O O
HON
O
OH
N
NH
O
O
-O
O
S
N
N+
OO
O-
H2N
S
N
O
O
HO
N
O OH
O O
O
HO
H
N
N
S
NH2
NH
O O
HO O
S
N
NH2
NH
O
O
HO O
S
N
Cl
O
O
HO
N
O OH
O O
O
HO
H
N
N
S
NH2
NH
O O
HO O
S
N
NH2
NH
O
O
HO O
S
N
Cl
O
O
HO
N
O OH
NH2
NH
O O
HO O
S
N
O
O
O
HO
H
N
N
S
O
O
O
HO
H
N
N
S
O
O
O
HO
H
N
N
S
O
OO
HO
H
N
N
S
O
O
O
HO
H
N
N
S
O
O
O
HO
H
N
N
S
O
O
O
HO
H
N
N
S
O
O
O
HO
H
N
N
S
O
O
O
HO
H
N
N
S
O
O
O
HO
H
N
N
S
NH2
O
O
O
HO
H
N
N
S
NH2
O
O
O
HO
H
N
N
S
NH2
O
O O
HO
H
N
N
S
NH2
O O
O
HO
H
N N
SNH2
O
O
O
HO
H
N
N
SNH
2
O
O
O
HO
H
N
N
S
NH2
O
O
O
HO
H
N
N
S
NH
2
O
O O
HO
H
N
N
S
NH2
O
O
HO
N
O OH
O
O
HO
N
O OH
O
O
HO
N
O OH
O
O
HO
N
O OH
O
O
HO
N
O OH
O
O
HO
N
O OH
O
O
HO
N
O OH
O
O
HO
N
O OH
O
O
HO
N
O OH
NH
2
NH
O O
HO
O
S
N
NH2
NH
O
O
HO O
S
N
NH2
NH
O
O
HO O
S
N
NH2
NH
O
O
HO O
S
N
NH2
NH
O
O
HO O
S
N
NH2
NH
O
O
HO O
S
N
NH
2
NH
O O
HO
O
S
N
NH2
NH
O O
HO O
S
N
NH2
NH
O
O
HO O
S
N
NH2
NH
O
O
HO O
S
N
Cl
NH2
NH
O
O
HO O
S
N
Cl
NH2
NH
O
O
HO O
S
N
Cl
NH2
NH
O
O
HO O
S
N
Cl
NH2
NH
O
O
HO O
S
N
Cl
NH2
NH
O
O
HO O
S
N
Cl
NH2
NH
O
O
HO O
S
N
Cl
NH
2
NH
O
O
HO
O
S
N
Cl
N
NH
O
O
-O
O
S
N
N +
O O
O-
H2
N
S
N
N
NH
O
O
-O O
S
N N
+
O
O
O-
H2N
S
N
N
NH
O
O
-O O
S
N N
+
O
O
O-
H2N
S
N
N
NH
O
O
-O O
S
N N
+
O
O
O-
H2N
S
N
N
NH
O
O
-O O
S
N N
+
O
O
O-
H2N
S
N
N
NH
O
O
-O O
S
N N
+
O
O
O-
H2N
S
N
N
NH
O
O
-O O
S
N N
+
O
O
O-
H2N
S
N
N
NH
O
O
-O O
S
N N
+
O
O
O-
H2N
S
N
N
NH
O
O
-O O
S
N N
+
O
O
O-
H2N
S
N
N
NH
O
O
-O O
S
N N
+
O
O
O-
H2N
S
N
N
NH
O
O
-O O
S
N N
+
O
O
O-
H2N
S
N
A T G T G C C A T T A G T C T A A G G C
C
C
C
C
C
C C
CC
C
C
C
C
C
CC
CC
C
C
C
AA A
A
A
A
A
A A
A
A
A
A A
A
A
AA
A
A
A
G
G GGG
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
G
T
T
T
T
T T
T T
T
T
T T
T
T
T
T
T
T
T
T
T
T
T
T
T
NH2
NH
O O
HO O
S
N
NH2
NH
O O
HO O
S
N
NH2
NH
O O
HO O
S
N
NH2
NH
O O
HO O
S
N
O
O
O
HO
H
N
N
S
O
O
O
HO
H
N
N
S
O
O
O
HO
H
N
N
S
O
O HO
N
O
OH
O
O HO
N
O
OH
O
O
HO
N
O OH
NH
2
NH
O O
HO
O
S
N
Cl
NH
2
NH
O
O HO
O
S
N
Cl
NH2
NH
O
O
HO O
S
N
Cl
NH2
NH
O
O
HO O
S
N
Cl
NH2
NH
O
O
HO O
S
N
Cl
O
O
O
HO
H
N
N
S
N
NH
O
O
-O
O
S
N
N+
OO
O-H2
N
S
N
REZISTENCE ENTEROBAKTERIÍ KE
KLINICKY VÝZNAMNÝM ANTIBIOTIKŮM
Monika Dolejská
Molekulární epidemiologie a úloha mobilních
genetických elementů
REZISTENCE ENTEROBAKTERIÍ
KE KLINICKY VÝZNAMNÝM ANTIBIOTIKŮM
Mobilní genetické elementy v šíření rezistence
k beta-laktamům a chinolonům
habilitační práce
Monika Dolejská
2016
Questo lavoro è dedicato a un grande uomo M. M.
Grazie per il tuo amore, il tuo sostegno e la tua amicizia!
Na tomto místě bych chtěla poděkovat všem, kteří mě náročnou cestou vědce provází. V první
řadě děkuji dvěma důležitým osobám, které považuji za své mentory. Stojí při mně od počátku mé
vědecké dráhy, dávají mi prostor k seberealizaci v oboru a pomáhají razit cestu k cíli. Tímto děkuji
prof. MVDr. Aloisu Čížkovi, CSC. který mě už jako studentku mikrobiologie na Přírodovědecké fakultě
k tématu antibiotické rezistence přivedl, za jeho podporu především v těžkých časech a otcovský přístup.
Můj velký dík patří prof. MVDr. Ivanu Literákovi, CSc. za personální a finanční podporu a znamenitou
organizaci našich výzkumných aktivit, které umožnily rozvoj naši „rezistentní rodiny“. Díky jeho expedicím
po světě a zahraničním kontaktům jsem byla zavalena cenným materiálem pro experimentální práci.
Obrovský dík patří všem mým kolegům a studentům nejen za jejich skvělou a tvrdou práci a
nepostradatelnou pomoc při řešení výzkumných projektů, ale také za jejich přátelství a pochopení
pro velké požadavky, které jsou na ně kladeny. Bez nich bych nemohla tuto habilitační práce oživit
takovým množstvích příloh našich vědeckých výstupů. Děkuji tímto Ivě Jamborové, Hance Dobiášové, Dáši
Taušové, Katce Albrechtové, Ivu Papouškovi, Martině Masaříkové, Daně Halové, Ludmile Kohoutové, Evě
Suchanové, Janě Hofírkové, Marii Slavíkové, Martě Křenové a mnoha dalším, se kterými mám nebo jsem
měla tu čest spolupracovat.
Zvláštní poděkování patří také mým zahraničním kolegům, kteří mě posunuli výrazně kupředu.
Mezi ně patří má „vědecká máma“ Alessandra Carattoli, která mě zasvětila do světa plazmidů. Vážím si
jejího přátelství, odborných rad a podpory v práci i osobním životě. Děkuji také kolegům z Kodaně, kde
jsem měla možnost strávit nějaký čas a seznámit se s novými technikami a vědeckými přístupy.
Děkuji také Ivě Kutilové a Jarce Laušové za pomoc s přípravou podkladů k habilitačnímu řízení a
jazykovou korekturu textu. Za kritické čtení rukopisu, cenné připomínky a rovněž za plodnou spolupráci
děkuji kolegovi a drahému příteli Jardovi Hrabákovi.
Výsledky předkládané v této práci byly získány s finanční podporou několika grantových agentur
a výzkumných subjektů. Na tomto místě bych chtěla poděkovat Grantové agentuře České republiky,
Interní grantové agentuře Ministerstva zdravotnictví, Agentuře zdravotnického výzkumu a Interní
grantové agentuře VFU Brno. Velký dík patří mé alma mater Veterinární a farmaceutické univerzitě Brno,
především Fakultě veterinární hygieny a ekologie, a dále výzkumnému centru CEITEC za podporu mé
vědecké a akademické kariéry.
Tuto práci bych chtěla věnovat skvělému člověku a znamenitému vědci Marco Minoia. Vděčím
mu za jeho lásku, přátelství a podporu. Děkuji mu také za spolupráci na poli vědeckém a za velikou
podporu v době přípravy habilitační práce, zejména pak za pomoc s grafickou úpravou textu. Poděkování
patří i mé rodině za jejich pochopení pro cestu, kterou jsem si zvolila.
V Brně dne 1. května 2016 Monika Dolejská
1
Obsah
Seznam zkratek 4
1. Úvod 7
2. Escherichia coli 9
3. Antimikrobiální látky 13
3.1 Charakteristika klinicky významných antimikrobiálních látek 15
3.1.1 Cefalosporiny 15
3.1.2 Karbapenemy 17
3.1.3 Chinolony 18
3.2 Antimikrobiální látky ve veterinární medicíně 20
3.2.1 Antimikrobiální látky ke stimulaci růstu zvířat 20
3.2.2 Antibiotika u potravinových zvířat a rizika pro člověka 22
3.2.3 Cefalosporiny a karbapenemy v terapii zvířat 22
3.2.4 Fluorochinolony v terapii zvířat 24
3.3 Vliv antimikrobiálních látek na životní prostředí 25
4. Antimikrobiální rezistence 27
4.1 Mechanizmy antibiotické rezistence a jejich genetický základ 29
4.2 Prostředí v kontextu původu antibiotické rezistence 30
4.3 Jednotky v šíření antibiotické rezistence 33
4.4 Cesty šíření rezistentních bakterií 35
5. Mechanizmy rezistence ke klinicky významným antibiotikům 37
5.1. Mechanizmy rezistence k cefalosporinům a karbapenemům 39
5.1.1 Obecná charakteristika a klasifikace beta-laktamáz 40
5.1.2 Širokospektré beta-laktamázy (ESBL) 41
5.1.2.1 Metody detekce producentů ESBL 44
5.1.3 AmpC beta-laktamázy 44
5.1.3.1 Plazmidové AmpC beta-laktamázy 46
5.1.3.2 Metody detekce producentů AmpC beta-laktamáz 46
5.1.3.3 Molekulární epidemiologie AmpC 47
5.1.4 Karbapenemázy 48
5.1.4.1 Charakteristika metalo-beta-laktamáz 48
5.1.4.2 Charakteristika karbapenemáz molekulární třídy A 49
5.1.4.3 Charakteristika karbapenemáz molekulární třídy D 49
5.1.4.4 Metody detekce karbapenemáz 50
5.1.4.5 Molekulární epidemiologie producentů karbapenemáz 50
5.1.4.6 Producenti karbapenemáz u zvířat a v prostředí 51
5.2 Mechanizmy rezistence k fluorochinolonům 53
5.2.1 Chromozomální mechanizmy rezistence k fluorochinolonům 54
5.2.1.1 Změny na úrovni buněčných membrán a aktivní eflux 54
5.2.1.2 Mutace cílových struktur chinolonů 56
5.2.2 Plazmidy determinovaná rezistence k fluorochinolonům (PMQR) 57
5.2.2.1 Qnr proteiny 57
5.2.2.2 Aminoglykozidová N-acetyltransferáza AAC(6’)-Ib-cr 59
5.2.2.3 Efluxní pumpy QepA a OqxAB 60
5.2.3 Původ genů PMQR a jejich biologická role 60
2
5.2.4 Klinický význam PMQR 61
5.2.5 PMQR a mutačně selekční koncentrace 63
5.2.6 Metody detekce bakterií s PMQR 64
5.2.7 Charakteristické vlastnosti izolátů s PMQR 65
5.2.8 Výskyt PMQR u člověka, zvířat a v prostředí 66
6. Mobilní genetické elementy v šíření rezistence 69
6.1 Horizontální přenos genů u bakterií 72
6.1.1 Transformace 73
6.1.1.1 Úloha transformace v šíření rezistence k antibiotikům 74
6.1.2 Transdukce 74
6.1.2.1 Úloha transdukce v šíření rezistence k antibiotikům 75
6.1.3 Konjugace 75
6.2 Mobilní genetické elementy 76
6.2.1 Inzerční sekvence 77
6.2.2 Transpozony 78
6.2.3 Struktury příbuzné inzerčním sekvencím 80
6.2.4 Mechanizmus transpozice 81
6.2.5 Integrony 85
6.2.5.1 Obecná struktura MRI integronů 85
6.2.5.2 Klasifikace MRI integronů 86
6.2.5.3 Mobilizace integronů 87
6.2.5.4 Rezistence sdružená s integrony 89
6.2.5.5 Superintegrony 90
6.2.6 Integrativní konjugativní elementy 91
6.2.7 Genomové ostrovy 92
6.2.8 Plazmidy 94
6.2.8.1 Základní organizace plazmidů 94
6.2.8.2 Nomenklatura plazmidů 98
6.2.8.3 Replikace plazmidů 98
6.2.8.4 Regulace replikace plazmidů 101
6.2.8.5 Inkompatibilita plazmidů 102
6.2.8.6 Koexistence plazmidů ze stejné Inc skupiny 104
6.2.8.7 Klasifikace plazmidů Enterobacteriaceae 104
6.2.8.8 Horizontální přenos plazmidů 105
6.2.8.9 Hostitelské rozmezí plazmidů 108
6.2.8.10 Mechanizmy stabilního udržování plazmidů 109
6.2.8.11 Funkce kódované plazmidy 113
7. Epidemiologie širokospektrých beta-laktamáz 121
7.1 Charakteristika beta-laktamázy CTX-M 123
7.2 Původ beta-laktamázy CTX-M 126
7.3 Faktory ovlivňující šíření CTX-M 127
7.4 Rozšíření ESBL u humánních izolátů 128
7.5 Výskyt ESBL u izolátů z potravinových zvířat 130
7.6 Výskyt ESBL u izolátů ze zvířat chovaných ze záliby 132
7.7 Šíření ESBL v prostředí – význam odpadních vod 133
7.8 Výskyt ESBL izolátů u volně žijících zvířat 134
7.9 Rizikové a úspěšné klony E. coli v šíření ESBL 136
7.10 Mobilní genetické elementy v šíření ESBL 139
7.10.1 ISEcp1 v šíření ESBL 140
7.10.1.1 Struktura modulu ISEcp1-blaCTX-M 140
3
7.10.1.2 ISEcp1 v mobilizaci a expresi genu blaCTX-M 141
7.10.2 Další mobilní elementy sdružené s ESBL 143
7.10.3 Plazmidy v šíření ESBL 145
7.10.3.1 Virulentní plazmidy rodiny IncF v šíření CTX-M-15 146
7.10.3.2 Multirezistentní IncA/C2 plazmidy v šíření beta-laktamáz 147
7.10.3.3 IncN s širokým spektrem hostitelů v šíření CTX-M-1 148
7.10.3.4 Multirezistentní IncHI plazmidy 149
7.10.3.5 Zoonotický potenciál IncI1 v šíření širokospektrých beta-laktamáz 151
7.10.3.6 IncL/M v globálním šíření OXA-48 152
7.10.3.7 IncK v šíření CTX-M-14 a CMY-2 152
8. Závěr 153
Seznam literatury 155
Přílohy 188
4
Seznam zkratek
AAC(6’)-Ib-cr bifunkční acetyltransferáza inaktivující aminoglykozidy a fluorochinolony
ABC rodina efluxních pump („adenosine triphosphate (ATP)-binding cassette“)
ACC rodina beta-laktamáz
ACT rodina beta-laktamáz
AIEC adherentní invazivní E. coli
AmpC rodina beta-laktamáz
APEC aviární patogenní E. coli
ATP adenozintrifosfát
BES rodina beta-laktamáz
bp; kb páry bazí („base pair“); kilobaze („kilobase“)
CcdAB typ plazmidového adikčního systému
CDEC „cell-detaching“ E. coli
CLSI „Clinical Laboratory and Standards Institute“
CMY rodina beta-laktamáz
Col skupina plazmidů sdružená s geny pro produkci kolicinů
CS konzervativní segment integronu
CTX-M rodina beta-laktamáz
ČOV čistírna odpadních vod
DAEC difuzně adherentní E. coli
DANMAP dánský program pro monitorování antibiotické rezistence („The Danish
Integrated Antimicrobial Resistance Monitoring“)
DHA rodina beta-laktamáz
DR přímá repetice („direct repeat“)
EAEC enteroagregativní E. coli
EARS-Net „Antimicrobial resistance interactive database“
ECDC „European Centre for Disease and Prevention Control“
ECOFF epidemiologický předěl („epidemiological cut-off value“)
EcoRII typ restrikčně modifikačního systému
EAHEC enteroagregativní hemoragická E. coli
EDTA kyselina ethylendiamintetraoctová
EFSA Evropský úřad pro bezpečnost potravin („European Food Safety Authority“)
