce expression of CYP3A4 (Schuetz et al. 2001),
SULT2A1 and UGT2B4 genes (Poupon 2012) and increase
CYP3A4 metabolic activity (Schuetz et al. 2001).
In particular, FXR nullizygous mice exhibit
downregulation of bile salt export pump and thus increase
hepatocellular BA content, which in turn, may activate
PXR and upregulate CYP3A (involved in their
metabolism), but also CYP2B and some ABC transporters
(Schuetz et al. 2001). It is also note of worth, that BA are
not equipotent ligands of FXR (Table 1). Hydrophilic BA
are not considered to be agonists of FXR (Chiang, 2013)
and sometimes are reported to be partial agonists, and
sometimes also partial antagonists of FXR, such as
UDCA (Modica et al. 2010).
It was reported that UDCA may induce the
enzymes of CYP3A subfamily (Schuetz et al. 2001) and
thus decrease concentrations of substrates of CYP3A4
(such as cyclosporine A (CsA)) after UDCA treatment
(Yan et al. 2008, Becquemont et al. 2006, Kurosawa et
al. 2009, Uchida et al. 2014).
Interestingly, the rate of CsA elimination was
not changed (Caroli-Bose et al. 2000), what implies for
decreased bioavailability through induction of intestinal
CYP3A4 and P-glycoprotein by activation of PXR
(Schuetz et al. 2001). PXR is known as potent inducer of
phase I metabolic enzymes, phase II conjugation enzymes
and phase III drug transporters (Chiang 2013). Among
BA, both taurine-conjugate of UDCA (TUDCA) and
UDCA were reported to be the most effective inducers of
CYP3A4 in primary human hepatocytes (Schuetz et al.
2001) which corresponds with their ability to decrease
toxicity of more hydrophobic BA.
Information on the influence of UDCA on
bioavailability of CsA are inconsistent and controversial,
since there were published studies documenting
decreased dosing of CsA when combined with UDCA,
when AUC of CsA were increased twice (Gutzler et al.
1992). Similarly, the bioavailability of CsA was
increased with either combination with TUDCA or
CsA-TUDCA micellar solution (Balandraud-Pieri et al.
1997). This report may be explained in part by effect of
excipient-based increase ion CsA bioavailability, since
other micellar dispersions of CsA may also increase the
bioavailability and AUC of CsA (Balandraud-Pieri et al.
1997).
Therapeutic use of BA
Dried bile of Chinese black bear was used as
a remedy already during the dynasty of Tang in China
(approximately 600-900 A.D.) (Guarino et al. 2013).
Evidence-based use of bile acids as drugs dates about
30 years back (Beuers et al. 2015). In particular, CDCA
was utilized as a treatment for gallstone dissolution,
which was later displaced by UDCA due to the better
safety profile and efficacy. CDCA caused diarrhea,
increased serum total cholesterol and LDL-cholesterol,
among other adverse effects (American Society of Health
System Pharmacists 2016a). UDCA is currently the only
drug approved by FDA for the treatment of primary
50
S434 Juřica et al. Vol. 65
biliary cirrhosis (PBC, stage I. and II.) (Roma et al.
2011). UDCA delays progression and need for liver
transplantation, increases survival and is well tolerated in
PBC at the doses of 10-20 mg/kg/day (American Society
of Health System Pharmacists 2016b, Poupon 2014,
Roma et al. 2011). In some countries, UDCA is also
recommended in primary sclerosing cholangitis (PSC)
but evidence on benefit from treatment with UDCA is not
as convincing as in PBC. Nevertheless, UDCA is
reported to improve biochemical characteristics of
disease, ameliorate inflammatory component of the
disease, but it probably does not influence overall
survival, liver histology nor time to the transplantation at
the doses of 10-15 mg/kg/day (EASL 2009). UDCA is
also registered for the dissolution of radiolucent,
noncalcified gallbladder stones smaller than 20 mm in
diameter at the doses of 10-114 mg/kg/day (American
Society of Health System Pharmacists 2016b). UDCA is
also recommended in the treatment of intrahepatal
cholestasis in pregnancy (10-20 mg/kg/day). It alleviates
pruritus and improves liver biochemical parameters in up
to 80 % of patients (European Assoc Study 2009,
Gabzdyl and Schlaeger 2015). Another use of UDCA is
cystic fibrosis liver disease (CFLD, syn. CFALD – Cystic
Fibrosis Associated Liver Disease, syn. CFAHD – Cystic
Fibrosis Associated Hepatobiliary Disorders). UDCA
improves biochemical parameters in cystic fibrosis
patients, but not overall survival (Staufer et al. 2014).
Concerning off-label use, UDCA is recommended by
European Society for Blood and Marrow Transplantation
(ESBMT) as protective agent in Hepatic Veno-Occlusive
Disease after hematopoietic stem cell transplantation
(RR=0.34) (Dalle and Giralt 2016). Due to the
hepatoprotective effect of UDCA, there are some reports
that UDCA improves biochemical parameters in nonalcoholic
steatohepatitis (NASH), notably in higher doses
(Xiang et al. 2013), but in overall there is not enough
evidence for routine use of UDCA in NASH (Ratziu
2012, Georgescu and Georgescu 2007). UDCA in low
doses may also prevent from colorectal cancer in patients
with concomitant inflammatory bowel disease and PSC
(Singh et al. 2013).
Some other derivatives of natural BA – “bile
mimetics” – in particular FXR and TGR5 agonists, such
as nor-UDCA and obeticholic acid, have been suggested
to treat cholestatic liver disease (Poupon 2012, Adorini et
al. 2012). Obeticholic acid (6α-ethyl-chenodeoxycholic
acid) is a semisynthetic derivative of CDCA and potent
FXR agonist (Neuschwander-Tetri et al. 2015). It was
used in the treatment of PBC and NASH in patients non
responding to UDCA (Camilleri and Gores 2015).
Obeticholic acid also improved liver histology in NASH
patients, but 23 % of the patients developed pruritus
compared to 6 % in placebo group (Neuschwander-Tetri
et al. 2015). Moreover, obeticholic acid (25 mg/day)
improved liver enzymes, increased low density
lipoproteins and decreased markers of fibrosis in patients
with type II diabetes mellitus and non-alcoholic fatty
liver disease (NAFLD) (Mudaliar et al. 2013). In another
study, increase of total cholesterol with simultaneous
decrease of HDL cholesterol was reported upon
obeticholic acid treatment (Neuschwander-Tetri et al.
2015).
BA and BA sequestrants are currently
investigated as possible adjustment to the treatment of
diabetes mellitus (notably Type II) due to their ability to
increase insulin sensitivity, and decrease gluconeogenesis
(in particular through increase of glucagon like peptide 1)
(Camilleri and Gores 2015).
Conclusions
BAs are essential physiological factors
preserving homeostasis through their influence on
nutrition, metabolism and excretion of both endo- and
xenobiotics and their metabolites. BAs have also
an important role in pathogenesis of cholestatic diseases
and drug induced liver injury. Some of BA, their
analogues and so called bile mimetics seem to be
promising drugs. Apart of the effects of lipid absorption
and xenobiotic excretion based on physico-chemical
properties of BA, most of their regulatory and signalling
properties are mediated through the nuclear receptors
FXR, PXR CAR, LXR and VDR, as well as membrane
bound receptors TGR5 and S1PR2 (Copple and Li 2016).
The physiological role of interaction of BA with NRs is
probably to decrease production of toxic hydrophobic BA
and to increase their metabolic turnover towards polar
and hydrophilic BA, to increase their excretion and thus
decrease their toxicity in the hepatocytes. By this, the
activity of some drug-metabolizing CYPs is also
influenced since these are regulated by the same NRs,
what could have clinically relevant consequences in
cholestatic diseases or during the treatment with BA or
their derivatives.
Conflict of Interest
There is no conflict of interest.
51
2016 Bile Acids and Cytochrome P450 S435
Acknowledgements
This work was supported by the grant of Grant agency of
the Czech Republic No. GA16-06106S and written at
Masaryk university as a part of the project „Experimental
pharmacological development in neuropsychopharmacology
and oncology“ number MUNI/A/1284/2015 with the
support of the Specific University Research Grant, as
provided by the Ministry of Education, Youth and
Sports of the Czech Republic in the year 2016.
References
ADORINI L, PRUZANSKI M, SHAPIRO D: Farnesoid X receptor targeting to treat nonalcoholic steatohepatitis. Drug
Discov Today 17: 988-997, 2012.
American Society of Health System Pharmacists 2016a, Inc., DynaMed [Internet]. Ipswich (MA): EBSCO Information
Services. 1995 - Record No. 900215, Chenodiol; [updated 2016 Jan 19, 20.07. 2016]; Available from
http://search.ebscohost.com/login.aspx?direct=true&db=dnh&AN=900215&site=dynamed-live&scope=site.
American Society of Health System Pharmacists 2016b, Inc., DynaMed [Internet]. Ipswich (MA): EBSCO Information
Services. 1995 - Record No. 526120, Ursodiol; [updated 2011 Jun 28, 20.07. 2016]; available from
http://search.ebscohost.com/login.aspx?direct=true&db=dnh&AN=526120&site=dynamed-live&scope=site.
BALANDRAUD-PIERI N, QUENEAU PE, CAROLIBOSC FX, BERTAULTPERES P, MONTET AM, DURAND A,
MONTET JC: Effects of tauroursodeoxycholate solutions on cyclosporin a bioavailability in rats. Drug Metab
Dispos 25: 912-916, 1997.
BECQUEMONT L, GLAESER H, DRESCHER S, HITZL M, SIMON N, MURDTER T, HEINKELE G, HOFMANN
U, SCHAEFER C, BURK O, VERSTUYFT C, EICHELBAUM M, FROMM M: Effects of ursodeoxycholic
acid on P-glycoprotein and cytochrome P450 3A4-dependent pharmacokinetics in humans. Clin Pharmacol
Ther 79: 449-460, 2006.
BEGLEY M, GAHAN CG, HILL C: The interaction between bacteria and bile. FEMS Microbiol Rev 29: 625-651,
2005.
BEILKE LD, ALEKSUNES LM, HOLLAND RD, BESSELSEN DG, BEGER RD, KLAASSEN CD,
CHERRINGTON NJ: Constitutive androstane receptor-mediated changes in bile acid composition contributes
to hepatoprotection from lithocholic acid-induced liver injury in mice. Drug Metab Dispos 37: 1035-1045,
2009.
BEUERS U, TRAUNER M, JANSEN P, POUPON R: New paradigms in the treatment of hepatic cholestasis: From
UDCA to FXR, PXR and beyond. J Hepatol 62: 25-37, 2015.
BING Y, ZHU S, JIANG K, DONG G, LI J, YANG Z, YANG J, YUE J: Reduction of thyroid hormones triggers
down-regulation of hepatic CYP2B through nuclear receptors CAR and TR in a rat model of acute stroke.
Biochem Pharmacol 87: 636-649, 2014.
BURYOVA H, CHALUPSKY K, ZBODAKOVA O, KANCHEV I, JIROUSKOVA M, GREGOR M, SEDLACEK R:
Liver protective effect of ursodeoxycholic acid includes regulation of ADAM17 activity. Bmc
Gastroenterology 13: 2013.
CAMILLERI M, GORES G: Therapeutic targeting of bile acids. Am J Physiol Gastrointest Liver Physiol 309:
G209-G215, 2015.
CAROLI-BOSE F, ILIADIS A, SALMON L, MACHERAS P, MONTET A, BOURGEON A, GARRAFFO R,
DELMONT J, MONTET J: Ursodeoxycholic acid modulates cyclosporin A oral absorption in liver transplant
recipients. Fundam Clin Pharmacol 14: 601-609, 2000.
CENTUORI S, MARTINEZ J: Differential regulation of EGFR-MAPK signaling by deoxycholic acid (DCA) and
ursodeoxycholic acid (UDCA) in colon cancer. Dig Dis Sci 59: 2367-2380, 2014.
CHIANG JYL: Regulation of bile acid synthesis: pathways, nuclear receptors, and mechanisms. J Hepatol 40: 539-551,
2004.
CHIANG JYL: Bile acids: regulation of synthesis. J Lipid Res 50: 1955-1966, 2009.
CHIANG JYL: Bile acid metabolism and signaling. Compr Physiol 3: 1191-1212, 2013.
52
S436 Juřica et al. Vol. 65
CHOW ECY, MAGOMEDOVA L, QUACH HP, PATEL R, DURK MR, FAN J, MAENG H-J, IRONDI K, ANAKK
S, MOORE DD, CUMMINS CL, PANG KS: Vitamin D receptor activation down-regulates the small
heterodimer partner and increases CYP7A1 to lower cholesterol. Gastroenterology 146: 1048-1605, 2014.
CLAUDEL T, STAELS B, KUIPERS F: The Farnesoid X receptor: a molecular link between bile acid and lipid and
glucose metabolism. Arterioscler Thromb Vasc Biol 25: 2020-2030, 2005.
CLAUDEL T, ZOLLNER G, WAGNER M, TRAUNER M: Role of nuclear receptors for bile acid metabolism, bile
secretion, cholestasis, and gallstone disease. Biochim Biophys Acta 1812: 867-878, 2011.
COPPLE BL, LI T: Pharmacology of bile acid receptors: Evolution of bile acids from simple detergents to complex
signaling molecules. Pharmacol Res 104: 9-21, 2016.
D'ALDEBERT E, BIYEYEME BI MVE MJ, MERGEY M, WENDUM D, FIRRINCIELI D, COILLY A,
FOUASSIER L, CORPECHOT C, POUPON R, HOUSSET C, CHIGNARD N: Bile salts control the
antimicrobial peptide cathelicidin through nuclear receptors in the human biliary epithelium. Gastroenterology
136: 1435-1443, 2009.
DALLE JH, GIRALT SA: Hepatic veno-occlusive disease after hematopoietic stem cell transplantation: Risk factors
and stratification, prophylaxis, and treatment. Biol Blood Marrow Transplant 22: 400-409, 2016.
DING L, YANG L, WANG Z, HUANG W: Bile acid nuclear receptor FXR and digestive system diseases. Acta Pharm
Sin B 5: 135-144, 2015.
DROCOURT L, OURLIN JC, PASCUSSI JM, MAUREL P, VILAREM MJ: Expression of CYP3A4, CYP2B6, and
CYP2C9 is regulated by the vitamin D receptor pathway in primary human hepatocytes. J Biol Chem 277:
25125-25132, 2002.
DROCOURT L, PASCUSSI JM, ASSENAT E, FABRE JM, MAUREL P, VILAREM MJ: Calcium channel
modulators of the dihydropyridine family are human pregnane X receptor activators and inducers of CYP3A,
CYP2B, and CYP2C in human hepatocytes. Drug Metab Dispos 29: 1325-1331, 2001.
DUBOC H, TACHÉ Y, HOFMANN AF: The bile acid TGR5 membrane receptor: from basic research to clinical
application. Dig Liver Dis 46: 302-312, 2014.
ELORANTA JJ, KULLAK-UBLICK GA: Coordinate transcriptional regulation of bile acid homeostasis and drug
metabolism. Arch Biochem Biophys 433: 397-412, 2005.
EASL Clinical Practice Guidelines: Management of cholestatic liver diseases. J Hepatol 51: 237-267, 2009.
FORMAN BM, GOODE E, CHEN J, ORO AE, BRADLEY DJ, PERLMANN T, NOONAN DJ, BURKA LT,
MCMORRIS T, LAMPH WW, EVANS RM, WEINBERGER C: Identification of a nuclear receptor that is
activated by farnesol metabolites. Cell 81: 687-693, 1995.
GABZDYL EM, SCHLAEGER JM: Intrahepatic cholestasis of pregnancy: a critical clinical review. J Perinat Neonatal
Nurs 29: 41-50, 2015.
GADALETA RM, MIL SW, OLDENBURG B, SIERSEMA PD, KLOMP LW, ERPECUM KJ: Bile acids and their
nuclear receptor FXR: Relevance for hepatobiliary and gastrointestinal disease. Biochim Biophys Acta 1801:
683-692, 2010.
GASCON-BARRÉ M, DEMERS C, MIRSHAHI A, NÉRON S, ZALZAL S, NANCI A: The normal liver harbors the
vitamin D nuclear receptor in nonparenchymal and biliary epithelial cells. Hepatology 37: 1034-1042, 2003.
GEORGESCU EF, GEORGESCU M: Therapeutic options in non-alcoholic steatohepatitis (NASH). Are all agents
alike? Results of a preliminary study. J Gastrointest Liver 16: 39-46, 2007.
GNERRE C, BLÄTTLER S, KAUFMANN MR, LOOSER R, MEYER UA: Regulation of CYP3A4 by the bile acid
receptor FXR: evidence for functional binding sites in the CYP3A4 gene. Pharmacogenetics 14: 635-645,
2004.
GOODWIN B, GAUTHIER KC, UMETANI M, WATSON MA, LOCHANSKY MI, COLLINS JL, LEITERSDORF
E, MANGELSDORF DJ, KLIEWER SA, REPA JJ: Identification of bile acid precursors as endogenous
ligands for the nuclear xenobiotic pregnane X receptor. Proc Natl Acad Sci U S A 100: 223-228, 2003.
GOODWIN B, HODGSON E, D'COSTA DJ, ROBERTSON GR, LIDDLE C: Transcriptional regulation of the human
CYP3A4 gene by the constitutive androstane receptor. Mol Pharmacol 62: 359-365, 2002.
53
2016 Bile Acids and Cytochrome P450 S437
GOODWIN B, JONES S, PRICE R, WATSON M, MCKEE D, MOORE L, GALARDI C, WILSON J, LEWIS M,
ROTH M, MALONEY P, WILLSON T, KLIEWER S: A regulatory cascade of the nuclear receptors FXR,
SHP-1, and LRH-1 represses bile acid biosynthesis. Molecular Cell 6: 517-526, 2000.
GUARINO M, COCCA S, ALTOMARE A, EMERENZIANI S, CICALA M: Ursodeoxycholic acid therapy in
gallbladder disease, a story not yet completed. World J Gastroenterol 19: 5029-5034, 2013.
GUTZLER F, ZIMMERMANN R, RING G, SAUER P, STIEHL A: Ursodeoxycholic acid enhances the absorption of
cyclosporine in a heart-transplant patient with short bowel syndrome. Transplant Proc 24: 2620-2621, 1992.
HAN S, LI T, ELLIS E, STROM S, CHIANG JY: A novel bile acid-activated vitamin D receptor signaling in human
hepatocytes. Mol Endocrinol 24: 1151-1164, 2010.
HANDSCHIN C, MEYER UA: Regulatory network of lipid-sensing nuclear receptors: roles for CAR, PXR, LXR, and
FXR. Arch Biochem Biophys 433: 387-396, 2005.
IHUNNAH CA, JIANG M, XIE W: Nuclear receptor PXR, transcriptional circuits and metabolic relevance. Biochim
Biophys Acta 1812: 956-963, 2011.
JANOWSKI BA, WILLY PJ, DEVI TR, FALCK JR, MANGELSDORF DJ: An oxysterol signalling pathway mediated
by the nuclear receptor LXR alpha. Nature 383: 728-731, 1996.
JIANG W, MIYAMOTO T, KAKIZAWA T, NISHIO SI, OIWA A, TAKEDA T, SUZUKI S, HASHIZUME K:
Inhibition of LXRalpha signaling by vitamin D receptor: possible role of VDR in bile acid synthesis. Biochem
Biophys Res Commun 351: 176-184, 2006.
JONES SA, MOORE LB, SHENK JL, WISELY GB, HAMILTON GA, MCKEE DD, TOMKINSON NC, LECLUYSE
EL, LAMBERT MH, WILLSON TM, KLIEWER SA, MOORE JT: The pregnane X receptor: a promiscuous
xenobiotic receptor that has diverged during evolution. Mol Endocrinol 14: 27-39, 2000.
KANDEL BA, THOMAS M, WINTER S, DAMM G, SEEHOFER D, BURK O, SCHWAB M, ZANGER UM:
Genomewide comparison of the inducible transcriptomes of nuclear receptors CAR, PXR and PPARα in
primary human hepatocytes. Biochim Biophys Acta 1859: 1218-1227, 2016.
KHAN AA, CHOW EC, VAN LOENEN-WEEMAES AM, PORTE RJ, PANG KS, GROOTHUIS GM: Comparison of
effects of VDR versus PXR, FXR and GR ligands on the regulation of CYP3A isozymes in rat and human
intestine and liver. Eur J Pharm Sci 37: 115-125, 2009.
KHAN AA, DRAGT BS, PORTE RJ, GROOTHUIS GM: Regulation of VDR expression in rat and human intestine
and liver - Consequences for CYP3A expression. Toxicol In Vitro 24: 822-829, 2010.
KIR S, KLIEWER SA, MANGELSDORF DJ: Roles of FGF19 in liver metabolism. Cold Spring Harb Symp Quant
Biol 76: 139-144, 2011.
KLIEWER SA, MOORE JT, WADE L, STAUDINGER JL, WATSON MA, JONES SA, MCKEE DD, OLIVER BB,
WILLSON TM, ZETTERSTRÖM RH, PERLMANN T, LEHMANN JM: An orphan nuclear receptor
activated by pregnanes defines a novel steroid signaling pathway. Cell 92: 73-82, 1998.
KRATTINGER R, BOSTROM A, LEE SM, THASLER WE, SCHIOTH HB, KULLAK-UBLICK GA, MWINYI J:
Chenodeoxycholic acid significantly impacts the expression of miRNAs and genes involved in lipid, bile acid
and drug metabolism in human hepatocytes. Life Sci 156: 47-56, 2016.
KUROSAWA S, UCHIDA S, ITO Y, YAMADA S: Effect of ursodeoxycholic acid on the pharmacokinetics of
midazolam and CYP3A in the liver and intestine of rats. Xenobiotica 39: 162-170, 2009.
KWONG E, LI Y, HYLEMON PB, ZHOU H: Bile acids and sphingosine-1-phosphate receptor 2 in hepatic lipid
metabolism. Acta Pharm Sin B 5: 151-157, 2015.
LEHMANN JM, KLIEWER SA, MOORE LB, SMITH-OLIVER TA, OLIVER BB, SU JL, SUNDSETH SS,
WINEGAR DA, BLANCHARD DE, SPENCER TA, WILLSON TM: Activation of the nuclear receptor LXR
by oxysterols defines a new hormone response pathway. J Biol Chem 272: 3137-3140, 1997.
LEHMANN JM, MCKEE DD, WATSON MA, WILLSON TM, MOORE JT, KLIEWER SA: The human orphan
nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug
interactions. J Clin Invest 102: 1016-1023, 1998.
LI T, CHANDA D, ZHANG Y, CHOI HS, CHIANG JY: Glucose stimulates cholesterol 7alpha-hydroxylase gene
transcription in human hepatocytes. J Lipid Res 51: 832-842, 2010.
LI T, CHIANG JY: Bile acids as metabolic regulators. Curr Opin Gastroenterol 31: 159-165, 2015.
54
S438 Juřica et al. Vol. 65
LI T, FRANCL JM, BOEHME S, OCHOA A, ZHANG Y, KLAASSEN CD, ERICKSON SK, CHIANG JY: Glucose
and insulin induction of bile acid synthesis: mechanisms and implication in diabetes and obesity. J Biol Chem
287: 1861-1873, 2012.
MAKISHIMA M, LU TT, XIE W, WHITFIELD GK, DOMOTO H, EVANS RM, HAUSSLER MR,
MANGELSDORF DJ: Vitamin D receptor as an intestinal bile acid sensor. Science 296: 1313-1316, 2002.
MAKISHIMA M, OKAMOTO AY, REPA JJ, TU H, LEARNED RM, LUK A, HULL MV, LUSTIG KD,
MANGELSDORF DJ, SHAN B: Identification of a nuclear receptor for bile acids. Science 284: 1362-1365,
1999.
MODICA S, GADALETA RM, MOSCHETTA A: Deciphering the nuclear bile acid receptor FXR paradigm. Nucl
Recept Signal 8: e005, 2010.
MODICA S, MOSCHETTA A: Nuclear bile acid receptor FXR as pharmacological target: are we there yet? FEBS Lett
580: 5492-5499, 2006.
MOSCHETTA A: Nuclear receptors and cholesterol metabolism in the intestine. Atheroscler Suppl 17: 9-11, 2015.
MUDALIAR S, HENRY RR, SANYAL AJ, MORROW L, MARSCHALL HU, KIPNES M, ADORINI L, SCIACCA
CI, CLOPTON P, CASTELLOE E, DILLON P, PRUZANSKI M, SHAPIRO D: Efficacy and safety of the
farnesoid X receptor agonist obeticholic acid in patients with type 2 diabetes and nonalcoholic fatty liver
disease. Gastroenterology 145: 574-582, 2013.
NEUSCHWANDER-TETRI BA, LOOMBA R, SANYAL AJ, LAVINE JE, VAN NATTA ML, ABDELMALEK MF,
CHALASANI N, DASARATHY S, DIEHL AM, HAMEED B, KOWDLEY KV, MCCULLOUGH A,
TERRAULT N, CLARK JM, TONASCIA J, BRUNT EM, KLEINER DE, DOO E, NETWORK NCR:
Farnesoid X nuclear receptor ligand obeticholic acid for non-cirrhotic, non-alcoholic steatohepatitis (FLINT):
a multicentre, randomised, placebo-controlled trial. Lancet 385: 956-965, 2015.
OTTE K, KRANZ H, KOBER I, THOMPSON P, HOEFER M, HAUBOLD B, REMMEL B, VOSS H, KAISER C,
ALBERS M, CHERUVALLATH Z, JACKSON D, CASARI G, KOEGL M, PÄÄBO S, MOUS J,
KREMOSER C, DEUSCHLE U: Identification of farnesoid X receptor beta as a novel mammalian nuclear
receptor sensing lanosterol. Mol Cell Biol 23: 864-872, 2003.
PARKS DJ, BLANCHARD SG, BLEDSOE RK, CHANDRA G, CONSLER TG, KLIEWER SA, STIMMEL JB,
WILLSON TM, ZAVACKI AM, MOORE DD, LEHMANN JM: Bile acids: natural ligands for an orphan
nuclear receptor. Science 284: 1365-1368, 1999.
PELLICCIARI R, FIORUCCI S, CAMAIONI E, CLERICI C, COSTANTINO G, MALONEY PR, MORELLI A,
PARKS DJ, WILLSON TM: 6alpha-ethyl-chenodeoxycholic acid (6-ECDCA), a potent and selective FXR
agonist endowed with anticholestatic activity. J Med Chem 45: 3569-3572, 2002.
PENG L, PIEKOS S, GUO GL, ZHONG X-B: Role of farnesoid X receptor in establishment of ontogeny of phase-I
drug metabolizing enzyme genes in mouse liver. Acta Pharm Sin B, 2016.
POUPON R: Ursodeoxycholic acid and bile-acid mimetics as therapeutic agents for cholestatic liver diseases:
An overview of their mechanisms of action. Clin Res Hepatol Gastroenterol 36: 3-12, 2012.
POUPON, R: Evidence-based treatment of primary biliary cirrhosis. Dig Dis 32, 626-630, 2014.
QATANANI M, MOORE DD: CAR, the continuously advancing receptor, in drug metabolism and disease. Curr Drug
Metab 6: 329-339, 2005.
RAO YP, VLAHCEVIC ZR, STRAVITZ RT, MALLONEE DH, MULLICK J, AVADHANI NG, HYLEMON PB:
Down-regulation of the rat hepatic sterol 27-hydroxylase gene by bile acids in transfected primary hepatocytes:
possible role of hepatic nuclear factor 1 alpha. J Steroid Biochem Mol Biol 70: 1-14, 1999.
RATZIU V: Treatment of NASH with ursodeoxycholic acid: pro. Clin Res Hepatol Gastroenterol 36 (Suppl. 1):
S41-S45, 2012.
RENGA B, MENCARELLI A, CIPRIANI S, D'AMORE C, CARINO A, BRUNO A, FRANCISCI D, ZAMPELLA A,
DISTRUTTI E, FIORUCCI S: The bile acid sensor FXR is required for immune-regulatory activities of TLR-9
in intestinal inflammation. PLoS One 8: e54472, 2013.
ROMA M, TOLEDO F, BOAGLIO A, BASIGLIO C, CROCENZI F, POZZI E: Ursodeoxycholic acid in cholestasis:
linking action mechanisms to therapeutic applications. Clin Sci 121: 523-544, 2011.
55
2016 Bile Acids and Cytochrome P450 S439
SATO H, MACCHIARULO A, THOMAS C, GIOIELLO A, UNE M, HOFMANN AF, SALADIN R, SCHOONJANS
K, PELLICCIARI R, AUWERX J: Novel potent and selective bile acid derivatives as TGR5 agonists:
biological screening, structure-activity relationships, and molecular modeling studies. J Med Chem 51:
1831-1841, 2008.
SATO K, KAMADA T: Regulation of bile acid, cholesterol, and fatty acid synthesis in chicken primary hepatocytes by
different concentrations of T0901317, an agonist of liver X receptors. Comp Biochem Physiol A Mol Integr
Physiol 158: 201-206, 2011.
SBERNA AL, ASSEM M, GAUTIER T, GROBER J, GUIU B, JEANNIN A, PAIS DE BARROS JP, ATHIAS A,
LAGROST L, MASSON D: Constitutive androstane receptor activation stimulates faecal bile acid excretion
and reverse cholesterol transport in mice. J Hepatol 55: 154-161, 2011.
SCHUETZ E, STROM S, YASUDA K, LECUREUR V, ASSEM M, BRIMER C, LAMBA J, KIM R,
RAMACHANDRAN V, KOMOROSKI B, VENKATARAMANAN R, CAI H, SINAL C, GONZALEZ F,
SCHUETZ J: Disrupted bile acid homeostasis reveals an unexpected interaction among nuclear hormone
receptors, transporters, and cytochrome p450. J Biol Chem 276: 39411-39418, 2001.
SEPE V, RENGA B, FESTA C, FINAMORE C, MASULLO D, CARINO A, CIPRIANI S, DISTRUTTI E,
FIORUCCI S, ZAMPELLA A: Investigation on bile acid receptor regulators. Discovery of cholanoic acid
derivatives with dual G-protein coupled bile acid receptor 1 (GPBAR1) antagonistic and farnesoid X receptor
(FXR) modulatory activity. Steroids 105: 59-67, 2016.
SILJEVIK ELLIS EC: Suppression of bile acid synthesis by thyroid hormone in primary human hepatocytes. World
J Gastroenterol 12: 4640-4645, 2006.
SINGH S, KHANNA S, PARDI D, LOFTUS E, TALWALKAR J: Effect of ursodeoxycholic acid use on the risk of
colorectal neoplasia in patients with primary sclerosing cholangitis and inflammatory bowel disease:
a systematic review and meta-analysis. Inflamm Bowel Dis 19: 1631-1638, 2013.
SONG C, HIIPAKKA RA, LIAO S: Selective activation of liver X receptor alpha by 6alpha-hydroxy bile acids and
analogs. Steroids 65: 423-427, 2000.
SONG C, LIAO S: Cholestenoic acid is a naturally occurring ligand for liver X receptor alpha. Endocrinology 141:
4180-4184, 2000.
SONG KH, CHIANG JY: Glucagon and cAMP inhibit cholesterol 7alpha-hydroxylase (CYP7A1) gene expression in
human hepatocytes: discordant regulation of bile acid synthesis and gluconeogenesis. Hepatology 43: 117-125,
2006.
STAUDINGER JL, GOODWIN B, JONES SA, HAWKINS-BROWN D, MACKENZIE KI, LATOUR A, LIU Y,
KLAASSEN CD, BROWN KK, REINHARD J, WILLSON TM, KOLLER BH, KLIEWER SA: The nuclear
receptor PXR is a lithocholic acid sensor that protects against liver toxicity. Proc Natl Acad Sci U S A 98:
3369-3374, 2001.
STAUFER K, HALILBASIC E, TRAUNER M, KAZEMI-SHIRAZI L: Cystic fibrosis related liver disease-another
black box in hepatology. Int J Mol Sci 15: 13529-13549, 2014.
TEBOUL M, ENMARK E, LI Q, WIKSTRÖM AC, PELTO-HUIKKO M, GUSTAFSSON JA: OR-1, a member of the
nuclear receptor superfamily that interacts with the 9-cis-retinoic acid receptor. Proc Natl Acad Sci U S A 92:
2096-2100, 1995.
TIMSIT YE, NEGISHI M: CAR and PXR: the xenobiotic-sensing receptors. Steroids 72: 231-246, 2007.
TRAUNER M, CLAUDEL T, FICKERT P, MOUSTAFA T, WAGNER M: Bile acids as regulators of hepatic lipid and
glucose metabolism. Dig Dis 28: 220-224, 2010.
TWISK J, HOEKMAN MFM, LEHMANN EM, MEIJER P, MAGER WH, PRINCEN HMG: Insulin suppresses bileacid
synthesis in cultured rat hepatocytes by down-regulation of cholesterol 7-alpha-hydroxylase and sterol
27-hydroxylase gene-transcription. Hepatology 21: 501-510, 1995.
UCHIDA S, TANAKA S, NAMIKI N: Simultaneous and comprehensive in vivo analysis of cytochrome P450 activity
by using a cocktail approach in rats. Biopharm Drug Dispos 35: 228-236, 2014.
WAGNER M, HALILBASIC E, MARSCHALL HU, ZOLLNER G, FICKERT P, LANGNER C, ZATLOUKAL K,
DENK H, TRAUNER M: CAR and PXR agonists stimulate hepatic bile acid and bilirubin detoxification and
elimination pathways in mice. Hepatology 42: 420-430, 2005.
56
S440 Juřica et al. Vol. 65
XIANG X, BACKMAN JT, NEUVONEN PJ, NIEMI M: Gender, but not CYP7A1 or SLCO1B1 polymorphism,
affects the fasting plasma concentrations of bile acids in human beings. Basic Clin Pharmacol Toxicol 110:
245-252, 2012.
XIANG Z, CHEN Y, MA K, YE Y, ZHENG L, YANG Y, LI Y, JIN X: The role of Ursodeoxycholic acid in nonalcoholic
steatohepatitis: a systematic review. BMC Gastroenterol 13, 140, 2013.
XIAO Y, YAN W, ZHOU K, CAO Y, CAI W: Glucocorticoid treatment alters systemic bile acid homeostasis by
regulating the biosynthesis and transport of bile salts. Dig Liver Dis 48: 771-779, 2016.
XIE W, BARWICK JL, SIMON CM, PIERCE AM, SAFE S, BLUMBERG B, GUZELIAN PS, EVANS RM:
Reciprocal activation of xenobiotic response genes by nuclear receptors SXR/PXR and CAR. Genes Dev 14:
3014-3023, 2000.
XIE W, RADOMINSKA-PANDYA A, SHI Y, SIMON CM, NELSON MC, ONG ES, WAXMAN DJ, EVANS RM:
An essential role for nuclear receptors SXR/PXR in detoxification of cholestatic bile acids. Proc Natl Acad Sci
U S A 98: 3375-3380, 2001.
YAN D, YANG Y, UCHIDA S, MISAKA S, LUO J, TAKEUCHI K, INUI N, YAMADA S, OHASHI K,
WATANABE H: Effects of ursodeoxycholic acid on the pharmacokinetics and pharmacodynamics of
intravenous and oral midazolam in healthy volunteers. Naunyn Schmiedebergs Arch Pharmacol 377: 629-636,
2008.
ZELCER N, TONTONOZ P: Liver X receptors as integrators of metabolic and inflammatory signaling. J Clin Invest
116: 607-614, 2006.
ZHANG Y, KAST-WOELBERN HR, EDWARDS PA: Natural structural variants of the nuclear receptor farnesoid
X receptor affect transcriptional activation. J Biol Chem 278: 104-110, 2003.
ZOLLNER G, WAGNER M, MOUSTAFA T, FICKERT P, SILBERT D, GUMHOLD J, FUCHSBICHLER A,
HALILBASIC E, DENK H, MARSCHALL HU, TRAUNER M: Coordinated induction of bile acid
detoxification and alternative elimination in mice: role of FXR-regulated organic solute transporter-alpha/beta
in the adaptive response to bile acids. Am J Physiol Gastrointest Liver Physiol 290: G923-G932, 2006.
57
5.2 Endocannabinoid system and P450
The therapeutic use of cannabinoids from cannabis in traditional medicine is known from antiquity,
as well as its misuse for psychotropic effects. Nevertheless, the pharmacodynamics of cannabinoids
was described as late as in the second half of the 20th
century when the Δ9
- tetrahydrocannabinol
(THC) was isolated (Gaoni and Mechoulam, 1964) and the CB1 receptor was first described (Devane
et al., 1988). Later on, the basic constituents of the endocannabinoid system (ECS) were described:
cannabinoid CB1 and CB2 receptors, their endogenous ligands called endocannabinoids, and
enzymes of their synthesis and degradation.
The effect of the ECS in the human body can be described as pleiotropic. Components of the ECS are
widely distributed throughout the whole body. It is involved in learning and memory, brain plasticity,
nociception, inflammation, energy balance, and many others (Aizpurua-Olaizola et al., 2017). Its
dysfunction is related to diseases such as depression (Huang et al., 2016), schizophrenia (Zamberletti
et al., 2012), obesity (Engeli, 2008), and diabetes (Gruden et al., 2016).
There is great potential for cannabinoids to be used therapeutically for a wide range of illnesses.
Today, herbal cannabis, standardized extracts of cannabis, and synthetic analogues of THC are used.
Besides THC, cannabidiol (CBD) is another important constituent of cannabis preparations. It
counteracts some unwanted psychotropic effects of THC (Niesink and van Laar, 2013). Besides this, it
also has anti-inflammatory, neuroprotective, anxiolytic, and antipsychotic properties (Devinsky et al.,
2014). There are a variety of synthetic ligands of cannabinoid receptors with various activities on
cannabinoid receptors. Some of them, called “spice” or “K2”, are misused for their psychotropic
effects. The first synthetic selective cannabinoid antagonist/inverse agonist of CB1, rimonabant, was
approved for the treatment of obesity and metabolic syndrome. Nevertheless, it was withdrawn
from the market because of serious unwanted psychiatric effects (Gong et al., 2007). The role of ECS
in the regulation of P450 activity as well as the influence of endocannabinoids is unclear.
5.2.1 The role of ECS in the regulation of P450 activity
In the brain, ECS serves as a retrograde modulator of other neuronal systems including the GABA,
dopaminergic, adrenergic, and serotonergic pathways (Carvalho and Van Bockstaele, 2012; HajDahmane
and Shen, 2011; Ohno-Shosaku and Kano, 2014). Recently, it was reported that some of
these neuronal circuits could be involved in the regulation of liver P450 (Bromek et al., 2013; Kot et
al., 2015; Rysz et al., 2016; Wójcikowski et al., 2008). The mechanism of how the signal is transduced
from the brain to the liver was studied, and hormones were identified to be involved (Wójcikowski et
al., 2007).
58
Figure 1. Possible involvement of endocannabinoid system in regulation of P450 activity (Zendulka et
al., 2016).
The stimulation or inhibition of particular neuronal pathways modulates the level of hormones
released from the pituitary and subsequently from the peripheral tissues and organs. Nuclear
receptors regulating the expression of genes of P450 involved in drug metabolism are under the
control of glucocorticoids (Dvorak et al., 2003; Ferguson et al., 2005), gonadal steroids (Mwinyi et al.,
2011), thyroid hormones (Liddle et al., 1998), or growth hormone (Dhir et al., 2006; Levitsky et al.,
1989).
The role of the retrograde modulator of neuronal systems in the brain indicates that ECS could be
indirectly involved in the regulation of P450 activity. This hypothesis is supported by the fact that
cannabinoid receptors can form heterodimers with dopaminergic receptors (Kearn et al., 2005). We
59
described this theory in our article “Cannabinoid and cytochrome P450 interactions” (Zendulka et al.,
2016), and a brief overview of this can be found in Figure 1. Besides the modulation of neuronal
circuits, cannabinoids could also influence P450 activity via nuclear receptors or directly by
interacting with the enzyme molecule.
Apart from the hypothesis, the article describes also the P450 enzymes as an alternative metabolic
pathway for the degradation of endocannabinoids, herbal cannabinoids, and synthetic cannabinoids
as well. Known drug-drug interactions of therapeutically used cannabinoids are also overviewed in
the manuscript. A summary of results from preclinical and clinical research on the influence of
cannabinoids on P450 amounts and activity is given too. Data from the in vivo models are diverse and
indicates that ECS could regulate the activity of P450 by other mechanism than by simple enzyme
inactivation.
Zendulka O., Dovrtělová G., Nosková K., Turjap M., Šulcová A., Hanuš L., Juřica J. Cannabinoids and
cytochrome P450 interactions, Current Drug Metabolism, 17 (3), 206-226, 2016.
Impact factor: 2.659; Pharmacology & Pharmacy Q2, Biochemistry & Molecular Biology Q3
Citations WoS: 22 Author’s contribution: 35%
60
Send Orders for Reprints to reprints@benthamscience.ae
206 Current Drug Metabolism, 2016, 17, 206-226
1389-2002/16 $58.00+.00 © 2016 Bentham Science Publishers
Cannabinoids and Cytochrome P450 Interactions
Ondej Zendulkaa,b,*
, Gabriela Dovrtlováa
, Krist
na Noskováa
, Miroslav Turjapa,c
, Alexandra ulcováb
,
Lumír Hanu d
and Jan Juicaa,b
a
Department of Pharmacology, Faculty of Medicine, Masaryk University, Brno, Czech Republic; b
Experimental
and Applied Neuropsychopharmacology Research Group, Central European Institute of Technology, Brno, Czech
Republic; c
Department of Clinical Pharmacy, University Hospital Ostrava, Ostrava, Czech Republic; d
School of
Pharmacy, Faculty of Medicine, The Hebrew University of Jerusalem, Jerusalem, Israel
Abstract: Objective: This review consists of three parts, representing three different possibilities of interactions
between cannabinoid receptor ligands of both exogenous and endogenous origin and cytochrome P450 enzymes
(CYPs). The first part deals with cannabinoids as CYP substrates, the second summarizes current knowledge on the
influence of various cannabinoids on the metabolic activity of CYP, and the third outline a possible involvement of
the endocannabinoid system and cannabinoid ligands in the regulation of CYP liver activity.
Methods: We performed a structured search of bibliographic and drug databases for peer-reviewed literature using
focused review questions.
Results: Biotransformation via a hydrolytic pathway is the major route of endocannabinoid metabolism and the deactivation of substrates
is characteristic, in contrast to the minor oxidative pathway via CYP involved in the bioactivation reactions. Phytocannabinoids are extensively
metabolized by CYPs. The enzymes CYP2C9, CYP2C19, and CYP3A4 catalyze most of their hydroxylations. Similarly, CYP
represents a major metabolic pathway for both synthetic cannabinoids used therapeutically and drugs that are abused. In vitro experiments
document the mostly CYP inhibitory activity of the major phytocannabinoids, with cannabidiol as the most potent inhibitor of
many CYPs. The drug-drug interactions between cannabinoids and various drugs at the CYP level are reported, but their clinical relevance
remains unclear. The direct activation/inhibition of nuclear receptors in the liver cells by cannabinoids may result in a change of
CYP expression and activity. Finally, we hypothesize the interplay of central cannabinoid receptors with numerous nervous systems, resulting
in a hormone-mediated signal towards nuclear receptors in hepatocytes.
Keywords: Cannabinoids, cytochrome P450, endocannabinoid system, interaction, metabolism, regulation.
1. INTRODUCTION
Cytochrome P450 (CYP) enzymes are haem-containing
monooxygenases (EC 1.14.14.1) bound to the membranes of the
endoplasmic reticulum or mitochondria in the liver, intestine, kidney,
lung, brain, skin, and heart, with the highest level of expression
in the liver and intestine [1, 2]. CYPs are functionally coupled
with cytochrome P450 reductase, which enables the transfer of
electrons from NADPH, the reduced form of NADP (nicotinamide
adenine dinucleotide phosphate), to CYP. Microsomal enzymes
from subfamilies CYP3A, CYP2C, CYP2D, CYP1A, and CYP2B
play a pivotal role in the metabolism of xenobiotics [2]. Variability
in the drug plasma levels may diverge depending on different factors,
and according to some authors may reach up to 40-fold differences
[3]. The most important factors influencing drug plasma levels
include the activities of the CYPs with their genetic polymorphisms,
epigenetic changes such as DNA methylation and histone
deacetylation, together with exogenous factors. These factors substantially
influencing CYP metabolic activity are the major source
of variability in the pharmacokinetics of drugs and thus in drug
responses [3]. CYPs are therefore of particular relevance in clinical
pharmacokinetics. On the other hand, the importance of CYP in the
metabolism of endogenous substances is also crucial. CYPs are
involved in the metabolism of steroid hormones, cholesterol, vitamin
D, bile acids and eicosanoids [1], and also most endocannabinoids
[4].
Cannabinoids are a group of substances originally isolated from
the cannabis plant (Cannabis sativa). Today over 100 different
*Address correspondence to this author at the Department of Pharmacology,
Faculty of Medicine, Masaryk University, 625 00, Brno, Czech Republic;
Tel: +420-549-493-971; Fax: +420-542-213-996;
E-mail: zendulka@med.muni.cz
molecules with similar structure, most of them with a C21 terpenophenolic
moiety, have been isolated and described [5, 6]. They are
known to have a wide range of pharmacologic effects [7, 8], for
which the hemp plant has been used for over 6000 years in herbal
medicine and as a recreational drug.
The first cannabinoid isolated from the cannabis oil was cannabinol
(CBN) in 1898 [9, 10], followed by cannabidiol (CBD) in
1940 [11]. Nevertheless, the major psychoactive compound of cannabis
remained unknown until 1964, when 
9
-tetrahydrocannabinol
(
9
-THC) was isolated in its pure form [12, 13] and its structure
was described [14]. The second breakthrough in cannabinoid research
was the finding that 
9
-THC elicits its activity by binding to
specific receptors. The first two G-protein coupled receptors
(GPCRs) to be discovered, which when activated inhibit adenylyl
cyclase, were called the CB1 and CB2 receptors. The CB1 receptor
was identified in the brain in 1988 [15], and the CB2 receptor in
immune cells in 1993 [16]. These were the first pieces of direct
evidence for the possible existence of the endocannabinoid system
[17]. The cloning of both of these receptors [16, 18] opened the
door to the identification of their endogenous ligands (endocannabinoids),
and to the description of their distribution and transduction
signal pathways. Anandamide (N-arachidonoylethanolamine)
[19] and 2-arachidonoylglycerol (2-AG) [20, 21] are among the
first detected and most studied endocannabinoids so far. More recent
studies indicate that endocannabinoids, besides the cannabinoid
receptor, can also activate multiple receptor targets, including
nuclear peroxisome proliferator-activated receptors (PPARs) [22,
23], the transient receptor potential vanilloid type 1 receptor
(TRPV1) [24, 25], and orphan G protein-coupled receptors, such as
GPR55, GPR119, and GPR18 [26-29]. Other works indicate that
cannabinoids have the ability to modulate the activity of additional
receptors and their signal transduction pathways, for example
61
Cannabinoids and Cytochrome P450 Interactions Current Drug Metabolism, 2016, Vol. 17, No. 3 207
opioid, serotonin, NMDA, and nicotinic acetylcholine receptors
[29, 30].
Nowadays, the terminology concerning cannabinoids is not
unified. Some authors describe cannabinoids as ligands of cannabinoid
CB1 or CB2 receptors of herbal (phytocannabinoids), endogenous
(endocannabinoids) or xenogenic origin (synthetic cannabinoids).
Some others differentiate between a) true cannabinoids with
the structure derived from endogenous arachidonic acid or natural
herbal cannabis-derived compounds, b) synthetic cannabinoid-like
compounds of different structures with either direct or indirect cannabimimetic
effects, or compounds inhibiting the cannabinoid receptor
activities. Moreover, some authors consider endogenous
molecules with a similar structure, but without the ability to bind to
CB receptors to also be cannabinoids. These endocannabinoid-like
compounds can interfere with the activity of true endocannabinoids,
as they are in several cases synthetized and biotransformed via the
same pathways [31]. For the above reasons and to maintain the
clarity the authors of this review decided to use the name cannabinoids
for all of the substances described. An overview of endocannabinoids
and endocannabinoid-like substances as well as the most
common phytocannabinoids, synthetic ligands of cannabinoid receptors
used in preclinical studies, and cannabinoid derived drugs is
shown in Table 1.
The aim of this work is to provide a comprehensive review of
the interactions between CYPs and the endocannabinoid system and
its ligands. Here, we describe the role of CYP in the metabolism of
cannabinoids and vice versa the role of cannabinoids in the regulation
of CYP activity.
2. CANNABINOIDS AS SUBSTRATES OF CYTOCHROME
P450 MONOOXYGENASES
The endogenous and exogenous cannabinoids are substrates of
various CYPs. Due to the possibility of interaction between endocannabinoids,
phytocannabinoids, or synthetic cannabinoids and
other drugs at the CYP site, there is a risk of treatment failure or
drug toxicity. It is therefore important to identify possible sites of
such interactions for the successful prevention of pharmacokinetic
drug-drug interactions.
2.1. Endocannabinoids and Endocannabinoid-Like Compounds
Numerous amides of fatty acids, notably amides of arachidonic
acid, its derivatives, and their metabolites, are potent ligands of
cannabinoid receptors. To date, anandamide (AEA), 2-AG and its
isomer 1-arachidonoylglycerol, oleamide (oleic acid amide),
virodhamine (O-arachidonoylethanolamine), di-homo- -linolenoylethanolamide,
N-arachidonoyldopamine, noladin ether (2arachidonylglyceryl
ether), and N-arachidonoylserine were identified
and proved to be endogenous ligands of at least some cannabinoid
receptors. Other endogenous N-acylethanolamines, Nacylethanolamides,
and N-acyl-aminoacids such as palmitoylethanolamide,
N-arachidonoyltaurine, N-arachidonoylglycine [32-35],
N-docosatetraenoyl-ethanolamine, N-docosahexaenoylethanolamine,
or N-eico-sapentaenoylethanolamine were found in mammalian
tissues over the last decade and exhibit varying affinity to cannabinoid
receptors CB1 and CB2. It is also possible that they potentiate
the effects of „classical“ endocannabinoids such as anandamide and
2-AG independently of binding to CB receptors. Therefore, they are
sometimes called „endocannabinoid-like compounds“ [4, 35-37].
The metabolism of AEA and 2-AG, being the first investigated
and most studied endocannabinoids, was recently reviewed by
Snider et al. [38] and Zelasko et al. [4].
The biological effects of most endocannabinoids are terminated
by transport to the cells and enzymatic inactivation. It was hypothesized
that the transport of endocannabinoids to the cells may also
regulate their biological effects. Mechanisms such as simple diffusion,
facilitated diffusion or endocytosis are thought to uptake AEA
to the cells [38]. A major degradation pathway is catalyzed by fatty
acid amide hydrolase (FAAH) and monoacylglycerol lipase
(MAGL) [4, 38]. The oxidative degradation of endocannabinoids is
only a minor pathway and involves the enzymes cyclooxygenase-2
(COX-2), 12- and 15-lipoxygenase (12-LOX, 15-LOX, respectively),
and CYPs [38-41]. Since some of the metabolites of endocannabinoids
originating via CYP enzymes are active ligands of CB
receptors, the role of this oxidative pathway remains unclear [4, 35,
37, 38]. Due to the focus of this review, CYP-mediated pathways
are described in detail.
Table 1. Overview of cannabinoids.
Endocannabinoids Endocannabinoid-like compounds Phytocannabinoids Synthetic cannabinoids
anandamide palmitoylethanolamide 9
-tetrahydrocannabinol dronabinola
2-arachidonoylglycerol N-docosatetraenoylethanolamine 8
-tetrahydrocannabinol nabilonea
noladin ether di-homo- -linolenoyl-ethanolamide cannabidiol rimonabant
virodhamine 2-oleoylglycerol cannabinol methanandamide
arachidonoyldopamine N-oleoylethanolamine cannabigerol JWH-0133
N-arachidonoylserine N-eicosapentaenoylethanolamine cannabichromen AM-251
ACEA
homo- -linolenoylethanolamide N-docosahexaenoylethanolamine cannabivarin
ACPA
7,10,13,16-
docosatetraenoylethanolamide
oleamide cannabielsoin WIN 55,212-2
N-arachidonoylglycine cannabitriol CP 55,940
1- arachidonoylglycerol HU-210
N-arachidonoyltaurine
a
synthetic analogues of 9
-THC
62
208 Current Drug Metabolism, 2016, Vol. 17, No. 3 Zendulka et al.
2.1.1. Arachidonic Acid
Since the CYP-mediated metabolic pathways of endocannabinoids
are closely similar to the metabolism of arachidonic acid
(AA), this CYP-mediated metabolism of AA is reviewed briefly so
as to elucidate theoretical possibilities of the oxidations at the “fatty
acid” site of endocannabinoid molecules.
CYPs are known to metabolize arachidonic acid by epoxidation,
/ -1 hydroxylation, bis allylic oxidations, and hydroxylation
to conjugated dienols (Fig. 1) [42-44]. As a result, a wide variety of
metabolites with biological activities are produced.
Arachidonic acid has four double bonds and epoxidation may
occur on any of them. The products of epoxidation, epoxyeicosatrienoic
acids (EET), may be further hydrolyzed to dihydroxyeicosatrienoic
acids (diHETE). EET are produced by several hepatic and
extrahepatic CYPs - CYP2C8, CYP2C9, CYP1A2, and CYP2B6, with
the latter playing only a minor role (Table 2). The / -1 hydroxylations
of arachidonic acid to hydroxyeicosatrienoic acid (HETE) are
catalyzed by the CYP4A, CYP2E1, and CYP4F families (Table 3).
Finally, bis-allylic oxidations and hydroxylations with double bond
migration are catalyzed by CYP families 1A, 3A, 2C, and 4F (Table 4).
2.1.2. Anandamide
Anandamide, the first known endocannabinoid, was isolated from
the porcine brain by L. O. Hanu and W. A. Devane from the team of
prof. R. Mechoulam at Hebrew University, Jerusalem in 1992 [19].
AEA is hydrolyzed by the membrane-bound enzyme FAAH, with the
highest level of expression in the liver. This degradative pathway is
the most important in the regulation of AEA cellular and tissue concentrations.
FAAH hydrolyses AEA towards arachidonic acid and
ethanolamine. Thus the inhibition of FAAH may become a useful
alternative in cannabinergic treatment options [38]. COX-2, an enzyme
expressed in an inducible manner in inflammation, converts
anandamide to several prostaglandin ethanolamides [46, 47]. Oxidation
of the aliphatic chain by 12-LOX and 15-LOX yields 12- and 15hydroxyanandamide.
12-hydroxyanandamide in particular may play a
significant role in the modulation of neuronal functions via its influence
on neurotransmitter levels [48].
Fig. (1). CYP-mediated metabolism of AA [42-44].
CYPs involved in the degradation of AEA belong to the
CYP3A and CYP4F families. The biodegradation of anandamide by
CYPs was reported for the first time by Bornheim et al. in 1995
[49], who described its conversion by mouse liver microsomal fraction
to approximately 20 products, whose structures were not identified.
Furthermore, pretreatment with common CYP inducers such
Table 2. Epoxidation of AA catalyzed by cytochrome P450 enzymes [42-44].
CYP Product Tissue
2B6 14,15-EET, 11,12-EET liver
2C8 14,15-EET, 11,12- EET, 8,9-EET liver, lung, vascular endothelium
2C9 14,15- EET, 11,12- EET, 8,9-EET liver, lung, vascular endothelium
2C19 14,15- EET, 8,9-EET liver
2J2 5,6- EET, 8,9- EET, 11,12- EET, 14,15-EET kidney, GIT, pancreas
1A2 8,9- EET, 11,12-EET liver, lung
Table 3. / -1 hydroxylations of AA catalyzed by cytochrome P450 enzymes [44, 45].
CYP Product Tissue
4A11 19-, 20-HETE liver, kidney
4F2 20-HETE liver, kidney
4F3 hydroxy-LTB4 polymorphonuclears
4F11 ? liver, kidney
4F12 18-HETE liver, kidney
2E1 19(S)-HETE, 19(R)-HETE, 18(R)- HETE
63
Cannabinoids and Cytochrome P450 Interactions Current Drug Metabolism, 2016, Vol. 17, No. 3 209
as dexamethasone increased the formation of metabolites 5-15 fold,
and pre-treatment with a CYP3A antibody diminished the production
of anandamide metabolites. Bornheim et al. also suggested that
the CYP3A, CYP2B, and CYP1A subfamilies are involved in the
metabolism of AEA in mouse liver microsomes. Similarly, Costa
et al. suggested that CYP3A and CYP2B subfamilies are involved
in the metabolism of anandamide in rat liver microsomes [50].
To the best of our knowledge, Snider et al. was the first to investigate
the biotransformation sites of AEA by human liver and
kidney microsomal CYPs, and identified the metabolites [51]. The
biotransformation routes are fundamentally similar to those of AA.
Anandamide may be epoxygenated by several CYPs at positions 5-
6, 8-9, 11-12, and 14-15 to form four epoxyeicosatrienoic acid
ethanolamides (EET-EAs). At least in some of them, this oxidative
pathway is more bioactivation than degradation, since 5,6-EET-EA
seems to be a more stable CB ligand than AEA itself [38]. Nevertheless,
all EET-EAs may be further hydroxylated in the positions
(again, similarly to AA metabolism) predominantly by CYP2D6
and thus 20-hydroxy-epoxyeicosatrienyl ethanolamides (HEETEAs)
are produced [51]. With 5,6-EET-EA and 14,15-EET-EA,
hydroxylations at positions 16, 17, 18, and 19 were also described.
EET-EA may be hydrolyzed by epoxyhydrolase to form dihydroxylated
EET-EA [52].
Besides these reactions, - and -1-hydroxylations of AEA
were also described [4, 38, 51, 53]. Details on the oxidative metabolism
of AEA are shown in Figure 2.
2.1.3. 2-arachidonoylglycerol
The main metabolic degradation of 2-AG is catalyzed by
MAGL, FAAH, and , -hydrolase domains (ABHD) 6 and 12 [4,
38, 54]. The structure of 2-AG suggests that they are subject to the
same oxidative metabolism as AA and AEA, which would lead to
four regioisomeric 2-epoxyeicosatrienylglycerol derivatives (EETG)
(Fig. 3). In contrast to this assumption, only 2 EET-G were identified
to date – 2-(11,12-epoxyeicosatrienyl)-glycerol and 2-(14, 15epoxyeicosatrienyl)
glycerol, which are produced by CYP2J2 in rat
kidney and spleen [55] and in bovine and porcine myocardium [56,
57]. These metabolites demonstrate regulatory effects on blood
pressure, as was shown in the study of Awumey et al. [58].
As well as in EET-EA, the CYP-mediated epoxygenation of 2AG
to EET-G seems to be a kind of bioactivation, since these metabolites
exhibit a tighter binding to CB receptors than 2-AG [56].
EET-G may be oxidatively decomposed by CYP2J2 to AA and
glycerol.
2.1.4. N-arachidonoyldopamine
N-arachidonoyldopamine (NADA) is another endocannabinoid
known to exert significant biological activity, e.g. in the immune
system and pain perception [59, 60]. Besides hydrolysis to AA and
dopamine by FAAH [35], NADA may be hydroxylated by rat microsomal
protein in the presence of NADPH in the and -1 positions
to form 19- and 20-hydroxyeicosatetraenyl dopamine (19HETE-DA
and 20-HETE-DA) [60] (Fig. 4).
The question of epoxygenase reactions analogous to the CYPmediated
metabolism of AA and anandamide remains to be further
elucidated.
2.1.5. Other Endocannabinoids and Cannabinoid-Like Com-
pounds
The metabolic fate of the other endocannabinoids and cannabinoid-like
compounds, such as virodhamine, oleamide, Narachidonoylglycine,
N-arachidonoylserine, or N-arachidonoyltaurine
is not well understood, but hydrolysis with esterases or amide hydrolases
is likely. On the other hand, hydrolysis of the ether group
(e.g. noladin ether) by these enzymes is not likely, in contrast to
oxidative metabolism, which may be an alternative degradative
pathway for ethers, but there is still no direct evidence for this.
2.1.6. Concluding Remarks Concerning Endocannabinoid Me-
tabolism
The metabolism of endocannabinoids via the hydrolytic pathway
(namely FAAH) usually produces inactive metabolites, in
terms of their affinity to bind to CB receptors. On the other hand,
the products of the oxidative pathway may be both metabolites with
a lower affinity to CB receptors (20-HETE-EA and 14,15-EET-EA)
and products with a higher affinity to the CB (or PPAR) receptor
than the parent compound, as shown with some 2-11,12-EET-Gs
and 2-14,15-EET-Gs [38]. Moreover, a molecule with higher stability
(5,6-EET-EA) can be produced. From this point of view, the
inhibition of endocannabinoid degradation may be a valuable
pharmacological target, and has been shown to produce anxiolyticlike
and antidepressant-like effects in animal models [62]. Despite
promising results from animal studies, there are no reliable data on
efficacy from clinical studies. The clinical trials were focused
mostly on safety; in general, the inhibitors were well tolerated and
lacked typical "cannabinoid-like effects" [62]. There has also been a
reported lack of efficacy in a clinical trial of an FAAH inhibitor in
the treatment of osteoarthritic pain [63]. Modulation of the oxidative
metabolic pathway was not studied in terms of a possible
therapeutic approach; modulating the oxidative pathway would be
problematic due to the involvement of CYPs (CYP2D6, CYP2C8,
CYP3A) in the metabolism of other endogenous substances and
possibly also co-administered drugs.
2.2. The Metabolism of Phytocannabinoids via Cytochrome
P450 Monooxygenases
The term phytocannabinoids covers naturally occurring phytochemicals
from Cannabis sativa, Cannabis indica, or Cannabis
Table 4. Bis-allylic oxidations and hydroxylations of AA with double bond migration which are catalyzed by cytochrome P450
enzymes [42].
CYP Product Tissue
1A2 7-, 10-, 13-HETE liver
3A4 7-, 10-, 13-HETE liver
2C8 11-, 13-, 15-HETE liver
2C9 12-, 13-HETE liver
2C19 13-, 19-HETE liver
4F8 13-HETE liver, ovary/testes
4F12 18-HETE liver, kidney, GIT
64
210 Current Drug Metabolism, 2016, Vol. 17, No. 3 Zendulka et al.
Fig. (2). CYP-mediated metabolism of anandamide [4, 38, 61].
ruderalis which are able to interact with cannabinoid receptors [64,
65]. Nearly 500 chemical entities were identified in Cannabis herbage,
of which about 70 are phytocannabinoids. These compounds
are present in the highest amounts in the viscous resin produced by
the glandules of female cannabis inflorescence [64, 66]. As a result,
several chemical classes of phytocannabinoids were defined by
ElSohly et al. [66]: 1) cannabigerol type, 2) cannabichromene type,
3) cannabidiol type, 4) (-)- 9
-trans-tetrahydrocannabinol type,
5) (-)- 8
-trans-tetrahydrocanna-binol type, 6) cannabicyclol type, 7)
cannabielsoin type, 8) cannabinol type, 9) cannabinodiol type, 10)
cannabitriol type, and 11) miscellaneous type. In terms of this classification,
the (-)- 9
-trans-tetrahydrocannabinol type, cannabinol
type, and cannabidiol type are the most abundant and best known
and studied. Out of 70 known phytocannabinoids, only 9
-THC,
CBN, and CBD are reviewed in terms of oxidative metabolism by
CYPs. No data were found for the other phytocannabinoids.
65
Cannabinoids and Cytochrome P450 Interactions Current Drug Metabolism, 2016, Vol. 17, No. 3 211
Fig. (3). CYP-mediated metabolism of 2-arachidonoylglycerol [4, 38].
Fig. (4). CYP-mediated metabolism of N-arachidonoyldopamine [60].
Fig. (5). Structure and CYP-mediated oxidative metabolism of 9
-THC
[69].
Fig. (6). Hydroxylation of CBN by CYP enzymes [69, 71].
2.2.1. 9
-tetrahydrocannabinol
The oxidative biotransformation of 9
-THC is quite complicated
– approximately 80 metabolites were identified in humans
[67]. The majority of the biotransformation processes of 9
-THC
are catalyzed by CYPs (Fig. 5). The first metabolite of 9
-THC was
described back in 1970 by Nilsson et al., who used NMR to identify
11-hydroxy- 9
- THC in an extract from the incubation of a crude
66
212 Current Drug Metabolism, 2016, Vol. 17, No. 3 Zendulka et al.
Fig. (7). Hydroxylation of CBD by CYP enzymes [72].
microsomal fraction of rabbit liver with 9
-THC [68]. This metabolite
was formerly named 7-hydroxy- 1
-THC, because of the different
numbering of the terpenophenolic ring in the past. The second
most abundant hydroxy-derivative of 9
-THC is 8 -hydroxy- 9
THC
[69]. Later on, many other metabolites were identified, mostly
in experiments with liver microsomes of different species, including
humans, and the relative importance of CYPs was also examined,
containing epoxygenated metabolites of THC [70]. The authors
suggest that CYP2C9 and CYP3A4 probably play the most important
roles in the oxidative metabolism of 9
-THC. Recently, Stout
et al. [65] published a unique systematic review on the metabolism
of cannabinoids.
Some of the metabolites of 9
-THC seem to be active (e.g. 11hydroxy-
9
-THC) and therefore some authors think that the oxidative
metabolism of 9
-THC may be necessary for the effects of
cannabis [69].
2.2.2. Cannabinol
Cannabinol metabolism was studied by Kuzuoka et al. [71] and
Watanabe et al. [69]. The chemical structure of CBN, being similar
to 9
-THC, leads us to expect similar metabolic pathways mediated
by microsomal monooxygenases. The hydroxylations occur at positions
8 and 11, and CYP2C9 and CYP3A4 are involved in their
formation as reported in [65, 69, 71] (Fig. 6).
2.2.3. Cannabidiol
The metabolism of cannabidiol was investigated both in vivo
and in vitro. 33 different metabolites were found in human urine
from a patient treated with CBD, 600 mg/day [72].
CBD is metabolized primarily by the enzymes CYP2C19 and
CYP3A4 [65, 73]. The hydroxylation reactions occur at positions 6,
7, and positions 1 - 5 of the aliphatic pentyl- and position 10 on
the propenyl- substituent (Fig. 7). Moreover, these metabolites may
be further oxidized to form dihydroxylated metabolites and CBDoic
acid derivatives [72]. In an experiment with recombinant human
liver microsomes, Jiang et al. proved that 7 out of 14 recombinant
human CYP enzymes may be involved in CBD metabolism [73].
These include CYP1A1, CYP1A2, CYP2C9, CYP2C19, CYP2D6,
CYP3A4, and CYP3A5.
Among monohydroxylated metabolites, the most abundant were
6 -OH-, 6 -OH-, 7-OH-, 1 -OH-, 2 -OH-, 3 -OH-, 4 -OH-, and
5 -OH-CBD [73]. The authors also confirmed the importance of
CYP3A4 and CYP2C19 in the overall metabolism of CBD, namely
in the 6 -, 6 -, 7-, and 4 -hydroxylations of CBD with the use of
selective isoform-specific inhibitors and anti-CYP3A4 antibodies.
2.2.4. Other Phytocannabinoids
The metabolism of other phytocannabinoids has not been studied
in humans, but the hydroxylation of several cannabinoids, including
THC, CBD, CBN, cannabichromene (CBC), and cannabigerol
(CBG) was studied in vitro in the liver microsomal fraction in
several animal species [74]. In general, similar hydroxylation reactions
are catalyzed by microsomal fractions, but particular CYPs
responsible for the reactions were not identified. Hydroxylation
occurs most abundantly at the allylic part of the molecule at positions
C5' and C6'. Apart from C5' and C6' hydroxylations, hydroxylation
also occurs at positions C2' and C1'' to C5'', and epoxidation
at the double bond of the methylpentenyl group [74] (Fig. 8).
Cannabigerol metabolism appeared to be similar to the metabolism
of CBC. Hydroxylations at the terminal allylic group of the
side chain were the most abundant reactions in the liver microsomes
of all species except for mouse, where C6' or C7' epoxide
was the most abundant [74] (Fig. 8).
Fig. (8). Structure of CBC (A) and CBG (B) and positions of oxidative
metabolism mediated by microsomal enzymes in mouse, rat, guinea pig,
rabbit, hamster, gerbil, cat [74].
In summary, phytocannabinoids are extensively metabolized by
CYP enzymes. For the most studied THC, CBN, and CBD, the
enzymes CYP2C9, CYP2C19, and CYP3A4 catalyze the majority
of hydroxylations. Most cannabinoids exhibit a similar pattern of
oxidative metabolism [74]. At first, tricyclic cannabinoids (THC,
CBD, and CBN) are the most effectively hydroxylated at the C-11
position and to a lesser extent also at the C-8 position. Various degrees
of hydroxylation and epoxidation also occur at the carbons of
the side chain in all cannabinoids, with the exception of CBN.
67
Cannabinoids and Cytochrome P450 Interactions Current Drug Metabolism, 2016, Vol. 17, No. 3 213
2.3. Synthetic Cannabinoids
Besides the substances isolated from natural materials, many
other ligands of CB receptors were synthetized in vitro. Synthetic
cannabinoids cover the whole spectrum of receptor ligand types
from full agonists to inverse agonists, and their biological effects
are therefore miscellaneous [75]. For the purposes of this review,
synthetic cannabinoids are classified into groups of drugs for therapeutic
purposes, molecules used as research tools, and abused
drugs.
2.3.1. Synthetic Cannabinoids as Medicinal Products
Dronabinol (Marinol®
) is a synthetic 9
-THC for oral use. It is
approved for medical use in the United States and several other
countries. Dronabinol is indicated for the treatment of anorexia
associated with weight loss in patients suffering from AIDS and for
the treatment of nausea and vomiting associated with cancer chemotherapy
in patients who have failed to respond adequately to
conventional antiemetic therapy [76]. It undergoes extensive firstpass
hepatic metabolism, primarily by microsomal hydroxylation
via multiple CYPs, yielding both active and inactive metabolites. Its
principal active metabolite is 11-OH- 9
-THC [76].
Nabilone (Cesamet®
) is a synthetic THC analogue for oral administration.
It is registered in Canada, the USA, and several other
countries for the treatment of nausea and vomiting associated with
cancer chemotherapy in patients who have failed to respond adequately
to conventional antiemetic treatments [77]. It has been suggested
that the antiemetic effect of nabilone is mediated by its interaction
with the cannabinoid CB1 receptor within the central nervous
system. The metabolism of nabilone is extensive, and several
metabolites have been identified. According to the data from Ce-
samet®
SPC [77], there are at least two metabolic pathways involved
in the biotransformation of nabilone. A minor pathway is
initiated by the stereospecific enzymatic reduction of the 9-keto
moiety of nabilone to produce the isomeric carbinol metabolite.
Secondly, a metabolite of nabilone in faeces has been identified as a
diol formed by reduction of the 9-keto group plus oxidation at the
penultimate carbon of the dimethylheptyl side chain. In addition,
there is evidence of extensive metabolism of nabilone by multiple
CYPs. In vitro CYP inhibition studies using human liver microsomes
showed that nabilone did not significantly inhibit the metabolic
activity of CYP1A2, 2A6, 2C19, 2D6, and 3A4. In clinical
use, nabilone is unlikely to alter the CYP-mediated metabolism of
co-administered drugs [77].
Rimonabant (Acomplia®
) was the first CB1 antagonist/inverse
agonist to be approved for therapeutic use in metabolic syndrome
and obesity [78]. Because of the significant risk of serious psychiatric
adverse effects, it was withdrawn from the market [79]. In vitro
experiments revealed CYP3A4 and amidohydrolase to be the major
metabolic pathways involved in the biotransformation of rimonabant
into inactive metabolites [80].
A buccal spray preparation containing Cannabis extracts,
whose main active ingredients are 9
-THC and CBD (Sativex®
), is
now available in many countries including the UK, Spain, Italy, and
Germany (not available in the US). It is used for the symptomatic
relief of spasticity or neuropathic pain in multiple sclerosis and in
cancer pain [81]. The active substances have the same structures as
natural 9
-THC and CBD, therefore they undergo the same metabolic
pathways.
2.3.2. Synthetic Cannabinoids as Experimental Tools
Compounds that are known to activate CB1 and CB2 receptors
with approximately equal potency and that are most commonly
used in the laboratory as CB1/CB2 receptor agonists fall essentially
into one of four chemical groups: classical cannabinoids, nonclassical
cannabinoids, amino-alkylindoles, and eicosanoids [29].
The classical group consists of dibenzopyran derivatives. The
prototypic synthetic member of this group is HU-210, a synthetic
analogue of (-)- 8
-THC. HU-210 displays a high affinity for CB1
and CB2 receptors, and also a high potency and relative intrinsic
activity as a cannabinoid receptor agonist [29]. In the study of Kim
et al. [82], the in vitro metabolism of HU-210 was investigated
using human liver microsomes to characterize associated phase I
metabolites. HU-210 was metabolized to yield a total of 24 metabolites,
characterized as mono-oxygenated, mono-hydroxylated, dioxygenated,
or di-hydroxylated metabolites. The specific enzymes
involved in the formation of the metabolites were not investigated.
The nonclassical group contains bicyclic and tricyclic analogues
of 9
-THC that lack the pyran ring. The most widely used
member of this group is CP 55,940. The oxidative metabolism of
CP 55,940 was studied in mouse liver microsomes by Thomas et al.
[83]. The mass spectral data indicated that five monohydroxylated
metabolites had been formed differing in their position of hydroxylation.
Two additional compounds were detected whose mass spectral
data suggested that these metabolites were hydroxylated at two
positions on the side chain. Side chain hydroxylation is consistent
with the metabolic profile of 9
-THC [83].
The prototype of the aminoalkylindole group widely used in
cannabinoid research is WIN 55,212-2. WIN 55,212-2 exhibits a
relatively high efficacy at the CB1 and CB2 receptors and possesses
CB1 and CB2 affinities in the low nanomolar range. The structure
of WIN 55,212-2 bears no structural similarity to classical, nonclassical,
or eicosanoid cannabinoids [84]. The metabolism of WIN
55,212-2 in rat liver microsomes was investigated in the study of
Zhang et al. [85]. The HPLC chromatogram revealed two major
and at least six minor metabolites derived from the parent compound.
The two major metabolites (representing 60 to 75 % of the
total metabolites) were each identified as dihydrodiol metabolites
resulting from the arene oxide pathway. Three of the minor metabolites
corresponded to structural isomers of the trihydroxylated parent
compound, the other two represent monohydroxylated isomers
and another was determined to be a dehydrogenation product. Specific
enzymes involved in the formation of metabolites were not
investigated.
Members of the eicosanoid group of cannabinoid CB1/CB2
receptor agonists have structures quite unlike those of classical,
nonclassical, or aminoalkylindole cannabinoids. Two prominent
members of this group are the endocannabinoids AEA and 2-AG.
The starting point for the development of the first CB1 selective
agonists was the AEA molecule [29]. A number of agonists with
significant selectivity for CB1 or CB2 receptors have been developed.
Important CB1 selective agonists include the AEA analogues
R-(+)-methanandamide, arachidonyl-2´-chloroethylamide (ACEA),
and arachidonyl-cyclopropylamide (ACPA). Of these, both ACEA
and ACPA share the susceptibility of AEA to enzymatic hydrolysis
by FAAH [29, 86]. In contrast, methanandamide is less susceptible
to enzymatic hydrolysis, probably because it is protected from this
by the presence of a methyl substituent at the 1´ carbon [87].
The CB2 selective agonists most widely used as experimental
tools have been the classical cannabinoid JWH-133, and the less
selective aminoalkylindole JWH-015 [29]. The in vitro phase I
metabolism of JWH-015 using human liver microsomes was studied
by Mazarino et al. [88]. A total of 18 metabolites were formed.
The biotransformation pathways detected consist of monohydroxylation,
di-hydroxylation, tri-hydroxylation, carboxylation,
N-dealkylation, dehydratation, and combinations of them, confirming
data from the study with rat liver microsomes [89]. Specific
enzymes involved in the oxidative metabolism were not studied.
2.3.3. Synthetic Cannabinoids as Abused Drugs
Synthetic cannabinoids recently became the largest group of
compounds to be monitored in Europe by the EU Early Warning
System on new psychoactive substances [90]. “Legal high” products
containing synthetic cannabinoids (SCs) have probably been
sold as herbal smoking mixtures since 2006. In 2008, a synthetic
68
214 Current Drug Metabolism, 2016, Vol. 17, No. 3 Zendulka et al.
cannabinoid JWH-018 was detected for the first time in a herbal
mixture. In 2014, a further 30 new synthetic cannabinoids were
reported for the first time, bringing the total number reported by the
EU Early Warning System to 137 in February 2015 [91]. New
drugs are synthesized by slight modifications of the known psychoactive
“parent” compound, to obtain similar - or even stronger psychoactive
effects and to circumvent the law, being not yet included
in the lists of controlled substances [92]. The common property
of all SCs is that they interact with the CB1 and CB2 cannabinoid
receptors and elicit cannabimimetic effects similar to 9
-THC.
They are synthesized in clandestine laboratories and illegally added
to commercial products such as herbal blends (these are sold under
brand names such as “Spice” and “K2”), which are claimed to be
air fresheners or herbal incenses. The most common way of administration
is smoking.
The majority of compounds are chemically unrelated to 9
THC.
To date hundreds of SCs were categorized into the following
structural groups: adamantoylindoles, aminoalkylindoles, benzoylindoles,
cyclohexylphenols, dibenzopyrans, naphthoylindoles,
naphthylmethylindoles, naphthylmethylindenes, naphthoylpyrroles,
phenylacetyl-indoles, tetramethylcyclopropylketone indoles, quinolinyl
ester indoles, and indazole carboxamide compounds [93].
Only limited data are available on the metabolism of the huge variety
of synthetic cannabinoids. Due to the insufficient toxicity data,
controlled human drug administration studies are not feasible.
Therefore, in vitro experiments are alternative approaches for metabolite
profiling and structure elucidation. Most of the recent in
vitro metabolite-profiling studies utilize human liver microsomes or
human hepatocytes. So far, we have identified such studies for the
following synthetic cannabinoids: AB-CHIMINACA [94], ABFUBINACA
[95-97], AB-PINACA [95, 96, 98], 5F-AB-PINACA
[98], ADB-FUBINACA [95], AKB-48 [99, 100], 5F-AKB-48
[100], AM-2201 [101, 102], APICA [103], CP 47,497 [104], HU-
210 [82], JWH-015 [88], JWH-018 [105-108], JWH-073 [108],
JWH-073 4-methylnaphthoyl analogue [108], JWH-122 [108-110],
JWH-200 [109], JWH-210 [88], MAM-2201 [110], PB-22 [95,
111], 5F-PB-22 [95, 111], RCS-4 [112], RCS-8 [113], STS-135
(5F-APICA) [103, 114], UR-144 [102], and XLR-11 [115].
In vitro metabolite-profiling studies with subsequent confirmation
in authentic specimens provide critically important information
for the identification of suitable in vivo biomarkers to document the
intake of SCs in clinical and forensic settings.
Two of the above-cited investigations also focused on the identification
of specific CYP enzymes involved in oxidative metabolism.
Chimalakonda et al. [101] studied the oxidative metabolism of
[1-naphthalenyl-(1-pentyl-1H-indol-3-yl]-methanone (JWH-018)
and its fluorinated counterpart AM-2201 [1-(5-fluoropentyl)-1Hindol-3-yl]-1-naphthalenyl-methanone.
Kinetic analysis using human
liver microsomes and six human recombinant CYPs (CYP1A2,
2C9, 2C19, 2D6, 2E1, and 3A4) identified CYP2C9 and CYP1A2
as the major CYPs responsible for the generation of hydroxylated
and carboxylated metabolites of JWH-018 and AM-2201. The contribution
of CYP2C19, 2D6, 2E1, and 3A4 in the hepatic metabolic
clearance of these synthetic cannabinoids was minimal. These findings
are further supported by the results of another investigation
that observed a concentration-dependent inhibition of JWH-018 and
AM-2201 oxidation in human liver microsomes by the CYP2C9and
1A2-selective chemical inhibitors sulfaphenazole and naphthoflavone,
respectively [116]. The study of Holm et al. [100]
was focused on the elucidation of CYP enzymes involved in the
oxidative metabolism of N-(1-adamantyl)-1-pentyl-1H-indazole-3carboxamide
(AKB-48, also known as APINACA). Metabolite
formation was screened using a panel of nine recombinant CYPs
(CYP1A2, 2B6, 2C8, 2C9, 2C18, 2C19, 2D6, 2E1, 3A4) and compared
the metabolites formed to human liver microsomal incubations
with specific inhibitors against CYP2D6, 2C19, and 3A4,
respectively. The results demonstrate that CYP3A4 is the major
CYP responsible for the oxidative metabolism of AKB-48, preferentially
performing the oxidation on the adamantyl moiety of the
compound. Such detailed data are not available for other SCs.
However, SCs are structurally diverse and the involvement of other
CYPs and non-CYP enzymes in phase I biotransformations is
likely. This was recently demonstrated for the quinolineindole synthetic
cannabinoids PB-22, 5F-PB-22, and BB-22, where carboxylesterase
1 hydrolyzes an ester bond [96]. In addition, carboxylesterase
1 also hydrolyzes the primary amide group of two other synthetic
cannabinoids, AB-PINACA and AB-FUBINACA [96].
Based on the recent evidence, synthetic cannabinoids are extensively
metabolized in phase I and phase II biotransformation reactions.
CYPs are involved in phase I metabolism. Oxidative metabolism
forms preferably mono-, di-, and tri- hydroxylated, carboxylated,
and N-dealkylated metabolites. Unlike 9
-THC metabolism,
several SC metabolites retain a high affinity for the CB1 and CB2
receptors and exhibit a range of intrinsic activities. The majority of
phase II SC metabolites are glucuronides.
3. CANNABINOIDS AS REGULATORS OF CYP METABOLIC
ACTIVITY
The therapeutic use of cannabis, its extracts and synthetic cannabinoids
together with the pleiotropic regulatory activity of the
endocannabinoid system and the role of CYP in the metabolism of
cannabinoids raises the question of drug-drug interaction with coadministered
medicines. The decrease in the metabolic activity of
individual CYPs can increase the plasma levels of their substrates,
and symptoms of toxicity could appear. In the opposite direction,
increased CYP activity will decrease the efficacy of its substrates,
and can lead to the failure of a therapy.
The interactions between cannabinoids and CYPs could be
simply caused by the competition of two substrates at the same
CYP protein. Nevertheless, the huge metabolic capacity of CYP
and involvement of alternative metabolic pathways decreases the
clinical importance of such drug-drug interplay. The second possibility
involves the direct interaction of cannabinoids with the CYP
protein in a non-competitive (allosteric) manner, which usually
leads to enzyme inactivation or a slowdown of the metabolic reaction.
On the other hand, the possibility of allosteric induction for
some substances was also described [117]. The final possibility for
how cannabinoids can influence the CYP-mediated metabolism of
co-administered drugs is by targeting the expression of CYP genes.
This possibility is likely, due to the involvement of the endocannabinoid
system in many physiological functions, including some
metabolic pathways [118, 119], and its interaction with many other
neuronal systems and circuits which might also be involved. Therefore,
the results of research focused on the direct interaction of
cannabinoids with CYP enzymes and the influence of cannabinoids
on the metabolic activity assessed after systemic administration or
in models using living cells with intact signal pathways could give
different results and are described separately.
3.1. Direct Interactions of Cannabinoids and CYP Proteins
Rimonabant was tested for the ability to bind to CYPs in the
model of human liver microsomes (HLM). Approximately 19 % of
the metabolites produced were covalently bound to CYPs [120].
Therefore it is not surprising that a mechanism-based inhibition of
CYP3A4 and decrease in the metabolic activity over 70 % was
described. A search for other CB1 antagonists for possible therapeutic
use led to the synthesis of aminopyrazine CB1 inverse agonists.
The chlorine in the para position of the 5-phenyl ring was
found to be responsible for the inhibition of CYP3A4 and its substitution
with a trifluoromethyl moiety did not change the potency at
the CB1 receptor, increased aqueous solubility, and decreased potential
for CYP3A4 inhibition [121]. The negative psychotropic
effects of rimonabant could be eliminated with analogues not crossing
the blood-brain barrier but with the effect on peripheral CB
69
Cannabinoids and Cytochrome P450 Interactions Current Drug Metabolism, 2016, Vol. 17, No. 3 215
receptors. LH-21, a CB1 antagonist with poor brain penetration, is
similar to rimonabant in both its anorectic affect and also CYP inhibiting
activity [122]. It inhibits the metabolic activity of CYP3A4,
2C9, and 2D6 with the IC50 of 1.62, 8.14, and >105 HM, respectively.
The inhibition was weaker in comparison to the control inhibitors
ketoconazole, sulfaphenazole, and quinidine. LH-21 is
reported to be a moderate inhibitor of CYP3A4 and CYP2C9 and
weak inhibitor of CYP2D6.
Ashino et al. described the inhibition of the CYP1A2 metabolic
activity of different synthetic cannabinoids with the indole structure
moiety in the model of mouse liver microsomes [123]. MAM-2201
and JWH-019 with the naphtoylindole structure were the most potent
inhibitors, and decreased the activity to 47.7 % and 64.3 % of
the control values at a concentration of 100 HM. Most of the adamantoylindole
derivatives inhibited the activity weakly (up to a 10
% decrease) except for STS-135, which exhibited an inhibition
comparable to naphtoylindole ligands. The last molecule tested with
the tetramethylcyclopropylindole core exhibited moderate inhibitory
activity with a decrease to 73.4 % of the control values at a 100
HM concentration.
9
-THC, CBN, and CBD are the most studied substances of the
phytocannabinoids group in terms of CYP interactions. All of them
competitively inhibit the CYP1A enzyme family, but with different
strengths [124]. The most potent inhibitor of CYP1A1 is CBD followed
by CBN, while the inhibition of CYP1A2 and CYP1B1 was
stronger after CBN treatment. All the enzymes were inhibited by
9
-THC less potently, with a low selectivity for individual CYP1
enzymes. The subsequent studies revealed the pentylresorcinol
[125] or methylresorcinol [126] structures to be important for the
direct inhibition of CYP1A1. The same moiety is probably involved
in the potent CYP2B6 inhibition by CBD [127], while 9
-THC and
CBN have a weaker effect. All of the substances decreased the
activity in a mixed fashion in comparison to the inhibition of
CYP2A6, which is non-competitive, and the inhibition potency of
all three phytocannabinoids was weaker than the inhibition of
CYP2B6. Similar results were obtained with CYP2C9, which was
also inhibited by all three substances [128]. The strongest inhibition
was reported for CBN, followed by 9
-THC and CBD. The same
substances were incubated with rat liver microsomes, and the 16 and
2 –hydroxylation of testosterone was assessed [129]. The reaction
is mediated by CYP2C11, which is considered to be the counterpart
of human CYP2C9 [130]. However, the results are different
from those obtained in the human studies. The inhibition was only
detected in CBD-treated samples, while 9
-THC and CBN did not
influenced the enzyme activity. Both CBN and 9
-THC decreased
the omeprazole 5-hydroxylase activity, indicating their inhibitory
effect on CYP2C19 [131], and at least one of the free phenolic
groups and pentyl side chain are the structural determinants of this
effect. The activity of CYP2D6 is again most sensitive to the effect
of CBD [132]. Its IC50 values were 2-4 times lower than those of
9
-THC and CBN. The CYP2D6 inhibition potency of these two is
similar. Similarly to the influence on the enzymes of the CYP1A
family, CYP3A enzymes are differentially sensitive to the effect of
the major phytocannabinoids. CBD inhibited the activity of
CYP3A4 and CYP3A5 most potently, while the influence of all
three substances on the activity of CYP3A7 was comparable [133].
The inhibition of 3A4 can also be indirectly evidenced by the suppression
of cyclosporine A metabolism in both mouse and human
liver microsomes preincubated with CBD [134]. The effect of phytocannabinoids
on the activity of 17 -hydroxylase (CYP17) was
tested in the model of rat testis microsomes. However, CBD was
the most potent inhibitor of CYP enzymes in most of the documented
experiments, its inhibitory effect on the CYP17 activity was
the weakest, and required IC50 concentrations over 290 HM [135].
On the other hand, 9
-THC and CBN inhibited the enzyme’s activity
with EC50 values of 42.8 HM and 32.9 HM, respectively. The
inhibition of individual CYPs by phytocannabinoids is in accordance
with the older data obtained with less selective CYP substrates
[136-138].
The clinical relevance of the presented data is questionable, due
to the high concentrations of the tested drugs used in in vitro studies
and their correspondence to plasma levels reached when phytocannabinoids
are used therapeutically or abused. When a marijuana
cigarette (15.8 mg 9
-THC) is smoked, the peak plasma concentrations
of 9
-THC is reported to be only 268 nM [139]. Similarly
after CBD and CBN (20 mg) administration by smoking a cigarette,
the levels reached 363 nM and 406 nM, respectively [140, 141].
Moreover, the plasma levels of synthetic 9
-THC dronabinol
reached a nanomolar concentration when administered in the recommended
therapeutic doses [124]. The review of inhibition constants
(Ki) values are presented in Table 5. It is obvious that clinically
relevant inhibition of CYP by phytocannabinoids is likely for
enzymes of the CYP1 family with CBN and for the CYP1A1, 2B6,
2C19, and 3A5 enzymes with CBD. The inhibition of CYP enzymes
by THC is probably too weak to cause a clinically significant
interaction with the co-administered drugs.
3.2. The Influence of Cannabinoids on CYP Metabolic Activity
– In vivo and Cell Culture Models
The possible discrepancy in the results of direct interaction
experiments and the systemic administration of drugs can be demonstrated
in the work of Bornheim et al. [142]. Different analogues
of THC were tested for both direct interaction with naïve mouse
liver microsomes, and microsomes sampled 2 hours after the systemic
administration of THC analogues to mice. While in the direct
interaction part of the study, some of the tested substances inhibited
the activities of CYP3A and CYP2C, the same molecules produced
no effect after systemic drug administration.
An important factor influencing the result of the study is the
duration of drug pre-treatment before the activity is assessed. The
results after a single dose of a drug and after the repeated administration
can be different. After the repeated administration of a
drug, higher values of plasma/tissue concentrations can be reached
than with a single dose. Moreover, there is probably interplay between
cannabinoids and endocannabinoid CB receptors, which can
lead to changes in signal pathways including CYP liver regulation
mechanisms. The subsequent change could therefore be timedependent,
such as for instance the induction of the enzyme activity
by the mechanism of increased gene transcription, and de novo
protein synthesis usually takes at least several hours from the drug
administration. An example can be found in the study concerning
the effect of the synthetic cannabinoid receptor agonist CP 55,940
on CYP activity in rats [143]. The only parameter that changed
after a single intraperitoneal dose of the drug (0.4 mg/kg) was an
increase in the oxygen consumption by the brain and liver. However
after 11 days of treatment with the same dose of the substance
the increased brain and hepatic mitochondrial respiration disappeared,
and the P-450 reductase, benzo(A)pyrene hydroxylase, and
ethoxycoumarin deethylase activities as well as the protein content
of the liver microsomes were increased.
The results of the in vivo experiment undoubtedly also depend
on the experimental model used. When CP 55,940 was administered
to mice (intraperitoneally, 0.5 mg/kg/day) for 5 or 24 days,
the microsomal protein content was decreased after the latter type
of administration [144], in contrast to the previous results with the
same substance in rats. Nevertheless, the activity of CYP2E1,
measured as p-nitrophenol oxidation, was unaffected. These data
correspond with the results of Yang et al. from HepG2 cells incubated
with a natural CB receptor agonist CBD [145]. Other researchers
reported an increase in the expression of CYP2E1 and
CYP2C6, together with an increased amount of total CYP hepatic
content in mice after a single dose or repeated administration of
hashish [146].
70
216 Current Drug Metabolism, 2016, Vol. 17, No. 3 Zendulka et al.
The variability in the experimental design thus leads to a high
variation in the results obtained. However, if the data from the experiments
with the same designs are compared, the variability disappears.
The first data regarding the influence of phytocannabinoids on
the activity of CYP in the animal models were homologous. An extract
from cannabis prolonged the sleeping time of mice treated with
the CYP substrate pentobarbitone, documenting the inhibition of its
metabolism [147]. Similar results were obtained with CBD [148], the
most studied cannabinoid in terms of CYP interactions. Moreover,
CBD inhibited the enzyme activities of various more or less selective
CYP substrates including p-nitroanisole O-demethylase [137], aniline
hydroxylase [137], hexobarbital hydroxylase [149], erythromycin Ndemethylase
[149], 6 -testosterone hydroxylase [149], and aminopyrine
N-demethylase [150].
The influence of CBD on single CYPs was evaluated in a number
of studies. CBD administered to mice at a dose of 120 mg/kg
inactivated CYP2C and CYP3A proteins by covalent binding after a
single dose [151]. Whereas after repeated administration of the
same dose, the expression of the mRNA of these two enzymes increased
as well as the protein content, while the activity remained
unchanged [152], probably because of the inactivation reported
previously. Similarly, in rats CBD decreased the total CYP hepatic
content after repeated administration [153]. Further research revealed
decreased activities of CYP17 and CYP2C [154]. The influence
of CBD on CYP2C activity is probably also sex-dependent
[155].