EHEC enterohemoragická E. coli
EIEC enteroinvazivní E. coli
EMEA Evropská léková agentura („European Medicines Agency“)
EPEC enteropatogenní E. coli
ESBL širokospektrá beta-laktamáza („extended-spectrum beta-lactamase“)
ETEC enterotoxigenní E. coli
EUCAST „The European Committee on Antimicrobial Susceptibility Testing“
ExPEC extraintestinálně patogenní E. coli
F+ buňka nesoucí fertilní (F, IncF) plazmid
FOX rodina beta-laktamáz
FQ fluorochinolony
GEI genomový ostrov („genomic island“)
GES rodina beta-laktamáz
GIM rodina beta-laktamáz
GIT gastrointestinální trakt
GyrA podjednotka DNA gyrázy (topoizomerázy II)
GyrB podjednotka DNA gyrázy (topoizomerázy II)
5
HGT horizontální tok genů („horizontal gene transfer“)
Hok-Sok typ plazmidového adikčního systému
ICE integrativní konjugativní element („integrative conjugative element“)
IMI rodina beta-laktamáz
IMP rodina beta-laktamáz
Inc skupina inkompatibility plazmidů
IR obrácená/invertovaná repetice („inverted repeat“)
IRi obrácená repetice u genu integrázy
IRL levá obrácená repetice („left inverted repeat“)
IRR pravá obrácená repetice („right inverted repeat“)
IRt obrácená repetice v oblasti tni
IS inzerční sekvence
ISCR inzerční sekvence transponovaná mechanizmem replikace na otáčející se
kružnici
KPC rodina beta-laktamáz
LAT rodina beta-laktamáz
LGT laterální tok genů („lateral gene transfer“)
MALDI-TOF hmotnostní spektrometrie („matrix-assisted laser desorption/ionization-time of
flight“)
MATE rodina efluxních pump („multidrug and toxic compound extrusion“)
MBL metalo-beta-laktamáza
MDR multirezistence („multidrug resistance“)
MFS rodina efluxních pump („major facilitator superfamily“)
mg/PCU množství účinné látky vztažené na velikost populace („population correction
unit”)
MGE mobilní genetický element
MIC minimální inhibiční koncentrace nebo mobilní inzerční kazeta
MIR rodina beta-laktamáz
MITE typ mobilního genetického elementu
MLST metoda typizace izolátů; multilokusová sekvenční typizace
Mob mobilizovatelný plazmid
MOX rodina beta-laktamáz
MPC mutačně preventivní koncentrace („mutation prevention concentration“)
MRI multirezistentní integron neboli integron nesoucí několik genů rezistence
(„multiresistance integron“)
MRR oblast multirezistence („multiresistance region“)
MRSA Staphylococcus aureus rezistentní k meticilinu
MSSA Staphylococcus aureus citlivý k meticilinu
NDM rodina beta-laktamáz
NMC rodina beta-laktamáz
NMEC E. coli vyvolávající novorozenecké meningitidy
NTEC nekrotoxigenní E. coli
Omp protein vnější plazmatické membrány („outer membrane protein“)
OqxAB efluxní pumpa; plazmidy kódovaná determinanta rezistence k chinolonům
orf otevřený čtecí rámec („open reading frame“)
oriV počátek replikace plazmidu („origin of vegetative replication”)
oriT počátek přenosu plazmidu („origin of transfer”)
OXA rodina beta-laktamáz
PAI ostrov patogenity („pathogenicity island“)
Par systém stabilní segregace plazmidů při buněčném dělení („partitioning“)
ParC podjednotka topoizomerázy IV
ParE podjednotka topoizomerázy IV
6
PBP protein vázající penicilin („penicilin-binding protein“)
PBRT metoda typizace replikonů založená na PCR („PCR-based replicon typing“)
PCR polymerázová řetězová reakce („polymerase chain reaction“)
PDR „panrezistence“; rezistence ke všem dostupným antibiotikům („pandrug
resistance“)
PemKI typ plazmidového adikčního systému
PER rodina beta-laktamáz
PFGE pulzní gelová elektroforéza („pulse-field gel electrophoresis“)
pMLST metoda typizace plazmidů, multilokusová sekvenční typizace plazmidů
(„plasmid multilocus sequence typing”)
PMQR plazmidy determinovaná rezistence k chinolonům (“plasmid-mediated
quinolone resistance“)
PndAC typ plazmidového adikčního systému
QepA efluxní pumpa; plazmidy kódovaná determinanta rezistence k chinolonům
Qnr rodina plazmidy kódovaných determinant rezistence k chinolonům
QRDR oblast určující rezistenci k chinolonům („quinolone resistance determining
region“)
RC transpozice zahrnující replikaci na otáčející se kružnici („rolling circle“)
RelBE typ plazmidového adikčního systému
Rep protein účastnící se replikace DNA
RM systém restrikčně modifikační systém
RND rodina efluxních pump („resistance-nodulation-cell division“)
SGI genomový ostrov salmonel („Salmonella genomic island“)
SHV rodina beta-laktamáz
SIM rodina beta-laktamáz
SME rodina beta-laktamáz
SMR rodina beta-laktamáz
SPM rodina beta-laktamáz
SPN rodina beta-laktamáz
SrnB typ plazmidového adikčního systému
SSCmec genová kazeta pro rezistenci k meticilinu vázaná na chromozom Staphylococus
spp. („staphylococcal cassette chromosome“)
ST sekvenční typ
STC komplex sekvenčních typů, alternativní název klonální komplex (CC–„clonal
complex“)
STEC shigatoxigenní E. coli
SVARM veterinární monitorovací program antimikrobiální rezistence ve Švédsku
(„Swedish Veterinary Antimicrobial Resistance Monitoring“)
TEM rodina beta-laktamáz
tIS transferová IS
Tn transpozon
Tra oblast plazmidu obsahující geny pro konjugativní přenos
UPEC uropatogenní E. coli
VagCD typ plazmidového adikčního systému
VCR repetitivní oblasti v superintegronech V. cholerae
VEB rodina beta-laktamáz
VIM rodina beta-laktamáz
XDR extenzivní neboli rozšířená rezistence („extensive drug resistance“)
XerCD systém rozdělování multimerních plazmidových forem
WHO Světová zdravotnická organizace
7
1. Úvod
Antibiotika jsou považována za jeden z nejvýznamnějších objevů v historii lidstva. O antibioticích
se bez nadsázky mluví jako o „zázračných“ lécích, které změnily charakter medicíny, umožnily terapii dříve
neléčitelných infekcí, provádění chirurgických zákroků a transplantací. V důsledku domněnky zázračnosti,
neškodnosti a naprosté univerzálnosti antibiotik jako nástrojů v boji proti mikrobům tomu odpovídalo i
jejich neuvážené a nadbytečné používání. To se postupem času odrazilo v jednom ze současných
palčivých problémů, kterým je rezistence bakterií k antibiotikům. Rezistence celosvětově narůstá, stoupá
četnost multirezistentních gramnegativních bakterií a těch, které odolávají všem dostupným
antimikrobiálním látkám. Současný stav je popisován jako antibiotická krize. Snižuje se účinnost klinicky
významných antibiotik humánní i veterinární medicíny a dochází k šíření bakterií rezistentních k lékům
poslední volby vyhrazených pro léčbu život ohrožujících infekcí člověka. Nejdramatičtější z hlediska
rostoucího trendu je situace v případě bakteriálních druhů Escherichia coli, Klebsiella pneumoniae a
dalších druhů čeledi Enterobacteriaceae. Jedná se o skupinu bakterií s kosmopolitním rozšířením, která
tvoří běžnou součást střevní mikroflóry člověka a zvířat a zároveň disponuje patogenním potenciálem.
Cílem této habilitační práce je podat ucelený přehled tématu bakteriální rezistence ke klinicky
významným antibiotikům humánní i veterinární medicíny. Práce popisuje problematiku epidemiologie
rezistence gramnegativních bakterií, zejména zástupců čeledi Enterobacteriaceae, rezistentních
k širokospektrým beta-laktamovým antibiotikům a fluorochinolonům. Pozornost je věnována výskytu
bakterií s touto rezistencí u člověka, zvířat i v prostředí s ohledem na dnes široce skloňovaný termín
„One Health“ neboli „jedno zdraví“. Habilitační práce je koncipována jako ucelený popis problematiky
doplněný původními vědeckými publikacemi autorai, které dokládají jeho přínos v oboru. Tyto vědecké
výstupy vznikly pod vlajkou Ústavu biologie a chorob volně žijících zvířat a Ústavu infekčních chorob a
mikrobiologie, VFU Brno. Práce bude v budoucnu sloužit jako výchozí materiál pro přípravu rozsáhlejšího
učebního textu věnovaného tématice antibiotické rezistence, který bude primárně určen pro studenty
mikrobiologie a blízkých přírodovědných či lékařských oborů.
E. coli je jedním z nejvýznamnějších bakteriálních druhů v šíření klinicky významné rezistence
k antibiotikům. Slouží rovněž jako vhodný ukazatel při sledování stavu a vývoje antibiotické rezistence.
První kapitola je proto věnována jeho stručnému představení. Další text popisuje vybrané skupiny
beta-laktamových antibiotik a fluorochinolony v kontextu jejich použití u zvířat a člověka, negativních
dopadů na selekci rezistentních bakterií a vlivů na životní prostředí. Tato kapitola je následována obecným
úvodem do problematiky antibiotické rezistence, který pojednává o původu rezistentních bakterií, věnuje
iCitace původních prácí autora, které jsou součástí této habilitační práce, jsou v textu označeny šedým písmem. Citace je
následována číselným odkazem na přílohu, která obsahuje kopii dané publikace.
8
se faktorům a cestám jejich šíření. Další kapitoly jsou věnovány bližšímu popisu mechanizmů, které
bakterie využívají k inaktivaci inhibičního účinku výše uvedených skupin antibiotik.
V šíření rezistence k antibiotikům u gramnegativních bakterií hraje úlohu horizontální přenos
genů zprostředkovaný úseky DNA – mobilními genetickými elementy. Tyto elementy si mezi sebou
bakterie ochotně předávají a spolu s nimi i genetickou informaci pro rezistenci k antibiotikům,
dezinfekčním látkám, těžkým kovům či virulenci. Vazba genů rezistence na přenosné plazmidy utváří
současný obraz epidemiologie rezistence k beta-laktamovým antibiotikům, udává její rostoucí charakter
a je spojena s četným výskytem multirezistence. Podstatná část textu je proto věnována mobilním
genetickým elementům v šíření klinicky významné rezistence. Je představena jejich strukturu a způsoby
přenosu mezi bakteriálními genomy. Poslední kapitola se soustředí na molekulární epidemiologii
producentů širokospektrých beta-laktamáz, které jsou jedním z nejvýznamnějších mechanizmů
rezistence enterobakterií vázaných na plazmidy a zároveň předmětem výzkumného zaměření autora.
9
2. Escherichia coli
10
11
Escherichia coli je gramnegativní fakultativně anaerobní tyčka. Řadíme ji do čeledi
Enterobacteriaceae, třídy Gammaproteobacteria. Do této čeledi náleží geneticky příbuzné druhy
s rozdílnou ekologií, rozmanitým spektrem hostitelů a různou mírou patogenního působení. Pro zástupce
čeledi Enterobacteriaceae je někdy používán termín „enterobakterie”. Většina enterobakterií není
patogenní, některé druhy jsou však podmíněnými či obligátními patogeny a způsobují závažná
onemocnění člověka nebo zvířat (např. Salmonella spp., Shigella spp., Yersinia pestis, patogenní kmeny
E. coli atd.). Některé druhy způsobují onemocnění rostlin. Enterobakterie nalézáme ve vodě a půdě, kde
je jejich výskyt indikací fekálního znečištění. Čeleď Enterobacteriaceae se v posledních letech stala
významnou skupinou bakterií v humánní i veterinární medicíně v souvislosti s narůstající rezistencí
k antibiotikům.
E. coli získala své jméno podle rakouského lékaře a mikrobiologa Theodora von Eschericha, který
ji v roce 1885 izoloval. Je nejběžnější fakultativně anaerobní bakterií v trávicím traktu člověka a mnoha
dalších teplokrevných živočichů. Většina kmenů tohoto bakteriálního druhu je nepatogenních a vykazuje
do jisté míry symbiotický stav se svým hostitelem, podílí se na syntéze některých vitamínů a přispívá
k ochraně trávicího traktu před kolonizací patogenními organizmy. Schopnost některých kmenů vyvolat
onemocnění je spojena s přítomností specifických genů kódujících faktory virulence. Genetickou
informaci pro virulenci může E. coli získat procesem horizontálního toku genů (HGT – „horizontal gene
transfer”) nesených plazmidy, bakteriofágy nebo ostrovy patogenity. Specifický patotyp E. coli je
definován kombinací určitých virulenčních faktorů a je spojen s limitovanou škálou klinických symptomů.