The most recent results from human cell cultures described the
induction of CYP1A enzymes by marijuana smoke [156, 157], 9
THC
[157-159], and CBD [159], probably mediated by the aryl
hydrocarbon receptor (AhR) [157, 159].
One of the great advantages of animal models is the possibility
of studying the effects of prenatal exposure to drugs. Maternal exposure
to 9
-THC, CBD, and CBN increased the levels of hepatic
CYP content, whereas postnatal exposure had the opposite effect in
male rat offspring [160].
3.3. Drug-Drug CYP-Mediated Interactions of Cannabinoids
The interspecies differences in the CYP system [161] creates a
great barrier to the clinical approximation of data obtained from
animals. Nevertheless, in most preclinical studies either with 9
THC
or CBD, the results correspond to in vitro experiments, and
generally these cannabinoids are reported to be CYP inhibitors.
CBD significantly decreased the metabolism of CYP substrates, e.g.
cocaine [162], anandamide [163], cyclosporine A [134], or THC
[162, 164, 165]. However, the dose of CBD necessary to evoke the
effect was 30 mg/kg in mice, which is higher than any dose of CBD
used in clinical practice.
Although there is enough evidence of the influence of cannabinoids
on the total hepatic amounts of CYPs and their activities from
preclinical studies, the clinical data on the topic are scarce. The risk
of interaction is significantly dependent on the dose administered.
Rimonabant (40 mg/day for 8 days) did not affect the steady-state
concentration of co-administered digoxin, midazolam, warfarin,
nicotine or oral contraceptives [166]. The effect of medicinal cannabis
(Bedrocan®
), containing 18 % 9
-THC and 0.8 % CBD administered
for 15 days, on the levels of irinotecan and docetaxel
were tested in oncologic patients [167]. Similarly, no significant
change in the clearance or exposure to the monitored drugs was
observed. Finally, the summary of medicinal product characteristics
of the synthetic 9
-THC and CBD mixture (Sativex®
) declares that
no interactions with CYP3 substrates are expected [168]. It has to
be stressed, that these results describe the risk of interaction of low
doses of CBD. Nadulski et al. tested the effect of 5.4 mg of CBD on
the pharmacokinetics of 10 mg of 9
-THC [169] and concluded that
the inhibitory effect of CBD on CYP in this dose is small compared
to the variability of CYP activity caused by other factors. This conclusion
could be generalized for the clinical use of CBD at doses of
up to 5 mg per day. On the other hand, higher doses of CBD in the
range 8-25 mg/kg/day were described to markedly inhibit the metabolism
of hexobarbital [170] or clobazam [171], both CYP3A4
substrates. The interaction potential of the higher doses of CBD
with CYP3A4 substrates is therefore clinically relevant.
4. POSSIBLE INVOLVEMENT OF ENDOCANNABINOID
SYSTEM IN THE REGULATION OF CYP EXPRESSION
AND CYP METABOLIC ACTIVITY IN THE LIVER
The regulation of CYP metabolic activity is complex in nature,
including many endogenous and exogenous factors determining the
actual amounts of enzymes and their catalytic activities. Besides the
exogenous ones, genetic polymorphisms, and the role of hormones
are known to be endogenous factors regulating the expression and
activity of CYPs. Recently, the involvement of some neuronal systems
was reported [172-174]. The regulatory role of the endocannabinoid
system raises the question of its participation in this process,
too. Here, we hypothesize that the central and peripheral pathways
of the endocannabinoid system and interplay between cannabinoid
ligands and various receptors are probably involved in
CYP regulation.
4.1. The Role of Central Endocannabinoid System in the CYP
Regulation
It is known that genes coding for various CYPs are regulated by
endogenous hormones, which are under the control of the central
nervous system. It has been also shown that changes in the brain
dopaminergic, noradrenergic, and serotonergic systems can affect
hepatic CYP expression [175]. The central endocannabinoid system
modulates neurotransmission at inhibitory and excitatory synapses,
and therefore could be also involved in the regulation of CYP activity.
Thus the endocannabinoid system and possible interactions with
other neuronal systems, its impact on the hypothalamic-pituitary
axis (HPA) and on the levels of circulating hormones are reviewed.
4.1.1. The Brain and Endocannabinoid System
Most central cannabinoid effects are mediated by the CB1 receptors
widely expressed throughout the brain, where they are the
most abundant in regions controlling a number of key functions [30,
176]. Therefore, CB1 receptors are present at a high density in the
basal ganglia, frontal cortex, hippocampus, and cerebellum, and at a
Table 5. Inhibition of CYP metabolic activity in vitro [124, 125, 127-129, 131-133, 135].
1A1 1A2 1B1 2A6 2B6 2C91
2C112
2C19 2D61
3A4 3A5 3A7 173
CBD 0.16C
2.69C
3.63C
55.0N
0.69M
5.6C
19.9 - 21.6C
0.793M
2.42 1.0C
0.195 12.3C
124.4M
9
-THC 4.78C
7.54C
2.47C
28.9N
2.81M
1.5M
none 1.93M
17.1A
>50A
35.6A
30.3A
15.9M
CBN 0.54C
0.08C
0.15C
39.8N
2.55M
0.93C
none no data 12.3A
>50A
>50A
23.8A
4.5M
A
Half maximal inhibitory concentration (IC50) in M. Other reported values are inhibition constants (Ki) in M; M
Mixed type of inhibition; C
Competitive type of inhibition; N
Noncompetitive
type of inhibition; Enzymes are recombinant human proteins, if not indicated different; 1
Human liver microsomes.; 2
Rat liver microsomes; 3
Rat testis microsomes.
71
Cannabinoids and Cytochrome P450 Interactions Current Drug Metabolism, 2016, Vol. 17, No. 3 217
moderate/low density in the nucleus accumbens, hypothalamus, and
amygdala [177].
The predominant localization of CB1 receptors at the presynaptic
terminals of neurons plays an important regulatory role, because
they can influence the release of a number of different neurotransmitters
[178, 179]. The postsynaptic localization of CB1 receptors
has been also observed, but only rarely [177]. The endocannabinoids
are synthesized and released by postsynaptic neurons, and
they act as retrograde neuronal messengers at presynaptic CB1
receptors. The activation of CB1 receptors by endocannabinoids
suppresses the presynaptic release of -aminobutyric acid (GABA),
glutamate, acetylcholine, serotonin, and noradrenaline [179].
Another reason for the increased complexity of endocannabinoid
signaling is the evidence that CB1 receptors form heteromers
with a variety of other GPCRs [180]. CB1 receptors can form functional
heterodimers with G-opioid receptors [181], orexin-1 receptors
[182, 183], adenosine A2A receptors [184, 185], serotonergic
(mainly 5-HT3) receptors [186, 187], or dopaminergic D2 receptors
[188]. Another possible interaction between the dopaminergic and
endocannabinoid system is indirectly via the GABAergic [189, 190]
and glutamatergic system [191, 192].
Endocannabinoid signaling in the brain may influence liver
CYP activity, but the signal has to be somehow mediated from the
CNS to the periphery. It is known that such signal transduction
could be found in hormones released from HPA and leading to
subsequent changes in the hormonal levels released from peripheral
organs. Hormones influence not only hepatic glucose or lipid metabolism,
but also the expression of genes coding for different CYP
liver enzymes [193-196].
Dopaminergic pathways which could possibly contribute to the
release of hormones are the mesolimbic and the tuberoinfundibular
pathways. It was reported that stimulation of the dopaminergic
system increases growth hormone (GH) [197, 198], adrenocorticotropic
hormone (ACTH), and corticosterone levels [199, 200]. In
contrast, the levels of thyroid-stimulating hormone (TSH) after
activation of the dopaminergic system were decreased [198, 201].
The ability of the brain dopaminergic system to affect liver CYP
expression by altering the levels of pituitary hormones was first
reported in the studies of Wójcikowski et al. [174, 202]. Dopaminergic
D2 receptors were identified to be involved in the regulation
of hormones and liver CYP enzymes in the mesolimbic pathway
[174].
Noradrenaline is one of the main neurotransmitters controlling
the release of GH [172, 203]. It also controls the production and
release of corticotropin-releasing hormone (CRH) and thyrotropinreleasing
hormone (TRH) [204]. The release of somatostatin is
regulated by noradrenaline, among other neurotransmitters and
neuropeptides. It was reported that a damage of the noradrenergic
innervation in the arcuate nucleus (ARC) or periventricular hypothalamic
nucleus (PVN) proved an opposite effect on the regulation
of CYP expression [172]. This can be explained by the fact that
destruction of the noradrenergic innervation in the ARC leads to a
decrease of the noradrenaline level and also to a decrease of the
level of GH. While destruction of the noradrenergic innervation in
the PVN causes a decrease of the level of noradrenaline, but the
plasma concertation of GH are increased probably due to the decreased
secretion of somatostatin. The involvement of the
noradrenergic system in CYP regulation was confirmed by Kot et
al. [205]. Again the hormones were identified to be the mediators of
the effect from the brain to the liver. The same author reported the
serotonergic system to also take part in CYP neurohumoral regulation
[173, 206, 207].
The influence of exogenous cannabinoids on the secretion of
pituitary hormones has been known for a long time, but the role of
endocannabinoids in the neuroendocrine system is not fully understood
yet [208, 209]. Based on available studies, two options for
how endocannabinoids influence HPA are suggested: (i) a direct
effect mediated by endocannabinoids receptors and/or (ii) an indirect
effect when cannabinoids change the activity of the endocannabinoid
system and this modulates the activity of other neuronal
systems controlling HPA. CB1 receptors are expressed in various
regions of the brain, and were also detected in the hypothalamus
and pituitary gland [210, 211]. Many studies describe the influence
of cannabinoids or endocannabinoids on the levels of CRH, GH,
TSH, prolactin (PRL), and luteinizing hormone (LH), but their
findings are often contradictory [208, 212-216]. It seems that the
main structure of endocannabinoid influence on neuroendocrine
functions is the hypothalamus, where they act as retrograde messengers
activating the CB1 receptors. Importantly, it was revealed
that endocannabinoids are involved in the rapid negative feedback
actions of glucocorticoids (GCs) in parvocellular neurons of the
hypothalamic paraventricular nuclei (PVN) containing CRH. GCs,
after binding to glucocorticoid (GR) receptors localized in the PVN,
activate the postsynaptic GPCRs. This leads to the synthesis and
release of endocannabinoids. These endocannabinoids act as retrograde
messengers to the CB1 receptors located at presynaptic glutamate
terminals and inhibit glutamate release [217]. These findings
thus provide a possible mechanism for the rapid feedback inhibition
of the hypothalamic pituitary adrenal axis by GCs. Moreover, the
CB1 receptors and endocannabinoids are found throughout all of
the extrahypothalamic sites that regulate PVN neuronal activation,
such as the hippocampus, prefrontal cortex, amygdala, bed nucleus
of the stria terminalis, and midbrain monoaminergic nuclei, such as
the locus coeruleus and dorsal raphe [218]. These brain regions are
the most likely sites of interaction between the endocannabinoid
system and other nervous systems [190, 219-221].
Once the CB ligands directly change the activity of the endocannabinoid
system or indirectly the activity of other neurotransmitters
and the HPA is changed, hormones start the signal transduction
towards the liver (Fig. 9). The regulation of liver CYP enzymes
by hormones involves binding the hormone to the nuclear receptor
and translocation of the ligand-receptor complex into the cell nucleus.
The expression of specific genes including CYP enzymes is
activated or inhibited. GH, GCs, and TSH are ligands of nuclear
receptors able to change the expression of CYP genes [222-224].
The influence of hormones on the transcription activity of CYP
genes is described at a glance in Table 6.
4.2. The Involvement of Peripheral Cannabinoid Receptors in
the CYP Regulation
When administered systemically, cannabinoids are able to
target both the regulation centers in the brain and the receptors in
peripheral tissues including the liver. Except for the direct
interaction with CYPs (see chapter 3.1.) there is a possibility of the
influence of cannabinoids on the receptors of target cells. The
receptor specificity of cannabinoids is broad due to their high
structure variability, therefore there are many receptors which
might be activated or inhibited with regard to the properties of the
ligand. Here we describe the evidence of interaction between
cannabinoids and peripheral receptors involved in the signal
pathways of CYP regulation and the role of these receptors in CYP
regulation.
The key ligand-activated transcriptional regulators of CYPs are
the pregnane X receptor (PXR), constitutive androstane receptor
(CAR), retinoid X receptors (RXRs), peroxisome proliferatoractivated
receptors (PPARs), glucocorticoid receptors (GRs), and
aryl hydrocarbon receptor (AhR) [222].
Briefly, PXR plays a key role in the regulation of the CYP2B6,
CYP2C, CYP2A6, CYP3A, and CYP4F12 genes [238-245]. Agonists
of PXR induce these CYP enzymes. In addition to the induction
of CYP enzymes, PXR activation also represses CYP7A1 expression
as a protective feedback in response to the accumulation of
bile acids in the liver [224, 246].
72
218 Current Drug Metabolism, 2016, Vol. 17, No. 3 Zendulka et al.
The activation of CAR is linked to the induction of CYP2B
[247]. There is signaling cross-talk between PXR and CAR. These
receptors control the expression of human CYP2A6 [238], CYP2B6
[248], CYP2C8/9 [230, 249], CYP2C19 [232], CYP3A4 [250],
CYP3A5 [251], and CYP3A7 [252].
AhR is not a true nuclear receptor; it belongs to a family of
transcription factors that contain the basic-helix-loop-helix and PerARNT-Sim
domains. AhR requires the AhR nuclear translocator as
its heterodimerization partner to be translocated into the nucleus
and turn on the CYP gene transcription. AhR triggers the expression
of CYP1A and CYP1B [222, 223].
The PPAR family currently has four members - PPAR ,
PPAR , PPAR , and PPAR - which differ in their localization
[253]. After activation by appropriate ligands, PPARs bind as
heterodimers with RXR (PPAR/RXR) to peroxisome proliferator
response elements. It has been shown that CYP2B, CYP3A, and
Table 6. Hormonal regulation of CYP genetic transcription [175, 193-195, 225-237].
GC T3 GH PRL
2A6b
1A1/2a
1A2 b
2C11a
2B6 b
2A1/2a
2A1a
2D1a
2B8 b
3A1/2a
2C7a
3A4a
2C8 b
3A4 b
2C12a
2C9 b
7A1 b
2C11a
2C19 b
2C19 b
3A4 b
2D1a
3A5 b
2E1a
3A1a
a
Data from preclinical experiments on rats. b
Data obtained from human cell lines.
Fig. (9). Endocannabinoid system and cannabinoids in the regulation of CYP activity.
73
Cannabinoids and Cytochrome P450 Interactions Current Drug Metabolism, 2016, Vol. 17, No. 3 219
CYP4A are activated by PPAR, and CYP2C11 is suppressed by the
PPAR agonist [254, 255].
CYP3A and CYP2B proteins are distinctly regulated by GRs
[256]. GRs may induce the expression of a gene that does not contain
GRE in its promoter. This is exerted by indirect “transregulation”.
Moreover, GRs contribute to functional cross-talk between
the PXR, CAR, AhR, and RXR signaling pathways [222,
226].
RXR is directly or indirectly involved in the regulation of many
enzymes and can be considered to be a limiting factor in the overall
regulation of hepatic gene expression patterns [253].
Some endocannabinoids, phytocannabinoids, and synthetic
cannabinoids are ligands of different PPARs and the AhR. An overview
of the selectivity of drugs to individual receptors is given in
Table 7.
5. CONCLUSION
Cannabinoids are a structurally and pharmacodynamically heterogeneous
group of drugs with great potential for therapeutic use
in the near future. The involvement of CYP in their metabolism is
clear and indisputable, whereas the clinical significance of their
drug-drug interactions has yet to be evaluated in detail. These interplays
may have various mechanisms from the direct interaction of
two substrates at the same enzyme, through different types of antagonism
with the CYP protein to the activation of various receptors
and changes in hormonal levels leading to an alteration in the
expression of CYP genes. The latter describes the suggested involvement
of the endocannabinoid system in the central regulation
of hepatic CYP activity. This hypothesis is based on indirect evidence,
and could be proved or refuted by further studies. Moreover,
we suggest that changes in liver CYP metabolic activity could be
time-dependent. Our idea is based on the signal transduction from
the brain to the liver via hormones which are under HPA control,
and a negative feedback mechanism plays a significant role here.
Therefore, the hormonal changes induced by drug administration
can be short-lived as well as the changes in CYP activity. To the
best of our knowledge, the factor of time was not studied in any of
the previous works focusing on the role of the central nervous system
in the regulation of liver CYP activity.
LIST OF ABBREVIATIONS
9
-THC = (-)-trans- 9
-tetrahydrocannabinol
2-AG = 2-arachidonoylglycerol
5-HT = 5-hydroxytryptamine, serotonin
AA = Arachidonic acid
ABHD = , -hydrolase domain
ACEA = Arachidonyl-2´-chloroethylamid
ACPA = Arachidonyl-cyclopropylamide
ACTH = Adrenocorticotropic hormone
AhR = Aryl hydrocarbon receptor
ARC = Arcuate nucleus
CAR = Constitutive androstane receptor
CBC = Cannabichromene
CBD = Cannabidiol
CBG = Cannabigerol
CBN = Cannabinol
CYP = Cytochrome P450
DA = Dopamine
diHETE = Dihydroxyeicosatrienoic acids
EET = Epoxyeicosatrienoic acids
EET-EA = Epoxyeicosatrienoic acid ethanolamide
EET-G = Epoxyeicosatrienylglycerol derivatives
FAAH = Fatty acid amide hydrolase
GABA = -aminobutiric acid
GCs = Glucocorticoids
GH = Growth hormone
GPCRs = G-protein coupled receptors
GRs = Glucocorticoid receptors
HEET-EA = 20-hydroxy-epoxyeicosatrienyl ethanolamide
HETE = Hydroxyeicosatrienoic acid
HETE-DA = Hydroxyeicosatetraenyl dopamine
HPA = Hypothalamic-pituitary axis
LH = Luteinizing hormone
NA = Noradrenaline
NADA = N-arachidonoyldopamine
PPARs = Peroxisome proliferator-activated receptors
PRL = Prolactin
PVN = Paraventricular nucleus
RXRs = Retinoid X receptors
SC = Synthetic cannabinoid
T3 = Triiodothyronine
T4 = Thyroxine
TSH = Thyroid-stimulating hormone
CONFLICT OF INTEREST
The authors confirm that this article content has no conflict of
interest.
ACKNOWLEDGEMENTS
Authors thanks for grant support from the projects
CZ.1.05/1.1.00/02.0068 and MUNI/A/1116/2014.
Table 7. Cannabinoid ligands of nuclear receptors [157, 159, 257, 258].
PPAR PPAR PPAR AhR
N-oleoylethanolamine AEA, 2-AG N-oleoylethanolamine 9
-THC
palmitoylethanolamide NADA, 9-THC CBD
virodhamine ajulemic acid
noladin ether CP 55,940, HU-210
WIN 55,212-2
74
220 Current Drug Metabolism, 2016, Vol. 17, No. 3 Zendulka et al.
REFERENCES
[1] Hasler, J.A.; Estabrook, R.M.M.; Pikuleva, I.; Waterman, M.;
Capdevila, J.; Holla, V.; Helvig, C.; Falck, J.R.; Farrell, G.; Kaminsky,
L.S.; Spivack, S.D.; Boitier, E.; Beaune, P. Human cytochromes
P450. Mol. Aspects Med., 1999, 20(1-2), 1-137.
[2] Anzenbacher, P.; Anzenbacherová, E. Cytochromes P450 and
metabolism of xenobiotics. Cell. Mol. Life Sci., 2001, 58(5-6), 737-
747.
[3] Zanger, U.M.; Schwab, M. Cytochrome P450 enzymes in drug
metabolism: regulation of gene expression, enzyme activities, and
impact of genetic variation. Pharmacol. Ther., 2013, 138(1), 103-
141.
[4] Zelasko, S.; Arnold, W.R.; Das, A. Endocannabinoid metabolism
by cytochrome P450 monooxygenases. Prostaglandins Other Lipid
Mediat., 2015, 116-117, 112-123.
[5] Ahmed, S.A.; Ross, S.A.; Slade, D.; Radwan, M.M.; Khan, I.A.;
ElSohly, M.A. Minor oxygenated cannabinoids from high potency
Cannabis sativa L. Phytochemistry, 2015, 117, 194-199.
[6] Pertwee, R.G. Handbook of cannabis, 1st ed.; Oxford University
Press: New York, 2014.
[7] Grotenhermen, F.; Müller-Vahl, K. The therapeutic potential of
cannabis and cannabinoids. Dtsch. Arztebl. Int., 2012, 109(29-30),
495-501.
[8] Alexander, S.P. Therapeutic potential of cannabis-related drugs.
Prog. Neuropsychopharmacol. Biol. Psychiatry, 2015, in press
available from: http://www.sciencedirect.com/science/article/pii/
S0278584615300105 (Accessed August 27, 2015).
[9] Dunstan, W.R.; Henry, T.A. On oxycannabin from Indian hemp.
Proc. Chem. Soc., 1898, 14, 44-45.
[10] Wood, T.B. Cannabinol, part I. J. Chem. Soc., 1899, 75, 20-36.
[11] Adams, R.; Hunt, M.; Clark, J. Structure of cannabidiol, a product
Isolated from the Marihuana Extract of Minnesota Wild Hemp. I. J.
Am. Chem. Soc., 1940, 62(1), 196-200.
[12] Gaoni, Y.; Mechoulam R. Isolation, structure, and partial synthesis
of an active constituent of hashish. J. Am. Chem. Soc., 1964, 86(8),
1646-1647.
[13] antav , F. Notes on the structure of cannabidiol compounds. Acta
Univ. Palacki. Olomuc. Fac. Med., 1964, 35, 5-9.
[14] Mechoulam, R.; Gaoni, Y. The absolute configuration of delta-1tetrahydrocannabinol,
the major active constituent of hashish. Tetrahedron
Lett., 1967, 12, 1109-1111.
[15] Devane, W.A.; Dysarz, F.A.; Johnson, M.R.; Melvin, L.S.;
Howlett, A.C. Determination and characterization of a cannabinoid
receptor in rat brain. Mol. Pharmacol., 1988, 34(5), 605-613.
[16] Munro, S.; Thomas, K.L.; Abu-Shaar, M. Molecular characterization
of a peripheral receptor for cannabinoids. Nature, 1993, 365,
61-65.
[17] Di Marzo, V.; Stella, N.; Zimmer, A.; Endocannabinoid signalling
and the deteriorating brain. Nat. Rev. Neurosci., 2015, 16(1), 30-42.
[18] Matsuda, L.A.; Lolait, S.J.; Brownstein, M.J.; Young, A.C.; Bonner,
T.I. Structure of a cannabinoid receptor and functional expression
of the cloned cDNA. Nature, 1990, 346(6284), 561-564.
[19] Devane, W.A.; Hanus, L.; Breuer, A.; Pertwee, R.G.; Stevenson,
L.A.; Griffin, G.; Gibson, D.; Mandelbaum, A.; Etinger, A.; Mechoulam,
R. Isolation and structure of a brain constituent that binds to
the cannabinoid receptor. Science, 1992, 258(5090), 1946-1949.
[20] Mechoulam, R.; Ben-Shabat, S.; Hanus, L.; Ligumsky, M.; Kaminski,
N.E.; Schatz, A.R.; Gopher, A.; Almog, S.; Martin, B.R.;
Compton, D.R. Identification of an endogenous 2-monoglyceride,
present in canine gut, that binds to cannabinoid receptors. Biochem.
Pharmacol., 1995, 50(1), 83-90.
[21] Sugiura, T.; Kondo, S.; Sukagawa, A.; Nakane, S.; Shinoda, A.;
Itoh, K.; Yamashita, A.; Waku, K. 2-Arachidonoylglycerol: a possible
endogenous cannabinoid receptor ligand in brain. Biochem.
Biophys. Res. Commun., 1995, 215(1), 89-97.
[22] Bouaboula, M.; Hilairet, S.; Marchand, J.; Fajas, L.; Le Fur, G.;
Casellas, P. Anandamide induced PPARgamma transcriptional activation
and 3T3-L1 preadipocyte differentiation. Eur. J. Pharmacol.,
2005, 517(3), 174-181.
[23] O'Sullivan, S.E.; Kendall, D.A. Cannabinoid activation of peroxisome
proliferator-activated receptors: potential for modulation of
inflammatory disease. Immunobiology, 2010, 215(8), 611-616.
[24] Zygmunt, P.M.; Petersson, J.; Andersson, D.A; Chuang, H.; Sørgård,
M.; Di Marzo, V.; Julius, D.; Högestätt, E.D. Vanilloid receptors
on sensory nerves mediate the vasodilator action of anandamide.
Nature, 1999, 400(6743), 452-457.
[25] Pacher, P.; Bátkai, S.; Kunos, G. Haemodynamic profile and responsiveness
to anandamide of TRPV1 receptor knock-out mice. J.
Physiol., 2004, 558(Pt2), 647-657.
[26] Overton, H.A.; Babbs, A.J.; Doel, S.M.; Fyfe, M.C.; Gardner, L.S.;
Griffin, G.; Jackson, H.C.; Procter, M.J.; Rasamison, C.M.; TangChristensen,
M.; Widdowson, P.S.; Williams, G.M.; Reynet, C.
Deorphanization of a G protein-coupled receptor for oleoylethanolamide
and its use in the discovery of small-molecule hypophagic
agents. Cell. Metab., 2006, 3(3), 167-175.
[27] Ryberg, E.; Larsson, N.; Sjögren, S.; Hjorth, S.; Hermansson, N.O.;
Leonova, J.; Elebring, T.; Nilsson, K.; Drmota, T.; Greasley, P.J.
The orphan receptor GPR55 is a novel cannabinoid receptor. Br. J.
Pharmacol., 2007, 152(7), 1092-1101.
[28] De Petrocellis, L.; Di Marzo, V. Non-CB1, non-CB2 receptors for
endocannabinoids, plant cannabinoids, and synthetic cannabimimetics:
focus on G-protein-coupled receptors and transient
receptor potential channels. J. Neuroimmune Pharmacol., 2010,
5(1), 103-121.
[29] Pertwee, R.G.; Howlett, A.C.; Abood, M.E.; Alexander, S.P.; Di
Marzo, V.; Elphick, M.R.; Greasley, P.J.; Hansen, H.S.; Kunos, G.;
Mackie, K.; Mechoulam, R.; Ross, R.A. International Union of Basic
and Clinical Pharmacology. LXXIX. Cannabinoid receptors and
their ligands: beyond CB1 and CB2. Pharmacol. Rev., 2010, 62(4),
588-631.
[30] Demuth, D.G.; Molleman, A. Cannabinoid signalling. Life Sci.,
2006, 78(6), 549-563.
[31] Kleberg, K.; Hassing, H.A.; Hansen, H.S. Classical endocannabinoid-like
compounds and their regulation by nutrients. Biofactors,
2014, 40(4), 363-372.
[32] Zhang, X.; Maor, Y.; Wang, J.F.; Kunos, G.; Groopman, J.E. Endocannabinoid-like
N-arachidonoyl serine is a novel proangiogenic
mediator. Br. J. Pharmacol., 2010, 160(7), 1583-1594.
[33] Giuffrida, A.; McMahon, L.R. In vivo pharmacology of endocannabinoids
and their metabolic inhibitors: therapeutic implications in
Parkinson's disease and abuse liability. Prostaglandins Other Lipid
Mediat., 2010, 91(3-4), 90-103.
[34] Di Marzo, V.; Deutsch, D.G. Biochemistry of the endogenous
ligands of cannabinoid receptors. Neurobiol. Dis., 1998, 5(6PtB),
386-404.
[35] Fonseca, B.M.; Costa, M.A.; Almada, M.; Correia-da-Silva, G.;
Teixeira, N.A. Endogenous cannabinoids revisited: a biochemistry
perspective. Prostaglandins Other Lipid Mediat., 2013, 102-103,
13-30.
[36] Tan, B.; Bradshaw, H.B.; Rimmerman, N.; Srinivasan, H.; Yu,
Y.W.; Krey, J.F.; Monn, M.F.; Chen, J.S.; Hu, S.S.; Pickens, S.R.;
Walker, J.M. Targeted lipidomics: discovery of new fatty acyl amides.
AAPS J., 2006, 8(3), E461-E465.
[37] Fezza, F.; Bari, M.; Florio, R.; Talamonti, E.; Feole, M.; Maccarrone,
M. Endocannabinoids, related compounds and their metabolic
routes. Molecules, 2014, 19(11), 17078-17106.
[38] Snider, N.T.; Walker, V.J.; Hollenberg, P.F. Oxidation of the endogenous
cannabinoid arachidonoyl ethanolamide by the cytochrome
P450 monooxygenases: physiological and pharmacological
implications. Pharmacol. Rev., 2010, 62(1), 136-154.
[39] Hillard, C.J.; Wilkison, D.M.; Edgemond, W.S.; Campbell, W.B.
Characterization of the kinetics and distribution of Narachidonylethanolamine
(anandamide) hydrolysis by rat brain.
Biochim. Biophys. Acta, 1995, 1257(3), 249-256.
[40] Sugiura, T.; Kobayashi, Y.; Oka, S.; Waku, K. Biosynthesis and
degradation of anandamide and 2-arachidonoylglycerol and their
possible physiological significance. Prostaglandins Leukot. Essent.
Fatty Acids, 2002, 66(2-3), 173-192.
[41] Ueda, N.; Tsuboi, K. Enzymes involved in the biosynthesis and
degradation of anandamide. Seikagaku, 2005, 77(12), 1505-1509.
[42] Roman R.J. P-450 metabolites of arachidonic acid in the control of
cardiovascular function. Physiol. Rev., 2002, 82(1), 131-185.
[43] Bylund, J.; Ericsson, J.; Oliw, E.H. Analysis of cytochrome P450
metabolites of arachidonic and linoleic acids by liquid chromatography-mass
spectrometry with ion trap MS. Anal. Biochem., 1998,
265(1), 55-68.
[44] Rifkind, A.B.; Lee, C.; Chang, T.K.; Waxman, D.J. Arachidonic
acid metabolism by human cytochrome P450s 2C8, 2C9, 2E1, and
75
Cannabinoids and Cytochrome P450 Interactions Current Drug Metabolism, 2016, Vol. 17, No. 3 221
1A2: regioselective oxygenation and evidence for a role for
CYP2C enzymes in arachidonic acid epoxygenation in human liver
microsomes. Arch. Biochem. Biophys., 1995, 320(2), 380-389.
[45] Laethem, R.M.; Balazy, M.; Falck, J.R.; Laethem, C.L.; Koop,
D.R. Formation of 19(S)-, 19(R)-, and 18(R)hydroxyeicosatetraenoic
acids by alcohol-inducible cytochrome
P450 2E1. J. Biol. Chem., 1993, 268(17), 12912-12918.
[46] Yu, M.; Ives, D.; Ramesha, C.S. Synthesis of prostaglandin E2
ethanolamide from anandamide by cyclooxygenase-2. J. Biol.
Chem., 1997, 272(34), 21181-21186.
[47] Kozak, K.R.; Crews, B.C.; Morrow, J.D.; Wang, L.H.; Ma, Y.H.;
Weinander, R.; Jakobsson, P.J.; Marnett, L.J. Metabolism of the
endocannabinoids, 2-arachidonylglycerol and anandamide, into
prostaglandin, thromboxane, and prostacyclin glycerol esters and
ethanolamides. J. Biol. Chem., 2002, 277(47), 44877-44885.
[48] Hampson, A.J.; Hill, W.A.; Zan-Phillips, M.; Makriyannis, A.;
Leung, E.; Eglen, R.M.; Bornheim, L.M. Anandamide hydroxylation
by brain lipoxygenase:metabolite structures and potencies at
the cannabinoid receptor. Biochim. Biophys. Acta, 1995, 1259(2),
173-179.
[49] Bornheim, L.M.; Kim, K.Y.; Chen, B.; Correia, M.A. Microsomal
cytochrome P450-mediated liver and brain anandamide metabolism.
Biochem. Pharmacol., 1995, 50(5), 677-686.
[50] Costa, B.; Parolaro, D.; Colleoni, M. Chronic treatment with the
endocannabinoid anandamide increases cytochrome P450 metabolizing
system in the rat. Eur. J. Pharmacol., 2002, 449(1-2), 61-69.
[51] Snider, N.T.; Kornilov, A.M.; Kent, U.M.; Hollenberg, P.F. Anandamide
metabolism by human liver and kidney microsomal cytochrome
p450 enzymes to form hydroxyeicosatetraenoic and epoxyeicosatrienoic
acid ethanolamides. J. Pharmacol. Exp. Ther.,
2007, 321(2), 590-597.
[52] Yu, Z.; Xu, F.; Huse, L.M.; Morisseau, C.; Draper, A.J.; Newman,
J.W.; Parker, C.; Graham, L.; Engler, M.M.; Hammock, B.D.;
Zeldin, D.C.; Kroetz, D.L. Soluble epoxide hydrolase regulates hydrolysis
of vasoactive epoxyeicosatrienoic acids. Circ. Res., 2000,
87(11), 992-998.
[53] Snider, N.T.; Sikora, M.J.; Sridar, C.; Feuerstein, T.J.; Rae, J.M.;
Hollenberg, P.F. The endocannabinoid anandamide is a substrate
for the human polymorphic cytochrome P450 2D6. J. Pharmacol.
Exp. Ther., 2008, 327(2), 538-545.
[54] Stark, K.; Dostalek, M.; Guengerich, F.P. Expression and purification
of orphan cytochrome P450 4X1 and oxidation of anandamide.
FEBS J., 2008, 275(14), 3706-3717.
[55] Navia-Paldanius, D.; Savinainen, J.R.; Laitinen, J.T. Biochemical
and pharmacological characterization of human / -hydrolase domain
containing 6 (ABHD6) and 12 (ABHD12). J. Lipid. Res.,
2012, 53(11), 2413-2424.
[56] Chen, J.; Chen, J.K.; Falck, J.R.; Guthi, J.S.; Anjaiah, S.; Capdevila,
J.H.; Harris R.C. Mitogenic activity and signaling mechanism
of 2-(14,15- epoxyeicosatrienoyl)glycerol, a novel cytochrome
p450 arachidonate metabolite. Mol. Cell. Biol., 2007,
27(8), 3023-3034.
[57] Chen, J.K.; Chen, J.; Imig, J.D.; Wei, S.; Hachey, D.L.; Guthi, J.S.;
Falck, J.R.; Capdevila, J.H.; Harris, R.C. Identification of novel
endogenous cytochrome p450 arachidonate metabolites with high
affinity for cannabinoid receptors. J. Biol. Chem., 2008, 283(36),
24514-24524.
[58] McDougle, D.R.; Kambalyal, A.; Meling, D.D.; Das, A. Endocannabinoids
anandamide and 2-arachidonoylglycerol are substrates
for human CYP2J2 epoxygenase. J. Pharmacol. Exp. Ther., 2014,
351(3), 616-627.
[59] Awumey, E.M.; Hill, S.K.; Diz, D.I.; Bukoski, R.D. Cytochrome P-
450 metabolites of 2-arachidonoylglycerol play a role in Ca2+induced
relaxation of rat mesenteric arteries. Am. J. Physiol. Heart
Circ. Physiol., 2008, 294(5), H2363-H2370.
[60] Manzanares, J.; Julian, M.; Carrascosa, A. Role of the cannabinoid
system in pain control and therapeutic implications for the management
of acute and chronic pain episodes. Curr. Neuropharmacol.,
2006, 4(3), 239-257.
[61] Rimmerman, N.; Bradshaw, H.B.; Basnet, A.; Tan, B.; Widlanski,
T.S.; Walker, J.M. Microsomal omega-hydroxylated metabolites of
N-arachidonoyl dopamine are active at recombinant human TRPV1
receptors. Prostaglandins Other Lipid Mediat., 2009, 88(1-2), 10-
17.
[62] Fowler, C.J. The potential of inhibitors of endocannabinoid metabolism
as anxiolytic and antidepressive drugs--A practical view.
Eur. Neuropsychopharmacol., 2015, 25(6), 749-762.
[63] Huggins, J.P.; Smart, T.S.; Langman, S.; Taylor, L.; Young, T. An
efficient randomised, placebo-controlled clinical trial with the irreversible
fatty acid amide hydrolase-1 inhibitor PF-04457845, which
modulates endocannabinoids but fails to induce effective analgesia
in patients with pain due to osteoarthritis of the knee. Pain, 2012,
153(9), 1837-1846.
[64] Fisar, Z. Phytocannabinoids and endocannabinoids. Curr. Drug
Abuse Rev., 2009, 2(1), 51-75.
[65] Stout, S.M.; Cimino, N.M. Exogenous cannabinoids as substrates,
inhibitors, and inducers of human drug metabolizing enzymes: a
systematic review. Drug Metab. Rev., 2014, 46(1), 86-95.
[66] ElSohly, M.A.; Slade, D. Chemical constituents of marijuana: the
complex mixture of natural cannabinoids. Life Sci., 2005, 78(5),
539-548.
[67] Agurell, S.; Halldin, M.; Lindgren, J.E.; Ohlsson, A.; Widman, M.;
Gillespie, H.; Hollister, L. Pharmacokinetics and metabolism of
delta 1-tetrahydrocannabinol and other cannabinoids with emphasis
on man. Pharmacol. Rev., 1986, 38(1), 21-43.
[68] Nilsson, I.M.; Agurell, S.; Nilsson, J.L.; Ohlsson, A.; Sandberg, F.;
Wahlqvist, M. Delta-1-tetrahydrocannabinol: structure of a major
metabolite. Science, 1970, 168(3936), 1228-1229.
[69] Watanabe, K.; Yamaori, S.; Funahashi, T.; Kimura, T.; Yamamoto,
I. Cytochrome P450 enzymes involved in the metabolism of tetrahydrocannabinols
and cannabinol by human hepatic microsomes.
Life Sci., 2007, 80(15), 1415-1419.
[70] Yamamoto, I.; Watanabe, K.; Matsunaga, T.; Kimura, T.; Funahashi,
T.; Yoshimura, H. Pharmacology and toxicology of major constituents
of marijuana - on the metabolic activation of cannabinoids
and its mechanism. J. Toxicol. Toxin. Rev., 2003, 22(4), 577-589.
[71] Kuzuoka, K.; Watanabe, K.; Matsunaga, T.; Yamamoto, I.; Yoshimura,
H. Characterisation of mouse hepatic microsomal enzyme
that catalyzes oxidation of cannabinol at the 11-position. Jpn. J.
Toxicol. Env. Health, 1992, 38(4), 349-354.
[72] Harvey, D.J.; Samara, E.; Mechoulam, R. Urinary metabolites of
cannabidiol in dog, rat and man and their identification by gas
chromatography-mass spectrometry. J. Chromatogr., 1991, 562(1-
2), 299-322.
[73] Jiang, R.; Yamaori, S.; Takeda, S.; Yamamoto, I.; Watanabe, K.
Identification of cytochrome P450 enzymes responsible for metabolism
of cannabidiol by human liver microsomes. Life Sci.,
2011, 89(5-6), 165-170.
[74] Harvey, D.J.; Brown, N.K. Comparative in vitro metabolism of the
cannabinoids. Pharmacol. Biochem. Behav., 1991, 40(3), 533-540.
[75] Gunderson, E.W.; Haughey, H.M.; Ait-Daoud, N.; Joshi, A.S.;
Hart, C.L. "Spice" and "K2" herbal highs: a case series and systematic
review of the clinical effects and biopsychosocial implications
of synthetic cannabinoid use in humans. Am. J. Addict., 2012,
21(4), 320-326.
[76] Marinol®, AbbVie Inc., Prescribing information. Available from:
http://www.rxabbvie.com/pdf/marinol_PI.pdf (Accessed August
15, 2015).
[77] Van Gaal, L.F.; Rissanen, A.M.; Scheen, A.J.; Ziegler, O.; Rössner,
S.; Group R-ES. Effects of the cannabinoid-1 receptor blocker rimonabant
on weight reduction and cardiovascular risk factors in
overweight patients: 1-year experience from the RIO-Europe study.
Lancet, 2005, 365(9468), 1389-1397.
[78] Christensen, R.; Kristensen, P.K.; Bartels, E.M.; Bliddal, H.; Astrup,
A. Efficacy and safety of the weight-loss drug rimonabant: a
meta-analysis of randomised trials. Lancet, 2007, 370(9600), 1706-
1713.
[79] Acomplia®, Sanofi-Aventis. Summary of Product Characteristics.
Available from: http://www.sanofi-aventis.co.uk/products/Acomplia_SPC.pdf
(Accessed August 15, 2015).
[80] Lexicomp Online®. Lexi-Drugs®: Hudson, Ohio: Lexi-Comp, Inc.
Available from: http://online.lexi.com/ (Accessed August 15,
2015).
[82] Kim, U.; Jin, M.J.; Lee, J.; Han, S.B.; In, M.K.; Yoo, H.H. Tentative
identification of phase I metabolites of HU-210, a classical
synthetic cannabinoid, by LC-MS/MS. J. Pharm. Biomed. Anal.,
2012, 64-65, 26-34.
[83] Thomas, B.F.; Martin, B.R. In vitro metabolism of (-)-cis-3-[2hydroxy-4-(1,1-dimethylheptyl)
phenyl]-trans-4-(3-hydroxypropyl)
76
222 Current Drug Metabolism, 2016, Vol. 17, No. 3 Zendulka et al.
cyclohexanol, a synthetic bicyclic cannabinoid analog. Drug Metab.
Dispos., 1990, 18(6), 1046-1054.
[84] Pertwee, R. Cannabinoid Receptor Ligands, Tocris Bioscience
Scientific Review Series No. 27. Available from: http://www. toc-
ris.com/pdfs/pdf_downloads/Cannabinoid_Receptor_Ligands_Revi
ew.pdf (Accessed August 15, 2015).
[85] Zhang, Q.; Ma, P.; Iszard, M.; Cole, R.B.; Wang, W.; Wang, G. In
vitro metabolism of R(+)-[2,3-dihydro-5-methyl-3[(morpholinyl)methyl]pyrrolo
[1,2,3-de]1,4-benzoxazinyl]-(1naphthalenyl)
methanone mesylate, a cannabinoid receptor agonist.
Drug Metab. Dispos., 2002, 30(10), 1077-1086.
[86] Hillard, C.J.; Manna, S.; Greenberg, M.J.; DiCamelli, R.; Ross,
R.A.; Stevenson, L.A.; Murphy, V.; Pertwee, R.G.; Campbell,
W.B. Synthesis and characterization of potent and selective agonists
of the neuronal cannabinoid receptor (CB1). J. Pharmacol.
Exp. Ther., 1999, 289(3), 1427-1433.
[87] Pertwee, R.G. The pharmacology of cannabinoid receptors and
their ligands: an overview. Int. J. Obes. (Lond), 2006, 30, Suppl 1,
S13-18.
[88] Mazzarino, M.; de la Torre, X.; Botrè, F. A liquid chromatographymass
spectrometry method based on class characteristic fragmentation
pathways to detect the class of indole-derivative synthetic cannabinoids
in biological samples. Anal. Chim. Acta, 2014, 837, 70-
82.
[89] Zhang, Q.; Ma, P.; Cole, R.B.; Wang, G. Identification of in vitro
metabolites of JWH-015, an aminoalkylindole agonist for the peripheral
cannabinoid receptor (CB2) by HPLC-MS/MS. Anal.
Bioanal. Chem., 2006, 386(5), 1345-1355.
[90] European Monitoring Centre for Drugs and Drug Addiction (EMCDDA).
New psychoactive substances in Europe - An update from
the EU Early Warning System (March 2015), Publications Office
of the European Union: Luxembourg, 2015.
[91] European Monitoring Centre for Drugs and Drug Addiction (EMCDDA).
Synthetic cannabinoids in Europe, Publications Office of
the European Union: Luxembourg, 2015.
[92] Strano-Rossi, S.; Anzillotti, L.; Dragoni, S.; Pellegrino, R.M.;
Goracci, L.; Pascali, V.L.; Cruciani, G. Metabolism of JWH-015,
JWH-098, JWH-251, and JWH-307 in silico and in vitro: a pilot
study for the detection of unknown synthetic cannabinoids metabolites.
Anal. Bioanal. Chem., 2014, 406(15), 3621-3636.
[93] Castaneto, M.S.; Gorelick, D.A.; Desrosiers, N.A.; Hartman, R.L.;
Pirard, S.; Huestis, M.A. Synthetic cannabinoids: epidemiology,
pharmacodynamics, and clinical implications. Drug Alcohol Depend.,
2014, 144, 12-41.
[94] Erratico, C.; Negreira, N.; Norouzizadeh, H.; Covaci, A.; Neels, H.;
Maudens, K.; van Nuijs, A.L. In vitro and in vivo human metabolism
of the synthetic cannabinoid AB-CHMINACA. Drug Test.
Anal., 2015, in press. Available from:
http://onlinelibrary.wiley.com/doi/
10.1002/dta.1796/abstract;jsessionid=7D79BC8B2D2E563E8A96F
95046AE07DE.f01t02 (Accessed August 27, 2015).
[95] Takayama, T.; Suzuki, M.; Todoroki, K.; Inoue, K.; Min, J.Z.;
Kikura-Hanajiri, R.; Goda, Y.; Toyo’oka, T. UPLC/ESI-MS/MSbased
determination of metabolism of several new illicit drugs,
ADB-FUBINACA, AB-FUBINACA, AB-PINACA, QUPIC, 5FQUPIC
and -PVT, by human liver microsome. Biomed. Chromatogr.,
2014, 28(6), 831-838.
[96] Thomsen, R.; Nielsen, L.M.; Holm, N.B.; Rasmussen, H.B.; Linnet,
K.; Consortium, I. Synthetic cannabimimetic agents metabolized
by carboxylesterases. Drug Test. Anal., 2015, 7(7), 565-576.
[97] Castaneto, M.; Wohlfarth, A.; Pang, S.; Zhu, M.; Scheidweiler, K.;
Kronstrand, R.; Huestis, M. Identification of AB-FUBINACA metabolites
in human hepatocytes and urine using high-resolution
mass spectrometry. Forensic Toxicol., 2015, 33(2), 295-310.
[98] Wohlfarth, A.; Castaneto, M.S.; Zhu, M.; Pang, S.; Scheidweiler,
K.B.; Kronstrand, R.; Huestis, M.A. Pentylindole/Pentylindazole
Synthetic Cannabinoids and Their 5-Fluoro Analogs Produce Different
Primary Metabolites: Metabolite Profiling for AB-PINACA
and 5F-AB-PINACA. AAPS J., 2015, 17(3), 660-677.
[99] Gandhi, A.S.; Zhu, M.; Pang, S.; Wohlfarth, A.; Scheidweiler,
K.B.; Liu, H.F.; Huestis, M.A. First characterization of AKB-48
metabolism, a novel synthetic cannabinoid, using human hepatocytes
and high-resolution mass spectrometry. AAPS J., 2013, 15(4),
1091-1098.
[100] Holm, N.B.; Nielsen, L.M.; Linnet, K. CYP3A4 Mediates Oxidative
Metabolism of the Synthetic Cannabinoid AKB-48. AAPS J.,
2015, 17(5), 1237-1245.
[101] Chimalakonda, K.C.; Seely, K.A.; Bratton, S.M.; Brents, L.K.;
Moran, C.L.; Endres, G.W.; James, L.P.; Hollenberg, P.F.; Prather,
P.L.; Radomiska-Pandya, A.; Moran, J.H. Cytochrome P450mediated
oxidative metabolism of abused synthetic cannabinoids
found in K2/Spice: identification of novel cannabinoid receptor
ligands. Drug Metab. Dispos., 2012, 40(11), 2174-2184.
[102] Sobolevsky, T.; Prasolov, I.; Rodchenkov, G. Detection of urinary
metabolites of AM-2201 and UR-144, two novel synthetic cannabinoids.
Drug Test. Anal., 2012, 4(10), 745-753.
[103] Sobolevsky, T.; Prasolov, I.; Rodchenkov, G. Study on the phase I
metabolism of novel synthetic cannabinoids, APICA and its fluorinated
analogue. Drug Test. Anal., 2015, 7(4), 131-142.
[104] Jin, M.J.; Lee, J.; In, M.K.; Yoo, H.H. Characterization of in vitro
metabolites of CP 47,497, a synthetic cannabinoid, in human liver
microsomes by LC-MS/MS. J. Forensic Sci., 2013, 58(1), 195-199.
[105] Wintermeyer, A.; Möller, I.; Thevis, M.; Jübner, M.; Beike, J.;
Rothschild, M.A.; Bender, K. In vitro phase I metabolism of the
synthetic cannabimimetic JWH-018. Anal. Bioanal. Chem., 2010,
398(5), 2141-2153.
[106] ElSohly, M.A.; Gul, W.; ElSohly, K.M.; Murphy, T.P.; Madgula,
V.L.; Khan, S.I. Liquid chromatography-tandem mass spectrometry
analysis of urine specimens for K2 (JWH-018) metabolites. J. Anal.
Toxicol., 2011, 35(7), 487-495.
[107] Chimalakonda, K.C.; Bratton, S.M.; Le, V.H.; Yiew, K.H.; Dineva,
A.; Moran, C.L.; James, L.P.; Moran, J.H.; Radominska-Pandya, A.
Conjugation of synthetic cannabinoids JWH-018 and JWH-073,
metabolites by human UDP-glucuronosyltransferases. Drug Metab.
Dispos., 2011, 39(10), 1967-1976.
[108] Gambaro, V.; Arnoldi, S.; Bellucci, S.; Casagni, E.; Dell'Acqua, L.;
Fumagalli, L.; Pallavicini, M.; Roda, G.; Rusconi, C.; Valoti, E.
Characterization of in vitro metabolites of JWH-018, JWH-073 and
their 4-methyl derivatives, markers of the abuse of these synthetic
cannabinoids. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci.,
2014, 957, 68-76.
[109] De Brabanter, N.; Esposito, S.; Tudela, E.; Lootens, L.; Meuleman,
P.; Leroux-Roels, G.; Deventer, K.; Van Eenoo, P. In vivo and in
vitro metabolism of the synthetic cannabinoid JWH-200. Rapid
Commun. Mass. Spectrom., 2013, 27(18), 2115-2126.
[110] Jang, M.; Shin, I.; Yang, W.; Chang, H.; Yoo, H.H.; Lee, J.; Kim,
E. Determination of major metabolites of MAM-2201 and JWH-
122 in in vitro and in vivo studies to distinguish their intake. Forensic
Sci. Int., 2014, 244, 85-91.
[111] Wohlfarth, A.; Gandhi, A.S.; Pang, S.; Zhu, M.; Scheidweiler,
K.B.; Huestis, M.A. Metabolism of synthetic cannabinoids PB-22
and its 5-fluoro analog, 5F-PB-22, by human hepatocyte incubation
and high-resolution mass spectrometry. Anal. Bioanal. Chem.,
2014, 406(6), 1763-1780.
[112] Gandhi, A.S.; Zhu, M.; Pang, S.; Wohlfarth, A.; Scheidweiler,
K.B.; Huestis, M.A. Metabolite profiling of RCS-4, a novel synthetic
cannabinoid designer drug, using human hepatocyte metabolism
and TOF-MS. Bioanalysis, 2014, 6(11), 1471-1485.
[113] Wohlfarth, A.; Pang, S.; Zhu, M.; Gandhi, A.S.; Scheidweiler,
K.B.; Huestis, M.A. Metabolism of RCS-8, a synthetic cannabinoid
with cyclohexyl structure, in human hepatocytes by high-resolution
MS. Bioanalysis, 2014, 6(9), 1187-1200.
[114] Gandhi, A.S.; Wohlfarth, A.; Zhu, M.; Pang, S.; Castaneto, M.;
Scheidweiler, K.B.; Huestis, M.A. High-resolution mass spectrometric
metabolite profiling of a novel synthetic designer drug, N-
(adamantan-1-yl)-1-(5-fluoropentyl)-1H-indole-3-carboxamide
(STS-135), using cryopreserved human hepatocytes and assessment
of metabolic stability with human liver microsomes. Drug Test.
Anal., 2015, 7(3), 187-198.
[115] Wohlfarth, A.; Pang, S.; Zhu, M.; Gandhi, A.S.; Scheidweiler,
K.B.; Liu, H.F.; Huestis, M.A. First metabolic profile of XLR-11, a
novel synthetic cannabinoid, obtained by using human hepatocytes
and high-resolution mass spectrometry. Clin. Chem., 2013, 59(11),
1638-1648.
[116] Chimalakonda, K.C.; James, L.P.; Radominska-Pandya, A.; Moran,
J.H. Sulfaphenazole and -naphthoflavone attenuate the metabolism
of the synthetic cannabinoids JWH-018 and AM2201 found in
K2/spice. Drug Metab. Lett., 2013, 7(1), 34-38.
77
Cannabinoids and Cytochrome P450 Interactions Current Drug Metabolism, 2016, Vol. 17, No. 3 223
[117] Liu, J.; Tawa, G.J.; Wallqvist, A. Identifying cytochrome p450
functional networks and their allosteric regulatory elements. PLoS
One, 2013, 8(12), e81980.
[118] Sun, L.J.; Yu, J.W.; Wan, L.; Zhang, X.Y.; Shi, Y.G.; Chen, M.Y.
Endocannabinoid system activation contributes to glucose metabolism
disorders of hepatocytes and promotes hepatitis C virus replication.
Int. J. Infect. Dis., 2014, 23, 75-81.
[119] Masoodi, M.; Kuda, O.; Rossmeisl, M.; Flachs, P.; Kopecky, J.
Lipid signaling in adipose tissue: Connecting inflammation & metabolism.
Biochim. Biophy.s Acta, 2015, 1851(4) 503-518.
[120] Bergström, M.A.; Isin, E.M.; Castagnoli, N.; Milne, C.E. Bioactivation
pathways of the cannabinoid receptor 1 antagonist rimonabant.
Drug Metab. Dispos., 2011, 39(10), 1823-1832.
[121] Wustrow, D.J.; Maynard, G.D.; Yuan, J.; Zhao, H.; Mao, J.; Guo,
Q.; Kershaw, M.; Hammer, J.; Brodbeck, R.M.; Near, K.E.; Zhou,
D.; Beers, D.S.; Chenard, B.L.; Krause, J.E; Hutchinson, A.J.
Aminopyrazine CB1 receptor inverse agonists. Bioorg. Med. Chem.
Lett., 2008, 18(11), 3376-3381.
[122] Alonso, M.; Serrano, A.; Vida, M.; Crespillo, A.; HernandezFolgado,
L.; Jagerovic, N.; Goya, P.; Reyes-Cabello, C.; PeresValero,
V.; Decara, J.; Macías-González, M.; Bermúndez-Silva,
F.J.; Suárez, J.; Rodríguey se Fonseca, F.; Pavón, F.J. Anti-obesity
efficacy of LH-21, a cannabinoid CB(1) receptor antagonist with
poor brain penetration, in diet-induced obese rats. Br. J. Pharmacol.,
2012, 165(7), 2274-2291.
[123] Ashino, T.; Hakukawa, K.; Itoh, Y.; Numazawa, S. Inhibitory
effect of synthetic cannabinoids on CYP1A activity in mouse liver
microsomes. J. Toxicol. Sci., 2014, 39(6), 815-820.
[124] Yamaori, S.; Kushihara, M.; Yamamoto, I.; Watanabe, K. Characterization
of major phytocannabinoids, cannabidiol and cannabinol,
as isoform-selective and potent inhibitors of human CYP1 enzymes.
Biochem. Pharmacol., 2010, 79(11), 1691-1698.
[125] Yamaori, S.; Okushima, Y.; Masuda, K.; Kushihara, M.; Katsu, T.;
Narimatsu, S.; Yamamoto, I.; Watanabe, K. Structural requirements
for potent direct inhibition of human cytochrome P450 1A1
by cannabidiol: role of pentylresorcinol moiety. Biol. Pharm. Bull.,
2013, 36(7), 1197-1203.
[126] Yamaori, S.; Okushima, Y.; Yamamoto, I.; Watanabe, K. Characterization
of the structural determinants required for potent mechanism-based
inhibition of human cytochrome P450 1A1 by cannabidiol.
Chem. Biol. Interact., 2014, 215, 62-68.
[127] Yamaori, S.; Maeda, C.; Yamamoto, I.; Watanabe, K. Differential
inhibition of human cytochrome P450 2A6 and 2B6 by major phytocannabinoids.
Forensic Toxicol., 2011, 29(2), 117-124.
[128] Yamaori, S.; Koeda, K.; Kushihara, M.; Hada, Y.; Yamamoto, I.;
Watanabe, K. Comparison in the in vitro inhibitory effects of major
phytocannabinoids and polycyclic aromatic hydrocarbons contained
in marijuana smoke on cytochrome P450 2C9 activity. Drug
Metab. Pharmacokinet., 2012, 27(3), 294-300.
[129] Narimatsu, S.; Watanabe, K.; Yamamoto, I.; Yoshimura, H.
Mechanism for inhibitory effect of cannabidiol on microsomal testosterone
oxidation in male rat liver. Drug Metab. Dispos., 1988,
16(6), 880-889.
[130] Yan, J.; He, X.; Feng, S.; Zhai, Y.; Ma, Y.; Liang, S.; Jin, C. Upregulation
on cytochromes P450 in rat mediated by total alkaloid
extract from Corydalis yanhusuo. BMC Complement Altern. Med.,
2014, 14, 306.
[131] Jiang, R.; Yamaori, S.; Okamoto, Y.; Yamamoto, I.; Watanabe, K.
Cannabidiol is a potent inhibitor of the catalytic activity of cytochrome
P450 2C19. Drug Metab. Pharmacokinet., 2013, 28(4),
332-338.
[132] Yamaori, S.; Okamoto, Y.; Yamamoto, I.; Watanabe, K. Cannabidiol,
a major phytocannabinoid, as a potent atypical inhibitor
for CYP2D6. Drug Metab. Dispos., 2011, 39(11), 2049-2056.
[133] Yamaori, S.; Ebisawa, J.; Okushima, Y.; Yamamoto, I.; Watanabe,
K. Potent inhibition of human cytochrome P450 3A isoforms by
cannabidiol: role of phenolic hydroxyl groups in the resorcinol
moiety. Life Sci., 2011, 88(15-16), 730-736.
[134] Jaeger, W.; Benet, L.Z.; Bornheim, L.M. Inhibition of cyclosporine
and tetrahydrocannabinol metabolism by cannabidiol in mouse and
human microsomes. Xenobiotica, 1996, 26(3), 275-284.
[135] Funahashi, T.; Ikeuchi, H.; Yamaori, S.; Kimura, T.; Yamamoto, I.;
Watanabe, K. In vitro Inhibitory Effects of Cannabinoids on Progesterone
17 -Hydroxylase Activity in Rat Testis Microsomes. J.
Health Sci., 2005, 51(3), 369-375.
[136] Fernandes, M.; Warning, N.; Christ, W.; Hill, R. Interactions of
several cannabinoids with the hepatic drug metabolizing system.
Biochem. Pharmacol., 1973, 22(23), 2981-2987.
[137] Watanabe, K.; Yamamoto, I.; Oguri, K.; Yoshimura, H. In vitro
and in vivo interactions of delta 8-tetra-hydrocannabinol and its
metabolites with hepatic microsomal drug metabolizing enzyme
systems of mice. J. Pharmacobiodyn., 1981, 4(8), 604-611.
[138] Watanabe, K.; Arai, M.; Narimatsu, S.; Yamamoto, I.; Yoshimura,
H. Self-catalyzed inactivation of cytochrome P-450 during microsomal
metabolism of cannabidiol. Biochem. Pharmacol., 1987,
36(20), 3371-3377.
[139] Huestis, M.A.; Henningfield, J.E.; Cone, E.J. Blood cannabinoids.
I. Absorption of THC and formation of 11-OH-THC and
THCCOOH during and after smoking marijuana. J. Anal. Toxicol.,
1992, 16(5), 276-282.
[140] Ohlsson, A.; Lindgren, J.E.; Andersson, S.; Agurell, S.; Gillespie,
H.; Hollister, L.E. Single-dose kinetics of deuterium-labelled cannabidiol
in man after smoking and intravenous administration.
Biomed. Environ. Mass Spectrom., 1986, 13(2), 77-83.
[141] Johansson, E., Ohlsson, A., Lindgren, J.E., Agurell, S., Gillespie,
H., Hollister, L.E. Single-dose kinetics of deuterium-labelled cannabinol
in man after intravenous administration and smoking. Biomed.
Environ. Mass Spectrom., 1987, 14(9), 495-499.
[142] Bornheim, L.M. Effects of unsaturated side-chain analogs of tetrahydrocannabinol
on cytochromes P450. Biochem. Pharmacol.,
2000, 60(7), 955-961.
[143] Costa, B.; Parolaro, D.; Colleoni, M. Chronic cannabinoid, CP-
55,940, administration alters biotransformation in the rat. Eur. J.
Pharmacol., 1996, 313(1-2), 17-24.
[144] Fontanellas, A.; Manzanares, J.; García-Bravo, M.; Buzaleh, A.M.;
Méndez, M.; Oliva, J.M.; Batlle, A.; Paloma, T.; Enríquez de
Salamance, R. Effects of repeated administration with CP-55,940, a
cannabinoid CB1 receptor agonist on the metabolism of the hepatic
heme. Int. J. Biochem. Cell Biol., 2005, 37(8), 1620-1625.
[145] Yang, L.; Rozenfeld, R.; Wu, D.; Devi, L.A.; Zhang, Z.; Cederbaum,
A. Cannabidiol protects liver from binge alcohol-induced
steatosis by mechanisms including inhibition of oxidative stress
and increase in autophagy. Free Radic. Biol. Med., 2014, 68, 260-
267.
[146] Sheweita, S.A. Narcotic drugs change the expression of cytochrome
P450 2E1 and 2C6 and other activities of carcinogenmetabolizing
enzymes in the liver of male mice. Toxicology, 2003,
191(2-3), 133-142.
[147] Paton, W.D.; Pertwee, R.G. Effect of cannabis and certain of its
constituents on pentobarbitone sleeping time and phenazone metabolism.
Br. J. Pharmacol., 1972, 44(2), 250-261.
[148] Borys, H.K.; Ingall, G.B.; Karler, R. Development of tolerance to
the prolongation of hexobarbitone sleeping time caused by cannabidiol.
Br. J. Pharmacol., 1979, 67(1), 93-101.
[149] Bornheim, L.M.; Correia, M.A. Effect of cannabidiol on cytochrome
P-450 isozymes. Biochem. Pharmacol., 1989, 38(17),
2789-2794.
[150] Bornheim, L.M.; Borys, H.K.; Karler, R. Effect of cannabidiol on
cytochrome P-450 and hexobarbital sleep time. Biochem. Pharmacol.,
1981, 30(5), 503-507.
[151] Bornheim, L.M.; Everhart, E.T.; Li, J.; Correia, M.A. Characterization
of cannabidiol-mediated cytochrome P450 inactivation. Biochem.
Pharmacol., 1993, 45(6), 1323-1331.
[152] Bornheim, L.M.; Everhart, E.T.; Li, J.; Correia, M.A. Induction and
genetic regulation of mouse hepatic cytochrome P450 by cannabidiol.
Biochem. Pharmacol., 1994, 48(1), 161-171.
[153] List, A.; Nazar, B.; Nyquist, S.; Harclerode, J. The effects of
delta9-tetrahydrocannabinol and cannabidiol on the metabolism of
gonadal steroids in the rat. Drug Metab. Dispos., 1977, 5(3), 268-
272.
[154] Narimatsu, S.; Watanabe, K.; Matsunaga, T.; Yamamoto, I.; Imaoka,
S.; Funae, Y.; Yoshimura, H. Inhibition of hepatic microsomal
cytochrome P450 by cannabidiol in adult male rats. Chem. Pharm.
Bull. (Tokyo), 1990, 38(5), 1365-1368.
[155] Narimatsu, S.; Watanabe, K.; Matsunaga, T.; Yamamoto, I.; Imaoka,
S.; Funae, Y.; Yoshimura, H. Suppression of liver microsomal
drug-metabolizing enzyme activities in adult female rats pretreated
with cannabidiol. Biol. Pharm. Bull., 1993, 16(4), 428-430.
[156] Lee, S.Y.; Oh, S.M.; Lee, S.K.; Chung, K.H. Antiestrogenic effects
of marijuana smoke condensate and cannabinoid compounds. Arch.
Pharm. Res., 2005, 28(12), 1365-1375.
78
224 Current Drug Metabolism, 2016, Vol. 17, No. 3 Zendulka et al.
[157] Roth, M.D.; Marques-Magallanes, J.A.; Yuan, M.; Sun, W.; Tashkin,
D.P.; Hankinson, O. Induction and regulation of the carcinogen-metabolizing
enzyme CYP1A1 by marijuana smoke and delta
(9)-tetrahydrocannabinol. Am. J. Respir. Cell. Mol. Biol., 2001,
24(3), 339-344.
[158] Sarafian, T.; Habib, N.; Mao, J.T.; Tsu, I.H.; Yamamoto, M.L.;
Hsu, E.; Tashkin, D.P.; Roth, M.D. Gene expression changes in
human small airway epithelial cells exposed to Delta9tetrahydrocannabinol.
Toxicol. Lett., 2005, 158(2), 95-107.
[159] Yamaori S.; Kinugasa Y.; Jiang, R.; Takeda, S.; Yamamoto, I.;
Watanabe, K. Cannabidiol induces expression of human cytochrome
P450 1A1 that is possibly mediated through aryl hydrocarbon
receptor signaling in HepG2 cells. Life Sci., 2015, 136, 87-93.
[160] Dalterio, S.; Thomford, P.J.; Michael, S.D.; DeAngelo, L.;
Mayfield, D. Perinatal cannabinoid exposure: effects on hepatic cytochrome
P-450 and plasma protein levels in male mice. Teratology,
1986, 33(2), 195-201.
[161] Martignoni, M.; Groothuis, G.M.; de Kanter, R. Species differences
between mouse, rat, dog, monkey and human CYP-mediated drug
metabolism, inhibition and induction. Expert Opin. Drug. Metab.
Toxicol., 2006, 2(6), 875-894.
[162] Reid, M.J.; Bornheim, L.M. Cannabinoid-induced alterations in
brain disposition of drugs of abuse. Biochem. Pharmacol., 2001,
61(11), 1357-1367.
[163] Bornheim, L.M.; Kim, K.Y.; Chen, B.; Correia, M.A. The effect of
cannabidiol on mouse hepatic microsomal cytochrome P450dependent
anandamide metabolism. Biochem. Biophys. Res. Commun.,
1993, 197(2), 740-746.
[164] Klein, C.; Karanges, E.; Spiro, A.; Wong, A.; Spencer, J.; Huynh,
T.; Gunasekaran, N.; Karl, T.; Long, L.E.; Huang, X.F.; Liu, K.;
Arnold, J.C.; McGregor, I.S. Cannabidiol potentiates 
9
tetrahydrocannabinol
(THC) behavioural effects and alters THC
pharmacokinetics during acute and chronic treatment in adolescent
rats. Psychopharmacology (Berl), 2011, 218(2), 443-457.
[165] Varvel, S.A.; Wiley, J.L.; Yang, R.; Bridgen, D.T.; Long, K.;
Lichtman, A.H.; Martin, B.R. Interactions between THC and cannabidiol
in mouse models of cannabinoid activity. Psychopharmacology
(Berl), 2006, 186(2), 226-234.
[166] European Medicines Agency. Scientific disscussion about rimonabant.
Publications Office of the European Union: Luxembourg,
2006.
[167] Engels, F.K.; de Jong, F.A.; Sparreboom, A.; Mathot, R.A.; Loos,
W.J.; Kitzen, J.J.; de Bruijn, P.; Verweij, J.; Mathijssen, R.H. Medicinal
cannabis does not influence the clinical pharmacokinetics of
irinotecan and docetaxel. Oncologist, 2007, 12(3), 291-300.
[168] Sativex®, GW Pharma Ltd, Summary of Product Characteristics.
Available from: http://www.medicines.org.uk/emc/medicine/23262
(Accessed August 23, 2015).
[169] Nadulski, T; Pragst, F.; Weinberg, G.; Roser, P.; Schnelle, M.;
Fronk, E.M.; Stadelmann, A.M. Randomized, double-blind, placebo-controlled
study about the effects of cannabidiol (CBD) on
the pharmacokinetics of Delta9-tetrahydrocannabinol (THC) after
oral application of THC verses standardized cannabis extract. Ther.
Drug Monit., 2005, 27(6), 799-810.
[170] Benowitz, N.L.; Nguyen, T.L.; Jones, R.T.; Herning, R.I.; Bachman,
J. Metabolic and psychophysiologic studies of cannabidiolhexobarbital
interaction. Clin. Pharmacol. Ther., 1980, 28(1), 115-
120.
[171] Geffrey, A.L.; Pollack, S.F.; Bruno, P.L.; Thiele, E.A. Drug-drug
interaction between clobazam and cannabidiol in children with refractory
epilepsy. Epilepsia, 2015, 56(8), 1246-1251.
[172] Bromek, E.; Wójcikowski, J.; Daniel, W.A. Involvement of the
paraventricular (PVN) and arcuate (ARC) nuclei of the hypothalamus
in the central noradrenergic regulation of liver cytochrome
P450. Biochem. Pharmacol., 2013, 86(11), 1614-1620.
[173] Kot, M.; Daniel, W.A. Cytochrome P450 is regulated by noradrenergic
and serotonergic systems. Pharmacol. Res., 2011, 64(4), 371-
380.
[174] Wójcikowski, J.; Go embiowska, K.; Daniel, W.A. Regulation of
liver cytochrome P450 by activation of brain dopaminergic system:
physiological and pharmacological implications. Biochem. Pharmacol.,
2008, 76(2), 258-267.
[175] Wójcikowski, J.; Daniel, W.A. The role of the nervous system in
the regulation of liver cytochrome p450. Curr. Drug Metab., 2011,
12(2), 124-138.
[176] Sví enská, I.; Dubov , P.; ulcová, A. Cannabinoid receptors 1 and
2 (CB1 and CB2), their distribution, ligands and functional involvement
in nervous system structures--a short review. Pharmacol.
Biochem. Behav., 2008, 90(4), 501-511.
[177] Mackie, K. Distribution of cannabinoid receptors in the central and
peripheral nervous system. Handb. Exp. Pharmacol., 2005, 168,
299-325.
[178] Marsicano, G.; Lutz, B. Expression of the cannabinoid receptor
CB1 in distinct neuronal subpopulations in the adult mouse forebrain.
Eur. J. Neurosci., 1999, 11(12), 4213-4225.
[179] Schlicker, E.; Kathmann, M. Modulation of transmitter release via
presynaptic cannabinoid receptors. Trends Pharmacol. Sci., 2001,
22(11), 565-572.
[180] Wager-Miller, J.; Westenbroek, R.; Mackie, K. Dimerization of G
protein-coupled receptors: CB1 cannabinoid receptors as an example.
Chem. Phys. Lipids, 2002, 121(1-2), 83-89.
[181] Canals, M.; Milligan, G. Constitutive activity of the cannabinoid
CB1 receptor regulates the function of co-expressed Mu opioid receptors.
J. Biol. Chem., 2008, 283(17), 11424-11434.
[182] Ellis, J.; Pediani, J.D.; Canals, M.; Milasta, S.; Milligan, G. Orexin-
1 receptor-cannabinoid CB1 receptor heterodimerization results in
both ligand-dependent and -independent coordinated alterations of
receptor localization and function. J. Biol. Chem., 2006, 281(50),
38812-38824.
[183] Hilairet, S.; Bouaboula, M.; Carrière, D.; Le Fur, G.; Casellas, P.
Hypersensitization of the Orexin 1 receptor by the CB1 receptor:
evidence for cross-talk blocked by the specific CB1 antagonist,
SR141716. J. Biol. Chem., 2003, 278(26), 23731-23737.
[184] Carriba, P.; Ortiz, O.; Patkar, K.; Justinova, Z.; Stroik, J.; Themann,
A.; Müller, C.; Woods, A.S.; Hope, B.T.; Ciruela, F.;
Casadó, V.; Canela, E.I.; Lluis, C.; Goldberg, S.; Morattala, R.;
Franco, R.; Ferré, S. Striatal adenosine A2A and cannabinoid CB1
receptors form functional heteromeric complexes that mediate the
motor effects of cannabinoids. Neuropsychopharmacology, 2007,
32(11), 2249-2259.
[185] Ferreira, S.G.; Gonçalves, F.Q.; Marques, J.M.; Tomé, Â.; Rodrigues,
R.J.; Nunes-Correia, I.; Ledent, C.; Harkany, T.; Venance, L.;
Cunha, R.A.; Köfalvi, A. Presynaptic adenosine A2A receptors
dampen cannabinoid CB1 receptor-mediated inhibition of corticostriatal
glutamatergic transmission. Br. J. Pharmacol., 2015, 172(4),
1074-1086.
[186] Hermann, H.; Marsicano, G.; Lutz, B. Coexpression of the cannabinoid
receptor type 1 with dopamine and serotonin receptors in
distinct neuronal subpopulations of the adult mouse forebrain.
Neuroscience, 2002, 109(3), 451-460.
[187] Morales, M.; Wang, S.D.; Diaz-Ruiz, O.; Jho, D.H. Cannabinoid
CB1 receptor and serotonin 3 receptor subunit A (5-HT3A) are coexpressed
in GABA neurons in the rat telencephalon. J. Comp.
Neurol., 2004, 468(2), 205-216.
[188] Pickel, V.M.; Chan, J.; Kearn, C.S.; Mackie, K. Targeting dopamine
D2 and cannabinoid-1 (CB1) receptors in rat nucleus accumbens.
J. Comp. Neurol., 2006, 495(3), 299-313.
[189] Szabo, B.; Siemes, S.; Wallmichrath, I. Inhibition of GABAergic
neurotransmission in the ventral tegmental area by cannabinoids.
Eur. J. Neurosci., 2002, 15(12), 2057-2061.
[190] Sperlágh, B.; Windisch, K.; Andó, R.D.; Sylvester Vizi, E. Neurochemical
evidence that stimulation of CB1 cannabinoid receptors
on GABAergic nerve terminals activates the dopaminergic reward
system by increasing dopamine release in the rat nucleus accumbens.
Neurochem. Int., 2009, 54(7), 452-457.
[191] Melis, M.; Pistis, M.; Perra, S.; Muntoni, A.L.; Pillolla, G.; Gessa,
G.L. Endocannabinoids mediate presynaptic inhibition of glutamatergic
transmission in rat ventral tegmental area dopamine neurons
through activation of CB1 receptors. J. Neurosci., 2004, 24(1), 53-
62.
[192] Robbe, D.; Alonso, G.; Duchamp, F.; Bockaert, J.; Manzoni, O.J.
Localization and mechanisms of action of cannabinoid receptors at
the glutamatergic synapses of the mouse nucleus accumbens. J.
Neurosci., 2001, 21(1), 109-116.
[193] Pascussi, J.M.; Drocourt, L.; Gerbal-Chaloin, S.; Fabre, J.M.; Maurel,
P.; Vilarem, M.J. Dual effect of dexamethasone on CYP3A4
gene expression in human hepatocytes. Sequential role of glucocorticoid
receptor and pregnane X receptor. Eur. J. Biochem., 2001,
268, 6346-6358.
[194] Daskalopoulos, E.P.; Lang, M.A.; Marselos, M.; Malliou, F.;
Konstandi, M. D2-dopaminergic receptor-linked pathways: critical
79
Cannabinoids and Cytochrome P450 Interactions Current Drug Metabolism, 2016, Vol. 17, No. 3 225
regulators of CYP3A, CYP2C, and CYP2D. Mol. Pharmacol.,
2012, 82(4), 668-678.
[195] Jürgens, G.; Lange, K.H.; Reuther, L.; Rasmussen, B.B.; Brøsen,
K.; Christensen, H.R. Effect of growth hormone on hepatic cytochrome
P450 activity in healthy elderly men. Clin. Pharmacol.
Ther., 2002, 71(3), 162-168.
[196] Lammel Lindemann, J.A.; Angajala, A.; Engler, D.A.; Webb, P.;
Ayers, S.D. Thyroid hormone induction of human cholesterol 7 alpha-hydroxylase
(Cyp7a1) in vitro. Mol. Cell. Endocrinol., 2014,
388(1-2), 32-40.
[197] Lal, S.; Tolis, G.; Martin, S.B.; Brown, G.M.; Guyda, H. Effect of
clonidine on growth hormone, prolactin, luteinizing hormone, follicle-stimulating
hormone, and thyroid-stimulating hormone in the
serum of normal men. J. Clin. Endocrinol. Metab., 1975, 41(5),
827-832.
[198] Mueller, G.P.; Simpkins, J.; Meites, J.; Moore, K.E. Differential
effects of dopamine agonists and haloperidol on release of prolactin,
thyroid stimulating hormone, growth hormone and luteinizing
hormone in rats. Neuroendocrinology, 1976, 20(2), 121-135.
[199] Fuller, R.W.; Snoddy, H.D. Elevation of serum corticosterone
concentrations in rats by pergolide and other dopamine agonists.
Endocrinology, 1981, 109(4), 1026-1032.
[200] Jeová, D.; Juroviová, J.; Vigas, M.; Murgas, K.; Labrie, F. Increase
in plasma ACTH after dopaminergic stimulation in rats.
Psychopharmacology (Berl), 1985, 85(2), 201-203.
[201] Morley, J.E.; Brammer, G.L.; Sharp, B.; Yamada, T.; Yuwiler, A.;
Hershman, J.M. Neurotransmitter control of hypothalamicpituitary-thyroid
function in rats. Eur. J. Pharmacol., 1981, 70(3),
263-271.
[202] Wójcikowski, J.; Go embiowska, K.; Daniel, W.A. The regulation
of liver cytochrome p450 by the brain dopaminergic system. Curr.
Drug Metab., 2007, 8(6), 631-638.
[203] Iqbal, J.; Manley, T.R.; Yue, Q.; Namavar, M.R.; Clarke, I.J.
Noradrenergic regulation of hypothalamic cells that produce
growth hormone-releasing hormone and somatostatin and the effect
of altered adiposity in sheep. J. Neuroendocrinol., 2005, 17(6),
341-352.
[204] Wittmann, G. Regulation of hypophysiotrophic corticotrophinreleasing
hormone- and thyrotrophin-releasing hormone-synthesising
neurones by brainstem catecholaminergic neurones. J. Neuroendocrinol.,
2008, 20(7), 952-960.
[205] Kot, M.; Sadakierska-Chudy, A.; Haduch, A.; Rysz, M.; Bromek,
E.; Go embiowska, K.; Daniel, W.A. The role of the dorsal
noradrenergic pathway of the brain (locus coeruleus) in the regulation
of liver cytochrome P450 activity. Eur. J. Pharmacol., 2015,
751, 34-41.
[206] Kot, M.; Pilc, A.; Daniel, W.A. Simultaneous alterations of brain
and plasma serotonin concentrations and liver cytochrome P450 in
rats fed on a tryptophan-free diet. Pharmacol. Res., 2012, 66(4),
292-299
[207] Haduch, A.; Wójcikowski, J.; Daniel, W.A. The effect of tricyclic
antidepressants, selective serotonin reuptake inhibitors (SSRIs) and
newer antidepressant drugs on the activity and level of rat CYP3A.
Eur. Neuropsychopharmacol., 2006, 16(3), 178-186.
[208] Pagotto, U.; Marsicano, G.; Cota, D.; Lutz, B.; Pasquali, R. The
emerging role of the endocannabinoid system in endocrine regulation
and energy balance. Endocr. Rev., 2006, 27(1), 73-100.
[209] Brown, T.T.; Dobs, A.S. Endocrine effects of marijuana. J. Clin.
Pharmacol., 2002, 42, 11 Suppl, 90S-96S.
[210] Herkenham, M.; Lynn, A.B.; de Costa, B.R.; Richfield, E.K. Neuronal
localization of cannabinoid receptors in the basal ganglia of
the rat. Brain Res., 1991, 547(2), 267-274.
[211] Pagotto, U.; Marsicano, G.; Fezza, F.; Theodoropoulou, M.;
Grübler, Y.; Stalla, J.; Arzberger, T.; Milone, A.; Losa, M.; Di
MArzo, V.; Lutz, V.; Stalla, G.K. Normal human pituitary gland
and pituitary adenomas express cannabinoid receptor type 1 and
synthesize endogenous cannabinoids: first evidence for a direct role
of cannabinoids on hormone modulation at the human pituitary
level. J. Clin. Endocrinol. Metab., 2001, 86(6), 2687-2696.
[212] Steiner, M.A.; Wotjak, C.T. Role of the endocannabinoid system in
regulation of the hypothalamic-pituitary-adrenocortical axis. Prog.
Brain Res., 2008, 170, 397-432.
[213] da Veiga, M.A.; Fonseca Bloise, F.; Costa-E-Sousa, R.H.; Souza,
L.L.; Almeida, N.A.; Oliveira, K.J.; Pazos-Moura, C.C. Acute effects
of endocannabinoid anandamide and CB1 receptor antagonist,
AM251 in the regulation of thyrotropin secretion. J. Endocrinol.,
2008, 199(2), 235-242.
[214] Deli, L.; Wittmann, G.; Kalló, I.; Lechan, R.M.; Watanabe, M.;
Liposits, Z.; Fekete, C. Type 1 cannabinoid receptor-containing axons
innervate hypophysiotropic thyrotropin-releasing hormonesynthesizing
neurons. Endocrinology, 2009, 150(1), 98-103.
[215] de Miguel, R.; Romero, J.; Muñoz, R.M.; García-Gil, L.; González,
S.; Villanua, M.A.; Makriyannis, A.; Ramos, J.A.; Fernández-Ruiz,
J.J. Effects of cannabinoids on prolactin and gonadotrophin secretion:
involvement of changes in hypothalamic gammaaminobutyric
acid (GABA) inputs. Biochem. Pharmacol., 1998,
56(10), 1331-1338
[216] Hill, M.N.; Tasker, J.G. Endocannabinoid signaling, glucocorticoid-mediated
negative feedback, and regulation of the hypothalamic-pituitary-adrenal
axis. Neuroscience, 2012, 204, 5-16.
[217] Di, S.; Malcher-Lopes, R.; Halmos, K.C.; Tasker, J.G. Nongenomic
glucocorticoid inhibition via endocannabinoid release in the hypothalamus:
a fast feedback mechanism. J. Neurosci., 2003, 23(12),
4850-4857.
[218] Gorzalka, B.B.; Hill, M.N. Integration of endocannabinoid signaling
into the neural network regulating stress-induced activation of
the hypothalamic-pituitary-adrenal axis. Curr. Top. Behav. Neurosci.,
2009, 1, 289-306.
[219] Kirilly, E.; Hunyady, L.; Bagdy, G. Opposing local effects of endocannabinoids
on the activity of noradrenergic neurons and release
of noradrenaline: relevance for their role in depression and in the
actions of CB(1) receptor antagonists. J. Neural. Transm., 2013,
120(1), 177-186.
[220] Nakazi, M.; Bauer, U.; Nickel, T.; Kathmann, M.; Schlicker, E.
Inhibition of serotonin release in the mouse brain via presynaptic
cannabinoid CB1 receptors. Naunyn Schmiedebergs Arch. Pharmacol.,
2000, 361(1), 19-24.
[221] Häring, M.; Marsicano, G.; Lutz, B.; Monory, K. Identification of
the cannabinoid receptor type 1 in serotonergic cells of raphe nuclei
in mice. Neuroscience, 2007, 146(3), 1212-1219.
[222] Dvoák, Z.; Pávek, P. Regulation of drug-metabolizing cytochrome
P450 enzymes by glucocorticoids. Drug Metab. Rev., 2010, 42(4),
621-635.
[223] Honkakoski, P.; Negishi, M. Regulation of cytochrome P450
(CYP) genes by nuclear receptors. Biochem. J., 2000, 347(Pt 2),
321-337.
[224] Tolson, A.H.; Wang, H. Regulation of drug-metabolizing enzymes
by xenobiotic receptors: PXR and CAR. Adv. Drug. Deliv. Rev.,
2010, 62(13), 1238-1249.
[225] Onica, T.; Nichols, K.; Larin, M.; Ng, L.; Maslen, A.; Dvorak, Z.;
Pascussi, J.M.; Vilarem, M.J.; Maurel, P.; Kirby, G.M. Dexamethasone-mediated
up-regulation of human CYP2A6 involves the glucocorticoid
receptor and increased binding of hepatic nuclear factor
4 alpha to the proximal promoter. Mol. Pharmacol., 2008, 73(2),
451-460.
[226] Pávek, P.; 
erven, L.; 
vecová, L.; Brysch, M.; Libra, A.; Vrzal,
R.; Nachtigal, P.; Staud, F.; Ulrichová, J.; Fendrich, Z.; Dvoák, Z.
Examination of Glucocorticoid receptor alpha-mediated transcriptional
regulation of P-glycoprotein, CYP3A4, and CYP2C9 genes
in placental trophoblast cell lines. Placenta, 2007, 28(10), 1004-
1011.
[227] Wang, H.; Faucette, S.R.; Gilbert, D.; Jolley, S.L.; Sueyoshi, T.;
Negishi, M.; LeCluyse, E.L. Glucocorticoid receptor enhancement
of pregnane X receptor-mediated CYP2B6 regulation in primary
human hepatocytes. Drug Metab. Dispos., 2003, 31(5), 620-630.
[228] Pascussi, J.M.; Gerbal-Chaloin, S.; Drocourt, L.; Maurel, P.;
Vilarem, M.J. The expression of CYP2B6, CYP2C9 and CYP3A4
genes: a tangle of networks of nuclear and steroid receptors. Biochim.
Biophys. Acta, 2003, 1619(3), 243-253.
[229] Pascussi, J.M.; Gerbal-Chaloin, S.; Fabre, J.M.; Maurel, P;.
Vilarem, M.J. Dexamethasone enhances constitutive androstane receptor
expression in human hepatocytes: consequences on cytochrome
P450 gene regulation. Mol. Pharmacol., 2000, 58(6), 1441-
1450.
[230] Ferguson, S.S.; Chen, Y.; LeCluyse, E.L.; Negishi, M.; Goldstein,
J.A. Human CYP2C8 is transcriptionally regulated by the nuclear
receptors constitutive androstane receptor, pregnane X receptor,
glucocorticoid receptor, and hepatic nuclear factor 4alpha. Mol.
Pharmacol., 2005, 68(3), 747-757.
[231] Schuetz, J.D.; Schuetz, E.G.; Thottassery, J.V.; Guzelian, P.S.;
Strom, S.; Sun, D. Identification of a novel dexamethasone respon-
80
226 Current Drug Metabolism, 2016, Vol. 17, No. 3 Zendulka et al.
sive enhancer in the human CYP3A5 gene and its activation in human
and rat liver cells. Mol. Pharmacol., 1996, 49(1), 63-72.
[232] Chen, Y.; Ferguson, S.S.; Negishi, M.; Goldstein, J.A. Identification
of constitutive androstane receptor and glucocorticoid receptor
binding sites in the CYP2C19 promoter. Mol. Pharmacol., 2003,
64(2), 316-324.
[233] Liddle, C.; Goodwin, B.J.; George, J.; Tapner, M.; Farrell, G.C.
Separate and interactive regulation of cytochrome P450 3A4 by triiodothyronine,
dexamethasone, and growth hormone in cultured
hepatocytes. J. Clin. Endocrinol. Metab., 1998, 83(7), 2411-2416.
[234] Waxman, D.J.; Morrissey, J.J.; LeBlanc, G.A. Female-predominant
rat hepatic P-450 forms j (IIE1) and 3 (IIA1) are under hormonal
regulatory controls distinct from those of the sex-specific P-450
forms. Endocrinology, 1989, 124(6), 2954-2966.
[235] Chen, G.F.; Ronis, M.J.; Ingelman-Sundberg, M.; Badger, T.M.
Hormonal regulation of microsomal cytochrome P4502E1 and
P450 reductase in rat liver and kidney. Xenobiotica, 1999, 29(5),
437-451.
[236] Waxman, D.J.; O'Connor, C. Growth hormone regulation of sexdependent
liver gene expression. Mol. Endocrinol., 2006, 20(11),
2613-2629.
[237] Ortiz de Montellano P. Cytochrome P450: Structure, Mechanism,
and Biochemistry, 3rd ed.; Kluwer academic/Plenum Publishers:
New York, 2005.
[238] Itoh, M.; Nakajima, M.; Higashi, E.; Yoshida, R.; Nagata, K.; Yamazoe,
Y.; Yokoi, T. Induction of human CYP2A6 is mediated by
the pregnane X receptor with peroxisome proliferator-activated receptor-gamma
coactivator 1alpha. J. Pharmacol. Exp. Ther., 2006,
319(2), 693-702.
[239] Hariparsad, N.; Chu, X.; Yabut, J.; Labhart, P.; Hartley, D.P.; Dai,
X.; Evers R. Identification of pregnane-X receptor target genes and
coactivator and corepressor binding to promoter elements in human
hepatocytes. Nucleic Acids Res., 2009, 37(4), 1160-1173.
[240] Goodwin, B.; Moore, L.B.; Stoltz, C.M.; McKee, D.D.; Kliewer,
S.A. Regulation of the human CYP2B6 gene by the nuclear pregnane
X receptor. Mol. Pharmacol., 2001, 60(3), 427-431.
[241] Faucette, S.R.; Wang, H.; Hamilton, G.A.; Jolley, S.L.; Gilbert, D.;
Lindley, C.; Yan, B.; Negishi, M.; LeCluyse, E.L. Regulation of
CYP2B6 in primary human hepatocytes by prototypical inducers.
Drug Metab. Dispos., 2004, 32(3), 348-358.
[242] Rana R.; Chen Y.; Ferguson S.S.; Kissling G.E.; Surapureddi S.;
Goldstein J.A. Hepatocyte nuclear factor 4{alpha} regulates rifampicin-mediated
induction of CYP2C genes in primary cultures of
human hepatocytes. Drug Metab. Dispos., 2010, 38(4), 591-599
[243] Blumberg B.; Sabbagh W.; Juguilon H.; Bolado J.; van Meter
C.M.; Ong E.S.; Evans R.M. SXR, a novel steroid and xenobioticsensing
nuclear receptor. Genes Dev., 1998, 12(20), 3195-3205
[244] Bertilsson G.; Heidrich J.; Svensson K.; Asman M.; Jendeberg L.;
Sydow-Bäckman M.; Ohlsson R.; Postlind H.; Blomquist P.; Berkenstam
A. Identification of a human nuclear receptor defines a new
signaling pathway for CYP3A induction. Proc. Natl. Acad. Sci.
USA, 1998, 95(21), 12208-12213.
[245] Kliewer, S.A.; Moore, J.T.; Wade, L.; Staudinger, J.L.; Watson,
M.A.; Jones, S.A.; McKee, D.D.; Oliver, B.B.; Willson, T.M.; Zetterström,
R.H.; Perlmann, T.; Lehman, J.M. An orphan nuclear receptor
activated by pregnanes defines a novel steroid signaling
pathway. Cell, 1998, 92(1), 73-82.
[246] Staudinger, J.L.; Goodwin, B.; Jones, S.A.; Hawkins-Brown, D.;
MacKenzie, K.I.; LaTour, A.; Liu, Y.; Klaasen, C.D.; Brown, K.K.;
Reinhard, J.; Willson, T.M.; Koller, B.H.; Kliewer, S.A. The nuclear
receptor PXR is a lithocholic acid sensor that protects against
liver toxicity. Proc. Natl. Acad. Sci. USA, 2001, 98(6), 3369-3374.
[247] Kawamoto, T.; Sueyoshi, T.; Zelko, I.; Moore, R.; Washburn, K.;
Negishi, M. Phenobarbital-responsive nuclear translocation of the
receptor CAR in induction of the CYP2B gene. Mol. Cell. Biol.,
1999, 19(9), 6318-6322.
[248] Kohalmy, K.; Tamási, V.; Kóbori, L.; Sárváry, E.; Pascussi, J.M.;
Porrogi, P.; Rozman, D.; Prough, R.A.; Meyer, U.A.; Monostory,
K. Dehydroepiandrosterone induces human CYP2B6 through the
constitutive androstane receptor. Drug Metab. Dispos., 2007, 35(9),
1495-1501.
[249] Ferguson, S.S.; LeCluyse, E.L.; Negishi, M.; Goldstein, J.A. Regulation
of human CYP2C9 by the constitutive androstane receptor:
discovery of a new distal binding site. Mol. Pharmacol., 2002,
62(3), 737-746.
[250] Martínez-Jiménez, C.P.; Jover, R.; Donato, M.T.; Castell, J.V.;
Gómez-Lechón, M.J. Transcriptional regulation and expression of
CYP3A4 in hepatocytes. Curr. Drug. Metab., 2007, 8(2), 185-194.