Komplikovaná nomenklatura patotypů E. coli je důsledkem několika faktorů, zahrnujících podobnosti
jmen jednotlivých patotypů a dále nesprávné nebo inkonzistentní používání jmen v odborné literatuře.
Přibývající poznatky v evoluci a patogenezi a průkaz nových patotypů rovněž vnáší do nomenklatury další
nejasnosti (Donneberg, 2013; Mainil, 2013). Podle místa infekce dělíme patogenní E. coli do dvou velkých
skupin na intestinální patogenní E. coli způsobující střevní infekce a extraintestinálně patogenní E. coli
(ExPEC) vyvolávající infekce mimo střevo. Nejčastější infekce mimo střevo zahrnují infekce močového
ústrojí případně novorozenecké meningitidy. Přehled nejvýznamnější patotypů uvádí Tab. 1.
E. coli je vysoce proměnlivým bakteriálním druhem s vysokou schopností adaptace k měnícím se
podmínkám vnějšího prostředí. Základní genetická informace E. coli sdílená všemi kmeny tohoto druhu
tvoří pouze 20 % celkové velikosti genomu (Rasko et al., 2008). Složení genomu je ovlivněno konstantním
tokem genů zprostředkovaným plazmidy a bakteriofágy. E. coli je ochotným dárcem a vděčným
příjemcem genetické informace včetně té, která udílí rezistenci k antibiotikům. Je zároveň
vhodným indikátorovým mikroorganizmem při zjišťování stavu rezistence k antibiotikům, a proto je
využíván pro studium šíření antibiotické rezistence v různých prostředích.
12
Tab. 1: Přehled nejvýznamnějších patotypů E. coli
Vytvořeno podle Allocati et al., 2013; Belanger et al., 2011; Biju et al., 2012; De Rycke et al., 1999; Donneberg, 2013; Johnson a
Russo, 2002a, b; Kolenda et al., 2015; Marks et al., 2011; Nagy a Fekete, 2005; Nakazato et al., 2009; Paciorek, 2002; Pitout,
2012a, b; Rubin a Pitout, 2014; Wales et al., 2005; Walker et al., 2007.
1podskupina STEC nesoucí přídatné faktory virulence, 2blízce příbuzná rodu Shigella, 3hypervirulentní patotyp, rekombinant STEC
a EAEC, zahrnuje serotyp O104:H.
Zkratka Celý název Základní patogeneze Typ onemocnění
EPEC enteropatogenní E. coli adheze k epitelu střevní sliznice, tvorba
„attaching-effacing“ lézí, produkce
enteroagregativního termostabilního
enterotoxinu 1
průjmová onemocnění lidí
v rozvojovém světě
STEC shigatoxigenní E. coli adheze k epitelu střevní sliznice, produkce
shigatoxinu s cytopatogenním efektem
průjmové onemocnění člověka,
edémová choroba prasat
EHEC1 enterohemoragická E. coli jako STEC, navíc sekreční systém typu III a
plazmid virulence s molekulovou
hmotností 60MDa, tvorba „attachingeffacing“
lézí
průjem, hemoragická kolitida a
hemolyticko-uremický syndrom
(HUS)
ETEC enterotoxigenní E. coli adheze k epitelu střevní sliznice,
termolabilní LT a termostabilní ST toxin
průjmová onemocnění dětí
v rozvojovém světě, cestovatelské
průjmy, vodnaté průjmy selat
EIEC2 enteroinvazivní E. coli invazi bakterií do buněk střevní sliznice,
produkce cytotoxinů a enterotoxinů
vodnatý průjem neodlišitelný
od průjmu způsobeného shigelou
EAEC enteroagregativní E. coli agregativní adherence k povrchu
enterocytů střeva, sekrece střevní sliznice,
tvorba biofilmu
průjmová onemocnění
v rozvojovém světě
DAEC difuzně adherentní E. coli adherence k povrchu enterocytů střeva
nebo epitelu močových cest
průjmové onemocnění a cystitida
dětí, peylonefritida těhotných,
recidivní infekce močových cest
AIEC adherentní invazivní
E. coli
adheze k epitelu střevní sliznice, invaze
do buněk střevní sliznice
ileální léze pacientů s Crohnovou
chorobou, granulomatózní kolitida
některých plemen psů
EAHEC3 enteroagregativní
hemoragická E. coli
agregativní adherence k povrchu
enterocytů střeva, tvorba shigatoxinu Stx2
gastroenterotida a HUS
CDEC „cell-detaching“ E. coli oddělení střevních buněk od epitelu
zprostředkované α-hemolysinem,
fimbriemi asociovanými s pyelonefritidou a
cytotoxickým faktorem 1
průjmová onemocnění dětí
APEC aviární patogenní E. coli adheze k epiteliálním buňkám plicních
vaků a tvorba lézí, produkce aerobaktinu,
toxinů a kolicinů
respirační infekce a septikémie
domestikovaných ptáků
UPEC uropatogenní E. coli adheze k epitelu močových cest
prostřednictvím fimbrií a nefibrilárních
adhezinů, produkce toxinů, sideroforů
infekce močových cest lidí i zvířat,
ojediněle zánět ledvin vedoucí k
bakteriémii
NMEC E. coli vyvolávající
neonatální meningitidy
tvorba kapsulárního antigenu - uniká
imunitnímu systému a proniká do
mozkomíšního moku přes
hematoencefalickou bariéru
meningitida novorezenců
NTEC nekrotoxigenní E. coli adheze k povrchu epitelu, tvorba toxinů
(např. cytotoxický nekrotizující faktor)
průjmová onemocnění lidí i zvířat,
různé typy extraintestinálních infekcí
člověka a zvířat (např. močové
infekce, meningitida)
13
3. Antimikrobiální látky
14
15
Název antibiotikum či antimikrobiální látka se datuje již do roku 1889, kdy Vuillemin definoval
termín „antibióza“ jako jakýkoliv antagonistický vztah mezi živými organizmy. Přímo termín antibiotikum
byl poprvé použit Waksmanem v roce 1942. Antimikrobiální látka je definována jako substance
produkovaná mikroorganizmy nebo připravená synteticky či semisynteticky, která v nízkých
koncentracích usmrcuje jiné mikroorganizmy nebo inhibuje jejich růst. Při svém účinku zasahují
antimikrobiální látky do nejrůznějších procesů života bakteriální buňky. Narušují funkci plazmatické
membrány, zasahují do tvorby buněčné stěny nebo inhibují syntézu proteinů a nukleových kyselin,
případně působí jako kompetitivní inhibitory některých metabolických drah.
Jedním z prvních antibiotik, které změnilo charakter medicíny 20. století, byl penicilin. Izolace
penicilinu A. Flemingem z plísně Penicillium notatum v roce 1928 byla ve 40. letech minulého století
následovaná přípravou penicilinových preparátů ke klinickému použití. Objev penicilinu odstartoval
zlatou éru antibiotik. Byli hledáni producenti látek s potenciálním antimikrobiálním účinkem v prostředí
nebo byly tyto látky připravovány chemickou syntézou. Antibiotickou éru dokumentuje skutečnost, že
mezi lety 1940 a 1962 bylo uvedeno na trh přes 20 tříd antimikrobiálních látek. Vývoj nových antibiotik
však postupně ustával a v posledních letech se na trh dostala pouze hrstka zcela nových preparátů.
Jedny z nejdůležitějších antimikrobiálních látek, vzhledem k jejich komplexnímu použití
v humánní i veterinární medicíně a širokému spektru účinku, jsou fluorochinolony a beta-laktamová
antibiotika (cefalosporiny a karbapenemy). Tyto antibiotické skupiny jsou zároveň v popředí světového
zájmu z důvodu narůstající prevalence rezistentních izolátů mezi zástupci čeledi Enterobacteriaceae.
Následující kapitoly stručně charakterizují tyto skupiny antimikrobiálních látek, popisují mechanizmy
jejich účinku, věnují se terapeutickému použití včetně jeho negativních dopadů.
3.1 Charakteristika klinicky významných antimikrobiálních látek
3.1.1 Cefalosporiny
Cefalosporiny řadíme mezi beta-laktamová antibiotika, jelikož podobně jako peniciliny obsahují
klasickou čtyřčlennou strukturu beta-laktamového kruhu. Oproti penicilinům je navíc k tomuto kruhu
připojena šestičlenná dihydrothizolová struktura udávající charakteristickou bicyklickou podobu molekuly
cefalosporinu. Antimikrobiální účinky prvního známého producenta cefalasporinů, plísně Acremonium
chrysogenum (dříve Cephalosporium acremonium), byly popsány v roce 1945. Následně byla na univerzitě
v Oxfordu z této kultury izolována krystalická látka s antimikrobiálními účinky, cephalosporin C. Klinické
použití cefalosporinu C bylo limitováno jeho slabou antimikrobiální aktivitou, která však byla zvýšena
modifikací postranního řetězce za vzniku 7-aminocefalosporanové kyseliny. Ta se stala základem
pro syntézu od ní odvozených nových molekul. Substituce postranních řetězců v této pozici je spojena se
16
změnou antimikrobiální aktivity a odolnosti vůči beta-laktamázám neboli enzymům degradujícím
beta-laktamová antibiotika (Finch et al., 2003; Mascaretti, 2003). Základní chemické struktury
cefalosporinů a dalších skupin beta-laktamových antibiotik jsou představeny na Obr. 1.
Podobně jako všechna beta-laktamová antibiotika zasahují cefalosporiny do procesu syntézy
buněčné stěny. Cílovým místem účinku jsou proteiny vázající penicilin (PBP – „penicilin binding protein“),
které vykazují funkci transpeptidáz a účastní se spřahování peptidových řetězců při tvorbě buněčné stěny.
Cefalosporiny inhibují vznik síťové struktury buněčné stěny, negativně tak ovlivňují její rigiditu a zároveň
aktivují autokatalytické enzymy s konečným výsledkem lyze bakteriální buňky (Mascaretti, 2003).
Cefalosporiny jsou tříděny do různých kategorií. Bylo navrženo několik systémů jejich dělení
zahrnující klasifikaci chemickou (na základě struktury molekuly), farmakokinetickou (dle poločasu
rozpadu molekuly) nebo mikrobiologickou. Mikrobiologická klasifikace je používána nejčastěji a dělí
cefalosporiny do čtyř generací (I-IV). Vychází ze schopnosti cefalosporinů inhibovat jednotlivé skupiny
bakterií a z jejich stability k beta-laktamázám. Vybraní zástupci jednotlivých generací cefalosporinů a
jejich spektrum účinku je uvedeno v Tab. 2. Dle antimikrobiální aktivity je možné obecně říci, že
od I. do III. generace roste jejich působení proti gramnegativním bakteriím a naopak klesá k bakteriím
grampozitivním. Čtvrtá generace zahrnuje nejnovější preparáty se širokou aktivitou proti grampozitivním
kokům a gramnegativním bakteriím produkujícím některé typy beta-laktamáz (Mascaretti, 2003).
Obr. 1: Základní struktura vybraných skupin beta-laktamových antibiotik
Vytvořeno podle Bryskier, 2005.
beta-laktamový kruh
peniciliny cefalosporiny
karbapenemy monobaktamy
17
Tab. 2: Klasifikace a spektrum účinku cefalosporinů
Generace Příklady základních molekul Antimikrobiální aktivita
I
cefalotin, cefazolin, cefadroxil,
cefaloridin
grampozitivní koky (Streptopoccus pneumoniae, Streptococcus
pyogenes, MSSA); Neisseria spp.; Enterobacteriaceae
neprodukující beta-laktamázu
II
cefamandol, cefuroxim,
cefamyciny-cefotetan, cefoxitin
grampozitivní koky (nižší účinek v porovnání s I. generací);
variabilní aktivita proti Enterobacteriaceae (stabilita vůči
úzkospektrým beta-laktamázám, cefamyciny stabilní také vůči
ESBL)
III
cefotaxim, ceftazidim,
cefoperazon, cefpiramid,
ceftriaxon, cefovecin
grampozitivní i gramnegativní bakterie; Haemophilus influenzae
a Neisseria gonorhoeae produkující beta-laktamázy;
Pseudomonas aeruginosa; neúčinné vůči MRSA a Enterococcus
spp.; různá stabilita vůči beta-laktamázám Enterobacteriaceae
IV cefepim, cefpirom, cefchinom
vysoká aktivita vůči gramnegativním bakteriím
(Enterobacteriaceae, N. gonnorhoeae, H. influenzae,
P. aeruginosa), streptokokům a MSSA; stabilní vůči AmpC
beta-laktamázám
Volně podle Finch et al. 2003; Giguère et al. 2013; Mascaretti, 2003. MSSA, S. aureus citlivý k meticilinu. MRSA, S. aureus
rezistentní k meticilinu. ESBL a AmpC představují skupiny širokospektrých beta-laktamáz, které budou blíže představeny
v kapitole 5.1.
3.1.2 Karbapenemy
Další skupinou klinicky významných beta-laktamových antibiotik jsou karbapenemy, jejichž
obecná struktura je uvedena na Obr. 1. Prvním objeveným karbapenemem byl thienamycin izolovaný
z půdní bakterie Streptomyces cattleya v roce 1976. Nestabilita této molekuly byla překonána následnou
chemickou syntézou. První karbapenem, imipenem, byl uveden na trh ke klinickému použití v roce 1985.
Limitací imipenemu je jeho nestabilita vůči dehydropeptidáze I produkované ledvinami a z tohoto důvodu
se podává spolu s inhibitory cilastatinem nebo betaminopronem. Nestabilita imipenemu aktivovala
snahu syntetizovat nové molekuly, které daly vznik dalším zástupcům skupiny karbapenemů odolávajících
dehydropeptidáze, například meropenemu, ertapenemu, doripenemu a biapenemu (Papp-Wallace et al.,
2011).
Karbapenemy jsou antibiotika se širokým spektrem účinku proti různým druhům grampozitivních
i gramnegativních bakterií. Jejich širokospektrální aktivita je dána několika faktory. Jednak dobře pronikají
do buněk gramnegativních bakterií díky specifickým transportním mechanizmům zprostředkovaným
vnějšími membránovými proteiny Omp, dále jsou vysoce stabilní k většině beta-laktamáz a silně se vážou
k PBP. Díky těmto vlastnostem je řadíme mezi rezervní antibiotika nebo antibiotika poslední volby
pro léčbu život ohrožujících infekcí člověka (Papp-Wallace et al., 2011). Jejich použití pro veterinární účely
nebylo schváleno.