[251] Burk, O.; Koch, I.; Raucy, J;. Hustert, E.; Eichelbaum, M.; Brockmöller,
J.; Zanger, U.M.; Wojniwski, L. The induction of cytochrome
P450 3A5 (CYP3A5) in the human liver and intestine is
mediated by the xenobiotic sensors pregnane X receptor (PXR) and
constitutively activated receptor (CAR). J. Biol. Chem., 2004,
279(37), 38379-38385.
[252] Pascussi, J.M.; Jounaidi, Y.; Drocourt, L.; Domergue, J.; Balabaud,
C.; Maurel, P.; Vilarem, M.J. Evidence for the presence of a functional
pregnane X receptor response element in the CYP3A7 promoter
gene. Biochem. Biophys. Res. Commun., 1999, 260(2), 377-
381.
[253] Wang, H.; LeCluyse, E.L. Role of orphan nuclear receptors in the
regulation of drug-metabolising enzymes. Clin. Pharmacokinet.,
2003, 42(15), 1331-1357.
[254] Johnson, E.F.; Palmer, C.N.; Griffin, K.J.; Hsu, M.H. Role of the
peroxisome proliferator-activated receptor in cytochrome P450 4A
gene regulation. FASEB J., 1996, 10(11), 1241-1248.
[255] Shaban, Z.; Soliman, M.; El-Shazly, S.; El-Bohi, K; Abdelazeez,
A.; Kehelo, K.; Kim, H.S.; Muzandu, K.; Ishizuka, M.; Kazusaka,
A.; Fujita, S. AhR and PPARalpha: antagonistic effects on CYP2B
and CYP3A, and additive inhibitory effects on CYP2C11. Xenobiotica,
2005, 35(1), 51-68.
[256] Schuetz, E.G.; Schmid, W.; Schutz, G.; Brimer, C.; Yasuda, K.;
Kamataki, T.; Bornheim, L.; Myles, K.; Cole, T.J. The glucocorticoid
receptor is essential for induction of cytochrome P-4502B by
steroids but not for drug or steroid induction of CYP3A or P-450
reductase in mouse liver. Drug Metab. Dispos., 2000, 28(3), 268-
278.
[257] O'Sullivan, S.E. Cannabinoids go nuclear: evidence for activation
of peroxisome proliferator-activated receptors. Br. J. Pharmacol.,
2007, 152(5), 576-582.
[258] Liu, J.; Li, H.; Burstein, S.H.; Zurier, R.B.; Chen, J.D. Activation
and binding of peroxisome proliferator-activated receptor gamma
by synthetic cannabinoid ajulemic acid. Mol. Pharmacol., 2003,
63(5), 983-992.
Received: August 31, 2015 Revised: December 10, 2015 Accepted: December 14, 2015
81
5.2.2 The effect of oleamide on the activity of rat and human P450
As was mentioned above, xenobiotics used or intended to be used as therapeutic agents have to be
checked for their interactions with P450. Therefore the interactions of rimonabant, THC, or
cannabidiol with P450 are known. Rimonabant and its peripherally acting analogue LH-21 are both in
vitro inhibitors of CYP3A4 (Alonso et al., 2012; Wustrow et al., 2008). Also other synthetic
cannabinoids act as P450 inhibitors in direct interactions studies (Ashino et al., 2014). Similarly,
herbal cannabinoids inhibit various P450 enzymes with various potencies in vitro (Zendulka et al.,
2016). There is limited data on the effect of cannabinoids on P450 in vivo, and moreover published
studies give divergent results. Both a decrease and increase in the activity/amount of P450 can be
found (Bornheim et al., 1993; Sheweita, 2003).
In our study, we described the effect of the endocannabinoid oleamide on selected P450 enzymes in
different experimental models using rat and human liver microsomes. We focused on the main P450
enzymes involved in drug metabolism: rat CYP1A2, CYP2A, CYP3A, CYP2B, CYP2C6, CYP2C11, and
CYP2D2 and human CYP1A2, CYP2B6, CYP2C9, and CYP3A4.
The oleamide was administered intraperitoneally, dissolved in propylene glycol, to male Wistar
albino rats at doses of 0. 1, 1 or 10 mg/kg/day for 7 days. The RLM were prepared by differential
ultracentrifugation and the amounts and activities of individual P450 enzymes were assessed.
Spectrophotometric methods were used to measure the total protein and total P450 content.
Testosterone, dextromethorphan, phenacetin, and diclofenac were used as probe substrates for
measuring metabolic activities. Animals administered the highest dose of oleamide exhibited a
significantly decreased content of both total protein and P450 in RLM. The metabolic activities of
CYP1A, CYP2B, CYP2C11, and CYP2D2 were significantly decreased, and with CYP3A the decrease was
not significant, even though the activity dropped to 77 % of the control value. The activities of CYP2A
and CYP2C6 were unchanged.
Further tests were performed to determine the underlying mechanism of this effect. Oleamide was
tested for a possible direct interaction with RLM isolated from the naïve animals, the levels of
hormones involved in the regulation of P450 activity was measured, and the amounts of enzymes
were quantified with western blotting. Oleamide was determined to be an inhibitor of rat CYP1A2,
CYP2D2, and CYP2C6 in vitro. CYP1A2 and CYP2D2 were inhibited weakly, while the effect on CYP2C6
was stronger, and so the Ki was calculated. The values of Ki varied from 28.7 to 71.6 µM with respect
to the model of inhibition used. Nevertheless, direct inhibition of the enzyme could not explain the
observed effect in vivo, as the isolated RLM were thought to be oleamide free and CYP2C6 was not
influenced in vivo. The levels of hormones (corticosterone, prolactine, and triiodothyronine) were
82
measured to check the probable relation between the central effect of oleamide and the liver.
Oleamide did not influence the levels of hormones in treated rats, and this possible mechanism can
be also excluded. Finally, the amounts of P450 in the isolated microsomes were again decreased in
terms of CYP1A2, CYP2B, CYP2C11, and CYP3A1 in animals with the highest dose of oleamide.
Together with the fact that the metabolic activity recalculated to the amount of P450 remained
unchanged, we concluded that the downregulation of P450 is the mechanism through which
oleamide influences P450 enzymes in the rat liver.
Because of known interspecies differences, the effect of oleamide on rat P450 was compared with
the effect on human recombinant CYP1A2, CYP2B6, CYP2C9, and CYP3A4 in vitro. Additionally,
oleamide (1 - 30 µM) was incubated together with primary human hepatocytes and tested for its
interaction with human nuclear receptors in HepG2 cells. Oleamide neither changed the activity nor
the mRNA levels of the tested P450 in primary human hepatocytes. It also did not influence the
metabolic activity of recombinant P450 and neither exhibited agonistic nor antagonistic properties
on human CAR, PXR, and AhR nuclear receptors.
The results of the study document that there are differences in the effect of the endocannabinoid
oleamide between rat and human P450. The precise mechanism of how oleamide causes the
downregulation of rat liver P450 has not been detemined yet. Nevertheless, our study indicates that
ECS could be involved in the regulation of P450 activity, as the effect of oleamide is not caused by a
simple drug-enzyme interaction.
Dovrtělová G., Zendulka O., Nosková K., Juřica J., Peš O., Dušek J., Carazo A., Zapletalová I., Hlaváčová
N., Pávek P. Effect of endocannabinoid oleamide on rat and human liver cytochrome P450 enzymes
in in vitro and in vivo models. Drug Metabolism and Disposition, 46, 913-923, 2018.
Impact factor: 3.64; Pharmacology & Pharmacy Q1 Citations WoS: 0
Author’s contribution: 20%, corresponding author
83
1521-009X/46/6/913–923$35.00 https://doi.org/10.1124/dmd.117.079582
DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 46:913–923, June 2018
Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics
Effect of Endocannabinoid Oleamide on Rat and Human Liver
Cytochrome P450 Enzymes in In Vitro and In Vivo Models
Gabriela Dovrtelova, Ondrej Zendulka, Kristyna Noskova, Jan Jurica, Ondrej Pes, Jan Dusek,
Alejandro Carazo, Iveta Zapletalova, Natasa Hlavacova, and Petr Pavek
Departments of Pharmacology (G.D., O.Z., K.N, J.J.) and Biochemistry (O.P.), Faculty of Medicine, Masaryk University, Brno,
Department of Pharmacology and Toxicology, Faculty of Pharmacy, Charles University, Hradec Kralove (J.D., A.C., P.P.), and
Department of Pharmacology, Faculty of Medicine and Dentistry, Palacky University Olomouc, Olomouc (I.Z.), Czech Republic;
and Institute of Experimental Endocrinology, Biomedical Research Center, Slovak Academy of Sciences, Bratislava, Slovak
Republic (N.H.)
Received November 20, 2017; accepted April 4, 2018
ABSTRACT
The endocannabinoid system is important for many physiologic and
pathologic processes, but its role in the regulation of liver cytochromes
P450 (P450s) remains unknown. We studied the influence
of the endocannabinoid oleamide on rat and human liver P450s.
Oleamide was administered intraperitoneally to rats at doses of 0.1,
1, and 10 mg/kg per day for 7 days. The content and activity of key
P450s were evaluated in rat liver microsomes. Moreover, interactions
with nuclear receptors regulating P450 genes and serum levels
of their ligands (prolactin, corticosterone, and free triiodothyronine)
were tested in in vitro P450 inhibition assays. Decreased protein
levels and metabolic activities of CYP1A2, CYP2B, and CYP2C11,
along with a drop in metabolic activity of CYP2D2, were observed in
animals treated with oleamide (10 mg/kg per day). The activities of
CYP2C6, CYP2A, and CYP3A and the levels of hormones were not
altered. In vitro, oleamide exhibited a weak inhibition of rat CYP1A2,
CYP2D2, and CYP2C6. The activities of rat CYP2A, CYP2B,
CYP2C11, and CYP3A and human CYP1A2, CYP2B6, CYP2C9, and
CYP3A4 were not altered. Oleamide did not interact with human
pregnane X, constitutive androstane, or aryl hydrocarbon receptors
in reporter gene experiments and did not regulate their target P450
genes in primary human hepatocytes. Our results indicate that
oleamide caused the downregulation of some rat liver P450s, and
hormones are not mediators of this effect. In vitro oleamide inhibits
mainly rat CYP2C6 and is neither an agonist nor antagonist of major
human nuclear receptors involved in the regulation of xenobiotic
metabolism.
Introduction
The endocannabinoid system (ECS) is an essential regulator of many
physiologic processes, such as memory, brain plasticity, thermogenesis,
nociception, energy balance, digestion, motility, and fertility (AizpuruaOlaizola
et al., 2017). Therefore, it is not surprising that changes in ECS
activity are involved in many pathophysiological processes in the central
nervous system, as well as in the peripheral tissues (Pertwee, 2015). The
ECS is a signaling system that consists of cannabinoid receptors CB1 and
CB2; their endogenous ligands (endocannabinoids); and associated
proteins for their synthesis, transport, and degradation. Endocannabinoids
are metabolized mainly by enzymatic hydrolysis via fatty acid
amide hydrolase (FAAH) and monoacylglycerol lipase, but some
endocannabinoids can also be sensitive to oxidative metabolism by
cyclooxygenase, lipoxygenase, and cytochrome P450 enzymes (P450s)
(Sugiura et al., 2002; Snider et al., 2010). N-arachidonoyl-ethanolamine
(anandamide) and 2-arachidonoyl-glycerol are two of the best studied
endocannabinoids (Di Marzo et al., 1998). Apart from these two,
oleamide (syn. cis-9,10-octadecenoamide, cis-9-octadecenamide, oleic
acid amide) is another molecule of interest because of its role in sleep
regulation (Obal and Krueger, 2003). It was first identified in the
cerebrospinal fluid of sleep-deprived cats (Cravatt et al., 1995). Because
of their similar structures, oleamide and anandamide evoke similar
effects (Divito and Cascio, 2013) including sleep induction (HerreraSolis
et al., 2010), hypothermia, hypomotility, and analgesia (Smith
et al., 1994; Fedorova et al., 2001). Oleamide is an agonist of CB1
receptors (Leggett et al., 2004). Moreover, it can act as an alternate
substrate for FAAH and thus increases the relative half-life and effects of
anandamide (Fowler et al., 2001). Synthetically produced oleamide has
been used in industry for a long time as a lubricant in the production of
plastic materials (Garrido-Lopez et al., 2006) and as a thickener and
emulsifier in cosmetics (Flick, 2012).
P450s are the major enzymatic systems of drug metabolism.
In particular, the subfamilies CYP3A, CYP2C, CYP2D, CYP2B,
and CYP1A are essential for the biotransformation of xenobiotics
in humans. It is known that many cannabinoids are not only
substrates of P450s, but they can also change the activity of these
enzymes. Nowadays, therapeutically used phytocannabinoids
This work was supported by Specific University Research Grant at Masaryk
University [Grants MUNI/A/1132/2017, MUNI/A/0910/2017], project of Grant
Agency of Czech Republic [Grant GA16-06106S], and grant of Czech Neuropsychopharmacological
Society.
https://doi.org/10.1124/dmd.117.079582.
ABBREVIATIONS: AhR, aryl hydrocarbon receptor; ANOVA, analysis of variance; CAR, constitutive androstane receptor; CB, cannabinoid; CITCO,
(6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde O-(3,4-dichlorobenzyl)oxime); DMSO, dimethylsulfoxide; ECS, endocannabinoid
system; ELISA, enzyme-linked immunosorbent assay; FAAH, fatty acid amide hydrolase; HPLC, high-performance liquid chromatography; LBD,
ligand binding domain; P450, cytochrome 450; PXR, pregnane X receptor; RLMs, rat liver microsomes.
913
atASPETJournalsonJuly10,2018dmd.aspetjournals.orgDownloadedfrom
84
(D9
-tetrahydrocannabinol, cannabidiol) and synthetic cannabinoids
(dronabinol and nabilone) are known to modulate the activity of
P450s in in vitro and in vivo models (Zendulka et al., 2016). Their
main indications in clinical practice include nausea and vomiting
associated with cancer chemotherapy, pain, and spasticity (May and
Glode, 2016; Keating, 2017). In addition, the ECS is a promising target
for new therapeutic strategies for other diseases (e.g., psychiatric disorders,
obesity, diabetes, and osteoarthritis (Aizpurua-Olaizola et al., 2017). Thus,
its possible role in the regulation of the activity of P450s would be of
great interest. Nevertheless, none of the endocannabinoids have been
tested for their influence on liver P450s yet.
We focused on oleamide as a candidate endocannabinoid for our
study because of its known ability to activate the ECS by various
mechanisms (CB1 receptor and FAAH enzyme). Moreover, the wide
use of oleamide in the plastics industry has made it a possible
pollutant, and therefore knowledge of its effect on P450s would be
beneficial.
The aim of this work was to investigate the influence of the
endocannabinoid oleamide on the activities of key rat and human
P450s involved in drug metabolism. For this purpose, in vitro P450
interaction assays and an in vivo rat model were used. To obtain
additional data about the possible mechanism of oleamide’s influence on
P450s we also measured the serum concentrations of hormones known
to be involved in the regulation of P450 metabolic activity, namely,
prolactin, corticosterone, and free triiodothyronine. Finally, the interactions
of oleamide with human nuclear receptors that regulate the
expression of P450 genes, namely, the pregnane X receptor (PXR),
aryl hydrocarbon receptor (AhR), and constitutive androstane receptor
(CAR), were also tested. The ability to induce their target P450 genes
was examined in primary human hepatocytes.
Material and Methods
Chemicals
The following compounds were provided by Sigma-Aldrich (St. Louis, MO):
oleamide (CAS no. 301-02-0), prednisone, testosterone, chlorpropamide, phenacetin,
diclofenac, 49-hydroxydiclofenac, acetaminophen, ibuprofen, dextromethorphan,
dextrorphan, laudanosine, triethylamine, NADP, glucose-6-phosphate dehydrogenase,
glucose-6-phosphate, MgCl2, EDTA, KH2PO4, Na2HPO4, sucrose, NH4HCO3,
CH3COOH, NH3, KCl, bovine serum albumin, dimethylsulfoxide (DMSO),
a-naphthoflavone, ketoconazole, fluconazole, ticlopidine, rifampicin, CITCO
(6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde O-(3,4dichlorobenzyl)oxime),
and 3-methylcholanthrene. Propylene glycol was obtained
from Fagron (Olomouc, CZE). The metabolites of testosterone, namely, 2b-, 2a-,
7a-, 6b-, 16a-, and 16b-hydroxytestosterone, were purchased from Steraloids Inc.
(Newport, RI). The primary and secondary antibodies, which were used for
Western blotting analyses, are described in detail in Table 1. Chemicals and organic
solvents for high-performance liquid chromatography (HPLC) analysis were
purchased from Lach-ner (Neratovice, CZE) and they were of an HPLC-gradient or
LC-mass spectroscopy (MS) grade. Cell culture media, nonessential amino acids,
and fetal bovine serum were purchased from Thermo Fisher Scientific, Inc.
(Waltham, MA).
Animals
The experiments were carried out on male Wistar albino rats (230 6 20 g),
which were purchased from the Masaryk University breeding facility (Brno,
CZE). The rats were housed under standard laboratory conditions (22 6 2°C
room temperature; 55% 6 5% room humidity; 12-hour light/dark cycle).
Animals had free access to water and food. All experiments were performed in
accordance with Czech act no. 246/1992 and with the approval of both the
regional and national Czech Central Commission for Animal Welfare (MSMT-
35 473/2012-30).
Experimental Design
After 5 days of acclimatization, the rats were randomly divided into five
experimental groups. All animals were treated intraperitoneally for 7 consecutive
days. Three groups (n = 10/group) were administered oleamide dissolved in
propylene glycol at doses of 0.1, 1, and 10 mg/kg per day The doses of oleamide
used in our experiment were selected according to preclinical studies in which
oleamide evoked various kinds of biologic activities (Fedorova et al., 2001;
Huitron-Resendiz et al., 2001). The control group was treated with the appropriate
volume of the vehicle (propylene glycol 1 ml/kg, n = 6). Because there were no
data on the influence of propylene glycol on P450s, a group of animals
administered saline (1 ml/kg, n = 10) was also used. All animals were sacrificed
under ether anesthesia by decapitation 24 hours after the last drug/vehicle
administration, and the samples of liver tissue were drawn immediately without
any liver perfusion and frozen at 280°C.
Preparation of Rat Liver Microsomes and Determination of Total Protein
and P450 Content
Rat liver microsomes (RLMs) were isolated from 3 g of liver tissue from each
individual animal. Each liver tissue sample was homogenized in 20 mM Tris/KCl
buffer (pH 7.4). RLMs were then isolated from the homogenate by differential
ultracentrifugation (19,000g, 20 minutes and 2Â 105,000g, 60 minutes) in 20 mM
Tris/KCl buffer (pH 7.4), including washing with 0.15 M KCl. The final pellet
was reconstituted with 0.25 M Tris/sucrose buffer (pH 7.4) to yield 1 ml of RLMs
from each gram of isolated tissue and stored at 280°C. The total protein content in
the microsomal preparations was assessed according to the method of Lowry et al.
(1951) using bovine serum albumin as a standard. Determination of total P450
content was assessed using a CO difference spectroscopy method according to
Omura and Sato (1964). The total protein content and total P450 content are
expressed as milligrams of protein per milliliter and nanomoles of P450/ml of
RLMs, respectively. RLMs were reconstituted in volume of Tris/sucrose buffer to
resemble the original liver tissue content.
TABLE 1
Primary and secondary antibodies used for Western blotting
Antibody
Biologic
Source
Speciesa
Catalog No. Company Dilution
Anti-CYP1A2 Mouse m, r, h sc-53241 Santa Cruz Biotechnologyb
1:500
Anti-CYP2B1/2B2 Mouse m, r sc-73546 Santa Cruz Biotechnology 1:500
Anti-CYP2C11 Goat r R-PAP 121 Cypexc
1:5000
Anti-CYP3A1 Mouse m, r, h sc-53246 Santa Cruz Biotechnology 1:1500
Anti-b-actin Rabbit m, r, h, b, p, k sc-4970 Cell Signaling Technologyd
1:500
Anti-mouse Goat A4416 Sigma-Aldriche
1:5000
Anti-goat Rabbit A5420 Sigma-Aldrich 1:5000
Anti-rabbit Goat A6667 Sigma-Aldrich 1:5000
a
m, mouse; r, rat; h, human; b, bovine; p, pig, k, monkey.
b
Dallas, TX.
c
Dundee, GBR.
d
Danvers, MA.
e
St. Louis, MO.
914 Dovrtelova et al.
atASPETJournalsonJuly10,2018dmd.aspetjournals.orgDownloadedfrom
85
Determination of P450 Activity in RLM
Assessment of the relative activity of CYP1A2, CYP2B, CYP2C, CYP2D2,
and CYP3A enzymes were based on the rate of biotransformation of a specific
marker in RLMs with an NADPH-generating system according to the previously
described method of Wojcikowski et al. (2008), with a slight modification.
The incubation mixture of the final 0.5 ml volume contained a phosphate buffer
(50 mM; pH 7.4), EDTA (1.1 mM), NADP (1.2 mM), glucose-6-phosphate
(4.4 mM), MgCl2 (3.2 mM), glucose-6-phosphate dehydrogenase (1 U/ml),
RLMs (1 mg/ml of total protein content), and a specific marker for determination
of the selected P450 enzymes activity. The reaction was stopped after incubation
at 37°C in a shaking water bath by the addition of 50 ml of methanol and cooling in
ice. The concentrations of markers and their specific metabolites were measured
with one of two HPLC systems: a Shimadzu LC-10 (Shimadzu, Tokyo, Japan)
with a DAD detector (SPD-M10AVP) and a fluorescence detector (RF 10AXL) or
a Dionex UltiMate 3000RS LC (Thermo Fisher Scientific) with a DAD detector.
Reaction rates exhibited a linear relationship to the incubation time and protein
concentration under the above-mentioned conditions. The relative metabolic
activities of all P450s were studied by measuring the rates of P450-specific
reactions and were expressed as a molar concentration of the metabolite per
minute per milligram of the total protein in RLMs. The specific metabolic
activities were also calculated with respect to the total P450 content and are
expressed as the molar concentration of the metabolite per minute per nanomolar
of total P450 content. The accuracy and precision of the HPLC methods were
below 10% of relative standard deviation within the calibration range. The
calibration range always included the concentrations of analytes in the measured
samples.
Determination of CYP1A2 Activity. The rate of phenacetin O-deethylation
was used for CYP1A2 activity assessment. The substrate concentration was
300 mM and the incubation period was 20 minutes. After the addition of the
internal standard (chlorpropamide) to the incubation mixture, the analytes were
extracted from the microsomal suspension with diethyl ether (4 ml, 10 minutes of
horizontal vortexing, 1400 rpm), the organic phase was evaporated, and the
residue was dissolved in 250 ml of the mobile phase. The following gradient mode
of separation was applied: 0:00–5:00 minutes, 90:10 (v/v 0.1% NH4CH3COO/
acetonitrile, pH 4.6); from 5:00 to 6:00 minutes, 35:65; and from 6:00 to the end of
the analysis at 8:00 minutes, 90:10. The separation of acetaminophen, phenacetin,
and chlorpropamide was achieved using Kinetex, 2.6 mm PFP 100A column
(150 Â 4.60 mm; Phenomenex, Torrance, CA) thermostatted at 45 6 0.1°C, at a
flow rate of 1.2 ml/min, and UV detection at 245 nm.
Determination of CYP2A, CYP2B, CYP2C11, and CYP3A Activity.
Testosterone 7a-, 16b-, 2a-, and 16a-, 2b-, and 6b-hydroxylations were used for
the activity assessment of CYP2A, CYP2B, CYP2C11, and CYP3A, respectively.
The substrate concentration was 400 mM, prednisone was used as the internal
standard, and the incubation time was 15 minutes. The separation conditions for
testosterone metabolite determination have been described in detail previously
(Dovrtelova et al., 2015).
Determination of CYP2C6 Activity. Diclofenac 49-hydroxylation was used
for measuring CYP2C6 activity, and the substrate concentration was 100 mM.
Ibuprofen was used as the internal standard, and the incubation time was
20 minutes. The separation conditions for diclofenac and 49-hydroxydiclofenac
determination have been described in detail previously (Noskova et al., 2016).
Determination of CYP2D2 Activity. Dextromethorphan O-demethylation
was used for measuring CYP2D2 activity. The substrate concentration was
500 mM, and the incubation time was 20 minutes. After addition of the internal
standard (laudanosine) and Na2CO3 (250 ml, 0.5 M) to the incubation mixture, the
analytes were extracted from the microsomal suspension with 4 ml of 1-butanol:
hexane mixture (1:9). The organic phase was decanted, and 300 ml of 0.01 M HCl
was added. After 10 minutes of horizontal shaking at 1400 rpm, the samples were
frozen. The organic layer was discarded, and a 5 ml portion of the aqueous phase
was injected into the HPLC system. The separation of dextrorphan, dextromethorphan,
and laudanosine was achieved in an isocratic separation mode with
fluorescence detection according to the method of Zimova et al. (2000).
Western Blotting
Western blot analyses were used to detect the protein expression of CYP2B1/2,
CYP3A1, CYP1A2, and CYP2C11 in RLMs. Individual samples were mixed
with a loading buffer (0.125 M Tris pH 6.8, 20% glycerol, 10% mercaptoethanol,
4% SDS, 0.004% bromphenol blue), boiled for 5 minutes at 95°C, and
separated on a 12% SDS-PAGE gel; 10 mg of RLMs was loaded per lane.
After electrophoresis, proteins were electrotransferred (100 V, 75 minutes) onto
polyvinylidene fluoride membranes (Merck Millipore, Darmstadt, DEU), which
were blocked with 5% nonfat milk in Tris-buffered saline with 0.08% Tween 20 at
room temperature for 1 hour. The membranes were incubated with primary
antibodies overnight at 4°C, followed by incubation with the appropriate
secondary antibodies for 1 hour at room temperature. The antibodies were
dissolved according to Table 1, and the b-actin antibody was used as a loading
control for normalization. Where necessary, the membranes were stripped in a
stripping buffer (74.3:25:10:0.7 H2O:1 M Tris (pH 7.4):20% SDS:b-mercaptoethanol),
washed, and reblotted with another antibody. The intensities of the bands
on the membranes were visualized using Immobilon Western Chemiluminescent
HRP Substrate (Millipore, Watford, GBR) and FUSION SL (Vilber Lourmat,
DEU). The Western blots were quantified using the software ImageJ (version
1.48; National Institutes of Health, Bethesda, MD). Statistical analyses were done
using at least three repetitions of individual animals of each group.
P450 Inhibition Assay In Vitro
RLMs from drug-naïve control animals, which were pooled from four
individuals, were used for a direct inhibition assay in vitro. The incubation
mixtures were processed as described in the section Determination of P450
Activity in R, except the final volume was 1 ml and the total protein content in
RLMs was 0.25 mg/ml. Each sample was prepared in triplicate. After 10 minutes
of preincubation with a different concentration of oleamide (see to follow) at 37°C
in a shaking water bath, reactions were initiated by the addition of specific
markers. The incubation times were 40 minutes (phenacetin and dextromethorphan),
20 minutes (testosterone), and 30 minutes (diclofenac).
First, pilot experiments were performed with single concentrations of the
substrates phenacetin (300 mM), testosterone (100 mM), diclofenac (8 mM), or
dextromethorphan (28 mM), and three concentrations of oleamide (0.1, 1, and
100 mM). Based on this experiment, we decided to perform only the inhibition
assay of CYP2C6 (with diclofenac as a probe substrate). The kinetic parameters of
CYP2C6 metabolic activity were determined using Michaelis-Menten kinetics.
For construction of the Dixon plot and determination of the inhibition constant
(Ki), diclofenac was used at concentrations of 4, 8, and 16 mM, oleamide at 0, 10,
25, 37.5, and 50 mM.
P450 Enzymatic Activity Assays
Human recombinant CYP3A4, CYP2B6, CYP2C9, and CYP1A2 enzymes
expressed in a microsomal fraction of P450 cDNA baculovirus-infected insect
cells (CYP450-Glo CYP3A4 Assay, CYP450-Glo CYP2B6 Assay, CYP450-Glo
CYP2C9 Assay, and CYP450-Glo CYP1A2 Assay; Promega, Hercules, CA)
were used to evaluate the interaction of oleamide with these enzymes in vitro
according to the manufacturer’s protocols. Ketoconazole, ticlopidine, fluconazole,
and a-naphthoflavone were used as prototypical inhibitors of CYP3A4,
CYP2B6, CYP2C9, and CYP1A2 enzymes.
Nuclear Receptors and Cell Viability Assays
Cell Lines. A HepG2 human Caucasian hepatocyte carcinoma cell line was
purchased from the European Collection of Cell Cultures (ECACC, Salisbury,
GBR) and maintained in Dulbecco’s modified Eagle’s medium (DMEM)
supplemented with 10% fetal bovine serum, 1% nonessential amino acids, and
2 mM L-glutamine (Sigma-Aldrich).
Cell Viability Assay. To evaluate the toxicity of oleamide in HepG2 cells, a
CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega, Madison,
WI) was performed according to the manufacturer’s protocol.
Plasmids. The construction of the PXR-responsive p3A4-luc construct
containing XREM and basal promoter sequences and pSG5-hourPXR expression
construct have been described by Rulcova et al. (2010). The AHR reporter
plasmid (pXRE-luc) was described in our previous report (Dvorak et al., 2008).
The pRL-TK construct was purchased from Promega. The constructs pCARC/VP16
and pCAR-N/GAL4 for the CAR assembly assay have been described in
a previous paper of ours (Carazo Fernandez et al., 2015).
Reporter Gene Assays (PXR, AhR). All transient transfection gene
reporter assays were performed with LipofectAMINE 3000 transfection
Interactions of Oleamide with Cytochrome P450 915
atASPETJournalsonJuly10,2018dmd.aspetjournals.orgDownloadedfrom
86
reagent (Invitrogen/Life Technologies, Carlsbad, CA) in HepG2 cells.
Briefly, cells were seeded onto 48-well plates and 24 hours later were
transfected with a luciferase reporter construct (150 ng/well), PXR
expression plasmid (100 ng/well, for PXR experiments), and Renilla
reniformis luciferase transfection control plasmid (pRL-TK) (30 ng/well).
Then, the cells were stabilized for 24 hours before treatment and further
Fig. 1. Changes in total protein content (A), total P450 content (B), and relative content of P450 (C) (nanomoles per milligram of microsomal protein) after systemic administration of
oleamide. The total protein content in individual RLMs was assessed according to the method of Lowry et al., and the total P450 content was determined using a CO difference spectroscopy
method according to Omura et al. Animals were treated intraperitoneally with oleamide 0.1 (n = 10), 1 (n = 10), 10 mg/kg per day (n = 10), and propylene glycol (control group, n = 6). Bars
and whiskers express the mean (S.D.). Statistical significance was assessed by Kruskal-Wallis test followed by multiple comparisons of mean ranks (A and C) and one-way ANOVA test followed
by Tukey’s significant difference test for unequal sample sizes (B). Statistical significance with respect to the control group (propylene glycol) is indicated with *P # 0.05.
Fig. 2. (A) Relative metabolic activities of CYP2A,
CYP2B, CYP3A, and CYP2C11 after systemic administration
of oleamide, measured as the rate of testosterone
hydroxylation and shown as the percentage of the rate of
reaction in the control group. The absolute control values
(picomoles per minute per milligram of total protein
content) were as follows: 217.4 6 23.7, 37.5 6 6.1, 76.2
6 14.8, 614.8 6 92.0, 3303.0 6 779.0, and 2934.5 6
791.6 (testosterone 7a-, 16b-, 2b-, 6b-, 2a-, and 16ahydroxylations,
respectively). Animals were treated intraperitoneally
with oleamide 0.1 (n = 10), 1 (n = 10),
10 mg/kg per day (n = 10), and propylene glycol (control
group, n = 6). Reactions were performed in the presence of
testosterone (400 mM) in RLMs (1 mg/ml of the total
protein content) with an NADPH-generating system in a
final volume of 1 ml at 37°C for 20 minutes. (B) Specific
metabolic activities of CYP2A, CYP2B, CYP3A, and
CYP2C11 after systemic administration of oleamide
measured as the rate of testosterone hydroxylation per
nanomoles of total P450 content per minute and shown as
the percentage of the rate of reaction in the control group.
The absolute control values (picomoles per minute per
nanomoles of total P450 content) were as follows: 350.8 6
38.8, 60.3 6 8.2, 122.5 6 20.2, 989.5 6 127.0, 5321.8 6
1188.7, and 4726.4 6 1209.4 (testosterone 7a-, 16b-, 2b-,
6b-, 2a-, and 16a- hydroxylations, respectively). All values
are expressed as bar graphs of the mean (S.D.). Statistical
significance was assessed by the Kruskal-Wallis test,
followed by multiple comparisons of mean ranks (A) and
one-way ANOVA test (B). Statistical significance with
respect to the control group (propylene glycol, n = 6) is
indicated with **P # 0.01.
916 Dovrtelova et al.
atASPETJournalsonJuly10,2018dmd.aspetjournals.orgDownloadedfrom
87
maintained in phenol red–free medium (150 ml) containing the evaluated
compounds at the indicated concentrations for an additional 24 hours. After
treatment, the cells were lysed, and luciferase activity was measured (Dual
Luciferase Reporter Assay; Promega). Two modes were used as follows: 1)
agonistic mode, in which the cells were treated with 0.1% DMSO or
prototype ligand 5 mM or three concentrations of oleamide 1 or 10 or
30 mM; 2) antagonistic mode, in which the cells were treated with 0.2%
DMSO or with prototype ligands (5 mM) in combination with oleamide at
concentrations of 1 or 10 or 30 mM. Rifampicin (PXR activator) and
3-methylcholanthrene (AhR activator) were used as the prototype ligands.
The data are expressed as a fold-change in firefly luciferase activity
normalized to Renilla luciferase activity in each sample and relative to the
vehicle (DMSO 0.1%)-treated control means, which were set to 1.
Statistical analyses were done using at least three independent assays
(n = 3) performed in triplicate.
Assembly Assay (CAR). The CAR ligand binding domain (LBD) assembly
assay is based on two hybrid expression constructs encoding the C- (pCARC/VP16)
and N- (pCAR-N/GAL4) terminal parts of human CAR LBD that are
cotransfected together with the pGL5-luc luciferase reporter plasmid (Promega)
containing upstream activating sequence binding sites. A ligand promotes the
connection of the two parts of the CAR LBD, resulting in luciferase transactivation.
Transient transfection assays were carried out using LipofectAMINE
3000 transfection reagent (Invitrogen/Life Technologies) in HepG2 cells. Cells were
seeded into 48-well plates andtransfected with a pGL5-luc luciferase reporterconstruct
(80 ng/well), the expression constructs pCAR-C/VP16 and pCAR-N/GAL4
(80 ng/well), and the Renilla reniformis luciferase transfection control plasmid
(pRL-TK) (30 ng/well) 24 hours later. Cells were maintained in a phenol red–free
medium (150 ml) and treated with the tested compounds. After treatment, the cells
were lysed, and luciferase activity was measured with a luciferase detection system
(Dual Luciferase Reporter Assay; Promega). Two modes were used as follows: 1)
agonistic mode, in which the cells were treated with 0.1% DMSO or CITCO (CAR
activator) 5 mM or three concentrations of oleamide, 1 or 10 or 30 mM; and 2)
antagonistic mode, in which the cells were treated with 0.2% DMSO or CITCO 5 mM
in combination with oleamide at concentrations of 1 or 10 or 30 mM. The data are
expressed as the fold-change in firefly luciferase activity normalized to Renilla
luciferase activity in each sample and relative to the vehicle (DMSO 0.1%)-treated
control means, which were set to 1. Statistical analyses were done using at least three
independent assays (n = 3) performed in triplicate.
Primary Cultures of Human Hepatocytes and Quantitative Reverse
Transcription Polymerase Chain Reaction. Human long-term hepatocytes in a
monolayer (batch HEP220971; Biopredic International, Saint Grégoire, France)
were prepared from the livers of a 46-year-old Caucasian man. The medium was
replaced with a serum-free medium the day after delivery of the primary human
hepatocytes, and the cultures stabilized for an additional 48 hours before
Fig. 3. (A) Relative metabolic activity of CYP2C6 after systemic administration of oleamide, measured as rate of diclofenac 49-hydroxylation and shown as the percentage
of the rate of reaction in the control group. The absolute control value was 1194.4 6 184.4 pmol/min per milligram of total protein content. (B) Relative metabolic activity of
CYP1A2 after systemic administration of oleamide, measured as the rate of phenacetin O-deethylation and shown as the percentage of the rate of reaction in the control
group. The absolute control value was 361.3 6 21.5 pmol/min per milligram of total protein content. (C) Relative metabolic activity of CYP2D2 after systemic
administration of oleamide, measured as rate of dextromethorphan O-demethylation and shown as the percentage of the rate of a reaction in the control group. The absolute
control value was 1154.9 6 135.0 pmol/min per milligram of total protein content. Animals were treated intraperitoneally with oleamide, 0.1 (n = 10), 1 (n = 10), 10 mg/kg
per day (n = 10), and propylene glycol (control group, n = 6). Reactions were performed in the presence of diclofenac (100 mM), phenacetine (400 mM), or dextromethorphan
(500 mM) in RLMs (1 mg/ml of the total protein content) with the NADPH-generating system in a final volume of 1 ml at 37°C for 15 minutes (phenacetine) or 20 minutes
(diclofenac and dextromethorphan). (D–F) Specific metabolic activities of CYP2C6, CYP1A2, and CYP2D6 after systemic administration of oleamide measured as the rate
of testosterone hydroxylation per nanomoles of total P450 content per minute and shown as the percentage of the rate of reaction in control group. The absolute control values
(picomoles per minute per nanomoles of total P450 content) were as follows: 1926.3 6 292.4, 582.48 6 23.4, and 1859.5 6 169.2 (diclofenac 499-hydroxylation, phenacetin
O-deethylation, and dextromethorphan O-demethylation, respectively). Bars and whiskers express the mean (S.D.). Statistical significance was assessed by one-way ANOVA
test, followed by Tukey’s significant difference test for unequal sample sizes. Statistical significance with respect to the control group (propylene glycol, n = 6), is indicated
with ***P # 0.001.
Interactions of Oleamide with Cytochrome P450 917
atASPETJournalsonJuly10,2018dmd.aspetjournals.orgDownloadedfrom
88
treatment. The cultures were maintained at 37°C in 5% CO2 in a humidified
incubator and treated with oleamide (10 mM) together with prototype CAR
(CITCO, 1 mM), PXR (rifampin, 10 mM), and AHR (3-methylcholantrene,
10 mM) ligands for 48 hours before the total RNA isolation. cDNA synthesis and
quantitative reverse transcription polymerase chain reaction (qRT-PCR) analyses
were performed as described previously (Rulcova et al., 2010).
Hormone Assays
Serum concentrations of corticosterone were analyzed by radioimmunoassay
after dichloromethane extraction as described previously (Jezova et al., 1994).
The intra-assay and interassay coefficient of variation values were 6% and 8%,
respectively, and the sensitivity of the assay was 0.5 mg/100 ml of plasma. The
concentrations of free triiodothyronine and prolactin in serum were measured
using commercially available enzyme-linked immunoassay (ELISA) kits (rat-free
triiodothyronine ELISA kit and Prolactin rat ELISA; Cusabio Technology,
Houston, TX, respectively). The intra- and inter-assay precision of the kits
(coefficient of variation %) were less than 15%. The sensitivity and detection
range reported by the manufacturer were 0.125 and 0.125–50 ng/ml for prolactin
and 0.38 and 2–32 pmol/liter for triiodothyronine, respectively.
Data Analysis
The results of the determination of P450 activities were statistically evaluated
using either 1) parametric one-way analysis of variance (ANOVA), followed by
Tukey’s honestly significant difference test for unequal sample sizes with a normal
distribution of data; or 2) nonparametric Kruskal-Wallis test followed by multiple
comparisons of mean ranks for all groups with a non-normal distribution of data. The
statistical evaluation of the results from Western blot analyses was performed using
the Wilcoxon signed-rank test. One-way ANOVA with a Dunnett’s post hoc test
were used for data from nuclear receptor assays, human P450 inhibition assays, and
primary hepatocytes assays. The nonparametric Mann-Whitney U test was used to
compare the hormone levels in two sets of samples. All values are expressed as means
(S.D.), and they were computed using the software Statistica 13 (TIBCO Software,
Palo Alto, CA). Results were considered statistically significant when P # 0.05. The
Ki value was determined using a Dixon plot and calculated with the software
SigmaPlot (SPSS, Inc., Chicago, IL). The Michaelis-Menten parameters (Km and
Vmax) and the kinetic pattern of inhibition were also assessed using SigmaPlot.
Results
Effect of Oleamide on Liver P450 Activity In Vivo
In preliminary experiments, we evaluated how propylene glycol (a
vehicle of oleamide) influenced the total microsomal protein, P450
levels, and their metabolic activity. We found no statistical difference
comparing these results with experiments with saline-treated animals
(data not shown). Hence, propylene glycol-treated animals were further
used as controls for oleamide-administered animals.
Total Protein and Total P450 Content. Animals administered the
highest dose of oleamide exhibited a significant decrease in the content
in both total protein (P , 0.05, Kruskal-Wallis test, Fig. 1A) and P450
(F(4,41) = 4.89 P , 0.01, one-way ANOVA test; Fig. 1B) in RLMs
compared with controls. The relative content of P450, representing
the ratio of P450 to total protein content (nanomoles per milligram of
isolated protein in RLMs) was calculated, and again there was a
significant decrease (F(4,41) = 4.89, P , 0.01, one-way ANOVA test) in
the group treated with the highest dose of oleamide compared with the
group treated with propylene glycol alone (Fig. 1C).
P450s Metabolic Activity. The incubation of RLMs isolated from
oleamide-treated animals with selective markers of P450 metabolic activity
resulted in a variety of effects, depending on the P450 isoform. None of the
tested oleamide doses influenced the relative or specific metabolic activities
of CYP2A and CYP2C6 (Fig. 2, A and B; Fig. 3, A and D respectively)
(for definitions of relative and specific metabolic activity, see section
Determination of P450 Activity in RM). The rate of testosterone 2b and
6b-hydroxylation decreased to 77% of the control value. Nevertheless,
the change in CYP3A relative activity was not statistically significant
(Fig. 2A). In contrast, the relative activities of the CYP1A (F(4,41) = 6,33
P , 0.001, one-way ANOVA test, Fig. 3B), CYP2B, CYP2C11
(P , 0.01, Kruskal-Wallis test, Fig. 2A), and CYP2D2 (F(4,40) = 7,42
P , 0.001, one-way ANOVA test, Fig. 3C) were significantly decreased
in animals treated with the highest dose of oleamide. Lower doses of
oleamide were incapable of decreasing the relative metabolic activity of the
P450s. Specific metabolic activities with respect to the total content of P450
did not exhibit any differences between the oleamide-treated animals and
controls in their CYP1A2 (Fig. 3E), CYP2D6 (Fig. 3F), or CYP2B (Fig.
2B). An exception was CYP2C11 (Fig. 2B), where the activities of both
the 2a-, and 16a-hydroxylations of testosterone were decreased in the
group treated with the highest dose of oleamide (one-way ANOVA test
F(4,39) = 8,22 P , 0.001 and F(4,41) = 5,31 P , 0.001, respectively).
Content of Distinct P450s. The amount of distinct P450 proteins was
determined only for P450s with a significant change in the relative
metabolic activity, with the exception of CYP2D2, because the monoclonal
antibody was not available. In addition, the protein content was
Fig. 4. Western blot analysis showing the expression of CYP1A2, CYP2B, CYP2C11, and CYP3A1 enzymes in RLMs after systemic administration of oleamide. Animals
were treated intraperitoneally with oleamide 0.1 (n = 10), 1 (n = 10), 10 mg/kg per day (n = 10), and propylene glycol (control group, n = 6). (A) Representative blots of three
individual animals of each group show expression of each indicated protein (10 mg in all cases). (B–E) Bar graphs show quantification of blots for CYP1A2, CYP2B,
CYP2C11, and CYP3A1 protein, respectively. The bars represent means (S.D.) of individual animals of each group in three repetitions. Blots were quantified relative to the
loading control (b-actin). Statistical significance was assessed by Wilcoxon signed-rank test and is shown as **P # 0.01; ***P # 0.001 compared with the control.
918 Dovrtelova et al.
atASPETJournalsonJuly10,2018dmd.aspetjournals.orgDownloadedfrom
89
measured for CYP3A, where the decrease in metabolic activity was on
the threshold of statistical significance. Blots were quantified, and the
decrease in protein levels was present in all evaluated P450s after the
10 mg/kg per day treatment with oleamide (Fig. 4). The most influenced
enzyme was CYP1A2, with a decrease in protein content to 33.6% 6
12% of the amount determined in the control group, followed by CYP3A
(41.9% 6 12% of the control group). The amount of CYP2B and
CYP2C11 decreased similarly to 54.5% 6 8% and 53.2% 6 1.3% of the
control group, respectively.
Effect of Oleamide In Vitro
Rat P450 Inhibition Assays In Vitro. The results of the pilot study
when oleamide was incubated with RLMs from naïve animals showed that
oleamide did not influence the activities of CYP2A, CYP2B, CYP3A, and
CYP2C11 (Table 2). The metabolic activities of these enzymes ranged
from 97% to 101% of the activity of the control group in all analyzed
testosterone metabolites and at all concentrations of oleamide used.
Nevertheless, oleamide weakly inhibited phenacetin O-demethylation,
indicating a weak inhibition of CYP1A2 activity. The rate of the reaction
was suppressed to 77% of the rate of the control at a 100 mM concentration
of oleamide in the incubation mixture. With CYP2D2, it was similarly
observed that the metabolic activity of the enzyme was suppressed up to
70% of the rate of the control at a 100 mM concentration of oleamide. Such
a high concentration of any drug is usually clinically irrelevant. Together
with the fact that the inhibition of metabolic activities was very weak, the Ki
value was not assessed for CYP1A2 and CYP2D2.
CYP2C6 was the most sensitive P450 to the inhibitory effect of
oleamide in the pilot study (Table 2). We determined the kinetic
parameters of CYP2C6 metabolic activity by using Michaelis-Menten
kinetics (Km = 7.2 6 0.94 mM, Vmax = 1.03 6 0.04 nmol/min per
milligram of protein). The 49-hydroxylation of diclofenac was inhibited
by 56%, with a final concentration of oleamide in the incubation mixture
of 100 mM. Thus, further studies to determine the type of inhibition were
done. Competitive, noncompetitive, and uncompetitive models of inhibition
were evaluated; the respective Ki values were 28.7, 71.6, and
28.9 mM. The Akaike’s Information Criterions corrected (AICc) in the
individual models were used to evaluate the suitability of each model.
The values of AICc were 2652.591, 2648.078, and 2634.012 for the
competitive, noncompetitive, and uncompetitive models, respectively.
Therefore, the competitive mode of inhibition seems to be an appropriate
model with the best fit (Fig. 5).
Nuclear Receptors and Cell Viability Assays. Oleamide was tested
at a range of concentrations from 1 to 30 mM for interaction with PXR,
CAR, and AhR in HepG2 cells by gene reporter assays. We found no
significant activation by the compound for any of these receptors (Fig.
6). Consistently, we did not observe inhibition of these nuclear receptors
in antagonistic experiments with prototype PXR, CAR, and AhR ligands
(rifampicin, CITCO, 3-methoxychlorantrene, respectively) (Fig. 6).
In addition, potential cytotoxicity was studied with the CellTiter 96 assay
in HepG2 cells. The results clearly showed that oleamide is not toxic at the
highest concentration assayed (30 mM) in HepG2 cells (data not shown).
Human P450 Inhibition Assays and Induction Experiments in
Primary Human Hepatocytes by Oleamide. In the next set of
experiments, we studied whether oleamide could inhibit human
TABLE 2
P450s interactions with oleamide in vitro (data from the pilot experiment)
The metabolic activities of CYP2A, CYP2B, CYP3A, and CYP2C11 were measured as the rate of testosterone hydroxylation. The
absolute control values (picomoles per milligram of protein per minute) were as follows: 1866.7 6 0.9, 1773.7 6 0.4, 2080.4 6 3.5, 2123.9
6 5.0, 1773.6 6 0.8, 1825.6 6 1.3 (testosterone 7a-, 16b-, 2a-, 16a-, 2b-, and 6b- hydroxylation, respectively). The metabolic activity of
CYP1A2 was measured as the rate of phenacetin O-deethylation and control value of 53.3 6 1.2 pmol/mg of protein per minute. The
metabolic activity of CYP2C6 was measured as the rate of diclofenac 49-hydroxylation and the control value 203.8 6 11.3 pmol/mg of
protein per minute. The metabolic activity of CYP2D2 was measured as the rate of dextromethorphan O-demethylation and a control value
of 320.2 6 7.6 pmol/mg of protein per minute. Experiments were performed with single concentrations of substrates phenacetin (300 mM),
testosterone (100 mM), diclofenac (8 mM), or dextromethorphan (28 mM) and three concentrations of oleamide in RLMs from naïve
animals (0.25 mg/ml of the total protein content) with the NADPH-generating system in a final volume of 1 ml at 37°C. After 10 minutes of
preincubation with a different concentration of oleamide, reactions were initiated by the addition of specific markers. The incubation times
were 40 (phenacetin and dextromethorphan), 20 (testosterone), and 30 minutes (diclofenac). All reactions were performed in triplicate.
Oleamide
CYP450 Metabolic Activity (% Activity of Control)
1A2 2C6 2D2 2A 2B 2C11 3A
0.1 mM 99.7 110.5 110.0 99.9a
100.0b
100.1c
99.6d
100.0e
100.1f
1 mM 108.6 94.2 96.8 100.1a
100.0b
100.8c
100.6d
100.0e
100.2f
100 mM 774 44.2 70.4 98.4a
99.9b
100.9c
99.4d
100.0e
100.0f
a
Testosterone 7a-hydroxylation.
b
16b-hydroxylation.
c
2a-hydroxylation.
d
16a-hydroxylation.
e
2b-hydroxylation.
f
6b-hydroxylation.
Fig. 5. Dixon plot of the effect of oleamide on 49-hydroxydiclofenac formation in RLMs from
naïve animals in a competitive model of inhibition. Reactions were performed in the presence of
diclofenac (4, 8, 16 mM) and various concentrations of oleamide (0, 10, 25, 37.5, 50 mM) in
RLMs (0.25 mg/ml of the total protein content) with the NADPH generating system in a final
volume of 1 ml at 37°C for 30 minutes after 10 minute preincubation. The reaction was
performed in triplicate. V = velocity of the reaction (nanomoles of 49hydroxydiclofenac per
minute per milligram protein) and I = concentration of oleamide (mM).
Interactions of Oleamide with Cytochrome P450 919
atASPETJournalsonJuly10,2018dmd.aspetjournals.orgDownloadedfrom
90
CYP2B6, CYP2C9, CYP3A4, and CYP1A2 enzymes in vitro and
whether it could induce key P450 genes regulated by the xenobiotic
nuclear receptors CAR, PXR, and AHR.
We found that oleamide inhibits none of tested human P450s up to a
concentration of 30 mM (Fig. 7, A–D). With CYP2B6, we observed an
insignificant inhibition of metabolic activity at a 30 mM concentration of
oleamide (Fig. 7A.).
We then treated primary human hepatocytes with 10 mM oleamide
and CAR (CITCO, 1 mM), PXR (rifampicin, 10 mM), and AhR
(3-methylcholantrene, 10 mM) ligands. We observed a significant induction
of CYP2B6 mRNA by CITCO, CYP3A4 mRNA by rifampicin,
and CYP1A2 mRNA by 3-methylcholantrene after 48 hours of treatment
(Fig. 7E). Oleamide slightly upregulated CYP2B6, CYP3A4, and
CYP1A2 mRNA (2.0-, 2.5-, and 3.3-fold, respectively), but the effects
were not statistically significant.
Serum Hormone Concentrations
We found no statistical differences between control and oleamide-treated
animals in serum levels of any of the hormones measured (Fig. 8).
Discussion
In this study, we demonstrate the effect of the endocannabinoid
oleamide on rat liver content and activities of key liver P450s, namely,
CYP1A2, CYP2A, CYP2B, CYP2C, CYP2D2, and CYP3A. The
in vivo effect was assessed after the repeated administration of three
different doses of oleamide to rats (0.1, 1, and 10 mg/kg per day).
The doses were selected with respect to available data for oleamide
biologic activity, including hypnogenic (10–20 mg/kg, i.p.) (HuitronResendiz
et al., 2001), analgesic (ED50 = 66 mg/kg, i.p.) (Fedorova et al.,
2001), hypothermic (ED50 = 14 mg/kg, i.p.; 2.5–20 mg/kg, i.p,
respectively) (Fedorova et al., 2001; Huitron-Resendiz et al., 2001),
anxiolytic (5 mg/kg, i.p.) (Fedorova et al., 2001), and antidepressant-like
(5 mg/kg, i.p.) (Ge et al., 2015) effects in animal experiments. Our
results showed that oleamide at a dose of 10 mg/kg per day decreased
the total protein content, as well as the total P450 protein levels in liver
(Fig. 1); however, the metabolic activities of the individual tested P450s
varied (Figs. 2 and 3). The overall decrease in the relative metabolic activity
could be interpreted in two ways. It could be caused by an inhibition
of P450 enzymes in terms of a decreased ability to catalyze the conversion
of substrate to the appropriate metabolite with the preserved amounts of
enzyme. The other possibility is the downregulation of P450s, meaning
decreased amounts of distinct P450 proteins with the preserved metabolic
activity. In our study, the relative metabolic activities of P450s were
assessed after the standardization per total protein content, but not per
individual amount of P450s. Decreased levels of distinct P450s (Fig. 4)
corresponded to their decreased relative metabolic activities (Figs. 2 and 3).
When relative metabolic activities were recalculated to specific metabolic
activities with respect to the total P450 content in the incubation mixtures,
there were no significant changes in the rate of marker reactions between
the tested groups, except for the decreased activity of CYP2C11 with the
highest dose of oleamide (Fig. 2). The reduction in CYP2C11 activity was
Fig. 6. Interaction of oleamide with PXR, AhR, or CAR in luciferase assays in HepG2 cells in agonistic (A, C, and E) and antagonistic (B, D, and F) modes. In the agonistic
mode, cells were treated with 0.1% DMSO (control) or with prototype ligands (5 mM) or three concentrations of oleamide 1, 10, or 30 mM. In the antagonistic mode, cells
were treated with prototype ligands (5 mM) in combination with oleamide at concentrations of 1, 10, or 30 mM. Rifampicin (RIF, PXR activator), 3-methylcholanthrene
(3-MC, AHR activator), and CITCO (CAR activator) were used as prototype ligands. The data are expressed as the fold-change in firefly luciferase activity normalized to
Renilla luciferase activity in each sample and relative to the vehicle (DMSO)-treated control means, which were set to 1. Statistical analyses were performed using at least
three independent assays (n = 3) performed in triplicate, and statistical significance was assessed by one-way ANOVA followed by Dunnett’s test.
920 Dovrtelova et al.
atASPETJournalsonJuly10,2018dmd.aspetjournals.orgDownloadedfrom
91
greater than could be explained by a simple decrease in total P450 content,
but the exact mechanism of this influence is still under investigation. Based
on the experimental data, we concluded that the metabolic activity of most
enzymes in the in vivo experiment had not been affected. The decreased
relative activities measured in our experiment were caused by P450
downregulation rather than by inhibition of enzymes, which is in line with
the results of Western blot testing.
The effects of other endocannabinoids on the activity of P450s are
unknown, and the influence of exogenous cannabinoid receptor ligands
is diverse. In detail, the decrease in the microsomal protein content in
experimental animals was reported after administration of the CB1
ligand (CP 55,940) to mice (Fontanellas et al., 2005) and rats (List et al.,
1977; Dalterio et al., 1986; Costa et al., 1996). Cannabidiol also
decreased the microsomal protein levels in human HepG2 cells (Yang
et al., 2014) and inhibited metabolism of the selected P450 substrates in
mice (Watanabe et al., 1981; Bornheim and Correia, 1989). On the other
hand, studies suggesting that cannabinoids (CP55,940, hashish, and
cannabidiol) would increase the content and/or activity of liver P450s in
rodents have been published (Dalterio et al., 1986; Costa et al., 1996;
Sheweita, 2003). The fact that these substances are usually of a different
chemical structure with different biologic activity limits generalization
of the results obtained using different cannabinoids as a general “class
Fig. 7. Oleamide does not affect CYP2B6, CYP2C9, CYP3A4, and CYP1A2 enzymatic activities in vitro and mRNA expression in primary human hepatocytes. It does not
inhibit metabolic activities of human CYP2B6 (A), CYP2C9 (B), CYP3A4 (C), and CYP1A2 (D), enzymes expressed in the microsomal fraction of P450 cDNA
baculovirus-infected cells. Assays were performed in three independent experiments (n = 3) measured in triplicate. (E) qRT-PCR experiment in primary human hepatocytes
treated with oleamide (10 mM), CITCO, RIF, or 3-methylcholantrene (3-MC) for 48 hours before total RNA isolation and qRT-PCR analysis were done. Data are presented
as the means (S.D.) of triplicates from a representative batch of primary human hepatocytes (human long-term hepatocytes in monolayer, batch HEP220971, Biopredic) and
are expressed as the fold mRNA upregulation relative to the vehicle-treated controls (set to 100%). Statistical significance was assessed by one-way ANOVA, *P # 0.05;
***P # 0.001.
Interactions of Oleamide with Cytochrome P450 921
atASPETJournalsonJuly10,2018dmd.aspetjournals.orgDownloadedfrom
92
effect” of cannabinoids. Moreover, the ECS could have reacted
differently to the same drug at different time points during drug
administration, as mechanisms of desensitization, or receptor downregulation
or upregulation might have been involved (Daigle et al., 2008;
Burston et al., 2010).
The ECS, as a retrograde modulator, is associated with different
neuronal systems within the brain, and therefore it can change the
activities of several neurotransmitters in various brain regions. It has
been documented that changes in the activity of these specific neuronal
circuits could influence the activity of liver P450s. Hormones were
identified as a probable link between the brain and liver (Wojcikowski
et al., 2008; Wojcikowski and Daniel, 2011; Bromek et al., 2013; Rysz
et al., 2016). Although exogenous cannabinoids have long been known
to be modulators of pituitary hormones (Pagotto et al., 2006), the
influence of endocannabinoids on the neuroendocrine system has not
been fully understood. Endocannabinoids modulate the levels of growth
hormone (Pagotto et al., 2006), thyrotropin-releasing hormone (Deli
et al., 2009), corticotrophin-releasing hormone (Steiner and Wotjak,
2008; Hill and Tasker, 2012), prolactin, and luteinizing hormone (de
Miguel et al., 1998), probably via the hypothalamus, where the ECS acts
as a retrograde messenger system. Hormones then bind to nuclear
receptors in hepatocytes and regulate P450 gene expression. Therefore,
the ECS is probably involved in the regulation of the metabolic activity
of liver P450s as well. This hypothesis was described in detail elsewhere
(Zendulka et al., 2016). In our study, oleamide did not influence the
levels of prolactin, corticosterone, or free triiodothyronine (Fig. 8).
Therefore, we expect these hormones not to be included in the
mechanism of liver P450 activity being influenced by oleamide.
The interactions of oleamide with the key human nuclear receptors
involved in regulation of major P450s were further tested to obtain
additional data on the possible influence of this endocannabinoid in
humans. The results showed that oleamide did not interact with human
AhR, PXR, or CAR nuclear receptors either in an agonistic or
antagonistic mode (Fig. 6). Consistently, oleamide did not induce
CYP2B6, CYP2C9, or CYP3A4 mRNA expression in a representative
primary human hepatocyte culture (Fig. 7E).
The direct inactivation of rat P450s by oleamide in RLMs was
tested in our in vitro model. Weak inhibition of CYP1A2, CYP2D2,
and, more noticeably, CYP2C6 are described in Table 2. Similarly, the
direct inhibition of P450s by phytocannabinoids, such as cannabidiol,
cannabinol, and D9
-THC, were reported (Zendulka et al., 2016). All
three substances inhibited the metabolic activity of P450s with various
potencies. Differences between the results obtained from two models
used in our study can be explained by the divergent modes of how the
metabolic activity of P450s can be influenced. In an in vitro experiment,
the drug could have bound either to the active or to the allosteric site of
P450s and decreased the metabolic activity by direct enzyme inactivation.
Livers isolated from animals treated with oleamide were
drawn 24 hours after the last dose of drug was administered and
microsomes were washed out several times with buffers during the
process of isolation. Therefore, the microsomes were thought to be “drug
free.” This was proved by there being no change in the metabolic activity
of CYP2C6 detected in the in vivo model compared with the results of
the in vitro model, where CYP2C6 was inhibited, and conversely by a
decreased metabolic activity of CYP2C11 assessed in vivo, with no
influence in vitro. Furthermore, the direct interaction with enzymes
could not explain the decreased P450 protein levels, which were detected
for CYP1A2, CYP2B, CYP2C11, and CYP3A after repeated systemic
administration of oleamide (Figs. 2–4). These findings further support
our conclusion that the influence of oleamide on rat P450s was mediated
by the mechanism of downregulation. Besides the direct interaction of
oleamide with RLMs, we tested its interaction with human recombinant
P450s (CYP2B6, CYP2C9, CYP3A4, and CYP1A2), finding insignificant
effects (Fig. 7, A–D).
In conclusion, we hypothesize that the repeated intraperitoneal
administration of oleamide (10 mg/kg per day) caused the downregulation
of CYP1A2, CYP2B, CYP2C11, and CYP2D2 in rats. The
effect is unlikely to be caused by the direct inhibition of P450 enzymes
or by oleamide influencing the hormonal levels. The mechanism of this
effect has not yet been determined. Although oleamide inhibited rat
CYP1A2, CYP2D2, and CYP2C6 enzymes, it did not interact with the
tested recombinant human cytochromes in vitro. We observed no effect
on human AhR, PXR, and CAR nuclear receptors in the regulation of
main human P450s in the primary human hepatocytes. To the best of our
knowledge, we are the first to report the effects of the endocannabinoid
CB1 agonist and the FAAH inhibitor oleamide on rat and human P450s.
Our results suggest the possible involvement of the endocannabinoid
system in the regulation of rat liver cytochrome activity. Still, oleamide
affected neither the activity of human recombinant P450s nor the
expression of mRNA of P450s in human primary hepatocytes. The
effects observed in rat P450 enzymes are likely to be species-specific,
and the clinical impact needs to be elucidated in future studies.
Fig. 8. Effect of systemic administration of oleamide on hormone concentrations in rat blood serum. Animals were treated intraperitoneally with oleamide 10 mg/kg per day
(n = 10) and propylene glycol (control group, n = 6). Bar graphs show concentrations of free triiodothyronine (A), prolactin (B), and corticosterone (C). The bars represent
means (S.D.) of individual animals of each group in three repetitions. Statistical significance was assessed by Mann-Whitney U test.
922 Dovrtelova et al.
atASPETJournalsonJuly10,2018dmd.aspetjournals.orgDownloadedfrom
93
Acknowledgments
We thank Vitezslav Bryja and his laboratory for help and support and Roman
Reminek and Roberta Frapolli for their help.
Authorship Contributions
Participated in research design: Dovrtelova, Zendulka, Jurica, Pavek.
Conducted experiments: Dovrtelova, Zendulka, Noskova, Jurica, Dusek, Pes,
Carazo, Zapletalova, Hlavacova.
Performed data analysis: Dovrtelova, Carazo.
Wrote or contributed to the writing of the manuscript: Dovrtelova, Zendulka,
Carazo.
References
Aizpurua-Olaizola O, Elezgarai I, Rico-Barrio I, Zarandona I, Etxebarria N, and Usobiaga A (2017)
Targeting the endocannabinoid system: future therapeutic strategies. Drug Discov Today 22:
105–110.
Bornheim LM and Correia MA (1989) Effect of cannabidiol on cytochrome P-450 isozymes.
Biochem Pharmacol 38:2789–2794.
Bromek E, Wojcikowski J, and Daniel WA (2013) Involvement of the paraventricular (PVN) and
arcuate (ARC) nuclei of the hypothalamus in the central noradrenergic regulation of liver cytochrome
P450. Biochem Pharmacol 86:1614–1620.
Burston JJ, Wiley JL, Craig AA, Selley DE, and Sim-Selley LJ (2010) Regional enhancement of
cannabinoid CB1; receptor desensitization in female adolescent rats following repeated
D-tetrahydrocannabinol exposure. Br J Pharmacol 161:103–112.
Carazo Fernandez A, Smutny T, Hyrsova L, Berka K, and Pavek P (2015) Chrysin, baicalein and
galangin are indirect activators of the human constitutive androstane receptor (CAR). Toxicol
Lett 233:68–77.
Costa B, Parolaro D, and Colleoni M (1996) Chronic cannabinoid, CP-55,940, administration alters
biotransformation in the rat. Eur J Pharmacol 313:17–24.
Cravatt BF, Prospero-Garcia O, Siuzdak G, Gilula NB, Henriksen SJ, Boger DL, and Lerner RA
(1995) Chemical characterization of a family of brain lipids that induce sleep. Science 268:
1506–1509.
Daigle TL, Kearn CS, and Mackie K (2008) Rapid CB1 cannabinoid receptor desensitization
defines the time course of ERK1/2 MAP kinase signaling. Neuropharmacology 54:36–44.
Dalterio S, Thomford PJ, Michael SD, DeAngelo L, and Mayfield D (1986) Perinatal cannabinoid
exposure: effects on hepatic cytochrome P-450 and plasma protein levels in male mice. Teratology
33:195–201.
Deli L, Wittmann G, Kallo I, Lechan RM, Watanabe M, Liposits Z, and Fekete C (2009) Type
1 cannabinoid receptor-containing axons innervate hypophysiotropic thyrotropin-releasing
hormone-synthesizing neurons. Endocrinology 150:98–103.
Di Marzo V, Melck D, Bisogno T, and De Petrocellis L (1998) Endocannabinoids: endogenous
cannabinoid receptor ligands with neuromodulatory action. Trends Neurosci 21:521–528.
de Miguel R, Romero J, Munoz RM, Garcia-Gil L, Gonzalez S, Villanua MA, Makriyannis A,
Ramos JA, and Fernandez-Ruiz JJ (1998) Effects of cannabinoids on prolactin and gonadotrophin
secretion: involvement of changes in hypothalamic g-aminobutyric acid (GABA) inputs.
Biochem Pharmacol 56:1331–1338.
Divito EB and Cascio M (2013) Metabolism, physiology, and analyses of primary fatty acid
amides. Chem Rev 113:7343–7353.
Dovrtelova G, Noskova K, Jurica J, Turjap M, and Zendulka O (2015) Can bioactive compounds of
Crocus sativus L. influence the metabolic activity of selected CYP enzymes in the rat? Physiol
Res 64 (Suppl 4):S453–S458.
Dvorak Z, Vrzal R, Pavek P, and Ulrichova J (2008) An evidence for regulatory cross-talk between
aryl hydrocarbon receptor and glucocorticoid receptor in HepG2 cells. Physiol Res 57:427–435.
Fedorova I, Hashimoto A, Fecik RA, Hedrick MP, Hanus LO, Boger DL, Rice KC, and Basile AS
(2001) Behavioral evidence for the interaction of oleamide with multiple neurotransmitter systems.
J Pharmacol Exp Ther 299:332–342.
Flick EW (2012) Industrial Surfactants: An Industrial Guide, 2nd ed, Noyes Publications, Park
Ridge, New Jersey.
Fontanellas A, Manzanares J, Garcia-Bravo M, Buzaleh AM, Mendez M, Oliva JM, Batlle A,
Palomo T, and Enriquez de Salamanca R (2005) Effects of repeated administration with
CP-55,940, a cannabinoid CB1 receptor agonist on the metabolism of the hepatic heme. Int J
Biochem Cell Biol 37:1620–1625.
Fowler CJ, Jonsson K-O, and Tiger G (2001) Fatty acid amide hydrolase: biochemistry, pharmacology,
and therapeutic possibilities for an enzyme hydrolyzing anandamide,
2-arachidonoylglycerol, palmitoylethanolamide, and oleamide. Biochem Pharmacol 62:517–526.
Garrido-Lopez A, Esquiu V, and Tena MT (2006) Determination of oleamide and erucamide in
polyethylene films by pressurised fluid extraction and gas chromatography. J Chromatogr A
1124:51–56.
Ge L, Zhu MM, Yang J-Y, Wang F, Zhang R, Zhang J-H, Shen J, Tian H-F, and Wu C-F (2015)
Differential proteomic analysis of the anti-depressive effects of oleamide in a rat chronic mild
stress model of depression. Pharmacol Biochem Behav 131:77–86.
Herrera-Solis A, Vasquez KG, and Prospero-Garcia O (2010) Acute and subchronic administration
of anandamide or oleamide increases REM sleep in rats. Pharmacol Biochem Behav 95:
106–112.
Hill MN and Tasker JG (2012) Endocannabinoid signaling, glucocorticoid-mediated negative
feedback, and regulation of the hypothalamic-pituitary-adrenal axis. Neuroscience 204:5–16.
Huitron-Resendiz S, Gombart L, Cravatt BF, and Henriksen SJ (2001) Effect of oleamide on sleep
and its relationship to blood pressure, body temperature, and locomotor activity in rats. Exp
Neurol 172:235–243.
Jezova D, Guillaume V, Jurankova E, Carayon P, and Oliver C (1994) Studies on the physiological
role of ANF in ACTH regulation. Endocr Regul 28:163–169.
Keating GM (2017) Delta-9-tetrahydrocannabinol/cannabidiol oromucosal spray (Sativex®
): a review
in multiple sclerosis-related spasticity. Drugs 77:563–574.
Leggett JD, Aspley S, Beckett SRG, D’Antona AM, Kendall DA, and Kendall DA (2004) Oleamide
is a selective endogenous agonist of rat and human CB1 cannabinoid receptors. Br J
Pharmacol 141:253–262.
List A, Nazar B, Nyquist S, and Harclerode J (1977) The effects of delta9-tetrahydrocannabinol and
cannabidiol on the metabolism of gonadal steroids in the rat. Drug Metab Dispos 5:268–272.
Lowry OH, Rosebrough NJ, Farr AL, and Randall RJ (1951) Protein measurement with the Folin
phenol reagent. J Biol Chem 193:265–275.
May MB and Glode AE (2016) Dronabinol for chemotherapy-induced nausea and vomiting unresponsive
to antiemetics. Cancer Manag Res 8:49–55.
Noskova K, Dovrtelová G, Zendulka O, Reminek R, and Jurica J (2016) The effect of (-)-linalool
on the metabolic activity of liver CYP enzymes in rats. Physiol Res 65 (Suppl 4):S499–S504.
Obal F, Jr and Krueger JM (2003) Biochemical regulation of non-rapid-eye-movement sleep. Front
Biosci 8:d520–d550.
Omura T and Sato R (1964) The carbon monoxide-binding pigment of liver microsomes I. Evidence
for its hemoprotein nature. J Biol Chem 239:2370–2378.
Pagotto U, Marsicano G, Cota D, Lutz B, and Pasquali R (2006) The emerging role of the
endocannabinoid system in endocrine regulation and energy balance. Endocr Rev 27:73–100.
Pertwee RG (2015) Endocannabinoids, Springer International Publishing, New York.
Rulcova A, Prokopova I, Krausova L, Bitman M, Vrzal R, Dvorak Z, Blahos J, and Pavek P (2010)
Stereoselective interactions of warfarin enantiomers with the pregnane X nuclear receptor in gene
regulation of major drug-metabolizing cytochrome P450 enzymes. J Thromb Haemost 8:2708–2717.
Rysz M, Bromek E, and Daniel WA (2016) Activation of brain serotonergic system by repeated
intracerebral administration of 5-hydroxytryptophan (5-HTP) decreases the expression and activity
of liver cytochrome P450. Biochem Pharmacol 99:113–122.
Sheweita SA (2003) Narcotic drugs change the expression of cytochrome P450 2E1 and 2C6 and other
activities of carcinogen-metabolizing enzymes in the liver of male mice. Toxicology 191:133–142.
Smith PB, Compton DR, Welch SP, Razdan RK, Mechoulam R, and Martin BR (1994) The
pharmacological activity of anandamide, a putative endogenous cannabinoid, in mice. J Pharmacol
Exp Ther 270:219–227.
Snider NT, Walker VJ, and Hollenberg PF (2010) Oxidation of the endogenous cannabinoid
arachidonoyl ethanolamide by the cytochrome P450 monooxygenases: physiological and pharmacological
implications. Pharmacol Rev 62:136–154.
Steiner MA and Wotjak CT (2008) Role of the endocannabinoid system in regulation of the
hypothalamic-pituitary-adrenocortical axis. Prog Brain Res 170:397–432.
Sugiura T, Kobayashi Y, Oka S, and Waku K (2002) Biosynthesis and degradation of anandamide
and 2-arachidonoylglycerol and their possible physiological significance. Prostaglandins Leukot
Essent Fatty Acids 66:173–192.
Watanabe K, Yamamoto I, Oguri K, and Yoshimura H (1981) In vitro and in vivo interactions of
delta 8-tetra-hydrocannabinol and its metabolites with hepatic microsomal drug metabolizing
enzyme systems of mice. J Pharmacobiodyn 4:604–611.
Wojcikowski J and Daniel WA (2011) The role of the nervous system in the regulation of liver
cytochrome p450. Curr Drug Metab 12:124–138.
Wojcikowski J, Golembiowska K, and Daniel WA (2008) Regulation of liver cytochrome P450 by
activation of brain dopaminergic system: physiological and pharmacological implications. Biochem
Pharmacol 76:258–267.
Yang L, Rozenfeld R, Wu D, Devi LA, Zhang Z, and Cederbaum A (2014) Cannabidiol protects
liver from binge alcohol-induced steatosis by mechanisms including inhibition of oxidative stress
and increase in autophagy. Free Radic Biol Med 68:260–267.
Zendulka O, Dovrtelová G, Noskova K, Turjap M, Sulcova A, Hanu L, and Jurica J (2016)
Cannabinoids and cytochrome P450 interactions. Curr Drug Metab 17:206–226.
Zimova G, Chladek J, Martinkova J, and Beranek M (2000) HPLC determination of dextromethorphan
and its metabolites in urine. Chem Listy 94:132–135.
Address correspondence to: Dr. Ondrej Zendulka, Department of Pharmacology,
Faculty of Medicine, Masaryk University, Kamenice 5, 625 00 Brno, Czech
Republic. E-mail: zendulka@med.muni.cz
Interactions of Oleamide with Cytochrome P450 923
atASPETJournalsonJuly10,2018dmd.aspetjournals.orgDownloadedfrom
94
6. P450 phenotyping in clinical practice
It is hard to predict the pharmacokinetic variability of drug metabolism due to numerous influences
that could participate in this phenomenon. On the one hand, the majority of drugs are so safe that
even huge interindividual differences in plasma levels after the same dose of the drug administered
to different patients lead to the expected therapeutic effect. On the other hand, if we were able to
predict the plasma levels of the drug prior to the drug’s administration, it could prevent patients
from experiencing adverse effects or signs of toxicity in drugs with a narrow therapeutic range. One
possible way to at least partially predict the metabolic pharmacokinetic variability is P450
genotyping. Some P450 are genetically polymorphic. A polymorphism is an occurrence of various
alleles at one locus with at least two of them occurring with a greater than 1% frequency in the
population (de Leon et al., 2009). The population can be classified into up to four groups with respect
to the number of alleles coding the functional enzyme. Poor metabolizers have both alleles null,
intermediate metabolizers have partially defective alleles or a combination of null and a partially
defective allele, extensive metabolizers have normal alleles, and ultrarapid metabolizers have
duplicated normal alleles (Zanger and Schwab, 2013). The higher the number of normal alleles, the
faster the speed of drug elimination, or for pro-drugs their bioactivation. A drug could be ineffective
in ultrarapid metabolizers due to rapid elimination while the same dose can cause toxicity in poor
metabolizers. The variability in the P450 activity between phenotypes can be as high as 30- to 40-fold
for CYP3A, 100-fold for CYP2D6, 50- to 60-fold for CYP2B6, and 40- to 50-fold for 2C9 (Tracy et al.,
2016). Not all polymorphic P450 enzymes exhibit all four of these types of phenotypes. CYP2C19
genes code enzymes of extensive and poor metabolizer phenotypes (Chaudhry et al., 2008), while all
four classes are described for CYP2D6 (Kiss et al., 2018). There are simple commercial assays for P450
genotyping using polymerase chain reaction methods. CYP3A5, CYP2C19, CYP2C9, and CYP2D6 can
be genotyped. The genotype describes just one of the factors that determine the P450 phenotype. In
some P450 enzymes, the role of genotype on the final P450 phenotype is significant while in others it
could be much weaker. P450 enzymes with a known strong influence of gene polymorphism on the
phenotype are CYP1A2, CYP2A6, CYP2B6, CYP2C19, CYP2C19, and CYP2D6 (Zanger and Schwab,
2013). The reliability of genotype-based predictions of phenotype therefore varies. For CYP2D6, it is
described to be 67% (Kiss et al., 2018). Nevertheless, the frequency of the genotype also depends on
the population studied, as there are different frequencies of P450 alleles across various ethnic groups
(McGraw and Waller, 2012).
The best option for predicting metabolic variability is therefore phenotyping. The principle of the
assay is simple. A known probe substrate of P450 is administered to a patient and biological fluids
95
(blood, urine, saliva) are sampled at specific time intervals. The amounts of P450-specific metabolites
are measured and the metabolic ratio (MR), the ratio of the concentration of metabolite to the
concentration of probe substrate, is calculated and evaluated. For some probe substrates there are
alternative evaluations to MR, but the administration of the probe substrates remains the same. The
speed of metabolism can be evaluated with a breath test using radiolabelled probes (Furuta et al.,
2009) or by measurement of the drug’s biological activity (pupilometry after tramadol use as a probe
of CYP2D2) (Matouskova et al., 2011).
Table 2. Overview of P450 selective probe substrates. Adapted with the permission of the author
(Dovrtělová, 2018).
Marker activity/reaction
Human
CYPs
CYP
subfamily
Rat
CYPs
Marker activity/reaction
caffeine/N-demethylation
phenacetine/O-deethylation
theophylline/N-demethylation,8-
hydroxylation
7-ethoxyresorufin/O-deethylation
CYP1A2 CYP1A CYP1A2
7-methoxyresorufin/ O-
dealkylation
phenacetin/O-deethylation
coumarin/7-hydroxylation
cotinine/3'-hydroxylation
CYP2A6 CYP2A
CYP2A1 testosterone/7α-hydroxylation
CYP2A2 testosterone/15α-hydroxylation
bupropion/4-hydroxylation
efavirenz/8-hydroxylation
S-mephenytoin/N-demethylation
CYP2B6 CYP2B CYP2B1
pentoxyresorufin/O-deethylation
testosterone/16β-hydroxylation
diclofenac/4'-hydroxylation
tolbutamide/methylhydroxylation
S-warfarin/7-hydroxylation
CYP2C9
CYP2C
CYP2C11
testosterone/2α-hydroxylation
testosterone/16α-hydroxylation
CYP2C6
diclofenac/4'-hydroxylation
S-warfarin/7-hydroxylation
S-mephenytoin/4´hydroxylation
omeprazole/5-hydroxylation
CYP2C19
codeine/O-demethylation
debrisoquine/4-hydroxylation
dextromethorphan/O-demethylation
metoprolol/α-hydroxylation
sparteine/dehydrogenation
tramadol/O-demethylation
CYP2D6 CYP2D
CYP2D1 bufuralol/1´-hydroxylation
CYP2D2
dextromethorphan/O-
demethylation
debrisoquine/4-hydroxylation
propranolol/7-hydroxylation
bufuralol/1´-hydroxylation
alfentanil/demethylation
midazolam/1-hydroxylation
dextromethorphan/N-demethylation
erythromycin/N-demethylation
testosterone/6β-hydroxylation
cortisol/6β-hydroxylation
CYP3A4
CYP3A
CYP3A1
testosterone/6-hydroxylation
testosterone/2-hydroxylation
midazolam/4-hydroxylation
triazolam/1'-hydroxylation
CYP3A2
testosterone/6β-hydroxylation
midazolam/1'-/4-hydroxylation
alprazolam/4-/1-hydroxylation
CYP3A5
CYP3A1
96
Different probe substrates are used in preclinical and clinical tests. In both, the basic requirements
for the probes are: i) to be metabolized via a distinct P450 for the specific metabolite; ii) the
metabolism should be the main process of probe elimination; iii) the probe and its metabolite should
be easily measured in the biological samples. The safety of the probe substrates is the limiting
requirement for clinical and in vivo experimental use. An overview of common P450 probes for rat
and human P450 can be found in Table 2. There are single-probe assays as well as cocktail
approaches. The great advantage of cocktail phenotyping is the possibility of assessing multiple P450
enzymes in one test and thus eliminate the influence of inter- and intra-individual variability in
testing. On the other hand decreased sensitivity, risk of adverse effects, toxicity, or drug-drug
interactions are the most common disadvantages (Zhou et al., 2004a).
6.1 Phenotyping of CYP1A2 with caffeine as a probe substrate
The activity and expression of CYP1A2 in human liver exhibits an approximately 40-fold interindividual
variability (Ghodke-Puranik and Lamba, 2017). Even though the number of drug substrates
of CYP1A2 is not as high as with CYP3A4/5 or CYP2D6, it still contributes in the metabolism of
approximately 9% of drugs biotransformed via the P450 system (Zanger and Schwab, 2013). Besides
clozapine, tacrine, or theophylline, it is involved in the metabolism of endogenous substrates
(melatonin, estradiol) and activates toxic compounds and procarcinogens (aflatoxin B1, aromatic
hydrocarbons) (Koonrungsesomboon et al., 2017).
The methylxanthine derivate caffeine, a phosphodiesterase inhibitor and antagonist of the adenosine
receptor, is a well-established probe substrate for P450 CYP1A2 phenotyping in vivo. It undergoes
extensive metabolism by CYP1A2 in the liver. The urinary MR of caffeine and its several metabolites
can be used for the assessment of CYP1A2 metabolic activity (Turesky et al., 2015).
In the article “Determination of caffeine and its metabolites in saliva and urine as a measure of
CYP1A2 metabolic activity”, we present a fast, sensitive, and reproducible method for CYP1A2
phenotyping. Briefly, the caffeine was administered at a dose of 3 mg/kg orally in a gelatin capsule.
The urine was collected for the following 6 hours and aliquots were drawn 3 and 6 hours after
administration of the probe. Saliva was sampled similarly 3 and 6 hours after caffeine administration.
The best recovery and sensitivity for sample extraction was reached with a 8.5 : 1.5 (v/v) mixture of
chloroform and isopropylacohol. An HPLC method was developed for the analysis of extracted
samples. The analytes were separated in a reversed-phase analytical column. Isocratic elution was
used with a mobile phase consisting of 15 mM sodium acetate and methanol 85 : 15 (v/v) and a flow
rate of 0.8 mL/min. Caffeine and its metabolites were detected with a diode array detector at various
wavelengths characteristic for individual analytes. A good correlation between urine and saliva
97
paraxantine/caffeine MR for both the 3 and 6 hour sampling points was found. There are many
advantages to our method over other published methods. Firstly, it is a method which can be
performed with a conventional HPLC system with diode array detector. It provides the possibility of
selecting urine or saliva for the assessment of CYP1A2 activity. Finally, the method can be used for
determination of the activity of other enzymes involved in the metabolism of caffeine, including
xanthinoxidase and N-acetyl transferase.
Turjap M., Zendulka O., Glatz Z., Brejcha S, Madr A., Juřica J. Determination of caffeine and its
metabolites in saliva and urine as a measure of CYP1A2 metabolic activity. Current Pharmaceutical
analysis, 12 (4), 325-332, 2016.
Impact factor: 0.75; Pharmacology & Pharmacy Q4 Citations WoS: 2
Author’s contribution: 10%
98
Send Orders for Reprints to reprints@benthamscience.ae
Current Pharmaceutical Analysis, 2016, 12, 000-000 1
1573-4129/16 $58.00+.00 © 2016 Bentham Science Publishers
Determination of Caffeine and its Metabolites in Saliva and Urine as a
Measure of CYP1A2 Metabolic Activity
Miroslav Turjap1,2
, Ondřej Zendulka1
, Zdeněk Glatz3
, Stanislav Brejcha4
, Aleš Mádr3
and
Jan Juřica1,*
1
Dpt. of Pharmacology, Faculty of Medicine, Masaryk University, Kamenice 5, 62500 Brno, Czech
Republic; 2
Dpt. of Clinical Pharmacy, University Hospital Ostrava, 17. listopadu 1790, 70852
Ostrava, Czech Republic; 3
Dpt. of Biochemistry, Faculty of Science, Masaryk University, Kamenice 5,
62500 Brno, Czech Republic; 4
Dpt. of Biochemistry, Faculty of Medicine, Masaryk University,
Kamenice 5, 62500, Brno, Czech Republic
Abstract: Objective: The aim of this work was to develop a new, simple, rapid, sensitive and reproducible
RP-HPLC method for the determination of caffeine, 1,7 dimethylxanthine, 1,7-dimethyluric
acid, 5-acetylamino-6-formylamino-3-methyluracil, 5-acetylamino-6-amino-3-methyluracil, 1methylxanthine,
and 1-methyluric acid in human urine and saliva as a method of determining the
metabolic activity of the human enzyme CYP1A2.
Methods: A Luna C18(2) (150 × 4.6 mm i.d.) analytical column was used for the separation. The mobile phase consisted
of sodium acetate trihydrate (pH 5.0) and methanol 85:15 (v/v). The flow rate was maintained at 0.8 mL/min. The absorbance
of the eluent was monitored at 263 nm (5-acetylamino-6-amino-3-methyluracil), 285 nm (5-acetylamino-6formylamino-3-methyluracil,
1,7-dimethyluric acid, 1-methyluric acid), 272 nm (caffeine, 1,7 dimethylxanthine) and 268
nm (1-methylxanthine). Acetaminophen as an internal standard was used to ensure the precision and accuracy of this
method, and it was monitored at 245 nm.
Results: All compounds, including the internal standard, were eluted within 18 min. Analytes were extracted by liquidliquid
extraction. Limits of quantitation varied from 7.2 to 74.2 µg/L for individual analytes in saliva and from 8.4 to 82.4
µg/L in urine.
Conslusion: This method may become a useful alternative to urine caffeine metabolic ratio measurement with respect to
CYP1A2 metabolic activity assessment in clinical practice.
Keywords: Caffeine, CYP1A2, saliva, urine, phenotyping, metabolic ratio.
1. INTRODUCTION
Caffeine, 1,3,7-trimethyl-1H-purine-2,6(3H,7H)-dione, is
a methylxanthine derivative, a phosphodiesterase inhibitor,
adenosine receptor antagonist, used as a psychostimulant and
analgesic adjuvant. Caffeine is extensively metabolized via
cytochrome P450 enzymes, N-acetyltransferase and xanthinoxidase
(Fig. 1) [1]. CYP1A2 plays a major role in caffeine
biotransformations, especially in N3 - demethylation, and
thus it is used as a measure of CYP1A2 metabolic activity.
The theoretical assumption that genotype is only one of
many factors influencing the endophenotype of CYP enzymes
was confirmed at least for CYP1A2 [2]. For instance,
the allele CYP1A2*1F predicts a higher susceptibility to
enzyme induction than the wt allele, and thus the impact of
CYP1A2 gene mutations also depends on environmental
factors [3]. CYP1A2 metabolic activity seems to be a better
*Address correspondence to this author at the Kamenice 5 62500,
Brno, Czech Republic; Tel: +420549494531; Fax: 549 49 3070;
E-mail: jurica@med.muni.cz
predictor of treatment outcomes than the CYP1A2 genotype
[4] and therefore CYP1A2 phenotype determination is superior
to genotype determination in terms of clinical validity
and utility. Several substrates have been used as “specific
markers“ of CYP1A2 metabolic activity including phenacetin
[5], nonetheless caffeine is the most widely used, despite
other enzymes also being involved in its biotransformation
(xanthinoxidase, N-acetyltransferase and to a lesser extent
also CYP2E1, CYP2B6, CYP3A4, CYP3A5) [6, 7].
The molar concentration ratio of marker to metabolite(s)
in urine, plasma or saliva was used in phenotyping studies.
Several ratios of molar concentrations of caffeine's metabolites
are used to estimate the actual metabolic activity of
CYP1A2 in humans as well as in rats [6, 8, 9]. The following
metabolic ratios which are believed to reflect the metabolic
activity of CYP1A2 have been reported [10-12] with "caffeine
metabolic ratio" [CMR: (AFMU + 1X + 1U)/17U] as
probably the best proved measure of CYP1A2 metabolic
activity [8]. Due to the low concentrations of most caffeine
metabolites in saliva, except for 1, 7X, a simple 1,7 dimethylxanthine
(paraxanthine) to caffeine molar concentration


Miroslav Turjap
99
2 Current Pharmaceutical Analysis, 2016, Vol. 12, No. ? Turjap et al.
ratio assessed in saliva or serum/plasma is also frequently
used [9]. Moreover, a good correlation has been reported
between a 6-hour salivary molar ratio of 1,7X to 1,3,7X and
immunoreactive CYP1A2 liver content, and an excellent
correlation between a 4-hour salivary ratio of 1,7X to 1,3,7X
and apparent caffeine clearance [13, 14].
Many methods for determining caffeine in the pharmaceutical
industry, beverages, food supplements, coffee beans
and even coffee flowers have been reported [10, 11, 15].
Several methods for determining caffeine metabolites have
been reported to date. Briefly, Holland et al. assessed paraxanthine
and caffeine in serum samples after simple sample
preparation using an RP analytical column and UV detection,
a single run was approx. 10 min and LOQ was 50 µg/L [16].
Krul and Hageman reported a HPLC - UV method for the
determination of caffeine and its five metabolites in urine,
but the analysis length was 30 min, which is unacceptable for
the batch analysis of large sets of samples [17]. Similarly,
Bendriss and colleagues published an HPLC-UV method for
the determination of caffeine and fourteen of its metabolites,
with limits of detection of 2 ng/mL. However, the method
utilized gradient elution (both in the flow and composition of
the mobile phase) and a single run was 60 min, not counting
column equilibration between runs [10]. Atia et al. published
a HPLC-UV method for the determination of caffeine and 8
of its metabolites in urine with LOQs in the range 14 to 41
ng/mL, analysis length of 15 minutes, however only spiked
blank urine samples were analyzed [18]. Zydron et al. published
a method for the determination of caffeine and 9 of its
metabolites in urine. A single run was about 30 minutes,
LOD were in the range 50-60 ng/mL and the authors used a
gradient elution [19]. The literature is scarce in terms of
methods for the determination of caffeine and metabolites in
saliva. The method of Perera et al. enables only 1,3,7X and
1,7X determination in saliva and plasma, a single run is 18
minutes and the limit of detection in saliva is 15 µg/L for
both 1,7X and 1,3,7X [20].
Due to the instability of AFMU in biological samples at
neutral or alkaline conditions, when AFMU is nonenzymatically
transformed to AAMU, some authors prefer
the determination of both (AAMU+AFMU) [12, 21], other
authors quantitatively transformed AFMU to AAMU. CMR
an then be calculated with use of molar concentrations as
follows: (AAMU + AFMU + 1X + 1U)/1,7U [12].
HPLC-MS methods were also used in CYP1A2 metabolic
activity determination [12, 22, 23] as well as capillary
electrophoretic methods [24]. In general, LC-MS methods
give lower LOQ and have the advantage of a shorter analytical
run.
However, none of the above methods enable the determination
of caffeine and its major metabolites in saliva and
urine samples with an acceptable length of a single analysis
run, without gradient elution, which requires the equilibration
of the column.
Here we present a simple, sensitive, reproducible and
also universal HPLC method for the determination of caffeine
and its metabolites in saliva and urine suitable for the
determination of CYP1A2 metabolic activity in humans.
2. MATERIALS AND METHODS
2.1. Chemicals
Caffeine, (1,3,7X), paraxanthine (1,7X), 1methylxanthine
(1X), 1,7-dimethyluric acid (1,7U), 1methyluric
acid (1U), N-(4-hydroxyphenyl)acetamide
(syn. acetaminophen, paracetamol, PAR), acetonitrile,
methanol, sodium acetate trihydrate and hydrochloric acid
were purchased from Sigma-Aldrich (Prague, Czech
Republic). 5-acetylamino-6-formylamino-3-methyluracil
(AFMU) and 5-acetylamino-6-amino-3-methyluracil
(AAMU) were purchased from Santa Cruz Biotechnology
(Dallas, Texas, USA). Chlorophorm and isopropylalcohol
Fig. (1). Biotransformation pathways of caffeine.
100
Determination of Caffeine and its Metabolites in Saliva and Urine Current Pharmaceutical Analysis, 2016, Vol. 12, No. ? 3
were purchased from Chromservis (Prague, Czech
Republic).