18
Karbapenemy se vyznačují svoji širokou aktivitou, která zahrnuje většinu zástupců čeledi
Enterobacteriaceae, acinetobaktery (kromě meropenemu), streptokoky, stafylokoky, pseudomonády
(kromě ertapenemu), gramnegativní anaerobní bakterie a grampozitivní tyčky (Clostridium spp.).
Výhodou karbapenemů je jejich schopnost odolávat širokospektrým beta-laktamázám, což je odlišuje
od cefalosporinů (Papp-Wallace et al., 2011).
3.1.3 Chinolony
Chinolony byly objeveny jako vedlejší produkty při syntéze antimalarika chlorochininu. Ačkoliv
tato látka vykazovala slabou antimikrobiální aktivitu proti některým gramnegativním bakteriím, objev
stimuloval snahy syntetizovat nové analogy. Jako první byla připravena v roce 1962 kyselina nalidixová
(Lesher et al., 1962). Jednalo se o první chinolon určený k léčbě močových infekcí. V následujícím
desetiletí byly připraveny další preparáty chemickou modifikací kyseliny nalidixové. Jednotlivé molekuly
chinolonů se různí ve své struktuře (Obr. 2). Chinolony se dělí na dvě základní skupiny sloučenin, které se
odlišují v pozici 8. Jedná se o 1,8-naftyridiny (např. kyselina nalidixová) nesoucí v této pozici atom dusíku
a 4-chinolony (např. ciprofloxacin), které obsahují v pozici 8 atom uhlíku. Substituce ve vedlejších pozicích
(1, 5, 6, 7, 8) základní molekuly tvoří základ spektra účinku a farmakologických vlastností daného
antimikrobiálního přípravku (Hooper a Rubinstein, 2003; Mascaretti, 2003). Například pro skupinu
fluorochinolonů uvedených na trh v 80. letech je charakteristický atom fluoru v pozici C-6 (Paton a
Reeves, 1988). Fluorochinolony (FQ) na rozdíl od kyseliny nalidixové dosahují vyšších hladin v séru a lepší
aktivity proti gramnegativních bakteriím (Hooper a Rubinstein, 2003).
Cílovými molekulami chinolonů jsou enzymy účastnící se replikace DNA, DNA gyráza
(topoizomeráza II) a topoizomeráza IV. Oba enzymy se vyznačují heterotetramerní strukturou a jsou
tvořeny dvěma podjednotkami přítomnými v páru. U gramnegativních bakterií je DNA gyráza primárním
místem zásahu chinolonů a je tvořená dvěma páry GyrA a GyrB. Topoizomeráza IV skládající se ze dvou
párů podjednotek ParC a ParE je místem sekundárním. DNA gyráza zavádí negativní vinutí do DNA a
topoizomeráza IV se podílí především na oddělování dceřiných nukleoidů vzniklých replikací.
Základním mechanizmem účinku chinolonů je nekovalentní vazba komplexu topoizomeráza II-DNA
(Hooper, 2000; Hooper a Rubinstein, 2003). Chinolony při svém účinku využívají základní biologické
funkce gyrázy a topoizomerázy IV, kterou je tvorba zlomů v dvouřetězcové DNA vznikající při replikaci
bakteriálního chromozomu. Vazbou na komplex enzym-DNA znemožňují opětovné spojení rozštěpených
konců DNA a tím navyšují množství tohoto letálního komplexu. Následná kolize replikační vidlice nebo
transkripčních faktorů se vzniklým komplexem vede ke vzniku trvalých dvouřetězcových zlomů
v bakteriálním chromozomu. Tvorba zlomů spouští SOS odpověď a jiné reparační systémy poškozené
DNA. Nahromaděné dvouřetězcové zlomy, které není buňka schopná odstranit, se pak stávají letálními.
19
Chinolony rovněž ovlivňují aktivitu gyrázy a topoizomerázy IV a působí jako inhibitory těchto enzymů, což
přispívá k celkovému toxickému účinku (Aldred et al. 2014).
V současné době patří chinolony díky širokému spektru účinku a výborným farmakokinetickým
vlastnostem mezi jedny z nejvýznamnějších antimikrobiálních látek humánní i veterinární medicíny. První
generace chinolonů se využívá zejména při léčbě infekcí močových cest. Druhá generace nachází své
uplatnění při léčbě infekcí gastrointestinálního a urogenitálního ústrojí vyvolaných gramnegativními
bakteriemi. Používají se také při infekcích dýchacího ústrojí, měkkých tkání a kostí. Třetí generace
chinolonů je méně účinná proti gramnegativním bakteriím, vykazuje naopak lepší aktivitu proti
grampozitivům a používá se při léčbě infekcí respiračního ústrojí. Čtvrtá generace chinolonů je účinná
proti grampozitivním i gramnegativním mikroorganizmům. Používá se především pro léčbu respiračních
infekcí a onemocnění vyvolaných anaeroby nebo Mycobacterium tuberculosis (Hooper a Rubinstein,
2003).
Fluorochinolony jsou řazeny mezi rezervní antibiotika, která by měla být podávaná pouze
v případech, kdy jsou jiná antibiotika in vitro neúčinná nebo nevhodná z důvodu toxicity a nežádoucích
účinků. Velikou nevýhodou fluorochinolonů je selekce rezistentních mutant, které často vznikají jako
důsledek nesprávného dávkování (Doss et al., 1995; Drago et al., 2010; Hooper, 2000).
Obr. 2: Struktura molekuly chinolonů
Vytvořeno podle Applebaum a Hunter, 2000; Hooper a Rubinstein, 2003. Chinolony se dělí na dvě základní skupiny
sloučenin, které se odlišují v pozici 8 (pozice označena červeným křížkem X ve struktuře molekuly chinolonu). Jedná se
o 1,8-naftyridiny (např. kyselina nalidixová) nesoucí v této pozici atom dusíku a 4-chinolony (např. ciprofloxacin), které
obsahují v pozici 8 atom uhlíku.
ciprofloxacin
obecná struktura chinolonů
kyselina nalidixová
20
Tab. 3: Klasifikace a spektrum účinku chinolonů
Generace Příklady základních molekul Antimikrobiální aktivita
I kyselina nalidixová, kys. pipemidová,
kys. oxolinová, cinoxacin, flumequin
střední aktivita vůči gramnegativním bakteriím, vůči
pseudomonádám neaktivní
II ciprofloxacin, norfloxacin, ofloxacin,
enoxacin, enrofloxacin
lepší aktivita vůči gramnegativním bakteriím než
I. generace (včetně pseudomonád), grampozitivní aerobní
bakterie
III gatifloxacin, grepafloxacin,
sparfloxacin
podobná aktivita jako II. generace, navíc lepší aktivita proti
grampozitivním bakteriím, atypickým bakteriím
(Mycoplasma pneumoniae, Chlamydia pneumoniae)
IV trovafloxacin, moxifloxacin,
gemifloxacin
obdobná aktivita vůči grampozitivním a gramnegativním
bakterím jako III. generace, zvýšená aktivita vůči
anaerobům, Pseudomonas spp.
Vytvořeno podle Andriole, 2005. Literatura uvádí různá klasifikační schémata, některá z nich operují pouze se třemi
generacemi chinolonů. Rovněž příslušnost základních molekul do jednotlivých tříd (zejména v případě III. a IV. generace)
se může lišit.
3.2 Antimikrobiální látky ve veterinární medicíně
Počátky antibiotické terapie u zvířat se datují do 40. letech minulého století, kdy se k léčbě
mastitid skotu začaly používat penicilinové preparáty ve formě intramamárních infuzí. V současné době
jsou ve veterinární medicíně antibiotika používána ke dvěma velice odlišným účelům, a to k prevenci a
léčbě bakteriálních infekcí a dále ke stimulaci růstu. Terapeutickým použitím antibiotika je vnímáno
individuální podávání léčebné látky perorální nebo parenterální cestou pouze jedincům s bakteriální
infekcí. Ve většině případů se ve velkých chovech zvířat, kde existuje vysoké riziko šíření infekce
z nemocných na zdravé jedince (chovy drůbeže, prasat, ryb), přistupuje k metafylaktickému podání
antibiotika ve vodě nebo potravě všem jedincům dané skupiny. Profylakticky se antibiotika podávají
zdravým jedincům preventivně v situacích nebo fázích života, kdy jsou vystaveni zvýšenému riziku rozvoje
bakteriální infekce, které hrozí například při chirurgických zákrocích, vakcinaci, transportu nebo u skotu
na konci laktačního období (Schwarz a Chaslus-Dancla, 2001; Schwarz et al., 2001).
3.2.1 Antimikrobiální látky ke stimulaci růstu zvířat
Použití antibiotik ke stimulaci růstu je specifické pro zvířata chovaná pro potravinové účely
(Dibner a Richards, 2005). Již v 50. letech byl prokázán vliv přídavku některých antibiotik do potravy
na rychlejší růst kuřat, skotu nebo prasat (Jukes et al., 1950; Moore et al., 1946). Spojitost mezi
podáváním subinhibičních koncentrací (tj. koncentrací pod hladinou nutnou pro inhibici růstu bakteriální
buňky) tetracyklinu pro stimulaci růstu kuřat a izolací bakterií rezistentních k tomuto antibiotiku
z medikovaných jedinců byla záhy prokázána několika studiemi (Barnes, 1958; Elliott a Barnes, 1959).
21
Pozitivní účinek antibiotika na růst je nepřímý a pravděpodobně souvisí s nárůstem produkce vitaminů
(např. B12) bakteriemi střevní mikroflóry, eliminací subpopulací patogenních bakterií a zvýšeným
vstřebáváním živin ve střevě (Dibner a Richards, 2005).
Obavy z negativních dopadů antibiotických růstových stimulátorů vzrostly v 90. letech. Bylo
upozorňováno na souvislost s použitím avoparcinu a nárůstem prevalence enterokoků rezistentních
k vankomycinu v chovech drůbeže a prasat a s tím související riziko přenosu těchto multirezistentních
bakterií k člověku cestou potravinového řetězce (Dibner a Richards, 2005; Wegener et al., 1999). Tato
zjištění vedla v roce 1997 k zákazu avoparcinu ke stimulaci růstu zvířat v celé EU (Dibner a Richards, 2005).
Obavy z ekonomických dopadů na potravinovou produkci po ukončení používání růstových stimulátorů
nebyly potvrzeny. Studie realizovaná v Dánsku, v jedné z prvních zemí vůbec, která ukončila používání
antibiotických růstových stimulátorů, neprokázala signifikantně negativní efekt na výtěžnost potravinové
produkce, zdraví zvířat, bezpečnost a cenu potravin pro konzumenta. Naopak demonstrovala mnohé
benefity jako vyšší produktivitu, snížení celkové spotřeby antimikrobiálních látek pro veterinární účely a
pokles rezistence k antibiotikům v chovech potravinových zvířat (WHO, 2003). Zákaz používání antibiotik
ke stimulaci růstu se odrazil v poklesu prevalence rezistence vybraných patogenů člověka a zvířat, např.
Enterococcus faecalis, Enterococcus faecium a Campylobacter spp. (Obr. 3; Phillips, 2007; WHO, 2003).
Používání antibiotik pro podporu růstu hospodářských zvířat je ve členských státech EU
od 1. ledna 2006 zakázáno. V jiných částech světa s vyspělým chovem potravinových zvířat (např. USA)
jsou však antibiotika ke stimulaci růstu i nadále používána.
Obr. 3: Výskyt rezistence ke glykopepetidům u E. faecalis v Dánsku ve vztahu ke spotřebě avoparcinu
v letech 1994–2007
Vytvořeno podle Hammerun et al., 2007.
E.faecalisrezistentníkeglykopeptidům(%)
Množstvípoužitéhoavoparcinu(kg)
kuřecí maso
prase
brojler
avoparcin
22
3.2.2 Antibiotika u potravinových zvířat a rizika pro člověka
Většina antibiotik používaná v terapii zvířat náleží do stejných antimikrobiálních tříd jako látky
určené k terapii člověka. To znamená, že antibiotika používaná pro veterinární účely mají své příslušné
analogy v medicíně humánní včetně antibiotik určených k léčbě závažných a život ohrožujících infekcí.
Tato skutečnost se týká rovněž antibiotik klasifikovaných WHO jako kriticky důležitá, kterými jsou některé
skupiny beta-laktamů, chinolony, aminoglykozidy a makrolidy (WHO, 2012). Podobně jako při použití
antibiotik v terapii člověka existují i ve veterinární medicíně velké geografické rozdíly v celkových
spotřebách. Nejvíce antibiotik (vyjádřeno v mg/PCU) je v Evropě pro terapii potravinových zvířat
spotřebováno na Kypru, který je následován Itálii, Španělskem, Německem, Maďarskem a Belgií (EMEA,
2013). Například v ČR je podíl antibiotik použitých pro terapii zvířat srovnatelný s množstvím
spotřebovaným medicínou humánní, naproti tomu 80 % z celkové spotřeby antibiotik v USA je použito
k veterinárním účelům. Velkým problémem jsou země, ve kterých není použití antibiotik regulováno,
a nemají vedená spolehlivá data o jejich spotřebě. Volný prodej antibiotik pro veterinární účely
bez nutnosti preskripce veterinárním lékařem je praktikován např. v Číně, která je významným
producentem masa a akvakultur pro světový trh. Současné tendence (zejména v EU, částečně v USA a
Austrálii) vedou ke snižování celkové spotřeby antibiotik u potravinových zvířat a k omezení nebo
úplnému ukončení používání kriticky důležitých antibiotik u cílových skupin potravinových zvířat
(cefalosporiny vyšších generací, fluorochinolony, aj.). Kromě mnoha národních antibiotických programů
(např. DANMAP v Dánsku, SVARM ve Švédsku) byl v EU vytvořen harmonizovaný systém detekce a
monitoringu šíření rezistentních bakterií v potravním řetězci (Rozhodnutí EU: 2013/652/EU).
Systém kontroly a regulace použití antibiotik pro veterinární účely je v ČR dobře propracován a
od roku 2000 je zajištěn Ústavem pro státní kontrolu veterinárních biopreparátů a léčiv (ÚSKVBL). Sleduje
se celková spotřeba antimikrobiálních látek na základě dat dostupných od distributorů a prodejců léčiv,
spotřeba v rámci jednotlivých skupin antibiotik a použité množství jednotlivých substancí. Veterinárním
lékařům pak stanovuje odpovědnost vést evidenci o antibiotické léčbě. Dále uděluje povinnost provádět
testy citlivosti původců bakteriálních infekcí na antibiotika, předepisovat antimikrobiální látky na základě
diagnózy, druhu zvířete, současného stavu antibiotické rezistence a dále stanovovat optimální dávky a
délku léčby zvířete. V neposlední řadě také spolupracovat s chovatelem při tvorbě preventivních postupů
proti výskytu infekčních onemocnění.
3.2.3 Cefalosporiny a karbapenemy v terapii zvířat
Cefalosporiny jsou klasifikovány jako kriticky důležitá antibiotika humánní medicíny (WHO,
2012). Zároveň jsou nejpoužívanějšími antibiotiky u potravinových zvířat pro léčbu systémových infekcí
23
(EMEA, 2013). První a druhá generace cefalosporinů (např. cefadroxil, cephapirin, cephalexin,
cefalonium, cefazoline, cefacetrile) je široce používaná pro terapii mastitid mléčného skotu. Ceftiofur
(III. generace) a cefchinom (IV. generace) jsou určeny čistě pro veterinární použití. Cefchinom je v mnoha
zemích autorizován pro terapii respiračních onemocnění skotu a prasat a mastitid mléčného skotu.
Ceftiofur se nejčastěji používá pro léčbu respiračních chorob prasat, přežvýkavců a koní a při metritidě
skotu (Hornish a Kotarski, 2002). Dvě výše zmíněná antibiotika mají v terapii skotu pro chovatele výhody
z důvodu nulové ochranné lhůty. V řadě případů jsou proto upřednostňovány oproti jiným preparátům
s obdobnými terapeutickými účinky ale s delší ochrannou lhůtou, kterými jsou např. tetracykliny (Seiffert
et al., 2013). Naopak u drůbeže se cefalosporiny používají velmi zřídka (Guardabassi et al., 2008).
Diskutabilní oblastí v terapii cefalosporiny je jejich off-label používání. V tomto případě je antimikrobiální
přípravek použit na jinou infekci nebo u jiného zvířete než k jakým účelům je registrován. Touto formou
však může být antibiotikum aplikováno pouze v případě, že neexistuje jiná dostupná alternativa (EMEA,
2012). V USA a některých státech EU byly touto formou cefalosporiny využívány pro prevenci časných
úhynů jednodenních kuřat, k ošetření vajec sprejováním případně in ovo a dále k profylaxi septikémie
selat (EFSA, 2011). Off-label použití cefalosporinů u skotu, prasat a drůbeže je dnes v USA a EU zakázáno.
Negativním důsledkem cefalosporinů vyšších generací je výrazná selekce bakterií rezistentních
k této skupině antibiotik, což bylo experimentálně prokázáno v chovech prasat a skotu (Cavaco et al.,
2008; Seiffert et al., 2013). Dopady terapie cefalosporiny byly demonstrovány také naší recentní studií.
V chovu mléčného skotu s vysokou spotřebou ceftiofuru byl prokázán zvýšený výskyt izolátů E. coli
rezistentních k cefalosporinům vyšších generací (39 %) v porovnání s chovem ekologickým (< 1 %), kde
není použití těchto antibiotik povoleno (Dolejska et al., 2011c6
). Podobný trend byl pozorován v chovech
prasat. Většina vyšetřených prasata z chovů s častým použitím ceftiofuru byla kolonizována izoláty E. coli
rezistentními k cefalosporinům, naopak v chovech s nízkou nebo nulovou spotřebou ceftiofuru byl výskyt
rezistence k této skupině antibiotik minimální (A. Čížek et al., VFU Brno, nepublikovaná data).
V současné době dochází v řadě zemí k poklesu spotřeby cefalosporinů III. a IV. generace
u cílových druhů potravinových zvířat. Použití těchto antibiotik v chovech prasat a skotu zastavily nebo
výraznou mírou snížily Francie, Nizozemí a Dánsko (EMEA, 2012). V současné době představují
cefalosporiny přibližně 1 % celkové spotřeby antibiotik u zvířat pro potravinové účely v EU. Cefalosporiny
vyšších generací jsou rovněž omezovány v terapii zvířat chovaných ze záliby (EMEA, 2012).
Karbapenemy nejsou ve veterinární medicíně autorizovány z důvodu rizika selekce a dalšího
šíření bakterií rezistentních k tomuto kriticky důležitému antibiotiku určenému pro léčbu život
ohrožujících infekcí člověka. Off-label jsou používány v terapii malých zvířat a koní při léčbě močových a
pooperačních infekcí vyvolaných multirezistentními bakteriemi (Gibson et al., 2008; Weese et al., 2011).
Problematika rezistence ke karbapenemům se však začíná týkat i veterinární sféry. Bakterie produkující
24
karbapenemázy byly u potravinových zvířat a zvířat chovaných ze záliby izolovány a toto téma bude blíže
rozpracováno v kapitole 5.1.4.6.
3.2.4 Fluorochinolony v terapii zvířat
Na rozdíl od cefalosporinů vyšších generací a karbapenemů jsou chinolony zvířatům podávány
kromě formy injekční také ve vodě či krmivu. Druhý způsob aplikace je obecně četnější (EMEA, 2012). FQ
jsou používány v terapii průjmových a respiračních onemocnění mláďat i starších zvířat (skot, prasata,
drůbež), v případě prasat také při mastitidách a metritidách. Jsou lékem volby pro prevenci koliseptikémie
u jednodenních kuřat. Používají se rovněž pro léčbu širokého spektra infekcí zvířat chovaných ze záliby, u
kterých je však dokumentováno časté off-label použití preparátů autorizovaných pro humánní medicínu
(Hooper a Rubinstein, 2003). FQ by měly být používány pouze pro léčbu vážných bakteriálních infekcí,
jako mastitid, septikémií, gastroenteritid a respiračních onemocnění vyvolaných gramnegativními
bakteriemi a to jen v případě, že není k dispozici jiná léková alternativa a zároveň byla prokázána citlivost
daného patogena laboratorním vyšetřením. V chovech ryb patří chinolony k nejvýznamnějším
antibiotikům především díky širokému spektru účinku zahrnující grampozitivní i gramnegativní bakterie
(Quesada et al., 2013). Jejich nadměrné použití v akvakulturách je dnes široce diskutováno.
Chinolony nachází své uplatnění při skupinové léčbě zvířat, která je spojena s mnoha úskalími.
V důsledku tohoto typu léčby se často do těla zvířete dostanou pouze subinhibiční koncentrace
antibiotika, které nejsou schopné usmrtit infekční agens a navíc zvyšují riziko rozvoje rezistence.
Rezistence k chinolonům vzniká mimo jiné v důsledku tvorby bodových mutací v cílových strukturách
antibiotika, které pak není v této pozměněné formě molekulou chinolonu rozpoznáno (Hooper, 2003).
Mechanizmy rezistence k chinolonům jsou blíže představeny v kapitole 5.2. Fluorochinolony tvoří
3 % celkové spotřeby antimikrobiálních látek pro potravinové účely v EU (EMEA, 2012). Nejvyšší spotřebu
uvádí Maďarsko, Portugalsko a Polsko (EMEA, 2012). Naopak v Austrálii nebyly chinolony pro použití
u potravinových zvířat nikdy autorizovány, což se odráží v nízkém výskytu bakterií rezistentních k této
skupině antimikrobiálních látek v porovnání se světem (Gottlieb et al., 2008; Turnidge et al., 2003;
Unicomb et al., 2006). Největší spektrum chinolonových preparátů je autorizováno v Asii (Hooper a
Rubinstein, 2003; Quesada et al., 2013). Z důvodu zvyšující se spotřeby FQ, jejich důležitosti pro humánní
medicínu a současnému trendu v nárůstu rezistence (např. u Campylobacter spp., Salmonella spp., E. coli)
je možné sledovat iniciativy vedoucí k omezení jejich spotřeby nebo úplnému zákazu pro potravinové
účely. Použítí fluorochinolonů u drůbeže ukončilo několik států jako např. USA, Dánsko, Finsko a nedávno
také Velká Británie.
25
3.3 Vliv antimikrobiálních látek na životní prostředí
Kontaminace životního prostředí farmaceuticky aktivními sloučeninami představuje závažný
problém, který nabývá na svém významu. Díky rozvoji citlivých analytických metod jsou tyto látky
prokazovány ve vodě, v půdě, v sedimentech a kalech. Prostředí je rovněž zatíženo antibiotiky.
Antibiotika, která se dostávají do prostředí činností člověka, mohou mít zásadní dopad na vodní
a suchozemské organizmy. Působí na mikrobiální společenstva v odpadních vodách a mohou tak narušit
proces biodegradace (Kuemmerer, 2009a, b). Antibiotika ovlivňují celkovou diverzitu mikrobiálních
společenstev a biogeochemické funkce ekosystému. Selektují bakterie rezistentní k antibiotikům a
podporují výměnu genů a mobilních genetických elementů (MGE) spojených s antibiotickou rezistencí
(Gilling, 2013). Subinhibiční koncentrace antibiotik významně působí na bakteriální buňku, aniž by došlo
k omezení jejího růstu. Antibiotika v nízkých koncentracích zvyšují bazální frekvenci mutací, ovlivňují
transkripci genů vedoucí ke vzniku adaptivních fenotypů (např. tvorba bičíků, schopnost kolonizovat
bioitické/abiotické povrchy; Seshasayee et al., 2006). Vedle antibiotik se na selekci rezistentních bakterií
podílí také další kontaminanty v prostředí, jako jsou těžké kovy a dezinfekční látky. Geny kódující
rezistenci k těmto látkám se mohou nacházet na stejných MGE jako geny pro rezistenci k antibiotikům,
proto selekce bakterií v přítomnosti dezinfekčních látek a těžkých kovů může současně navyšovat
abundanci genů rezistence k antibiotikům.
Většina antimikrobiálních látek není plně makroorganizmem metabolizována, je vylučována
v aktivní formě močí a trusem do odpadového systému a následně je zachytávána v čistírnách odpadních
vod (Kummerer a Henninger, 2003). Odhaduje se, že 30-90 % spotřebovaných antibiotik pro humánní i
veterinární účely jsou z těla vylučovány v nezměněné formě (Sarmah et al., 2006). Odstranění antibiotik
procesem používaným v čistírnách odpadních vod je pouze částečné a závisí především na charakteru
použitého procesu a fyzikálně-chemických vlastnostech dané sloučeniny (Lindberg et al., 2007). Cestou
odpadních vod mohou antibiotika kontaminovat povrchové nebo podzemní vody a usazovat se
v sedimentech. V nemocničních odpadních vodách je možné nalézt výrazně vyšší koncentrace antibiotik
v porovnání s městskými odpady. V aktivovaném kalu v čistírnách odpadních vod byly v účinných
koncentracích nalezeny, např. FQ, makrolidy a cefalosporiny (Baquero et al., 2008). V řadě zemí
rozvojového světa však účinný sanitační systém zcela chybí a dá se tedy předpokládat zásadnější dopad
odpadů na životní prostředí. Velké množství antibiotik se dostává do vodních ekosystémů také
při průmyslové výrobě antibiotik (Gillings, 2013).
Významným zdrojem antibiotik pro prostředí jsou také odpady ze zemědělské produkce.
Rizikovým procesem je například hnojení půd zvířecími výkaly, které je zdrojem antibiotik a rezistentních
bakterií pro půdní ekosystém. Antibiotika mohou v půdě dlouhodobě přetrvávat a kontaminovat
26
zemědělské plodiny (Boxall et al., 2006). V období dešťů mohou být odnášena z polí do řek nebo mohou
prosakovat do vod podzemních (Kuemmerer, 2009a, b). Důležitým zdrojem antibiotik a rezistentních
bakterií pro vodní ekosystém představují akvakultury. Intenzivní chov ryb spojený s nedodržením
vhodných podmínek a nadužíváním antimikrobiálních látek má významné dopady na životní prostředí
(Quesada et al., 2013).
Rizikovou skupinu představují FQ, které jsou z velké části v nezměněné podobě vylučovány močí.
Proces čištění v čistírnách odpadních vod (ČOV) odstraní pouze 80 % z jejich celkového množství (Sukul a
Spiteller, 2007). FQ se navíc vyznačují schopností silné absorpce na minerální a organické látky ve vodním
prostředí, v půdě a sedimentech. Absorpcí se snižuje volná koncentrace antibiotika, zároveň dochází
ke zpomalení jeho biologického odbourávání, které může vést k dlouhodobé perzistenci antibiotika
v prostředí. Fluorochinolony byly nalezeny v potenciálně účinné koncentraci v aktivovaném kalu z ČOV
(Baquero et al., 2008; Robinson et al., 2005). Byla také demonstrována toxicita fluorochinolonů na vodní
organizmy (Robinson et al., 2005).
27
4. Antimikrobiální rezistence
28
29
Antibiotická rezistence bakterií představuje jeden z nejzávažnějších problémů současné
medicíny. Infekce vyvolané multirezistentními bakteriemi vyžadují výrazně vyšší náklady na léčbu a jsou
spojeny s vyšší mortalitou pacientů. Antibiotická rezistence je většinou vnímána jako důsledek
nesprávného používání a nadužívání antibiotik. Problém je však mnohem komplexnější, zahrnuje dopady
celkové spotřeby antibiotik v humánní i veterinární sféře, v zemědělství a mnoho dalších faktorů včetně
vlivu prostředí. Nedostatečná hygiena a sanitace v některých zemích vedou ke snadnému šíření
patogenních a rezistentních bakterií.
Antibiotická rezistence je široký problém s ohledem na kritéria posuzování, která zahrnují
hledisko mikrobiologické, klinické nebo genetické. Obecně můžeme antibiotickou rezistenci definovat
jako schopnost bakterie odolávat účinku antibiotika, ke kterému byla dříve citlivá. Kmen je
z mikrobiologického hlediska rezistentní, pokud je schopen růstu ve vyšší koncentraci antibiotika
v porovnání s fylogeneticky příbuznými kmeny. Z klinického pohledu je mikroorganizmus rezistentní,
pokud existuje vysoká pravděpodobnost selhání terapie i v případě použití maximální možné dávky
antibiotika. Z hlediska genetického je rezistence spojena s přítomností genu rezistence.
Rezistence mikroorganizmů k více antimikrobiálním látkám představuje rostoucí klinický
problém. Komplikuje empirickou léčbu infekcí a prodlužuje tak čas před zahájení antimikrobiální terapie.
Současně limituje možnosti použitelných antibiotik, která by si zachovávaly účinnost. V literatuře se
setkáváme z řadou pojmů, které tyto vysoce rezistentní bakterie definují (Magiorakos et al., 2012).
Multirezistence (MDR – „multidrug resistance”) je chápána jako odolnost alespoň k jedné látce ze tří a
více antibiotických skupin. Multirezistentní bakterie zároveň představují vděčné příjemce různých MGE,
jimiž mohou získat další geny, prostřednictvím kterých si rozšiřují svůj rezistentní fenotyp. Bakterie
s rozšířenou neboli extenzivní rezistencí (XDR – „extensive drug resistance“) si zachovávají citlivost pouze
k jedné nebo maximálně dvěma antibiotickým skupinám. V extrémním případě bakterie nabude
panrezistentního profilu (PDR – „pandrug resistance) a je schopná odolávat všem dostupným
antimikrobiálním látkám.