All reagents used were of analytical grade, except for
methanol and acetonitrile, which were of HPLC grade. All
water solutions were prepared with Ultrapure water (Premier
MFG Systems, Phoenix, Arizona, USA) filtered through a
0.45 µm nylon membrane filter.
2.2. Standard Stock Solutions, Calibration Standards and
Quality Controls
The standards 1,3,7X, 1,7X, 1X, AAMU and PAR (IS)
were dissolved in methanol, AFMU was dissolved in methanol:
0.1 M acetic acid (50:50 v/v), and 1,7U and 1U were
dissolved in a methanol: 0.1 M NaOH solution (50:50 v/v) to
prepare stock solutions. The stock solutions were stored at
−18 °C. Working standard solutions of AAMU; AFMU; 1U;
1X; 1,7 U; 1,7X and 1,3,7X (80.0, 60.0, 51.7, 48.9, 56.7,
70.0, 63.33 and 86.7 mg/L respectively) were made by diluting
the stock solutions with water-methanol (1:1, v/v). The
linearity of the detector response was evaluated with sets of
standard solutions in the mobile phase to obtain the final
concentrations specified in Table 1. The calibration standards
were prepared by spiking fresh blank urine/saliva samples
with the working standard solutions.
A working internal standard solution was prepared at a
final concentration of 630 mg/L. Quality control samples
were prepared by spiking drug-free saliva and urine with
standard stock solutions at three different concentrations of
each analyte for the method validation.
2.3. Equipment
The HPLC system was a Shimadzu LC-10 series set
(Shimadzu, Kyoto, Japan), i.e. LC-10ADvp gradient pump
with DGU-14A degasser, SIL10ADvp autosampler,
CTO10ACvp column oven, SPD-M10Avp DAD detector
and SCL10Avp system controller. Data from the detector
were collected and analyzed using LabSolution 1.03 SP3
software (Shimadzu, Kyoto, Japan). A MultiReax vortex
shaker (Heidolph, Schwabach, Germany) and Universal 32R
centrifuge (Hettich, Tuttlingen, Germany) were used for
sample preparation.
3. EXPERIMENTAL
3.1. Sample Preparation
Blank human saliva and urine samples from 6 healthy
volunteers were drawn after 72 h of a caffeine-free diet.
These blank samples were spiked and used for calibration,
precision and accuracy determination. Aliquots (500 µL) of
human saliva or urine samples (3 and 6 h postdose) or spiked
blank human urine or saliva were transferred into screwcapped
glass tubes. 25 µL of the IS solution (630 mg/L) and
100 µL of 0.1M HCl were added. Then, 5 mL of chlorophorm:isopropanol
(85:15 v/v) was added and samples were
vortexed for 10 min at 2,000 rpm and centrifuged for 5 min
at 3,000 g at 4°C. After that, a 4.5 mL of organic layer was
transferred into a glass conical tube and organic solvent was
evaporated under a gentle stream of nitrogen at 30 °C. The
residues after evaporation were dissolved in 250 µL of mobile
phase, were transferred into vials for automated HPLC
analysis, and 50 µL was injected into the system. Due to the
previously reported instability and non-enzymatic conversion
of AFMU towards AAMU [25], which was also observed by
ourselves and confirmed by UPLC-ESI(+)-MS/MS, AAMU
was assessed along with AFMU.
3.2. Chromatographic Conditions
HPLC separations were carried out in a Luna C18(2) reversed
phase analytical column (150 × 4.6 mm i.d.) protected
with a SecurityGuard (8.0 × 3.0 mm i.d.), both packed with 5
µm particles (Phenomenex, Torrance, CA, USA). The mobile
phase consisted of 15 mM sodium acetate (pH 5.0; adjusted
with 10% CH3COOH) and methanol 85:15 (v/v) and
was filtered through a 0.45 µm filter (Supelco, Bellefonte,
PA, USA) before use. The flow rate was maintained at 0.8
mL/min. Absorbance of the eluent was monitored with use
of diode array detector at absorption maximum of each analyte
in the mobile phase: 285 nm (AFMU; 1,7U; 1U), 272
nm (1,3,7X and 1,7X) and 268 nm (1X). The bandwidth of
all wavelengths was 4 nm. All compounds, including the
internal standard, were eluted within 18 min.
3.3. Method Validation
The method was validated for its selectivity, accuracy,
precision, recovery, linearity and stability according to the
Table 1. Parameters of linearity of calibration curve.
Analyte Slope Intercept Determination Coefficient Calibration interval [mg/l]
AFMU 216.98 102.5 0.999 0.119 – 40.0
AAMU 82.15 -3.57 0.991 0.089 - 30.0
1U 119.43 -33.04 0.999 0.077 - 51.7
1X 145.66 -27.30 0.999 0.072 - 48.9
1,7U 108.02 -25.61 0.999 0.0839 - 56.7
PAR (I.S.) 152.86 -28.14 0.999 0.104 - 35.0
1,7X 69.47 -14.51 0.999 0.094 – 31.7
1,3,7X 84.85 -23.95 0.999 0.128 – 43.4
101
4 Current Pharmaceutical Analysis, 2016, Vol. 12, No. ? Turjap et al.
principles of the relevant Food and Drug Administration
Guidance [26].
3.4. Human Saliva and Urine Samples
Sixteen volunteers after at least 24 hours of abstinence
from caffeine received orally a capsule with caffeine at a
dose of 3 mg/kg at 07:00. Urine was collected in a glass bottle
until 13:00. Aliquots (3x 500 µL) were drawn at 10:00
and 13:00. Saliva samples were taken at 10:00 and 13:00 into
Salivette plastic tubes (Sarstedt AG & Co., Nümbrecht,
Germany) and centrifuged at 2000 g for 10 minutes. Samples
were frozen at -40 °C until analysis (max. 4 weeks).
4. RESULTS AND DISCUSSION
4.1. Extraction
The extraction procedure was optimized for extraction
recovery and sensitivity. We tested diethylether (100 %),
diethylether + isopropylalcohol 8.5 : 1.5, hexane + butanol 9
: 1 and chlorophorm + isopropylalcohol 8.5 : 1.5 (v/v). The
best results were obtained using the latter mixture of solvents.
Along with the extraction procedure, protein precipitation
using 100 µL of acetonitrile + vortexing + centrifugation
was also tested as a sample pre-treatment, but was evaluated
as insufficient due to observed interferences. The extraction
recoveries for all analytes were measured at three levels of
concentration in spiked saliva and urine (Table 2). Three
replicates of these samples were extracted and analyzed according
to the method described above. Standard samples
were prepared along with spiked saliva and urine samples by
diluting standard stock solutions with the mobile phase. Recovery
was calculated using the following equation: Recovery
= (peak area after extraction / peak area of standard sample
of the equal nominal concentration) x 100 (%). Despite
the simple extraction, the extraction recoveries of all analytes
except for AFMU, which is extremely unstable in solution,
were within the acceptable range of 75.2 - 93.3 % when extracted
from urine. Extraction recovery from saliva was in
the range 75.8 - 95.3 %.
Compared to other methods for determining caffeine and
metabolites in biological samples and utilizing liquid-liquid
extraction [10], the extraction recoveries of the analytes were
comparable, with the exception of AFMU. Nonetheless, if
we assume that there is an equimolar conversion of AFMU
to AAMU, and the metabolic activity of CYP1A2 is expressed
by means of (17X+17U)/137X, (AAMU + AFMU +
1X + 1U)/17U or simply 1,7X/1,3,7X, this instability and
thus analytical imprecision is of negligible clinical importance.
Moreover, the differences in the recoveries of the analytes
had negligible impact on the accuracy of the measured
concentration due to the preparation of calibration samples
(standards in blank urine/saliva) concurrent extraction with
the experimental samples and use of an internal standard.
Table 2. Intraday and interday precision and accuracy data for caffeine and its metabolites in spiked urine, extraction recovery of
liquid-liquid extraction of analytes from spiked samples.
Analyte Nominal concentration
(mg/L)
Intraday Accuracy
(%)
Intraday
RSD (%)
Interday Accuracy
(%)
Interday
RSD (%)
Saliva Extraction
recovery (%)
Urine Extraction
recovery (%)
10.66 117.80 1.73 114.44 1.94 89.6 87.5
1.78 118.20 3.64 123.80 1.59 88.7 86.7
AAMU
0.59 119.53 5.94 109.55 8.77 95.3 93.3
8.00 90.30 0.49 92.02 8.66 58.3 54.3
1.33 102.89 1.53 92.28 6.80 55.8 52.2
AFMU
0.44 99.76 8.23 93.76 5.88 58.3 56.9
6.88 100.30 1.03 96.66 2.15 78.5 77.8
1.15 108.63 7.31 101.24 1.82 79.2 75.2
1U
0.38 109.11 7.62 104.79 5.96 80.1 78.4
6.52 103.80 0.17 100.37 1.74 88.2 87.5
1.09 116.67 2.06 106.12 4.26 84.5 82.3
1X
0.36 122.81 7.92 109.04 3.30 83.6 80.6
7.56 100.50 0.25 97.65 2.13 80.7 81.0
1.26 103.77 2.00 101.67 1.08 82.4 84.2
1,7U
0.42 115.20 7.90 107.92 6.07 83.4 86.6
9.32 101.60 0.27 98.10 1.83 87.0 84.8
1.55 100.65 0.37 101.85 1.07 85.9 82.3
1,7X
0.52 106.74 7.31 105.92 7.36 82.9 78.9
8.44 101.60 0.28 98.62 1.73 86.5 78.7
1.41 102.62 1.44 101.29 1.03 91.6 82.0
1,3,7X
0.47 106.48 7.76 105.43 7.59 87.0 83.8
102
Determination of Caffeine and its Metabolites in Saliva and Urine Current Pharmaceutical Analysis, 2016, Vol. 12, No. ? 5
4.2. Optimization of the Separation
The HPLC method was optimized to obtain sufficient
resolution with an acceptable analysis length. We tested several
RP columns (Luna C18 150x4.6 mm, 5 µm; Kinetex
C18, 150x4.6 mm 2.6 µm; 5 µm, Kinetex HILIC, 150x4.6
mm 2.6 µm and Gemini C18, 150 x 4.6 mm; 5 µm; Phenomenex,
Torrance, CA, USA) and mobile phases (different
proportions of methanol or acetonitrile + 0.1% acetic acid,
methanol or acetonitrile + 10-15-25 mM acetate buffer pH
4.6 - 4.8 - 5.0 - 5.2 and acetonitrile + KH2PO4 buffer pH 4.0
- 4.5 - 4.8) with the proportion of organic phase ranging from
10 to 30 % and mobile phase flow from 0.4 to 1.8 mL/min.
The best results in terms of resolution and single run length
were obtained with the conditions described in section 3.2.
Despite its simple analytical instrumentation and conditions,
the method enables good resolution with acceptable
retention times: AAMU 2.3 min, AFMU 2.7 min; 1U 3.5
min; 1X 4.9 min; PAR 6.3 min; 1,7U 6.9 min, 1,7 X 8.9 min;
1,3,7X 17.9 min. Fig. (2a) shows a chromatogram of blank
urine spiked with internal standard, Fig. (2b) shows a chromatogram
of blank saliva spiked with internal standard.
Typical chromatograms of human urine and saliva samples
are shown in Fig. (3a and 3b), respectively. In all of the
chromatograms presented, the samples were extracted using
the same liquid-liquid extraction procedure as described
above in section 3.1.
Current clinical pharmacology still needs simple analytical
tools for phenotyping major biotransforming enzymes,
such as CYP1A2. CYP phenotyping remains relevant in
some clinically difficult situations, where simple therapeutic
drug monitoring (TDM) cannot provide a satisfactory explanation
of non-response or drug toxicity in drugs being
Fig. (2). a) chromatogram of blank urine spiked with internal standard
b) chromatogram of blank saliva spiked with internal standard.
Fig. (3). Typical chromatograms of a) human urine and b) saliva
samples drawn 6 h after caffeine administration.
metabolized by polymorphic enzyme, or the suspected induction/inhibition
of CYP enzymatic activity which occurs
with co-medication [27]. Analytical methods for clinical
practice need to be precise, repeatable, robust, easy to use
and affordable. The separation of analytes in our method is
good - resolution was at least 1.75 for AAMU and AFMU, in
other analytes it is much greater. The analysis length is less
than 18 minutes, which is indisputably worse than LC-MS
methods, but in light of the number of analytes measured (7+
IS) and compared to other LC-UV methods, is acceptable
and allows for routine use in a clinical setting. Moreover,
method does not require expensive instrumentation, such as
MS detector.
4.3. Linearity
The linearity of the detector response for the solutions of
standards in the mobile phase was evaluated using a linear
regression model; regression lines were constructed by plotting
peak area to concentration in three replicates at six levels
of concentration. The parameters of the linear regression
equations of detector response [mAU.s] versus concentration
[mg/L] are presented in Table 1.
4.4. Precision and Accuracy
To determine the intra- and inter-day precision and accuracy
of the assay, replicate sets (n = 6 for intraday and n = 6
consecutive days for interday, respectively) of three concentrations
of each analyte in blank urine were analyzed. Precision
was calculated as intra- and inter-day RSD values, and
accuracy was expressed as (measured concentration x 100) /
nominal concentration [%]. The intraday variations for the
measured analytes were < 8.2 %. The interday variations
were < 8.8 %, respectively (Table 2).
103
6 Current Pharmaceutical Analysis, 2016, Vol. 12, No. ? Turjap et al.
4.5. Limit of Detection
To determine the limit of detection and limit of quantitation
(LOD, S/N > 3:1, LOQ , S/N > 10:1), spiked blank urine
and saliva samples were analyzed at the lowest concentration
level used for linearity evaluation. Chromatograms from the
assay of blank urine and saliva samples were used to establish
the "background noise" in the assay. The LODs in saliva
were in the range 2.16 (1X) - 22.25 µg/L (AFMU), the LOQs
in saliva were in the range 7.2 (1X) - 74.17 µg/L (AFMU).
The LODs in urine were in the range 2.52 (1X) - 24.72 µg/L
(AFMU) and the LOQs in urine were in the range 8.40 -
82.41 µg/L. The LOD and LOQ are mentioned in the supplementary
material (Table S1). These limits of detection
and quantitation proved to be sufficient for common
CYP1A2 metabolic activity determination, when caffeine is
administered at a dose of 1-4 mg/kg and concentrations of
caffeine and metabolites observed by ourselves (at the dose
of 3 mg/kg) in urine were in units of mg/L. In saliva, concentrations
of 1,3,7X and 1,7X are still 3 to 20 times higher than
the LOQ, but some metabolites of caffeine in some of the
saliva samples (3 or 6 hours after caffeine administration),
namely 1X, 1U, 1,7U are close to or below the LOQ. Nevertheless,
ratios other than 1,7X to 1,3,7X are not routinely
evaluated in saliva samples. The limits of detection of this
method are, in general, comparable with the previously published
HPLC-UV methods [10, 28], but inferior to LC-MS
methods [8, 12, 24] or HPLC with electrochemical detection
[29].
4.6. Stability of Sample Extracts
The stability of analytes was evaluated as the percentage
of peak area of distinct analyte in the extract of blank
saliva samples spiked with standards (at medium concentration
level mentioned in Table 1, which ranged from 1.09
to 1. 93 mg/L) after 7 days in the dark at 4°C. The stability
in the mobile phase was poor for AFMU and AAMU,
where a 28% increase in the peak area of AAMU was observed,
and a 22% decrease in the peak area of AFMU
compared with the peak areas of freshly prepared extract
(considered as 100 %). In all the other analytes, the stability
was acceptable, with the lowest peak area in 1U (96 % of
original) and the highest peak area in 1,7X (109 % of original)
after 7 days of storage. The data are available in supplementary
material (Fig. S2).
The instability of AFMU does not allow for sample storage,
and thus immediate analysis is necessary once extraction
is performed. Similar findings on AFMU instability
were also reported by others [12, 25].
4.7. Selectivity
The selectivity (non-interference with endogenous compounds)
was tested with pooled blank samples spiked with
standards at the concentration near to the LOQ (10 µg/L of
each analyte). Moreover, the non- interference with some
of frequently used medication (acetylsalicylic acid,
diazepam, diclofenac, fluoxetine, ketoconazole, prednisone,
alprazolam, phenacetine, chlorpropamide) was proved in
the same manner with use of standards of above mentioned
drugs.
4.8. Data Obtained from Experimental Samples
This method was used to determine the molar metabolic
ratios of caffeine to its metabolites in human saliva and human
urine samples obtained from 0-3 h and 0-6 h (urine) or
the single point sample collections at 3 h and 6 h (saliva)
after a single dose of caffeine (3 mg/kg). Molar metabolic
ratios were calculated (1,7X/1,3,7X and
AAMU+AFMU+1U+1X/1,7U) in 16 subjects. Descriptive
statistical methods were performed for the analysis of metabolic
ratios in urine and saliva. Using a linear regression
model, a good correlation was found between the 0-3 h urinary
and 3 h salivary molar 1,7X/1,3,7X ratio, with the regression
equation: y = 0.0744 + 0.093x; r = 0.8553; p =
0.00005 where y = salivary 1,7X/1,3,7X and x = urinary
1,7X/1,3,7X ratio. Similarly, we observed a correlation between
the 0-6 h urinary and 6 h salivary molar 1,7X/1,3,7X
ratio, with the regression equation: y = 0.1187 + 0.1325x; r =
0.7279; p = 0.0014.
Based on the papers of Perera, Faber and Fuhr [14, 20,
30, 31], the salivary ratio of 1,7X to 1,3,7X has proved its
applicability in CYP1A2 metabolic activity assessment. We
have confirmed a good correlation between the salivary and
urinary 1,7X to 1,3,7X metabolic ratio reported by others [8,
13, 14, 31-33] which could allow for CYP1A2 phenotype
determination with the use of saliva samples in clinical settings.
Moreover, according to Bendriss et al. [10], this
method could be also used for determining the metabolic
activity of N-acetyltransferase 2 (NAT2), CYP2A6 and xanthine
oxidase, since the ratio of 1U/1X+1U is considered a
measure of xanthine oxidase metabolic activity,
AFMU/(AFMU+1X+1U) as a measure of NAT2 metabolic
activity and 17U/(AFMU+1X+1U+1,7X+1,7U) as a measure
of CYP2A6 metabolic activity. Since Perera et al. reported
that a 24h methylxanthine-free diet has a negligible impact
on apparent caffeine to paraxanthine clearance and paraxanthine
clearance, when compared to no methylxanthine-free
diet [34], CYP1A2 phenotyping methods which utilize caffeine
are clinically applicable, even if the subjects fail to
abstain from methylxanthines.
An advantage of this method is that the analysis can be
carried out in a standard analytical laboratory and no special
equipment is needed. Our method is simple, cost-effective,
has a proven sufficient sensitivity comparable with other LCUV
methods, and enables the assessment of various caffeine
metabolic ratios in urine, and without any modification also
the salivary caffeine to paraxanthine ratio. The method was
fully validated in terms of linearity, precision, accuracy, extraction
recovery and the stability of analytes. It may be easily
used on any HPLC-UV instrumentation by clinicians or
laboratory technicians. The method was successfully applied
in the analysis of real samples and therefore has been shown
to be clinically useful.
CONCLUSION
Our method has several advantages over published
methods. First, the method enables the determination of
CYP1A2 metabolic activity using either urine or saliva samples.
Nonetheless, the method is universal and can be also utilized
for the assessment of CMR, xanthinoxidase xanthinoxidase
or NAT2 metabolic activity in urine samples. Second, de-
104
Determination of Caffeine and its Metabolites in Saliva and Urine Current Pharmaceutical Analysis, 2016, Vol. 12, No. ? 7
termination may be performed by laboratory technicians, with a
conventional HPLC system with a DAD detector with sufficient
sensitivity for clinical usage.
LIST OF ABBREVIATIONS
CYP = cytochrome P450 (e.g. CYP1A2 = 1A2 enzyme
of cytochrome P450 family)
NAT2 = N- acetyltransferase 2
PAR = paracetamol, acetaminophen, N-(4-
hydroxyphenyl)acetamide
1,3,7X = caffeine, 1,3,7-trimethylpurine-2,6-dione
1,7X = paraxanthine, 1,7-dimethyl-3-hydropurine-
2,6-dione
1X = 1-methylxanthine, 1-methyl-3,7-
dihydropurine-2,6-dione
1,7U = 1,7-dimethyluric acid, 1,7-dimethyl-3,9-
dihydropurine-2,6,8-trione
1U = 1-methyluric acid, 1-methyl-7,9-dihydro-3H-
purine-2,6,8-trione
AFMU = 5-acetylamino-6-formylamino-3-methyluracil
AAMU = 5-acetylamino-6-amino-3-methyluracil
CONFLICT OF INTEREST
The authors confirm that this article content has no conflict
of interest.
ACKNOWLEDGEMENTS
This work was supported by research project of the Grant
Agency of the Czech Republic No. P206/11/0009 and by the
project MUNI/A/1116/2014.
REFERENCES
[1] Kot, M.Daniel, M.A. The relative contribution of human cytochrome
P450 isoforms to the four caffeine oxidation pathways: An
in vitro comparative study with cDNA-expressed P450s including
CYP2C isoforms. Biochem. Pharmacol., 2008, 76(4), 543-551.
[2] Jiang, Z.W.; Dragin, N.; Jorge-Nebert, L.F.; Martin, M.V.; Guengerich,
F.P.; Aklillu, E.; Ingelman-Sundberg, M.; Hammons, G.J.;
Lyn-Cook, B.D.; Kadlubar, F.F.; Saldana, S.N.; Sorter, M.; Vinks,
A.A.; Nassr, N.; von Richter, O.; Jin, L.; Nebert, D.W. Search for
an association between the human CYP1A2 genotype and CYP1A2
metabolic phenotype. Pharmacogenet. Genomics, 2006, 16(5),
359-367.
[3] Shin, M.K.; Yi, H.G.; Kwon, Y.H.; Lee, S.K.; Lim, W.S.; Park,
C.S.; Kang, J.H., Effects of CYP1A2*1C and CYP1A2*1F genotypes
on the activity and inducibility of CYP1A2 determined by
urinary caffeine metabolite ratio in Koreans. Mol. Cell. Toxicol.,
2007, 3(4), 314-319.
[4] Shirley, K.L.; Hon, Y.Y.; Penzak, S.R.; Lam, Y.W.F.; Spratlin, V.;
Jann, M.W. Correlation of cytochrome P450 (CYP) 1A2 activity
using caffeine phenotyping and olanzapine disposition in healthy
volunteers. Neuropsychopharmacology, 2003, 28(5), 961-966.
[5] Jurica, J.; Konecny, J.; Zahradnikova, L.Z.; Tomandl, J. Simultaneous
HPLC determination of tolbutamide, phenacetin and their
metabolites as markers of cytochromes 1A2 and 2C6/11 in rat liver
perfusate. J. Pharm. Biomed. Anal., 2010, 52(4), 557-64.
[6] Dorne, J.L.C.M.; Walton, K.; Renwick, A.G. Uncertainty factors
for chemical risk assessment: human variability in the pharmacokinetics
of CYP1A2 probe substrates. Food Chem. Toxicol., 2001,
39(7), 681-696.
[7] Tassaneeyakul, W.; Birkett, D.J.; Mcmanus, M.E.; Tassaneeyakul,
W.; Veronese, M.E.; Andersson, T.; Tukey, R.H.; Miners, J.O.,
Caffeine Metabolism by Human Hepatic Cytochromes P450 - Contributions
of 1a2, 2e1 and 3a Isoforms. Biochem. Pharmacol.,
1994, 47(10), 1767-1776.
[8] Hakooz, N.M.K., Caffeine Metabolic Ratios for the In Vivo
Evaluation of CYP1A2, N-acetyltransferase 2, Xanthine Oxidase
and CYP2A6 Enzymatic Activities. Curr. Drug Metab., 2009,
10(4), 329-338.
[9] van Troostwijk, L.J.A.E.D.; Koopmans, R.P.; Vermeulen, H.D.B.;
Guchelaar, H.J., CYP1A2 activity is an important determinant of
clozapine dosage in schizophrenic patients. Eur. J. Pharm. Sci.,
2003, 20(4-5), 451-457.
[10] Bendriss, E.K.; Markoglou, N.; Wainer, I.W., Liquid chromatographic
method for the simultaneous determination of caffeine
and fourteen caffeine metabolites in urine. J. Chromatogr. B Biomed.
Sci. Appl. 2000, 746(2), 331-338.
[11] Caubet, M.S.; Elbast, W.; Dubuc, M.C.; Brazier, J.L., Analysis of
urinary caffeine metabolites by HPLC-DAD: the use of metabolic
ratios to assess CYP1A2 enzyme activity. J. Pharm. Biomed. Anal.,
2002, 27(1-2), 261-270.
[12] Schneider, H.; Ma, L.; Glatt, H., Extractionless method for the
determination of urinary caffeine metabolites using highperformance
liquid chromatography coupled with tandem mass
spectrometry. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci.
2003, 789(2), 227-237.
[13] Fuhr, U.Rost, K.L., Simple and Reliable Cyp1a2 Phenotyping by
the Paraxanthine/Caffeine Ratio in Plasma and in Saliva. Pharmacogenetics,
1994, 4(3), 109-116.
[14] Fuhr, U.; Rost, K.L.; Engelhardt, R.; Sachs, M.; Liermann, D.;
Belloc, C.; Beaune, P.; Janezic, S.; Grant, D.; Meyer, U.A.; Staib,
A.H., Evaluation of caffeine as a test drug for CYPIA2, NAT2 and
CYP2E1 phenotyping in man by in vivo versus in vitro correlations.
Pharmacogenetics, 1996, 6(2), 159-176.
[15] de Araujo, D.M.; Brito, C.D.; de Oliveira, S.D.S.; da Silva, D.R.;
Martinez-Huitle, C.A.; Aragao, C.F.S., Platinum Sensor for Quantifying
Caffeine in Drug Formulations. Curr. Pharm. Anal., 2014,
10(4), 231-238.
[16] Holland, D.T.; Godfredsen, K.A.; Page, T.; Conner, J.D., Simple
high-performance liquid chromatography method for the simultaneous
determination of serum caffeine and paraxanthine following
rapid sample preparation. J. Chromatogr. B, 1998, 707(1-2), 105-
110.
[17] Krul, C.Hageman, G., Analysis of urinary caffeine metabolites to
assess biotransformation enzyme activities by reversed-phase highperformance
liquid chromatography. J. Chromatogr. B Analyt.
Technol. Biomed. Life Sci., 1998, 709(1), 27-34.
[18] Atia, N.N.; York, P.; Clark, B.J. Development and validation of a
rapid and efficient method for simultaneous determination of methylxanthines
and their metabolites in urine using monolithic HPLC
columns. J. Sep. Sci., 2009, 32(7), 931-938.
[19] Zydron, M.; Baranowski, J.; Baranowska, I. Separation, preconcentration,
and HPLC analysis of methylxanthines in urine
samples. J. Sep. Sci. 2004, 27(14), 1166-1172.
[20] Perera, V.; Gross, A.S.; McLachlan, A.J. Caffeine and paraxanthine
HPLC assay for CYP1A2 phenotype assessment using saliva and
plasma. Biomed. Chromatogr., 2010, 24(10), 1136-1144.
[21] Nyeki, A.; Biollaz, J.; Kesselring, U.W.; Decosterd, L.A., Extractionless
method for the simultaneous high-performance liquid
chromatographic determination of urinary caffeine metabolites for
N-acetyltransferase 2, cytochrome P450 1A2 and xanthine oxidase
activity assessment. J. Chromatogr. B Biomed. Sci. Appl., 2001,
755(1-2), 73-84.
[22] Caubet, M.S.; Comte, B.; Brazier, J.L. Determination of urinary C-
13-caffeine metabolites by liquid chromatography-mass spectrometry:
the use of metabolic ratios to assess CYP1A2 activity. J.
Pharm. Biomed. Anal., 2004, 34(2), 379-389.
[23] Rybak, M.E.; Pao, C.I.; Pfeiffer, C.M. Determination of urine caffeine
and its metabolites by use of high-performance liquid chromatography-tandem
mass spectrometry: estimating dietary caffeine
exposure and metabolic phenotyping in population studies. Anal.
Bioanal. Chem., 2014, 406(3), 771-784.
[24] Peri-Okonny, U.L.; Wang, S.X.; Stubbs, R.J.; Guzman, N.A. Determination
of caffeine and its metabolites in urine by capillary
electrophoresis-mass spectrometry. Electrophoresis, 2005, 26(13),
2652-2663.
105
8 Current Pharmaceutical Analysis, 2016, Vol. 12, No. ? Turjap et al.
[25] Wong, P.; Villeneuve, G.; Tessier, V.; Banerjee, K.; Nedev, H.;
Jean-Claude, B.J.; Leyland-Jones, B. Stability of 5-acetamido-6formylamino-3-methyluracil
in buffers and urine. J. Pharm. Biomed.
Anal., 2002, 28(3-4), 693-700.
[26] FDA, Guidance for Industry: Bioanalytical Method Validation,
U.S.D.o.H.a.H. Services, et al., CDER, CVM, 2001, FDA. p. 1-55.
[27] Hiemke, C.; Shams, M. Phenotyping and Genotyping of Drug
Metabolism to Guide Pharmacotherapy in Psychiatry. Curr. Drug
Deliv., 2013, 10(1), 46-53.
[28] Begas, E.; Kouvaras, E.; Tsakalof, A.; Papakosta, S.; Asprodini,
E.K. In vivo evaluation of CYP1A2 CYP2A6, NAT-2 and xanthine
oxidase activities in a Greek population sample by the RP-HPLC
monitoring of caffeine metabolic ratios. Biomed. Chromatogr.,
2007, 21(2), 190-200.
[29] Svorc, L. Determination of Caffeine: A Comprehensive Review on
Electrochemical Methods. Int. J. Electrochem. Sci., 2013, 8(4),
5755-5773.
[30] Faber, M.S.; Jetter, A.; Fuhr, U. Assessment of CYP1A2 activity in
clinical practice: Why, how, and when? Basic. Clin Pharmacol.
Toxicol. 2005, 97(3), 125-134.
[31] Perera, V.; Gross, A.S.; McLachlan, A.J. Measurement of CYP1A2
Activity: A Focus on Caffeine as a Probe. Curr. Drug Metab.,
2012, 13(5), 667-678.
[32] Carvalho, J.J.; Weller, M.G.; Panne, U.; Schneider, R.J. Monitoring
Caffeine in Human Saliva Using a Newly Developed Elisa. Anal.
Lett., 2012, 45(17), 2549-2561.
[33] Fenske, M. Caffeine determination in human saliva and urine by
TLC and ultraviolet absorption densitometry. Chromatographia,
2007, 65(3-4), 233-238.
[34] Perera, V.; Gross, A.S.; Forrest, A.; Landersdorfer, C.B.; Xu, H.;
Ait-Oudhia, S.; McLachlan, A.J. A pharmacometric approach to
investigate the impact of methylxanthine abstinence and caffeine
consumption on CYP1A2 activity. Drug Metab. Dispos., 2013,
41(11), 1957-66.
Received: September 03, 2015 Revised: November 06, 2015 Accepted: November 18, 2015
106
6.2 Phenotyping of CYP2D6 with dextromethorphan as a probe substrate
Despite CYP2D6 representing only approximately 4% of the total P450 content in the liver, it is
involved in the metabolism of 15 - 25% of all drugs used in clinical practice (Zanger and Schwab,
2013). However CYP2D6 is non-inducible, there is an up to 100-fold difference in inter-individual
activity (Ning et al., 2018). Opioids, antidepressants, antidysrhythmics, or β blockers are examples of
substrates of CYP2D6. Both ultrarapid and poor metabolizers can be at risk of adverse effects of
CYP2D6 drug substrates due to the increased activation of opioids (codeine, tramadol) or slow
elimination of antidepressants (venlafaxine, fluoxetine) (Haufroid and Hantson, 2015). Both CYP2D6
genotyping and phenotyping is used for the optimization of dosaging.
Dextromethorphan O-demethylation is a well established and safe probe substrate for both in vitro
and in vivo CYP2D6 phenotyping. The urine MR of dextromethorphan to dextrorphan is widely used
for evaluating the CYP2D6 phenotype, while plasma or salivary MR are used rarely. The correlation
between serum and urine MR was studied in our trial in 30 healthy volunteers. Dextromethorphan
was administered orally (30 mg) in a syrup, and urine was collected for the following eight hours.
Blood was sampled three hours after the administration of the probe substrate. The samples were
enzymatically hydrolysed with β-glucuronidase, extracted by two-step liquid-liquid extraction and
dextromethorphan and its metabolites dextrorphan, methoxymorphinan, and hydroxymorphinan
were analysed by HPLC. A tight non-linear correlation between serum and urine MR was described.
The cut-off values for distinguishing between the phenotypes (poor, intermediate, and extensive
metabolizers) were calculated using receiver operating characteristic analysis, in the second part of
the study. Levels of dextromethorphan and dextrorphan were analysed in serum samples of 30
healthy volunteers and 51 psychiatric drug-naïve patients. The cut-off values for the group of poor
metabolizers to extensive or combination of extensive and intermediate metabolizers were
calculated to be in the range between 0,215-0,742, with 100% sensitivity and specificity. The
distinguishing cut-off value for the groups of extensive metabolizers and of intermediate + poor
metabolizers, as well as for the cut-off between extensive and intermediate metabolizers, was
0,02081. Nevertheless, the sensitivity and specificity of these values decreased to 70.03% +70.37%
and 61.9% + 70.83%, respectively.
Juřica J., Barteček R., Žourková A., Pindurová E., Šulcová A., Kašpárek T., Zendulka O. Serum
dextromethorphan/dextrorphan metabolic ratio for CYP2D6 phenotyping in clinical practice. Journal
of Clinical Pharmacy and Therapeutics, 37, 486-490, 2012.
Impact factor: 2.104; Pharmacology & Pharmacy Q3 Citations WoS: 18
Author’s contribution: 10%, corresponding author
107
Pharmacogenetics
Serum dextromethorphan/dextrorphan metabolic ratio for CYP2D6 phenotyping
in clinical practice
J. Jurica* PhD, R. Bartecek  MD, A. Zourkova  MD, E. Pindurovaà MSc, A. Sulcova* MD, T. Kasparek  MD PhD and
O. Zendulka* PhD
*Department of Pharmacology, Faculty of Medicine, Experimental and Applied Neuropsychopharmacology Research Group, Central European Institute of
Technology (CEITEC), Masaryk University,  Department of Psychiatry, Faculty Hospital Brno, Behavioral and Social Neuroscience Research Group,
Central European Institute of Technology (CEITEC), Masaryk University, àDepartment of Human Genetics, Faculty Hospital Brno, Masaryk University,
Brno, Czech Republic
Received 20 September 2011, Accepted 12 January 2012
Keywords: CYP2D6, dextromethorphan, genotype, metabolic ratio, phenotype, serum
SUMMARY
What is known and Objective: Accurate prediction of actual
CYP2D6 metabolic activity may prevent some adverse drug
reactions and improve therapeutic response in patients receiving
CYP2D6 substrates. Dextromethorphan-to-dextrorphan
metabolic ratio (MRDEM/DOR) is well established as a marker
of CYP2D6 metabolizer status. The relationship between urine
and plasma or serum MRDEM/DOR is not well established nor
is there evidence of antimode for separation of intermediate
and especially poor metabolizers (PM) from extensive metabolizers
(EM). This study addressed whether CYP2D6 phenotyping
using molar metabolic ratio of dextromethorphan to
dextrorphan (MRDEM/DOR) in serum is usable and reliable in
clinical practice as urinary MRDEM/DOR.
Methods: We measured MRDEM/DOR in serum and CYP2D6
genotype in 51 drug-naive patients and 30 volunteers. Receiver-operator
characteristic (ROC) analysis was used for the
evaluation of optimum cut-off value for discriminating
between extensive, intermediate and PM. In addition, we
studied the correlation of serum MRDEM/DOR with urine
MRDEM/DOR in the 30 healthy volunteers.
Results and Discussion: A trimodal distribution of log
MRDEM/DOR in serum was observed, with substantial overlap
between extensive and intermediate metabolizer groups. We
obtained an acceptable cut-off serum MRDEM/DOR value to
discriminate between PM and either extensive or extensive
+ intermediate metabolizers. Using serum MRDEM/DOR, it
seems to be unreliable to discriminate EM from intermediate
metabolizers (IM). A strong correlation between serum
MRDEM/DOR and urine MRDEM/DOR was found.
What is new and Conclusion: Serum MRDEM/DOR (3 h) correlated
with MRDEM/DOR in urine (0–8 h). Serum MRDEM/DOR
discriminated between extensive and PM and between extensive
+ intermediate and PM. Our CYP2D6 phenotyping using
serum dextromethorphan/dextrorphan molar ratio appears reliable
but requires independent validation.
WHAT IS KNOWN AND OBJECTIVE
CYP2D6 plays a pivotal role in the metabolism of many drugs.
It is a highly polymorphic enzyme, and to date, more than 80
allelic variants alleles have been identified.1
The variant alleles
may encode proteins with normal (e.g. CYP2D6*2), decreased
(e.g. CYP2D6*10) or no (e.g. CYP2D6*4) enzyme activity. As a
consequence, there is a wide range of CYP2D6 metabolic activity
shows wide inter-subject variability. The CYP2D6 metabolic
phenotype can be classified into four groups – poor metabolizers
(PM), intermediate metabolizers (IM), extensive metabolizers
(EM) and ultrarapid metabolizers (UM).2
Thus, the same dose
of a drug extensively metabolized by CYP2D6 can result in a
different clinical response in patients depending on the P450
phenotype.2
Moreover, CYP2D6–drug interactions may also
have clinical consequences. For example, after administration of
paroxetine, a CYP2D6 inhibitor, to patients on tamoxifen, a
decrease in plasma levels of the active metabolite of tamoxifen
was detected.3
This change may have serious consequences in
breast cancer treatment with tamoxifen. CYP2D6 ultrarapid metabolizer
phenotype may cause failure of pharmacotherapy
because of the very low and thus ineffective drug plasma lev-
els.4
In antipsychotic treatment, an association has been
observed between extrapyramidal adverse effects and the
CYP2D6 genotype.5
Therefore, for drugs with narrow therapeutic
indices, it seems to be useful to assess CYP2D6 metabolic
activity prior to or during therapy with CYP2D6 substrates and
to adjust the individual dosage according to the patient’s phenotype.
Such personalized pharmacotherapy may prevent adverse
effects and improve response. Specific substrates (markers) that
are metabolized selectively by CYP2D6 are often used for the
assessment of metabolic activity. The concentration of specific
substrate and its metabolite in body fluids (a ratio of molar concentrations;
metabolic ratio) serves as a measure of the individual
CYP activity. Histograms of log-transformed metabolic
ratios may show cut-off values of MR which distinguish EM
from PM, UM or IM. Suitable substrates for CYP2D6 include
debrisoquine, bufuralol, tramadol, dextromethorphan, metoprolol
and sparteine.2,6
Debrisoquine and sparteine are not
currently available, and except for dextromethorphan, the other
substrates are seldom administered. Dextromethorphan remains
the most widely used probe for CYP2D6 metabolic activity
Correspondence: O. Zendulka, Assistant, Department of Pharmacology,
Faculty of Medicine, Masaryk University, Kamenice 5, 62500
Brno, Czech Republic. Tel.: +420549493971; fax: +420549492364;
e-mail: zendulka@med.muni.cz
Journal of Clinical Pharmacy and Therapeutics, 2012, 37, 486–490 doi: 10.1111/j.1365-2710.2012.01333.x
ª 2012 Blackwell Publishing Ltd 486
108
assessment in vivo.6
The ratio of molar concentrations of dextromethorphan
to dextrorphan (MRDEM/DOR) serves as a measure
of metabolic activity and phenotype of CYP2D6. A cut-off value
for 8-h urinary MRDEM/DOR of 0Æ3 is widely used to differentiate
between extensive and poor metabolizers.7–9
As 8-h sampling of
urine is demanding, alternative procedures have been developed.
Saliva or plasma samples can also be used for the determination
of MRDEM/DOR.7,10
A non-invasive CYP2D6 phenotype
test was developed by Hu et al.10
using single or multiple doses
of controlled-release dextromethorphan tablets. Although these
authors have demonstrated that there is a good correlation
between single-dose and multiple-dose dextromethorphan as
well as between MRDEM/DOR assessed in various kinds of samples,
they did not investigate the cut-off value for discriminating
EM from PM.10
Indeed, only two studies have investigated this
cut-off value; Shiran et al.11
suggested a value of 0Æ1 for differentiating
between EM and PM using 3 h post-dose MRDEM/DOR,
whereas Kohler et al.12
suggested a value of 0Æ126 using 1 h
post-dose MRDEM/DOR. However, the relationship between urine
and plasma or serum MRDEM/DOR is not well established, and
there is as yet no reliable evidence of antimode for identification
of IM and especially PM, from EM patients.
Our aim was to assess the correlation between MRDEM/DOR in
serum (3 h) and MRDEM/DOR in urine (0–8 h) and to identify the
serum MRDEM/DOR cut-off value for distinguishing between
EM, IM and PM.
METHODS
Fifty-one drug-naive patients and 30 healthy volunteers were
studied. Participation was voluntary. The study was performed
in accordance with the Helsinki declaration, revision 2008, and
approved by the ethics committee of the Faculty Hospital Brno.
All subjects had given their written informed consent prior to
the start of any activities connected with the study.
Inclusion criteria for patients were as follows: treatment at
the Department of Psychiatry of Masaryk University, Brno; male
and female patients aged 18–70 years; diagnosis of schizophrenia/depression/anxiety
disorder according to ICD X; no medication
known to affect cytochrome P450 enzyme activity; and
no previous pharmacological treatment of schizophrenia/
depression/anxiety disorder. Exclusion criteria were the following:
patients treated with substrates or inhibitors of CYP2D6;
serious somatic condition; patients with risk of suicidal behaviour;
and pregnant and breastfeeding women. Inclusion criteria
for healthy volunteers were men and women aged 18–70 years
of age. Exclusion criteria were treatment with substrates or
inhibitors of CYP2D6; serious somatic condition; and pregnant
and breastfeeding women. All the subjects were Caucasians.
Molecular genetic analysis: Peripheral blood samples were
taken from patients into tubes with EDTA. DNA was isolated
from lymphocytes using standard procedure of phenol chloroform
precipitation or by means of an automatic isolator (Roche,
Indianapolis, IN, USA). As a main method, direct automatic
sequencing of all the nine exons of the CYP2D6 gene using
seven specific pairs of primers was performed using the Primer3plus
software (Free Software Foundation, Inc., Boston, MA,
USA). Because of the localization of two pseudogenes in close
proximity to the CYP2D gene, the product generated by Long
Range PCR (Analytik Jena/bio solution, Jena, Germany) was
used as a template for sequencing and genotyping.13
The DNA
sequences were compared with the standard sequences, and the
resultant allele combinations were evaluated.
Real-time PCR and specific FRET probes were used (TibMolBiol,
Berlin, Germany) as a complementary method for the
detection of the most frequent null alleles *3,*4,*6,*7,*8 in Caucasian
population.14
Subsequently, real-time PCR method using
FRET probes was replaced by high-resolution melting analysis
(Roche). This approach helps us to assess the PM faster than
standard sequencing and cheaper than FRET probes. By using
high-resolution melting analysis, we could distinguish standard
subjects (wt/wt) from variant homozygotes and heterozygotes.
Pairs of primers (designed in our laboratory, sequences and
lengths of primers are given in Table 1) and an intercalation
dye that binds on dsDNA ensured production of very short
sequences (max. 148 kb).
Large gene deletions and duplications were detected using
agarose electrophoresis or UPL probes (Roche).15
Subjects carrying
a combination of null/null alleles were classified as genetically
PM. Subjects with null/full function alleles, null/reduced
function alleles or reduced function/reduced function alleles
were classified as IM, and subjects carrying either full function/
full function alleles or full function/reduced function alleles
were classified as EM.
Phenotype analysis: Dextromethorphan hydrobromide (Robitussin
syrup; Wyeth, Wien, Austria) in syrup available as OTC
drug was administered to subjects orally at 07:00 h at the dose
of 30 mg after overnight fasting. Blood samples (10 mL) were
Table 1. Primer sequences for CYP2D6
established alleles (Primer 3 plus free
software used as source of all sequences)
Allele Main nucleotide change Sequence of primers Product length
ALLELE *4 1846G>A F: ACCCCTTACCCGCATCTC 74 bp
R: TTGCTCACGGCTTTGTCC
ALLELE *9 2613-2615delAGA F: GACCTGACTGAGGCCTTCCT 80 bp
R: CTCAACCCACCACCCTTG
ALLELE *41 2988G>A F: GAGCCCATCTGGGAAACAGT 77 bp
R: GGTGTCCCAGCAAAGTTCAT
ALLELE *3 2549deA F: TTCCAAAAGGCTTTCCTGAC 98 bp
R: AAGGCCTCAGTCAGGTCTCG
ALLELE *10 100C>T F: TAGTGGCCATCTTCCTGCTC 148 bp
R: ACCTGGTCGAAGCAGTATGG
ALLELE *7 2935A>C F: GCCTCCTGCTCATGATCCTA 55 bp
R: GTTTCCCAGATGGGCTCAC
ALLELE *6 + *8 1758G>T + 1707delT F: CAAGAAGTCGCTGGAGCAG 110 bp
R: TCCCAGTTCCCGCTTTGT
ª 2012 Blackwell Publishing Ltd Journal of Clinical Pharmacy and Therapeutics, 2012, 37, 486–490
487
Phenotyping CYP2D6 using 3-h serum dextromethorphan MR J. Jurica et al.
109
drawn 3 h after ingestion of dextromethorphan (in both patients
and volunteers) into BD Vacutainer SST tubes for serum separation.
Urine was collected for 8 h after dextromethorphan administration
into glass screw-capped tubes. Urine was collected
only for volunteers and not for patients because of the unreliability
of collection (particularly in schizophrenic patients).
Blood samples were centrifuged 10 min at 1000 g at 4 °C. Serum
aliquots were transferred into a screw-capped polypropylene
tube and were frozen at )75 °C until HPLC analysis. Collected
urine samples for each subject were pooled, the volume was
measured, and the aliquots were frozen at )75 °C until analysis.
The analysis was carried out according the method of Zimova
et al.16
Prior to the analysis, the samples were enzymatically hydrolysed
with b-glucuronidase and extracted with a mixture of
n-hexane/1-butylalcohol (9 : 1) and re-extracted into 0Æ1 m HCl
(all chemicals were from SigmaAldrich, Darmstadt, Germany).