4.1 Mechanizmy antibiotické rezistence a jejich genetický základ
Bakterie si vyvinuly různé mechanizmy jak neutralizovat účinek antimikrobiální látky. Vedle
primární rezistence, která je dána přirozenou necitlivostí bakterie (např. absence zásahových struktur
antibiotika), rozlišujeme rezistenci získanou, kdy se původně citlivá bakterie stává rezistentní k danému
antibiotiku nebo skupině antibiotik. Další kategorii představuje rezistence adaptivní. Jedná se
o přechodnou reverzibilní rezistenci, která vzniká změnou v genové expresi jako důsledek působení
vnějších faktorů (stres, nedostatek živin, subinhibičních koncentrace antibiotik atd.). Bakteriální buňka se
30
může bránit účinku antibiotika enzymatickou inaktivací, sníženým příjmem nebo aktivním vylučování
antibiotika, případně modifikací jeho cílových míst. Méně časté mechanizmy zahrnují ochranu cílových
struktur antibiotika nebo zvýšení jejich počtu. Mechanizmus rezistence může být specifický a jeho
primární funkcí je tedy zprostředkování rezistence pouze pro konkrétní toxickou látku nebo nespecifický,
při kterém daná struktura odpovědná za rezistenci k antibiotiku plní v bakteriální buňce i jiné funkce
(Aarestrup, 2006; Mascaretti, 2003). Přehled základních mechanizmů bakteriální rezistence
k antibiotikům je shrnut na Obr. 4.
Genetický základ získané rezistence k antibiotikům spočívá v mutačních změnách zásahových
míst antibiotika nebo získáním cizorodého genetického materiálu, který zajištuje profil rezistence.
Nejvýznamnějšími jsou mechanizmy vázané na mobilní genetické elementy (plazmidy, transpozony,
integrony), které umožňují předávání determinant rezistence mezi jednotlivými bakteriálními buňkami.
Tento proces toku genů je vysoce efektivním nástrojem v šíření antibiotické rezistence v bakteriálních
populacích.
Obr. 4: Základní mechanizmy rezistence rezistence bakterií k antibiotikům
4.2 Prostředí v kontextu původu antibiotické rezistence
V přirozených ekosystémech plní antibiotika dvojí funkci. V první řadě, podobně jako při jejich
klinickém použití, negativně ovlivňují růst mikroorganizmů. Antibiotika vznikající v prostředí činností
přirozených producentů vykazují určitou míru antimikrobiálního účinku, v porovnání s terapeutickou
aplikací je ale velmi zřídka dosaženo hladin nutných pro inhibici růstu. V nízkých koncentracích působí
enzymatická inaktivace antibiotika
plazmid
chromozom
efflux (odčerpávání) antibiotika
změna struktury buněčných povrchů
snížený příjem antibiotika
modifikace zásahového cíle antibiotika
31
antibiotika jako signální molekuly, ovlivňují transkripci genů a podílí se na různých typech mezibuněčných
interakcí (Linares et al. 2006). Více než 80 % antibiotik používaných pro terapii má své analogy v prostředí.
Nejvýznamnější producenty nacházíme mezi půdními mikroorganizmy, především aktinomycetami
(Kieser, 2000). Předpokládá se tedy, že půdní prostředí je rovněž primárním zdrojem genů rezistence
pro patogenní i komenzální bakterie zvířat a člověka. Půdní bakterie a plísně obsahují geny rezistence jako
přirozené mechanizmy sebeobrany před nežádoucím účinkem antibiotika, které produkují. Tyto
protektivní geny přirozených producentů vykazují vysokou míru sekvenční podobnosti s geny rezistence
klinických izolátů bakterií (Benvenis a Davies, 1973; Marshall et al., 1997). Předpokládá se však, že geny
rezistence mohly v původních mikroorganizmech plnit i jiné primární funkce (metabolické, strukturní,
signální) vedle odolnosti k antibiotikům (Fajardo a Martinez, 2008).
Současný výzkum je zaměřen na hledání původu jednotlivých mechanizmů rezistence (D'Costa et
al., 2006). Původ rezistence u přirozených rezervoárů v prostředí se podařilo vypátrat i v případě klinicky
významné rezistence k cefalosporinům, karbapenemům, aminoglykozidům, fluorochinolonům a
vankomycinu (Benvenis a Davies, 1973; Gudeta et al., 2016; Marshall et al., 1997; Poirel et al., 2005).
V této oblasti výzkumu nachází uplatnění především funkční metagenomika (Riesenfeld et al., 2004).
V metagenomických datech půdních mikrobiomů a mořských sedimentů byly identifikovány neobvyklé
geny s beta-laktamázovou aktivitou, nové geny rezistence k aminoglykozidům a tetracyklinům (Allen et
al., 2009; Koenig et al., 2008; Michael et al., 2004; Riesenfeld et al., 2004). Je vysoce pravděpodobné, že
v přirozených ekosystémech existuje nespočetné množství dosud nepopsaných genů, které tvoří
komplexní antibiotický rezistom. Pojem rezistom je chápán jako soubor všech genů v bakteriálním
ekosystému, které mohou přispívat k rezistentnímu fenotypu (Gilllings, 2013). Do současnosti bylo
popsáno okolo dvaceti tisíc různých genů rezistence, které ale nejspíše představují pouhý zlomek
skutečné velikosti rezistomu. Rezistom v prostředí představuje zdroj genetických determinant rezistence
pro významné humánní patogeny (Nesme a Simonet, 2015).
Geny rezistence k antibiotikům byly u bakterií rozšířené i v předantibiotické éře, coždokumentuje
například recentní výzkum permafrostu a izolovaných jeskynních mikrobiálních společenství (Bhullar et
al., 2012; D’Costa et al., 2011). Zásadní význam v jejich přenosu z přirozených rezervoárů v prostředí
k bakteriím s klinickým významem měly MGE. Horizontální přenos genetické informace zajištěný MGE je
přirozený proces bakteriálních populací, jeho dynamika však byla v antibiotické éře silně narušena.
Selekční tlak antibiotik vyvolá pomnožení bakterií s výhodnou kombinací genů rezistence nesených
na MGE a zároveň podporuje jejich přenos na další bakterie v mikrobiálním společenstvu. Proces vzniku
a šíření rezistence k antibiotikům je přiblížen na Obr. 5. Pro soubor všech MGE v bakteriálním ekosystému
je používán termín mobilom. Mobilom napomáhá vytvářet vysokou diverzitu prokaryotických genomů
32
(Gillings, 2013). Koncept uspořádání bakteriálních genomů v mikrobiálním společenství ve vztahu
k mobilomu a rezistomu je vysvětlen na Obr. 6.
Obr. 5: Proces vzniku a šíření rezistentních bakterií s klinickým významem
Volně podle Stokes a Gillings, 2011.
Selekční tlak širokého spektra antibiotik vede k expanzi
multirezistentních klonů, které zároveň slouží jako donoři
rezistentních plazmidů pro další bakterie a podporují tak
šíření rezistence horizontální cestou.
Epidemické multirezistentní klony se expanzivně šíří
mezi různými ekosystémy. Kromě výhodné kombinace
plazmidů s genem (geny) rezistence a genetickým
pozadím hostitelské bakterie je úspěch těchto klonů
ovlivněn dalšími faktory.
Distribuce genů rezistence a mobilních genetických
elementů (integronů, transpozonů, plazmidů a dalších)
v mikrobiálním společenstvu v předantibiotické éře.
Soubor genů rezistence představuje rezistom a mobilní
genetické elementy tvoří mobilom. Obě tyto složky tvoří
základní elementy v šíření genetické informace
pro rezistenci k antibiotikům v bakteriálním ekosystému.
Vytváření náhodných kombinací genů rezistence a
mobilních genetických elementů. Výhodné kombinace
jsou pomnoženy a šířeny mezi bakteriálními genomy jako
odpověď na změnu mikrobiálních ekosystémů v důsledku
selekčního tlaku antibiotik.
Horizontální šíření genů rezistence v mikrobiálním
společenstvu prostřednictvím plazmidů a jejich přenos
k patogenům člověka a zvířat.
33
Obr. 6: Uspořádání bakteriálních genomů v ekosystému, koncept rezistomu a mobilomu ve vztahu k
šíření rezistence k antibiotikům
Vytvořeno podle Norman et al., 2009. Geny rezistence nesené MGE (zahrnující inzerční sekvence, transpozony, plazmidy,
bakteriofágy atd.) nebo vázané na bakteriální chromozom jsou součástí komplexní genetické informace prokaryotických
buněk tvořící dané společenství. Tato souborná genetická informace bakteriálního společenství je označována jako
supergenom (na obrázku vyznačen barevným kruhem). Všechny supergenomy daného prostředí pak tvoří
environmentální metagenom. Genetická informace ve formě MGE může být přenášena mezi bakteriemi v rámci daného
supergenomu. Některé MGE disponují širokým hostitelským spektrem a mohou se šířit mezi různými supergenomy
(na obrázku se tento soubor sdílených genů nachází v místě překryvu dvou různých supergenomů).
4.3 Jednotky v šíření antibiotické rezistence
Aby se mohl gen rezistence efektivně šířit mezi bakteriemi, musí vytvářet kombinace s mobilní DNA.
Výhodná sdružení genů rezistence a MGE (inzerčních sekvencí, transpozonů, konjugativních plazmidů)
podporují šíření klinicky významné rezistence v mikrobiálních společenstvech. Úseky DNA nesoucí geny
rezistence se vyznačují vysoce mozaikovým charakterem, který podporuje další přestavby a výměny
genetické informace mezi genomy a vede tak ke vzniku výhodnějších kombinací. Horizontální přenos genů
rezistence nesených plazmidy ke komenzálním i patogenním bakteriím adaptovaných na člověka a zvířata
supergenom
environmentální
metagenom
geny rezistence
vázané na
chromozom
MGE nesoucí
geny rezistence
MGE přenosné mezi
supergenomy
MGE se širokým
spektrem hostitelů
chromozomální
geny
34
spolu se selekčním tlakem antibiotik dal vzniku
úspěšným bakteriálním liniím (Stokes a Gillings,
2011). V epidemiologii rezistence ke klinicky
významným antibiotikům hrají úlohu dvě základní
složky – úspěšný bakteriální klon a vysoce přenosný
mobilní element, nejčastěji v podobně
konjugativního plazmidu. Obě tyto složky utváří
současný obraz antibiotické rezistence a významně
se podílí na jejím rostoucím charakteru. Tvorba
úspěšných kombinací genů rezistence s MGE a
asociace s vhodnými bakteriálními kmeny stojí za
úspěchem mnoha rezistentních mechanizmů
včetně beta-laktamáz. Horizontální přenos genů
rezistence je považován za hlavní hnací motor
narůstající rezistence k antibiotikům. Typická
hierarchie těchto tří podjednotek „gen rezistence -
mobilní element - bakteriální hostitel“ v šíření
antibiotické rezistence je představena na Obr. 7.
Pro úspěšné linie bakterií, které se dnes
expanzivně šíří v různých ekosystémech po celém
světě, je používán termín epidemický klon. Klon je
definován jako soubor bakteriálních izolátů, které
ačkoliv byly získány z různých zdrojů, odlišných míst
a v různém čase vykazují významné fenotypové a
genotypové charakteristiky (van Belkum, 2007).
Příslušníci daného klonu respektive klonální linie
pochází z jednoho společného předka. Významným mezníkem ve studiu genetické variability populace
enterobakterií přispěla metoda multilokusové sekvenční analýzy neboli MLST („multilocus sequence
typing“). Tato vysoce diskriminační typizační metoda umožnila identifikovat významné multirezistentní
klony neboli sekvenční typy (ST) E. coli a K. pneumoniae, které byly izolovány z různých zdrojů po celém
světě (Diancourt et al., 2005; Wirth et al., 2006; Woodford et al., 2011). Epidemické klony zároveň
podporují další šíření genů rezistence v bakteriálních společenstvech. Díky jejich vysoké prevalenci a
obecnému rozšíření mají také více příležitostí fungovat jako donoři genetického materiálu a přenášet
geny rezistence na jiné bakterie.
Obr. 7: Hierarchické uspořádání jednotek
v šíření rezistence k antibiotikům na příkladu
širokospektrých beta-latamáz
Vytvořeno podle Canton et al., 2012b.
(1) inzerční sekvence sdružená (šedá) s genem
rezistence (červená, např. ISEcp1-blaCTX-M-15)
(2) transpozon (modrý segment) nesoucí inzerční
sekvenci s genem rezistence (např. Tn3)
(3) konjugativní plazmid s variabilní oblastí (barevně
označená) nesoucí geny rezistence
k antibiotikům
(4) epidemický klon (např. E. coli ST131)
1
2
3
4
35
4.4 Cesty šíření rezistentních bakterií
Rezistentní bakterie a geny rezistence nesené MGE se šíří různými cestami (Obr. 8). Jednotlivé
složky a směry přenosu utváří komplexní charakter současné epidemiologie antibiotické rezistence. Geny
rezistence, MGE a bakteriální buňky jako nositelé této genetické informace jsou sdíleny všemi složkami
tohoto systému. V kontextu šíření antibiotické rezistence používáme termín „jedno zdraví“ neboli „One
Health“.
Obr. 8: Selekce a přenos rezistentních bakterií a genů rezistence mezi člověkem, zvířaty a prostředím
Hlavními místy selekce rezistentních bakterií jsou přirozeně ta, která jsou pod intenzivním
selekčním tlakem antibiotik (Obr. 8). Široké spektrum antibiotik používané v terapii infekčních
onemocnění v nemocnicích podporuje vznik a udržování multirezistentních patogenů. Antibiotika působí
jako stresové faktory indukující SOS reakci s rozsáhlými účinky na bakteriální genom. Podporují
horizontální přenos genů rezistence a také zvyšují rekombinaci genomu vedoucí například ke vzniku
nových kombinací genových kazet integronů (Guerin et al., 2009; Miller et al., 2004). Rezistentní bakterie
jsou rovněž selektovány použitím antibiotik v komunitě. Enterobakterie s klinicky významnými
mechanizmy rezistence komplikují úspěšnost terapie komunitně získaných infekcí (Laupland et al.,
2008a).
Ve veterinární oblasti je nejvyšší podíl antibiotik použit v chovech potravinových zvířat při terapii
a prevenci bakteriálních infekcí. Veterinární antibiotické přípravky náleží do různých funkčních skupin
včetně těch, které patří v humánní medicíně mezi kriticky důležité. Zvířata mohou pro člověka
36
představovat nepřímý zdroj rezistentních bakterií prostřednictvím potravin živočišného původu. Mohou
být rovněž zdrojem přímým, při kterém se tyto bakterie případně jejich genetická informace
pro rezistenci přenesou ke člověku cestou fyzického kontaktu se zvířetem například v rámci vykonávání
profese ošetřovatele nebo veterinárního lékaře (da Costa et al., 2013; de Been et al., 2014; Moodley a
Guardabassi, 2009). Multirezistentní bakterie izolované ze zvířat chovaných ze záliby (psů, koček, koní)
často náleží mezi významné humánní patogeny. Sdílení identických kmenů rezistentních bakterií mezi
člověkem a „domácím mazlíčkem“ je pouhým odrazem jejich blízkého kontaktu (Ewers et al., 2012).
Významnou složkou v cirkulaci antibiotické rezistence představuje také prostředí. Chlévská mrva
z farem zavážená na pole jako hnojivo kontaminuje zemědělskou půdu a do půdního mikrobiomu vnáší
rezistentní bakterie a geny rezistence. Mnohonásobné zvýšení abundance klinicky významných genů
rezistence v zemědělské půdě po aplikaci chlévské mrvy a jejich dlouhodobá perzistence byla
zdokumentována (Cheng et al., 2016; Pourcher et al. 2014; Ruuskanen et al. 2016). Vodní ekosystémy
jsou rovněž zatíženy odpadními produkty humánního i veterinárního původu (da Costa et al., 2013;
da Costa et al., 2008; Wang et al., 2012). Čistírny městských odpadních vod představují pro prostředí
hlavní antropogenní zdroje antibiotik a bakterií rezistentních k antibiotikům včetně významných
patogenů (Masarikova et al., 201631
; Dolejska et al., 2011b9
). Subinhibiční koncentrace antibiotik přítomné
v odpadních vodách se podílí na selekci rezistentních bakterií, které se následně šíří do vodních toků.
Prostředí ČOV rovněž disponuje ideálními podmínkami pro výměnu genetické informace mezi bakteriemi,
včetně genů rezistence k antibiotikům (Rizzo et al., 2013).
Rezistentní bakteriální kmeny byly izolovány také z různých druhů volně žijících zvířat. Prevalence
rezistentních bakterií u volně žijících zvířat je závislá na mnoha faktorech. Mezi ty nejdůležitější patří
potravní návyky daného druhu a charakter konkrétní lokality. Druhy, které mají tendenci shlukovat se
do měst, do okolí farem, pohybovat se v okolí ČOV a přiživovat se na komunálních skládkách, jsou v tomto
ohledu vystaveny vyššímu riziku. Výskyt rezistentních bakterií ve volné přírodě je v podstatě odrazem
lidské činnosti a představuje další druh znečištění životního prostředí (Guenther et al., 2011). Skutečnost,
že rezistentní bakterie byly prokázány také u zvířat žijících v prostředí s minimálním vlivem
antropogenních aktivit, podtrhuje komplexnost tohoto problému (Albrechtova et al., 201422
; Bonnedahl
et al., 2014; Janatova et al., 201423
). Problematika rezistentních bakterií u volně žijících zvířat v kontextu
šíření širokospektrých beta-laktamáz bude představena v kapitole 7.8.
37
5. Mechanizmy rezistence
ke klinicky významným
antibiotikům
38
39
Narůstající rezistence gramnegativních bakterií k antimikrobiálním látkám představuje jeden
z nejvýznamnějších problémů současné medicíny. Z důvodu klinické významnosti pro humánní i
veterinární medicínu je dnes pozornost soustředěna na beta-laktamová antibiotika se širokým spektrem
účinku (cefalosporiny, karbapenemy) a fluorochinolony. Narůstající rezistence patogenů zvířat a člověka
k těmto antibiotikům výrazně komplikuje úspěšnost léčby infekčních onemocnění. Bakterie disponují
mnoha nástroji, jak inaktivovat inhibiční účinek těchto skupin antibiotik. Následující odstavce jsou
věnovány stručnému přehledu těchto rezistentních mechanizmů. Pozornost je soustředěna
na mechanizmy vázané na mobilní genetické elementy, které zajišťují efektivní šíření genů rezistence
mezi bakteriemi a mají tedy vyšší epidemiologickou významnost v porovnání s chromozomálně
zakotvenou rezistencí. Text je doplněn o aktuální informace v epidemiologii daných mechanizmů
rezistence ve světě. Molekulární epidemiologie širokospektrých beta-laktamáz, která je hlavní výzkumnou
oblastí autora a stěžejním bodem této práce, je podrobně zpracována v kapitole 7.
5.1. Mechanizmy rezistence k cefalosporinům a karbapenemům
Produkce beta-laktamázy je nejvýznamnějším nástrojem odolnosti gramnegativních bakterií
k cefalosporinům a karbapenemům. Jedná se o enzymy schopné degradovat beta-laktamová antibiotika
vedoucí ke ztrátě jejich inhibičního účinku na bakteriální buňku. Beta-laktamázy byly identifikovány
u mnoha bakteriálních druhů a představují závažný problém moderní medicíny. V dnešní epidemiologii
antibiotické rezistence jsou nejvýznamnější širokospektré beta-laktamázy, pro které je charakteristické
jejich globální a rostoucí rozšíření zejména u zástupců čeledi Enterobacteriaceae. V posledních letech
máme možnost být svědkem celosvětové expanze novějších typů beta-laktamáz – karbapenemáz, které
degradují prakticky všechna beta-laktamová antibiotika včetně rezervních karbapenemů. Geny
pro klinicky významné beta-laktamázy jsou ve většině případů neseny MGE, zejména plazmidy a
transpozony, které usnadňují jejich další šíření v bakteriálních populacích a stojí za současným úspěchem
některých variant těchto enzymů.
Bylo popsáno několik dalších mechanizmů rezistence k beta-laktamovým antibiotikům vedle
produkce beta-laktamáz, které zahrnují sníženou propustnost buněčné stěny v důsledku změny exprese
porinů (Martinez-Martinez, 2008; Nikaido, 2003) nebo aktivní vylučování antibiotika prostřednictvím
efluxních pump. Tyto transportní pumpy mají obvykle charakter multirezistentních (MDR) efluxních pump
a jsou schopné vedle beta-laktamů pokrýt poměrně velkou škálu různých skupin antimikrobiálních látek.
Nejčastěji je u Enterobacteriaceae nacházena třísložková MDR pumpa AcrAB-TolC (Nikaido a Takatsuka,
2009). Tyto dva mechanizmy rezistence k beta-laktamům jsou obvykle kódovány chromozomálními geny,
40
v porovnání s geny beta-laktamáz vázanými na plazmidy je jejich epidemiologický význam tudíž omezený.
Negativním důsledkem rezistentních mechanizmů spojených s bakteriální membránou a transportem
látek může být snížený příjem důležitých živin bakteriální buňkou případně jejich zvýšené vylučování,
které se může odrazit ve fitness rezistentních kmenů bakterií (Perez et al., 2012).
5.1.1 Obecná charakteristika a klasifikace beta-laktamáz
Beta-laktamázy jsou enzymy hydrolyzující beta-laktamový kruh (Obr. 9), který je sdílený všemi
beta-laktamovými antibiotiky (Bush et al., 1995). Blízká homologie aminokyselinové sekvence beta-laktamáz
a chromozomálních PBP různých bakteriálních druhů ukazuje na nejpravděpodobnější původ
těchto enzymů (Koch, 2003). V 60. letech byla popsaná první plazmidově kódovaná beta-laktamáza
TEM-1 (Datta and Kontomichalou, 1965). Nová varianta beta-laktamázy může vzniknout jen jedinou
mutací v kódujícího genu vedoucí k záměně aminokyseliny v sekvenci proteinu. Do dneška bylo popsáno
přes 2000 sekvenčních typů beta-laktamáz (ftp://ftp.ncbi.nlm.nih.gov/pathogen/betalactamases/, ke dni
23. 2. 2016) a jejich počty konstantně narůstají.
Obr. 9: Antibiotická aktivita penicilinu G inhibicí transpeptidázy (A) a hydrolýza beta-laktamového kruhu
antibiotika účinkem beta-laktamázy (B)
Vytvořeno podle Mascaretti et al., 2003.
(A) Penicilin G narušuje aktivitu transpeptidázy tvorbou vysoce stabilního penicilloyl-enzymového intermediátu.
(B) Serinová beta-laktamáza napadá beta-laktamový kruh penicilinu G a dává vznik kyselině penicilová. V této změněné
podobě je penicilin inaktivní.
A
B
penicilloyl-transpeptidáza
transpeptidáza
Penicillin G
Penicillin G
beta-laktamáza kyselina penicilová
41
Z ohledem na velký počtu a variabilitu beta-laktamáz bylo navrženo několik systému jejich třídění
do skupin na základě biochemických, molekulárních a mikrobiologických vlastností. Nejuznávanější je
klasifikace na základě sekvence aminokyselin dle Amblera (Ambler, 1980) a funkční klasifikace podle
substrátové specifity a citlivosti k inhibitorům beta-laktamáz navržená K. Bush a kolegy (Bush et al., 1995).
Tyto dva přístupy přehledně shrnuje recentní práce K. Bush (Bush, 2013). Bez ohledu na řazení
do klasifikačních skupin můžeme beta-laktamázy rozdělit na základě jejich substrátové specifity
na penicilinázy neboli úzkospektré beta-laktamázy, širokospektré beta-laktamázy, cefalosporinázy AmpC a
karbapenemázy (Bush a Jacoby, 2010), jejichž přehled uvádí Tab. 4.
Tab. 4: Přehled vybraných beta-laktamáz gramnegativních bakterií
Skupina Příklad enzymu Substrátové spektrum
Inhibice
kyselinou
klavulanovou
Klasifikační
třída
Penicilinázy
(úzkospektré
beta-laktamázy)
TEM-1, SHV-1 penicilin G, aminopeniciliny,
karboxypeniciliny, úzkospektré
cefalosporiny
ano A/2b
skupina OXA podobně jako TEM-1, navíc
kloxacilin, methicilin, oxacilin
variabilní D/2d
Širokospektré
beta-laktamázy
skupina TEM a SHV jako penicilinázy, navíc oxyiminocefalosporiny
a monobaktamy
(aztreonam)
ano A/2be,2br,
2ber
skupina CTX-M podobně jako skupina TEM a
SHV, u některých i cefepim
ano A/2be
skupina OXA jako CTX-M variabilní D/2de
PER-1, BES-1, VEB-1 jako TEM a SHV skupina ano A/2be
AmpC
cefalosporinázy
CMY, ACC-1, ACT-1, DHA-2,
MIR-1, MOX-1, skupina FOX a
LAT
jako ESBL, navíc cefamyciny ne C/1
Karbapenemázy metalo-betalaktamázy VIM,
IMP, NDM, SIM, SPN, GIM-1,
SPM-1
jako ESBL, navíc cefamyciny a
karbapenemy, nehydrolyzují
monobaktamy
ne B/3a
KPC, IMI, SME, GES jako ESBL, karbapenemy,
cefamyciny
ne A/2f
skupina OXA-48, OXA-23 kabapenemy, cloxacilin, oxacilin variabilní D/2df
Upraveno podle Bush, 2010; Paterson, 2006.
5.1.2 Širokospektré beta-laktamázy (ESBL)
Tato skupina enzymů známá pod zkratkou ESBL („extended-spectrum beta-lactamase”) je
produkovaná různými druhy gramnegativních bakterií. ESBL hydrolyzují peniciliny, oxyimino-cefalosporiny
a monobaktamy, zatímco cefamyciny a karbapenemy jsou stabilní jejich působení. Jejich
negativní účinek na bakteriální buňku je potlačován inhibitory beta-laktamáz (kyselinou klavulanovou,
tazobaktamem a sulbaktamem). Mechanizmus interakce inhibitoru s beta-laktamázou je přiblížen
42
na Obr. 10. Tato vlastnost je zároveň využívána v diagnostice producentů těchto enzymů. ESBL jsou
produkovány především zástupci čeledi Enterobacteriaceae, dále pseudomonádami a acinetobaktery.
Obr. 10: Interakce kyseliny klavulanové s transpeptidázou (A) a zjednodušený mechanizmus nevratné
inhibice beta-laktamázy účinkem inhibitoru (B).
Vytvořeno podle Mascaretti, 2003.
Širokospektré cefalosporiny byly zavedeny do klinické praxe na počátku 80. let minulého století
pro léčbu závažných infekcí vyvolaných gramnegativními bakteriemi (Bradford, 2001). Tato antibiotika
byla hojně aplikována a bylo jen otázkou času, kdy budou nalezeny bakterie schopné odolávat jejich
účinku. První popisované ESBL byly substituční deriváty úzkospektrých beta-laktamáz TEM a SHV. Vznikly
jednou či dvěma mutacemi v definovaných pozicích těchto kódujících genů.
První popsanou ESBL byla SHV-2 u Klebsiella ozanae v Německu (Kliebe et al., 1985). Jedná se
o derivát penicilinázy SHV-1, která je nejběžnější úzkospektrou beta-laktamázou K. pneumoniae, jejíž
kódující je lokalizován na plazmidu nebo na bakteriálním chromozomu (Livermore, 1995). Beta-laktamázy
typu TEM tvoří početnou skupinu. TEM-1 je nejrozšířenější variantou u gramnegativních bakterií,
hydrolyzuje peniciliny a úzkospektré cefalosporiny. První širokospektrá beta-laktamáza typu TEM byla
TEM-3 popsaná v roce 1988 (Sougakoff et al., 1988). V současné době je známo 189 variant SHV a
220 variant TEM (ftp://ftp.ncbi.nlm.nih.gov/pathogen/betalactamases/, ke dni 23. 2. 2016). Je však nutné
podotknout, že ne všechny varianty TEM a SHV disponují vlastnostmi ESBL, mnohé z nich náleží mezi betalaktamázy
úzkospektré.
transpeptidáza
minimální antibiotická aktivita
beta-laktamáza (Enz)
sled reakcí vedoucí k přestavbách
ve struktuře molekul
nevratně inhibovaná
beta-laktamáza (Enz)
A
B
kyselina klavulanová
kyselina klavulanová
43
Další skupinou, která obsahuje varianty s charakterem ESBL, jsou beta-laktamázy rodiny OXA,
které na rozdíl od TEM a SHV náleží do molekulární třídy D/funkční třídy 2d. Od výše uvedených
beta-laktamáz se navíc odlišují vysokou aktivitou k oxacilinu a kloxacilinu a slabou inhibicí kyselinou
klavulanovou (Bush et al., 1995). Jsou rozšířeny především u P. aeruginosa (Bradford, 2001). Kódující geny
jednotlivých variant beta-laktamáz OXA se vyznačují nízkou sekvenční homologií.