Aliquots were injected in a Shimadzu LC-10 series HPLC system
(Shimadzu, Kyoto, Japan). A Tessek Separon SGX phenyl
(150 · 3 mm, 5 lm) reversed-phase analytical column protected
with guard column Tessek SGX phenyl (4 · 40 mm; 5 lm)
(both Tessek, Prague, Czech Republic) was used for the separation.
Dextromethorphan, its metabolites dextrorphan, methoxymorphinan,
hydroxymorphinan and internal standard
laudanosine were detected using fluorescence detector RF-10Axl
(Shimadzu), the excitation wavelength was set at kex = 280 nm,
and the emission wavelength was set at kem = 320 nm. Data
from the detector were collected and analysed using LabSolution
1.03 SP3 software (Shimadzu). Limits of detection (signalto-noise
ratio = 3) for dextromethorphan and dextrorphan were
186 and 204 ng/L, respectively. Coefficients of variation for
intra- and interday precision of assessment were below 10%.
Molar concentrations of dextromethorphan and dextrorphan in
serum and urine samples were measured and MRDEM/DOR cal-
culated.
Receiver-operator characteristic (ROC) analysis was undertaken
to find the MRDEM/DOR cut-off values for separating EM/
IM/PM. Cut-off values were assessed on the basis of the highest
AUC of the ROC curve.
RESULTS AND DISCUSSION
Histograms of log-transformed serum and urine MRDEM/DOR
values are shown in Figs 1 and 2. As can be seen, a bimodal
distribution of urine MRDEM/DOR was observed in volunteers,
and a trimodal distribution of serum MRDEM/DOR was observed
in drug-naive patients with substantial overlap between the EM
and IM groups. Despite this, the MRDEM/DOR values for the two
groups were different (t test, P = 0Æ017).
Genotype was analysed in 51 patients and 30 volunteers.
Analysis of genotype in 51 patients proved that six subjects
were classified and grouped as PM with genotype of *4*4 or
*4*5(3-h serum MRDEM/DOR 0Æ74–4Æ98), 21 subjects were classified
as IM because of their genotype *1*4, *1*3, *4*41, *4*2,
*4*10, *10*41, *41*41 (3-h serum MRDEM/DOR 0Æ0033–0Æ2133), and
the remainder of the subjects were shown to be EM with genotypes
*1*1, *1*2, *1*41, *1*9, *2*9, *2*2, *2*41 (3-h serum MRDEM/
DOR 0Æ0032–0Æ1062).
Only two PM with genotypes *4*4 and *3*4 and with respective
8-h urine MRDEM/DOR of 1Æ58 and 1Æ59 were observed. Interestingly,
the highest 8-h urine MRDEM/DOR of 30Æ1 (serum
MRDEM/DOR 3Æ4) was observed in a subject classified as IM
based on his *1*4 genotype. Nine subjects were classified as IM
with genotypes *1*4 or *1*3 (8-h urine MRDEM/DOR 0Æ00465–
30Æ1), and the other subjects as EM, carrying genotypes *1*1,
*1*2, *1*41 or *1*9 (8-h urine MRDEM/DOR 0Æ00094–0Æ0819).
Cut-off values were assigned based on the CYP2D6 genotype
and serum MRDEM/DOR of 51 drug-naive patients (Fig. 3). From
the ROC analysis, the cut-off value for discriminating IM + PM
from EM was 0Æ02081 with the specificity of 70Æ03% and the sensitivity
of 70Æ37%. The cut-off value for discriminating EM from
IM only was also 0Æ0208 but with only 61Æ9% sensitivity and
70Æ83% specificity.
The cut-off value for discriminating IM from PM was
between serum MRDEM/DOR 0Æ215 and 0Æ742 (100% sensitivity,
100% specificity, AUC of 1Æ0 within the range). Similarly, the
cut-off value for discriminating PM from IM + EM was in the
range 0Æ21–0Æ742 (100% sensitivity, 100% specificity, AUC of 1Æ0).
There was good correlation of log MRDEM/DOR in serum with
that of urine based on 30 volunteers (r2
= 0Æ87).
Fig. 1. Histogram of log-transformed serum MRDEM/DOR of 51
drug-naive patients.
Fig. 2. Histogram of log-transformed urine MRDEM/DOR of 30
volunteers.
ª 2012 Blackwell Publishing Ltd Journal of Clinical Pharmacy and Therapeutics, 2012, 37, 486–490
488
Phenotyping CYP2D6 using 3-h serum dextromethorphan MR J. Jurica et al.
110
DISCUSSION
The CYP2D6 genotype does not always predict the metabolic
phenotype reliably.11,17,18
Thus, metabolic activity assessment
may be preferable for predicting therapeutic response. The
CYP2D6 metabolic phenotype is mostly assessed using urinary
MRDEM/DOR (0–8 h post-dose), because it does not require invasive
procedure. Collection of urine for 8 h is inconvenient and
often not reliable especially in psychiatric patients. Besides urinary
samples, serum and salivary samples have also been used
for MRDEM/DOR determination.10,19,20
For salivary samples,
greater doses of dextromethorphan are needed,19
and there is
no consensus on the cut-off for discriminating EM from PM.
Moreover, the usefulness of salivary CYP2D6 testing with
dextromethorphan seems to be inferior to serum-/urine-based
testing.10,20
Bimodal or trimodal distribution of the log-transformed urinary
MRDEM/DOR is normally observed with dextromethorphan,
debrisoquine or sparteine CYP2D6 phenotyping.2,9,16,21,22
In our
study, the distribution of both serum and urine log-transformed
MRDEM/DOR was similar. The distribution of serum log MRDEM/
DOR demonstrates11,12
that it can be used for phenotype assessment.
A good correlation exists between serum MRDEM/DOR
and urine MRDEM/DOR. It is well known that the metabolic phenotype
of P450 enzymes may be responsible for the high variance
seen in plasma concentrations of drug substrates and
consequently in their clinical response too.23
In our opinion, at
least some patients may benefit from CYP2D6 phenotyping
prior to pharmacological treatment.
WHAT IS NEW AND CONCLUSION
Our data suggest that serum MRDEM/DOR can be used to discriminate
PM from either extensive or extensive + intermediate
metabolizers, but not EM from IM. However, our results need
independent validation.
ACKNOWLEDGEMENT
The work was supported by the Ministry of Health of Czech
Rep.: NS 9676-4/2008 and by the project ‘CEITEC – Central
European Institute of Technology’ (CZ.1.05/1.1.00/02.0068) from
European Regional Development Fund. We would like to thank
Professor Brian Leonard (Galway, Ireland) for his kind help
with preparation of this manuscript.
REFERENCES
1. The Human Cytochrome P450 (CYP)
Allele Nomenclature Database. Available
at: http://www.cypalleles.ki.se/ (accessed
17 August 2011).
2. Zanger UM, Raimundo S, Eichelbaum M.
Cytochrome P450 2D6: overview and
update on pharmacology, genetics, biochemistry.
Naunyn Schmiedebergs Arch
Pharmacol, 2004;369:23–37.
3. Stearns V, Johnson MD, Rae JM et al.
Active tamoxifen metabolite plasma concentrations
after coadministration of
tamoxifen and the selective serotonin reuptake
inhibitor paroxetine. J Natl Cancer
Inst, 2003;95:1758–1764.
4. Corruble E. Non-response to consecutive
antidepressant therapy caused by
CYP2D6 ultrarapid metabolizer phenotype.
Int J Neuropsychopharmacol, 2008;11:
727–728.
5. Fleeman N, Dundar Y, Dickson R et al.
Cytochrome P450 testing for prescribing
antipsychotics in adults with schizophrenia:
systematic review and meta-analyses.
Pharmacogenomics J, 2011;11:1–14.
6. Zhou SF. Polymorphism of human cytochrome
P450 2D6 and its clinical significance
Part I. Clin Pharmacokinet,
2009;48:689–723.
7. Chladek J, Zimova G, Beranek M, Martinkova
J. In-vivo indices of CYP2D6 activity:
comparison of dextromethorphan metabolic
ratios in 4-h urine and 3-h plasma.
Eur J Clin Pharmacol, 2000;56:651–657.
8. Lotsch J, Rohrbacher M, Schmidt H et al.
Can extremely low or high morphine formation
from codeine be predicted prior to
therapy initiation? Pain, 2009;144:119–124.
9. Ito T, Kato M, Chiba K, Okazaki O, Sugiyama
Y. Estimation of the interindividual
variability of cytochrome 2D6 activity
from urinary metabolic ratios in the literature.
Drug Metab Pharmacokinet,
2010;25:243–253.
10. Hu OYP, Tang HS, Lane HY, Chang WH,
Hu TM. Novel single-point plasma or saliva
dextromethorphan method for determining
CYP2D6 activity. J Pharmacol Exp
Ther, 1998;285:955–960.
11. Shiran MR, Chowdry J, Rostami-Hodjegan
A et al. A discordance between cytochrome
P450 2D6 genotype and phenotype
in patients undergoing methadone
maintenance treatment. Br J Clin Pharmacol,
2003;56:220–224.
12. Kohler D, Hartter S, Fuchs K, Sieghart W,
Hiemke C. CYP2D6 genotype and phenotyping
by determination of dextromethorphan
and metabolites in serum of healthy
controls and of patients under psychotropic
medication. Pharmacogenetics, 1997;7:453–461.
13. Sachse C, Brockmoller J, Bauer S, Roots I.
Cytochrome P450 2D6 variants in a Caucasian
population: allele frequencies and
phenotypic consequences. Am J Hum
Genet, 1997;60:284–295.
14. Stamer UM, Bayerer B, Wolf S, Hoeft A,
Stuber F. Rapid and reliable method for
cytochrome P450 2D6 genotyping. Clin
Chem, 2002;48:1412–1417.
15. Daly AK, Steward A. Use of the expandÔ
long template PCR system in genotyping
for polymorphisms in the human cytochrome
P450 CYP2D6 gene. Biochemica,
1997;4:31–32.
16. Zimova G, Chladek J, Martinkova J, Beranek
M. HPLC determination of dextromethorphan
and its metabolites in urine.
Chemicke Listy, 2000;94:132–135.
Fig. 3. Grouping of patients according to their genotype and
serum MRDEM/DOR in cut-off value assessment.
ª 2012 Blackwell Publishing Ltd Journal of Clinical Pharmacy and Therapeutics, 2012, 37, 486–490
489
Phenotyping CYP2D6 using 3-h serum dextromethorphan MR J. Jurica et al.
111
17. Bailey B, Daneman R, Daneman N, Mayer
JM, Koren G. Discrepancy between
CYP2D6 phenotype and genotype derived
from post-mortem dextromethorphan
blood level. Forensic Sci Int, 2000;110:61–70.
18. Daly AK, Leathart JBS, London SJ et al.
CYP2D6 phenotype-genotype relationships
in African-Americans and Caucasians
in Los Angeles. Pharmacogenetics,
1998;8:529–541.
19. Yeh GC, Tao PL, Ho HO et al. Analysis
of pharmacokinetic parameters for
assessment of dextromethorphan metabolic
phenotypes. J Biomed Sci,
2003;10:552–564.
20. Frank D, Jaehde U, Fuhr U. Evaluation of
probe drugs and pharmacokinetic metrics
for CYP2D6 phenotyping. Eur J Clin Pharmacol,
2007;63:321–333.
21. Gaedigk A, Simon SD, Pearce RE et al.
The CYP2D6 activity score: translating
genotype information into a qualitative
measure of phenotype. Clin Pharmacol
Ther, 2008;83:234–242.
22. Ducharme J, Abdullah S, Wainer IW. Dextromethorphan
as an in vivo probe for the
simultaneous determination of CYP2D6
and CYP3A activity. J Chromatogr B Biomed
Appl, 1996;678:113–128.
23. Ingelman-Sundberg M. Genetic polymorphisms
of cytochrome P450 2D6
(CYP2D6): clinical consequences, evolutionary
aspects and functional diversity.
Pharmacogenomics J, 2005;5:6–13.
ª 2012 Blackwell Publishing Ltd Journal of Clinical Pharmacy and Therapeutics, 2012, 37, 486–490
490
Phenotyping CYP2D6 using 3-h serum dextromethorphan MR J. Jurica et al.
112
7 Conclusions
The system of P450 enzymes plays a crucial role in drug safety and efficacy. Research on this topic is
ongoing, and this habilitation thesis adds one of the pieces to the final puzzle of P450. We have
reported an interaction between memantine and fluoxetine at the level of CYP2D2 in rats. The
activity of this enzyme was inhibited, and there was a difference in the effect between the in vitro
and in vivo model. Similarly, crocin and quercetin decreased the metabolic activity of P450, whereas
an increased activity of P450 enzymes was documented after the administration of safranal. The
effect of trans-resveratrol on the activity of P450 seems to be enzyme- and sex-dependant. Most of
our experiments are carried out on animal models and enzymes, therefore their clinical relevance
should be carefully interpreted with respect to the known interspecies differences between rat and
human P450.
An important part of understanding the P450 system is its endogenous regulation. The bile acids are
an excellent example of how the P450 system is involved in the biosynthesis of endogenous
metabolites on one hand and how these products can influence P450 activity on the other. The
endocannabinoid system seems to be also involved in the endogenous regulation of P450 activity.
The clinical outcomes of the research included in these theses are represented by two methods for
P450 phenotyping. Phenotype assessment should be the most relevant method for optimizing drug
dosaging, assuming P450 to be an essential enzyme for the pharmacological effect of administered
drugs.
The more knowledge about the function, regulation, and interactions of P450 we gain, the safer and
more effective pharmacotherapy with its substrates can be, especially with the drugs with narrow
therapeutic ranges.
113
8 References
Ahn, T., and Yun, C.H. (2010). Molecular mechanisms regulating the mitochondrial targeting of
microsomal cytochrome P450 enzymes. Curr Drug Metab; 11, 830-838.
Aizpurua-Olaizola, O., Elezgarai, I., Rico-Barrio, I., Zarandona, I., Etxebarria, N., and Usobiaga, A.
(2017). Targeting the endocannabinoid system: future therapeutic strategies. Drug Discov Today; 22,
105-110.
Akhondzadeh Basti, A., Moshiri, E., Noorbala, A.A., Jamshidi, A.H., Abbasi, S.H., and Akhondzadeh, S.
(2007). Comparison of petal of Crocus sativus L. and fluoxetine in the treatment of depressed
outpatients: a pilot double-blind randomized trial. Prog Neuropsychopharmacol Biol Psychiatry; 31,
439-442.
Akhondzadeh, S., Fallah-Pour, H., Afkham, K., Jamshidi, A.H., and Khalighi-Cigaroudi, F. (2004).
Comparison of Crocus sativus L. and imipramine in the treatment of mild to moderate depression: a
pilot double-blind randomized trial [ISRCTN45683816]. BMC Complement Altern Med; 4, 12.
Alavizadeh, S.H., and Hosseinzadeh, H. (2014). Bioactivity assessment and toxicity of crocin: a
comprehensive review. Food Chem Toxicol; 64, 65-80.
Alonso, M., Serrano, A., Vida, M., Crespillo, A., Hernandez-Folgado, L., Jagerovic, N., Goya, P., ReyesCabello,
C., Perez-Valero, V., Decara, J., et al. (2012). Anti-obesity efficacy of LH-21, a cannabinoid
CB(1) receptor antagonist with poor brain penetration, in diet-induced obese rats. Br J Pharmacol;
165, 2274-2291.
Anand David, A.V., Arulmoli, R., and Parasuraman, S. (2016). Overviews of biological importance of
quercetin: a bioactive flavonoid. Pharmacogn Rev; 10, 84-89.
Anzenbacher, P., and Anzenbacherová, E. (2003). Cytochromes P450: Review on their basic
principles. Proceedings of Indian National Science Academy; B69, 883-991.
Ascher-Svanum, H., Nyhuis, A.W., Stauffer, V., Kinon, B.J., Faries, D.E., Phillips, G.A., Schuh, K., Awad,
A.G., Keefe, R., and Naber, D. (2010). Reasons for discontinuation and continuation of antipsychotics
in the treatment of schizophrenia from patient and clinician perspectives. Curr Med Res Opin; 26,
2403-2410.
Ashino, T., Hakukawa, K., Itoh, Y., and Numazawa, S. (2014). Inhibitory effect of synthetic
cannabinoids on CYP1A activity in mouse liver microsomes. J Toxicol Sci; 39, 815-820.
Bathaie, S.Z., and Mousavi, S.Z. (2010). New applications and mechanisms of action of saffron and its
important ingredients. Crit Rev Food Sci Nutr; 50, 761-786.
Biasutto, L., Marotta, E., Garbisa, S., Zoratti, M., and Paradisi, C. (2010). Determination of quercetin
and resveratrol in whole blood--implications for bioavailability studies. Molecules; 15, 6570-6579.
Blaschke, T.F., Osterberg, L., Vrijens, B., and Urquhart, J. (2012). Adherence to medications: insights
arising from studies on the unreliable link between prescribed and actual drug dosing histories. Annu
Rev Pharmacol Toxicol; 52, 275-301.
114
Bornheim, L.M., Everhart, E.T., Li, J., and Correia, M.A. (1993). Characterization of cannabidiolmediated
cytochrome P450 inactivation. Biochem Pharmacol; 45, 1323-1331.
Bromek, E., Wójcikowski, J., and Daniel, W.A. (2013). Involvement of the paraventricular (PVN) and
arcuate (ARC) nuclei of the hypothalamus in the central noradrenergic regulation of liver cytochrome
P450. Biochem Pharmacol; 86, 1614-1620.
Camilleri, M., and Gores, G.J. (2015). Therapeutic targeting of bile acids. Am J Physiol Gastrointest
Liver Physiol; 309, G209-215.
Carvalho, A.F., and Van Bockstaele, E.J. (2012). Cannabinoid modulation of noradrenergic circuits:
implications for psychiatric disorders. Prog Neuropsychopharmacol Biol Psychiatry; 38, 59-67.
Chaudhry, A.S., Kochhar, R., and Kohli, K.K. (2008). Genetic polymorphism of CYP2C19 & therapeutic
response to proton pump inhibitors. Indian J Med Res; 127, 521-530.
Chiang, J.Y.L. (2009). Bile acids: regulation of synthesis. Journal of Lipid Research; 50, 1955-1966.
Chiang, J.Y.L. (2013). Bile Acid Metabolism and Signaling. Comprehensive Physiology; 3, 1191-1212.
Claudel, T., Zollner, G., Wagner, M., and Trauner, M. (2011). Role of nuclear receptors for bile acid
metabolism, bile secretion, cholestasis, and gallstone disease. Biochimica Et Biophysica ActaMolecular
Basis of Disease; 1812, 867-878.
Coleman, C.I., Limone, B., Sobieraj, D.M., Lee, S., Roberts, M.S., Kaur, R., and Alam, T. (2012). Dosing
frequency and medication adherence in chronic disease. J Manag Care Pharm; 18, 527-539.
Curkovic, M., Dodig-Curkovic, K., Eric, A.P., Kralik, K., and Pivac, N. (2016). Psychotropic medications
in older adults: a review. Psychiatr Danub; 28, 13-24.
de Leon, J., Susce, M.T., Johnson, M., Hardin, M., Maw, L., Shao, A., Allen, A.C., Chiafari, F.A., Hillman,
G., and Nikoloff, D.M. (2009). DNA microarray technology in the clinical environment: the AmpliChip
CYP450 test for CYP2D6 and CYP2C19 genotyping. CNS Spectr; 14, 19-34.
Denisov, I.G., Frank, D.J., and Sligar, S.G. (2009). Cooperative properties of cytochromes P450.
Pharmacol Ther; 124, 151-167.
Devane, W.A., Dysarz, F.A., Johnson, M.R., Melvin, L.S., and Howlett, A.C. (1988). Determination and
characterization of a cannabinoid receptor in rat brain. Mol Pharmacol; 34, 605-613.
Devinsky, O., Cilio, M.R., Cross, H., Fernandez-Ruiz, J., French, J., Hill, C., Katz, R., Di Marzo, V., JutrasAswad,
D., Notcutt, W.G., et al. (2014). Cannabidiol: pharmacology and potential therapeutic role in
epilepsy and other neuropsychiatric disorders. Epilepsia; 55, 791-802.
Dhir, R.N., Dworakowski, W., Thangavel, C., and Shapiro, B.H. (2006). Sexually dimorphic regulation
of hepatic isoforms of human cytochrome p450 by growth hormone. J Pharmacol Exp Ther; 316, 87-
94.
Dluzen, D.F., and Lazarus, P. (2015). MicroRNA regulation of the major drug-metabolizing enzymes
and related transcription factors. Drug Metab Rev; 47, 320-334.
115
Donato, M.T., Castell, J.V., and Gómez-Lechón, M.J. (1994). Cytochrome P450 activities in pure and
co-cultured rat hepatocytes. Effects of model inducers. In Vitro Cell Dev Biol Anim; 30A, 825-832.
Dovrtělová, G. (2018). Involvement of endocannabinoid system in the regulation of liver cytochromes
P450. In Department of Pharmacology, Faculty of Medicine (Brno: Masaryk University), pp. 143.
Dvorak, Z., Modriansky, M., Pichard-Garcia, L., Balaguer, P., Vilarem, M.J., Ulrichová, J., Maurel, P.,
and Pascussi, J.M. (2003). Colchicine down-regulates cytochrome P450 2B6, 2C8, 2C9, and 3A4 in
human hepatocytes by affecting their glucocorticoid receptor-mediated regulation. Mol Pharmacol;
64, 160-169.
Eberhart, D., Fitzgerald, K., and Parkinson, A. (1992). Evidence for the involvement of a distinct form
of cytochrome P450 3A in the oxidation of digitoxin by rat liver microsomes. J Biochem Toxicol; 7, 53-
64.
EMA (2012). Guideline on the investigation of drug interactions (CPMP/EWP/560/95/Rev.1),
Committee for Human Medicinal Products (CHMP), European Medicines Agency.
Engeli, S. (2008). Dysregulation of the endocannabinoid system in obesity. J Neuroendocrinol; 20
Suppl 1, 110-115.
Fadiran, E.O., and Zhang, L. (2014). Effects of sex differences in the pharmacokinetics of drugs and
their impact on the safety of medicines in women. In Medicines For Women, M. Harrison-Woolrych,
ed. (Switzerland: Springer International Publishing).
FDA (2017a). Clinical drug interaction studies — Study design, data analysis, and clinical implications
guidance for industry, U.S. Department of Health and Human Services, U.S. Food and Drug
Administration.
FDA (2017b). Drug development and drug interactions: Table of substrates, inhibitors and inducers,
U.S. Food and Drug Administration.
[accessed online 8.8.2018] https://www.fda.gov/Drugs/DevelopmentApprovalProcess/Development
Resources/ DrugInteractionsLabeling/ucm093664.htm#table1
Ferguson, S.S., Chen, Y., LeCluyse, E.L., Negishi, M., and Goldstein, J.A. (2005). Human CYP2C8 is
transcriptionally regulated by the nuclear receptors constitutive androstane receptor, pregnane X
receptor, glucocorticoid receptor, and hepatic nuclear factor 4alpha. Mol Pharmacol; 68, 747-757.
Furuta, T., Kodaira, C., Nishino, M., Yamade, M., Sugimoto, M., Ikuma, M., Hishida, A., Watanabe, H.,
and Umemura, K. (2009). [13
C]-pantoprazole breath test to predict CYP2C19 phenotype and efficacy
of a proton pump inhibitor, lansoprazole. Aliment Pharmacol Ther; 30, 294-300.
Gadaleta, R.M., van Mil, S.W., Oldenburg, B., Siersema, P.D., Klomp, L.W., and van Erpecum, K.J.
(2010). Bile acids and their nuclear receptor FXR: Relevance for hepatobiliary and gastrointestinal
disease. Biochim Biophys Acta; 1801, 683-692.
Gaoni, Y., and Mechoulam, R. (1964). Isolation, structure, and partial synthesis of an active
constituent of hashish. J Am Chem Soc; 86, 1646-1647.
116
Ghodke-Puranik, Y.A., and Lamba, J.K. (2017). Chapter 7 - Pharmacogenomics. In Innovative
Approaches in Drug Discovery, B. Patwardhan, and R. Chaguturu, eds. (Boston: Academic Press), 195-
234.
Gong, Y., Huang, Z., Christensen, E., and Gluud, C. (2007). Ursodeoxycholic acid for patients with
primary biliary cirrhosis: An updated systematic review and meta-analysis of randomized clinical
trials using Bayesian approach as sensitivity analyses. American Journal of Gastroenterology; 102,
1799-1807.
Gordeziani, M.S., Varazi, T.G., and Pruidze, M.V. (2016). Structural-functional organization of
cytochrome P450 containing monooxygenase and some aspects of modeling. Annals of Agrarian
Science; 14, 82-94.
Gruden, G., Barutta, F., Kunos, G., and Pacher, P. (2016). Role of the endocannabinoid system in
diabetes and diabetic complications. Br J Pharmacol; 173, 1116-1127.
Guengerich, F.P. (2017). Intersection of the roles of cytochrome p450 enzymes with xenobiotic and
endogenous substrates: Relevance to toxicity and drug interactions. Chem Res Toxicol; 30, 2-12.
Guengerich, F.P., and Shimada, T. (1998). Activation of procarcinogens by human cytochrome P450
enzymes. Mutat Res; 400, 201-213.
Gunes, A., Ozbey, G., Vural, E.H., Uluoglu, C., Scordo, M.G., Zengil, H., and Dahl, M.L. (2009).
Influence of genetic polymorphisms, smoking, gender and age on CYP1A2 activity in a Turkish
population. Pharmacogenomics; 10, 769-778.
Gupta, S., Stravitz, R.T., Dent, P., and Hylemon, P.B. (2001). Down-regulation of cholesterol 7 alphahydroxylase
(CYP7A1) gene expression by bile acids in primary rat hepatocytes is mediated by the cJun
N-terminal kinase pathway. Journal of Biological Chemistry; 276, 15816-15822.
Haj-Dahmane, S., and Shen, R.Y. (2011). Modulation of the serotonin system by endocannabinoid
signaling. Neuropharmacology; 61, 414-420.
Harwood, M., Danielewska-Nikiel, B., Borzelleca, J.F., Flamm, G.W., Williams, G.M., and Lines, T.C.
(2007). A critical review of the data related to the safety of quercetin and lack of evidence of in vivo
toxicity, including lack of genotoxic/carcinogenic properties. Food Chem Toxicol; 45, 2179-2205.
Haufroid, V., and Hantson, P. (2015). CYP2D6 genetic polymorphisms and their relevance for
poisoning due to amfetamines, opioid analgesics and antidepressants. Clin Toxicol (Phila); 53, 501-
510.
He, X., and Feng, S. (2015). Role of metabolic enzymes P450 (CYP) on activating procarcinogen and
their polymorphisms on the risk of cancers. Curr Drug Metab; 16, 850-863.
Henry, L.A., and Witt, D.M. (2002). Resveratrol: phytoestrogen effects on reproductive physiology
and behavior in female rats. Horm Behav; 41, 220-228.
Herman, A., and Tambor, K. (2016). Linalool affects the antimicrobial efficacy of essential oils. Curr
Microbiol; 72, 165-172.
117
Hippocrates, Jones, W.H.S., Withington, E.T., Stanton, A., and Freidberg, M.D. (1923). Hippocrates
(Cambridge: Harvard University Press).
Hiroi, T., Chow, T., Imaoka, S., and Funae, Y. (2002). Catalytic specificity of CYP2D isoforms in rat and
human. Drug Metab Dispos; 30, 970-976.
Hrycay, E.G., and Bandiera, S.M. (2015). Monooxygenase, peroxidase and peroxygenase properties
and reaction mechanisms of cytochrome P450 enzymes. Adv Exp Med Biol; 851, 1-61.
Huang, W.J., Chen, W.W., and Zhang, X. (2016). Endocannabinoid system: Role in depression, reward
and pain control (Review). Mol Med Rep; 14, 2899-2903.
Hyman, S.E. (2013). Psychiatric drug development: diagnosing a crisis. Cerebrum; 2013, 5.
Joseph, S.V., Edirisinghe, I., and Burton-Freeman, B.M. (2016). Fruit polyphenols: A review of antiinflammatory
effects in humans. Crit Rev Food Sci Nutr; 56, 419-444.
Juřica, J., and Žourková, A. (2013). Dynamics and persistence of CYP2D6 inhibition by paroxetine. J
Clin Pharm Ther; 38, 294-300.
Kang, J.S., and Lee, M.H. (2009). Overview of therapeutic drug monitoring. Korean J Intern Med; 24,
1-10.
Kasper, S., Gastpar, M., Müller, W.E., Volz, H.P., Möller, H.J., Dienel, A., and Schläfke, S. (2010).
Silexan, an orally administered Lavandula oil preparation, is effective in the treatment of
'subsyndromal' anxiety disorder: a randomized, double-blind, placebo controlled trial. Int Clin
Psychopharmacol; 25, 277-287.
Kato, R., and Yamazoe, Y. (1992). Sex-specific cytochrome P450 as a cause of sex- and species-related
differences in drug toxicity. Toxicol Lett; 64-65, 661-667.
Kawaii, S., Tomono, Y., Ogawa, K., Sugiura, M., Yano, M., Yoshizawa, Y., Ito, C., and Furukawa, H.
(2001). Antiproliferative effect of isopentenylated coumarins on several cancer cell lines. Anticancer
Res; 21, 1905-1911.
Kawase, A., Yoshida, I., Tsunokuni, Y., and Iwaki, M. (2007). Decreased PXR and CAR inhibit
transporter and CYP mRNA Levels in the liver and intestine of mice with collagen-induced arthritis.
Xenobiotica; 37, 366-374.
Kearn, C.S., Blake-Palmer, K., Daniel, E., Mackie, K., and Glass, M. (2005). Concurrent stimulation of
cannabinoid CB1 and dopamine D2 receptors enhances heterodimer formation: a mechanism for
receptor cross-talk? Mol Pharmacol; 67, 1697-1704.
Khmelevtsova, L., Sazykin IS, Sazykina MA, and Selivertsova EY (2017). Prokaryotic cytochromes P450
(Review). Applied Biochemistry and Microbiology; 53, 401-409.
Kiss, Á.F., Tóth, K., Juhász, C., Temesvári, M., Paulik, J., Hirka, G., and Monostory, K. (2018). Is CYP2D6
phenotype predictable from CYP2D6 genotype? Microchemical Journal; 136, 209-214.
118
Koonrungsesomboon, N., Khatsri, R., Wongchompoo, P., and Teekachunhatean, S. (2018). The impact
of genetic polymorphisms on CYP1A2 activity in humans: a systematic review and meta-analysis.
Pharmacogenomics J; 18, 760-768.
Kot, M., Sadakierska-Chudy, A., Haduch, A., Rysz, M., Bromek, E., Gołembiowska, K., and Daniel, W.A.
(2015). The role of the dorsal noradrenergic pathway of the brain (locus coeruleus) in the regulation
of liver cytochrome P450 activity. Eur J Pharmacol; 751, 34-41.
Lage, M., and Cantrell, C.L. (2009). Quantification of saffron (Crocus sativus L.) metabolites crocins,
picrocrocin and safranal for quality determination of the spice grown under different environmental
Moroccan conditions. Scientia Horticulturae; 121, 366-373.
Levitsky, L.L., Schoeller, D.A., Lambert, G.H., and Edidin, D.V. (1989). Effect of growth hormone
therapy in growth hormone-deficient children on cytochrome P-450-dependent 3-N-demethylation
of caffeine as measured by the caffeine 13
CO2 breath test. Dev Pharmacol Ther; 12, 90-95.
Liddle, C., Goodwin, B.J., George, J., Tapner, M., and Farrell, G.C. (1998). Separate and interactive
regulation of cytochrome P450 3A4 by triiodothyronine, dexamethasone, and growth hormone in
cultured hepatocytes. J Clin Endocrinol Metab; 83, 2411-2416.
Lin, J.H., and Lu, A.Y. (1998). Inhibition and induction of cytochrome P450 and the clinical
implications. Clin Pharmacokinet; 35, 361-390.
Lin, J.H., and Lu, A.Y. (2001). Interindividual variability in inhibition and induction of cytochrome P450
enzymes. Annu Rev Pharmacol Toxicol; 41, 535-567.
Linck, V.M., da Silva, A.L., Figueiró, M., Piato, A.L., Herrmann, A.P., Dupont Birck, F., Caramão, E.B.,
Nunes, D.S., Moreno, P.R., and Elisabetsky, E. (2009). Inhaled linalool-induced sedation in mice.
Phytomedicine; 16, 303-307.
Lynch, T., and Price, A. (2007). The effect of cytochrome P450 metabolism on drug response,
interactions, and adverse effects. Am Fam Physician; 76, 391-396.
Matouskova, O., Slanar, O., Chytil, L., and Perlik, F. (2011). Pupillometry in healthy volunteers as a
biomarker of tramadol efficacy. J Clin Pharm Ther; 36, 513-517.
McGraw, J., and Waller, D. (2012). Cytochrome P450 variations in different ethnic populations. Expert
Opin Drug Metab Toxicol; 8, 371-382.
Md Othman, S.N.A., Hassan, M.A., Nahar, L., Basar, N., Jamil, S., and Sarker, S.D. (2016). Essential Oils
from the Malaysian Citrus (Rutaceae) Medicinal Plants. Medicines (Basel) 3.
Michalets, E.L. (1998). Update: clinically significant cytochrome P-450 drug interactions.
Pharmacotherapy; 18, 84-112.
Moktali, V., Park, J., Fedorova-Abrams, N.D., Park, B., Choi, J., Lee, Y.H., and Kang, S. (2012).
Systematic and searchable classification of cytochrome P450 proteins encoded by fungal and
oomycete genomes. BMC Genomics; 13, 525.
119
Mudaliar, S., Henry, R.R., Sanyal, A.J., Morrow, L., Marschall, H.U., Kipnes, M., Adorini, L., Sciacca, C.I.,
Clopton, P., Castelloe, E., et al. (2013). Efficacy and safety of the farnesoid X receptor agonist
obeticholic acid in patients with type 2 diabetes and nonalcoholic fatty liver disease.
Gastroenterology; 145, 574-582.e571.
Mwinyi, J., Cavaco, I., Yurdakok, B., Mkrtchian, S., and Ingelman-Sundberg, M. (2011). The ligands of
estrogen receptor α regulate cytochrome P4502C9 (CYP2C9) expression. J Pharmacol Exp Ther; 338,
302-309.
Nascimento, S.S., Camargo, E.A., DeSantana, J.M., Araújo, A.A., Menezes, P.P., Lucca-Júnior, W.,
Albuquerque-Júnior, R.L., Bonjardim, L.R., and Quintans-Júnior, L.J. (2014). Linalool and linalool
complexed in β-cyclodextrin produce anti-hyperalgesic activity and increase Fos protein expression in
animal model for fibromyalgia. Naunyn Schmiedebergs Arch Pharmacol; 387, 935-942.
Nedelcheva, V., and Gut, I. (1994). P450 in the rat and man: methods of investigation, substrate
specificities and relevance to cancer. Xenobiotica; 24, 1151-1175.
Nelson, D.R. (2006). Cytochrome P450 nomenclature, 2004. Methods Mol Biol; 320, 1-10.
Niesink, R.J., and van Laar, M.W. (2013). Does cannabidiol protect against adverse psychological
effects of THC? Front Psychiatry; 4, 130.
Ning, M., Duarte, J.D., Rubin, L.H., and Jeong, H. (2018). CYP2D6 protein level is the major contributor
to interindividual variability in CYP2D6-mediated drug metabolism in healthy human liver tissue. Clin
Pharmacol Ther; 104, 974-982.
Nishimuro, H., Ohnishi, H., Sato, M., Ohnishi-Kameyama, M., Matsunaga, I., Naito, S., Ippoushi, K.,
Oike, H., Nagata, T., Akasaka, H., et al. (2015). Estimated daily intake and seasonal food sources of
quercetin in Japan. Nutrients; 7, 2345-2358.
Ohno-Shosaku, T., and Kano, M. (2014). Endocannabinoid-mediated retrograde modulation of
synaptic transmission. Curr Opin Neurobiol; 29, 1-8.
Ostad Haji, E., Hiemke, C., and Pfuhlmann, B. (2012). Therapeutic drug monitoring for antidepressant
drug treatment. Curr Pharm Des; 18, 5818-5827.
Pandey, K.B., and Rizvi, S.I. (2009). Plant polyphenols as dietary antioxidants in human health and
disease. Oxid Med Cell Longev; 2, 270-278.
Peana, A.T., D'Aquila, P.S., Chessa, M.L., Moretti, M.D., Serra, G., and Pippia, P. (2003). (-)-Linalool
produces antinociception in two experimental models of pain. Eur J Pharmacol; 460, 37-41.
Peana, A.T., D'Aquila, P.S., Panin, F., Serra, G., Pippia, P., and Moretti, M.D. (2002). Anti-inflammatory
activity of linalool and linalyl acetate constituents of essential oils. Phytomedicine; 9, 721-726.
Pelkonen, O., Turpeinen, M., Hakkola, J., Honkakoski, P., Hukkanen, J., and Raunio, H. (2008).
Inhibition and induction of human cytochrome P450 enzymes: current status. Arch Toxicol; 82, 667-
715.
120
Rezaee, R., and Hosseinzadeh, H. (2013). Safranal: from an aromatic natural product to a rewarding
pharmacological agent. Iran J Basic Med Sci; 16, 12-26.
Richardson, T.A., and Morgan, E.T. (2005). Hepatic cytochrome P450 gene regulation during
endotoxin-induced inflammation in nuclear receptor knockout mice. J Pharmacol Exp Ther; 314, 703-
709.
Rocca, W. A. (2000). Dementia, Parkinson’s disease, and stroke in Europe: A commentary. Neurology;
54, S38-40.
Rosenblat, M., Volkova, N., Borochov-Neori, H., Judeinstein, S., and Aviram, M. (2015). Antiatherogenic
properties of date vs. pomegranate polyphenols: the benefits of the combination. Food
Funct; 6, 1496-1509.
Rysz, M., Bromek, E., and Daniel, W.A. (2016). Activation of brain serotonergic system by repeated
intracerebral administration of 5-hydroxytryptophan (5-HTP) decreases the expression and activity of
liver cytochrome P450. Biochem Pharmacol; 99, 113-122.
Scandlyn, M.J., Stuart, E.C., and Rosengren, R.J. (2008). Sex-specific differences in CYP450 isoforms in
humans. Expert Opin Drug Metab Toxicol; 4, 413-424.
Seol, G.H., Kang, P., and Lee, H.S. (2016). Antioxidant activity of linalool in patients with carpal tunnel
syndrome. BMC Neurol; 16, 17.
Sever, R., and Glass, C.K. (2013). Signaling by nuclear receptors. Cold Spring Harb Perspect Biol; 5,
a016709.
Sheweita, S.A. (2003). Narcotic drugs change the expression of cytochrome P450 2E1 and 2C6 and
other activities of carcinogen-metabolizing enzymes in the liver of male mice. Toxicology 191, 133-
142.
Simić, A., Soković, M.D., Ristić, M., Grujić-Jovanović, S., Vukojević, J., and Marin, P.D. (2004). The
chemical composition of some Lauraceae essential oils and their antifungal activities. Phytother Res;
18, 713-717.
Singla, R.V., and Bhat, V.G. (2011). Crocin: An Overview. Indo Global Journal of Pharmaceutical
Sciences; 1, 281-286.
Soucek, P., and Gut, I. (1992). Cytochromes P-450 in rats: structures, functions, properties and
relevant human forms. Xenobiotica; 22, 83-103.
Souto-Maior, F.N., de Carvalho, F.L., de Morais, L.C., Netto, S.M., de Sousa, D.P., and de Almeida, R.N.
(2011). Anxiolytic-like effects of inhaled linalool oxide in experimental mouse anxiety models.
Pharmacol Biochem Behav; 100, 259-263.
Steinhausen, H.C. (2015). Recent international trends in psychotropic medication prescriptions for
children and adolescents. Eur Child Adolesc Psychiatry; 24, 635-640.
121
Takagi, S., Nakajima, M., Mohri, T., and Yokoi, T. (2008). Post-transcriptional regulation of human
pregnane X receptor by micro-RNA affects the expression of cytochrome P450 3A4. J Biol Chem; 283,
9674-9680.
Tarantilis, P.A., and Polissiou, M.G. (1997). Isolation and identification of the aroma components
from saffron (Crocus sativus). Journal of Agricultural and Food Chemistry; 45, 459-462.
Terashima, J., Jimma, Y., Jimma, K., Hakata, S., Yachi, M., Habano, W., and Ozawa, S. (2018). The
regulation mechanism of AhR activated by benzo[a]pyrene for CYP expression are different between
2D and 3D culture of human lung cancer cells. Drug Metab Pharmacokinet; 33, 211-214.
Tracy, T.S., Chaudhry, A.S., Prasad, B., Thummel, K.E., Schuetz, E.G., Zhong, X.B., Tien, Y.C., Jeong, H.,
Pan, X., Shireman, L.M., et al. (2016). interindividual variability in cytochrome P450-mediated drug
metabolism. Drug Metab Dispos; 44, 343-351.
Tsai, H.Y., Ho, C.T., and Chen, Y.K. (2017). Biological actions and molecular effects of resveratrol,
pterostilbene, and 3'-hydroxypterostilbene. J Food Drug Anal; 25, 134-147.
Tsuchiya, Y., Nakajima, M., and Yokoi, T. (2005). Cytochrome P450-mediated metabolism of
estrogens and its regulation in human. Cancer Lett 227, 115-124.
Turesky, R.J., White, K.K., Wilkens, L.R., and Le Marchand, L. (2015). Caffeine cytochrome P450 1A2
metabolic phenotype does not predict the metabolism of heterocyclic aromatic amines in humans.
Chem Res Toxicol; 28, 1603-1615.
Uehleke, B., Schaper, S., Dienel, A., Schlaefke, S., and Stange, R. (2012). Phase II trial on the effects of
Silexan in patients with neurasthenia, post-traumatic stress disorder or somatization disorder.
Phytomedicine; 19, 665-671.
Valdez-Morales, M., Espinosa-Alonso, L.G., Espinoza-Torres, L.C., Delgado-Vargas, F., and MedinaGodoy,
S. (2014). Phenolic content and antioxidant and antimutagenic activities in tomato peel,
seeds, and byproducts. J Agric Food Chem; 62, 5281-5289.
von Moltke, L.L., Greenblatt, D.J., Duan, S.X., Schmider, J., Kudchadker, L., Fogelman, S.M., Harmatz,
J.S., and Shader, R.I. (1996). Phenacetin O-deethylation by human liver microsomes in vitro:
inhibition by chemical probes, SSRI antidepressants, nefazodone and venlafaxine.
Psychopharmacology (Berl); 128, 398-407.
Vrijens, B., Antoniou, S., Burnier, M., de la Sierra, A., and Volpe, M. (2017). Current Situation of
Medication Adherence in Hypertension. Front Pharmacol 8, 100.
Wang, K., Chen, S., Xie, W., and Wan, Y.J. (2008). Retinoids induce cytochrome P450 3A4 through
RXR/VDR-mediated pathway. Biochem Pharmacol; 75, 2204-2213.
Waxman, D.J. (1999). P450 gene induction by structurally diverse xenochemicals: central role of
nuclear receptors CAR, PXR, and PPAR. Arch Biochem Biophys; 369, 11-23.
Waxman, D.J., and Holloway, M.G. (2009). Sex differences in the expression of hepatic drug
metabolizing enzymes. Mol Pharmacol; 76, 215-228.
122
Wustrow, D.J., Maynard, G.D., Yuan, J., Zhao, H., Mao, J., Guo, Q., Kershaw, M., Hammer, J.,
Brodbeck, R.M., Near, K.E., et al. (2008). Aminopyrazine CB1 receptor inverse agonists. Bioorg Med
Chem Lett; 18, 3376-3381.
Wójcikowski, J., Gołembiowska, K., and Daniel, W.A. (2007). The regulation of liver cytochrome p450
by the brain dopaminergic system. Curr Drug Metab; 8, 631-638.
Wójcikowski, J., Gołembiowska, K., and Daniel, W.A. (2008). Regulation of liver cytochrome P450 by
activation of brain dopaminergic system: physiological and pharmacological implications. Biochem
Pharmacol; 76, 258-267.
Wójcikowski, J., Haduch, A., and Daniel, W.A. (2013). Effect of antidepressant drugs on cytochrome
P450 2C11 (CYP2C11) in rat liver. Pharmacol Rep; 65, 1247-1255.
Xu, J., Wang, X., and Guo, W. (2015). The cytochrome P450 superfamily: Key players in plant
development and defense. Journal of Integrative Agriculture; 14, 1673-1686.
Yamazaki, H., Mimura, M., Sugahara, C., and Shimada, T. (1994). Catalytic roles of rat and human
cytochrome P450 2A enzymes in testosterone 7 alpha- and coumarin 7-hydroxylations. Biochem
Pharmacol; 48, 1524-1527.
Yu, A., Dong, H., Lang, D., and Haining, R.L. (2001). Characterization of dextromethorphan O- and Ndemethylation
catalyzed by highly purified recombinant human CYP2D6. Drug Metab Dispos; 29,
1362-1365.
Zalachoras, I., Kagiava, A., Vokou, D., and Theophilidis, G. (2010). Assessing the local anesthetic effect
of five essential oil constituents. Planta Med; 76, 1647-1653.
Zamberletti, E., Rubino, T., and Parolaro, D. (2012). The endocannabinoid system and schizophrenia:
integration of evidence. Curr Pharm Des; 18, 4980-4990.
Zanger, U.M., and Schwab, M. (2013). Cytochrome P450 enzymes in drug metabolism: regulation of
gene expression, enzyme activities, and impact of genetic variation. Pharmacol Ther; 138, 103-141.
Zanger, U.M., Turpeinen, M., Klein, K., and Schwab, M. (2008). Functional
pharmacogenetics/genomics of human cytochromes P450 involved in drug biotransformation. Anal
Bioanal Chem; 392, 1093-1108.
Zendulka, O., Dovrtělová, G., Nosková, K., Turjap, M., Šulcová, A., Hanuš, L., and Juřica, J. (2016).
Cannabinoids and cytochrome P450 Interactions. Curr Drug Metab; 17, 206-226.
Zendulka, O., Zahradníková, L., Juřica, J., and Totušek, J. (2008). The influence of trans-resveratrol
and quercetin on the activity of CYP1A2 in rat. Czech Journal of Food Science; 26, S60-S64.
Zhou, H., Tong, Z., and McLeod, J.F. (2004a). "Cocktail" approaches and strategies in drug
development: valuable tool or flawed science? J Clin Pharmacol; 44, 120-134.
Zhou, S., Chan, E., Pan, S.Q., Huang, M., and Lee, E.J. (2004b). Pharmacokinetic interactions of drugs
with St John's wort. J Psychopharmacol; 18, 262-276.
123