Nová skupina beta-laktamáz, která díky zvýšené schopnosti hydrolyzovat cefotaxim získala název
CTX-M, v posledních 15 letech prakticky vytlačila enzymy výše uvedených rodin a stala se dominantní
mezi producenty ESBL. Na rozdíl od výše uvedených rodin beta-laktamáz vykazují všechny variant CTX-M
enzymů vlastnosti ESBL. Do současnosti bylo popsáno 161 odlišných sekvenčních variant CTX-M
(ftp://ftp.ncbi.nlm.nih.gov/pathogen/betalactamases/, ke dni 23. 2. 2016), což dokládá jejich vysokou
heterogenitu. Jednotlivé varianty CTX-M mohou vykazovat drobné odlišnosti ve spektru a míře hydrolýzy
beta-laktamových antibiotik (Bonnet, 2004; Poirel et al., 2008b). Předpokládá se, že vznik nových variant
bodovými mutacemi stávajících enzymů je podporován selekčním tlakem cefalosporinů a může přispívat
ke zvýšené hydrolytické aktivitě těchto enzymů. Bližšímu popisu epidemiologii ESBL je věnována
kapitola 7. Tab. 5 dokumentuje sekvenční variabilitu vybraných skupin beta-laktamáz.
Tab. 5: Počty dosud popsaných sekvenčních variant vybraných skupin beta-laktamáz
Molekulární
třída
Skupina
Typ enzymu na základě substrátové
aktivity
Číslo nejvyšší
popsané varianty
A TEM penicilináza/ESBL 224
SHV penicilináza/ESBL 193
CTX-M ESBL 179
KPC karbapenemáza 24
GES karbapenemáza 30
SME karbapenemáza 5
B IMP karbapenemáza 58
VIM karbapenemáza 50
NDM karbapenemáza 16
C CMY AmpC beta-laktamáza 139
ACT AmpC beta-laktamáza 39
DHA AmpC beta-laktamáza 24
MIR AmpC beta-laktamáza 18
MOX AmpC beta-laktamáza 12
FOX AmpC beta-laktamáza 13
ACC AmpC beta-laktamáza 5
D OXA penicilináza/ESBL/karbapenemáza 518
Vytvořeno podle ftp://ftp.ncbi.nlm.nih.gov/pathogen/betalactamases, ke dni 18. 4. 2016. Celkový počet uznaných
sekvenčních variant jednotlivých beta-laktamáz může být nižší než číslo nejvyšší popsané varianty. Některé enzymy,
u kterých bylo zjištěno, že byly chybně identifikovány jako nové varianty (chyba v sekvenci, neúplná sekvence, apod.), byly
z databáze vyřazeny.
44
5.1.2.1 Metody detekce producentů ESBL
Specifické metody založené na průkazu fenotypu ESBL vychází ze substrátové specifity těchto
enzymů a jejich citlivosti k inhibitorům beta-laktamáz. Pro vyhledávání kmenů je možné v první fázi použít
výsledky vyšetření citlivosti k beta-laktamovým antibiotikům diskovou difuzní metodou nebo hodnoty
minimální inhibiční koncentrace (MIC). Následně je produkce ESBL potvrzena testem synergického účinku
mezi kyselinou klavulanovou a cefalosporiny třetí nebo čtvrté generace (CLSI, 2013). Komplikací v detekci
ESBL je současná přítomnost dalších mechanizmů, např. konstitutivní produkce AmpC beta-laktamázy
nebo karbapenemázy. V těchto případech je potřeba použít další specifické antibiotické indikátory a
inhibitory, které zajistí odlišení jednotlivých mechanizmů (Hrabak et al., 2011b). Přehledně se těmto
metodám a jejich úskalím věnuje recentní práce J. Hrabáka (Hrabák, 2009). Kmen produkující ESBL bývá
obvykle hodnocen jako rezistentní ke všem beta-laktamovým antibiotikům včetně kombinací s inhibitory
serinových beta-laktamáz (CLSI, 2013). Molekulárně-genetické metody využívají polymerázovou
řetězovou reakci se specifickými primery a DNA mikročipy pro průkaz genů kódujících ESBL. Pro odlišení
jednotlivých variant ESBL je následně nutné stanovit primární nukleotidovou sekvenci. Přesné určení
varianty ESBL enzymu poskytuje cennou informaci pro znalost epidemiologie antibiotické rezistence
na lokální i globální úrovni.
5.1.3 AmpC beta-laktamázy
Substrátová specifita AmpC beta-laktamáz zahrnuje peniciliny, cefamyciny, většinu cefalosporinů
a monobaktamy. AmpC beta-laktamázy obsahují serin v aktivním místě a jsou inhibovány kyselinou
boritou či oxacilinem, nikoli však klasickými inhibitory beta-laktamáz (kyselinou klavulanovou,
tazobaktamem, sulbaktamem). AmpC jsou exprimovány inducibilně nebo konstitutivně, přičemž
inducibilní produkce je běžnější a podílí se na ní geny ampD, ampG a ampR (Obr. 11). Bez přítomnosti
induktoru (např. kyseliny klavulanové, cefoxitinu, imipenemu) dochází pouze k nízké expresi těchto
enzymů. Konstitutivní produkce je podmíněna mutací v regulačním systému AmpC, přičemž tato změna
je nevratná (Philippon et al., 2002).
Enzymy této skupiny se nachází inherentně na chromozomu celé řady bakterií, např.
Acinetobacter spp., Aeromonas spp., Chromobacterium spp., P. aeruginosa, Serratia marcescens,
Citrobacter freundii, Enterobacter aerogenes a dalších. Inherentní AmpC disponuje také u E. coli, zde však
není produkce inducibilní z důvodu absence genu ampR (Jacoby, 2009). Role těchto přirozeně se
vyskytujících AmpC není zcela objasněna, ale předpokládá se jejich zapojení do procesu recyklace
buněčné stěny (Bishop a Weiner, 1992; Johnson et al., 2013b). Později byly AmpC identifikovány
na plazmidu u mnoha druhů gramnegativních bakterií a nabyly tak klinického významu.
45
Obr. 11: Mechanizmus regulace exprese ampC
Vytvořeno podle Lister et al., 2009.
(A) Bazální exprese ampC bez přítomnosti
induktoru. Během procesu recyklace buněčné
stěny jsou molekuly 1,6-anhydromuramyl-pentapeptidy
odstraňovány z buněčné stěny
a transportovány do cytoplazmy
prostřednictvím permeázy AmpG.
Ve vnitrobuněčném prostoru jsou molekuly
1,6-anhydromuramyl-pentapeptidu štěpeny
proteinem AmpD za vzniku volných tripeptidů,
které jsou následně přeměňovány na UDP-MurNAc-pentapeptidy.
Tyto peptapeptidy
reagují s molekulou AmpR navázanou v oblasti
mezi geny ampR a ampC, přičemž tato
interakce vyvolá snížení transkripce genu
ampC. Vytváří se pouze malé množství AmpC
beta-laktamázy, která je následně
transportována do periplazmatického
prostoru.
(B) Indukce exprese ampC účinkem beta--
laktamu. Beta-laktamová antibiotika (např.
imipenem, cefoxitin) působí jako induktory
AmpC beta-laktamáz. V periplazmatickém
prostoru interagují s PBP. Vytváří se zvýšené
množství 1,6-anhydromuramyl-pentapeptidu,
které AmpD nezvládá převádět na tripeptidy. V
důsledku převažujícího množství se
přednostně váže k AmpR (namísto UDP-MurNAc-pentapeptidů)
a vyvolává jeho
konformační změnu na transkripční aktivátor
genu ampC. Vzniká velké množství AmpC,
která je transportována do periplazmatického
prostoru buňky. Pokles hladiny beta-laktamu
pod hodnotu potřebnou pro indukci vyvolá
sníženou tvorbu 1,6-anhydromuramylpentapeptidu,
který je účinně zpracován
prostřednictvím AmpD.
(C) Konstitutivní exprese ampC
zprostředkovaná AmpD. Snížení exprese ampD
případně jeho mutace vedoucí k inaktivaci
AmpD narušuje proces recyklace buněčné
stěny a vede k tvorbě vysokých hladin 1,6-anhydromuramyl-pentapeptidu
cytoplazmě
buňky. Ten se přednostně váže na AmpR a
aktivuje tak transkripci ampC přepisovaného
do beta-laktamázy AmpC, která je přítomná
ve vysokých hladinách.
VM, vnější fosfolipidová membrána
PG, peptidoglykan
PP, periplazmatický prostor
CM, vnitřní cytoplazmatická membrána
PBP, proteiny vázající penicilin
VM
PG
PP
CM
VM
PG
PP
CM
VM
PG
PP
CM
46
5.1.3.1 Plazmidové AmpC beta-laktamázy
První AmpC beta-laktamáza kódovaná geny na plazmidu byla izolována z Proteus mirabilis a
vykazovala vysokou sekvenční homologii s chromozomální AmpC (Bobrowski et al., 1976). Bylo popsáno
mnoho typů plazmidových AmpC a mezi nejčastější patří varianty CMY, FOX, ACT, ACC, DHA, MIR a MOX
(Tab. 4–5). Jsou identifikovány především u druhů, které postrádají inherentní AmpC (např. Klebsiella
spp., Salmonella spp. a P. mirabilis), ale také u E. coli. Plazmidové AmpC mají svůj původ právě
v inherentních (chromozomálních) beta-laktamázách různých druhů bakterií (Barlow a Hall, 2002;
Hanson, 2003; Verdet et al., 2006). Například nejvýznamnější skupina CMY vykazuje vysoký stupeň
příbuznosti s chromozomálními AmpC u Aeromonas spp. a C. freundii. Na rozdíl od inherentních AmpC je
však produkce plazmidových variant až na drobné výjimky vždy konstitutivní, jelikož ampR kódující
represor není přenesen spolu s genem pro vlastní beta-laktamázu. Inducibilní produkce byla popsána
v případě AmpC asociovaných s genem ampR, např. ACT-1, DHA-1, DHA-2 a některých variant CMY
(Jacoby, 2009).
5.1.3.2 Metody detekce producentů AmpC beta-laktamáz
Kmeny produkující AmpC jsou obvykle rezistentní k cefamycinům (např. cefoxitinu). Výsledky
vyšetření citlivosti k antibiotikům mohou tedy poskytnout informaci, zda se jedná o potenciálního
producenta AmpC beta-laktamázy. Jelikož rezistence k cefoxitinu může být způsobena produkcí
karbapenemáz nebo mechanizmy vázanými na cytoplazmatickou membránu, je zapotřebí pro potvrzení
produce AmpC beta-laktamázy použít specifické testy. K tomu účelu bylo popsáno několik fenotypových
metod, které přehledně shrnuje publikace A. Jacobyho (Jacoby, 2009). Mezi nejpoužívanější patří testy
využívající inhibitory AmpC beta-laktamáz, např. kyselinu boritou nebo kloxacilin. Test je založen
na srovnání inhibičních zón případně stanovení rozdílu MIC u cefalosporinů a jejich kombinací s některým
z inhibitorů (Jacoby, 2009; Yagi et al., 2005).
Podobně jako v případě jiných typů beta-laktamáz je i pro detekci AmpC možné použít metody
molekulární biologie (Jacoby, 2009). Tyto metody doplňují primární fenotypový průkaz produkce AmpC
beta-laktamázy a dále umožňují zařadit beta-laktamázu do konkrétní skupiny (CMY, DHA, FOX atd.).
Následná sekvenční analýza poskytne informaci o konkrétní variantě enzymu (CMY-1, CMY-2, DHA-1,
DHA-2 atd.). Mezi nejpoužívanější patří metoda multiplex PCR (Perez-Perez a Hanson, 2002).
Problematiku AmpC beta-laktamáz včetně přehledného a detailního popisu metod jejich detekce se
věnuje publikace J. Hrabáka (Hrabak, 2007).
47
5.1.3.3 Molekulární epidemiologie AmpC
V posledním dvaceti letech došlo k celosvětovému rozšíření těchto enzymů a v současné době
představují závažný klinický problém. Většina producentů AmpC navíc nese další úzkospektré nebo
širokospektré beta-laktamázy (Alvarez et al., 2004; Sheng et al., 2013) a často také vykazuje rezistenci
k jiným skupinám antimikrobiálních látek vedle beta-laktamů. Výskyt a variabilita jednotlivých typů AmpC
je však i nadále nižší v porovnání s ESBL. Rizika kolonizace a infekce producenty AmpC jsou ale obdobné
jako ty, které platí pro ESBL. Zahrnují hospitalizaci, pobyt na jednotkách intenzivní péče, katetrizaci a
předchozí terapii beta-laktamovými antibiotiky. Výskyt AmpC producentů je tedy nejčastější
u hospitalizovaných pacientů (Jacoby, 2009; Tagg et al., 2015). Producenti AmpC nejsou pouze doménou
humánní medicíny, ale byly izolováni také ze skotu, prasat a drůbeže a zvířat chovaných ze záliby (Rubin
a Pitout, 2014; Smet et al., 2010a). V důsledku jejich rostoucí prevalence a obecného rozšíření je
upozorňováno na možnou existenci rezervoárů AmpC beta-laktamáz u potravinových zvířat a s tím
související význam potravního řetězce v přenosu těchto bakterií ke člověku (EFSA, 2011).
Z širokého spektra dosud popsaných enzymů je CMY-2 nejrozšířenější. Druhou nejčastější AmpC
beta-laktamázou, která je často nacházena u izolátů produkujících karbapenemázy, patří DHA-1 (Jacoby,
2009). CMY-2 je identifikována u humánních i veterinárních izolátů E. coli a dalších zástupců čeledi
Enterobacteriaceae. Byla spojena s nárůstem rezistence k beta-laktamovým antibiotikům včetně
cefalosporinů u netyfoidních salmonel (Carattoli et al., 2002; Dunne et al., 2000). Od druhé poloviny 90.
let bylo pozorováno její šíření v Severní Americe u různých serotypů Salmonella spp. u lidí, potravinových
zvířat, psů a koček (Jacoby, 2009). Později byla dokumentována difuze CMY-2 do populací komenzálních
izolátů E. coli. Frekventovaný výskyt je sledován celosvětově u E. coli a K. pneumoniae rezistentní
k cefoxitinu a to jak u hospitalizovaných pacientů tak v komunitě (Denisuik et al., 2013; Reuland et al.,
2015; Sheng et al., 2013; Tagg et al., 2015; Voets et al., 2012; Wu et al., 2007). Beta-laktamáza CMY-2
byla také popsána u E. coli z psů a koček v USA, Evropě a Austrálii (Baede et al., 2015; Bogaerts et al.,
2015; Bortolaia et al., 2014; Trott, 2013), což poukazuje na význam zvířat chovaných ze záliby v komplexní
epidemiologii AmpC beta-laktamáz.
Prevalence CMY-2 v populaci komenzálních izolátů enterobakterií z potravinových zvířat se
pohybuje v širokém rozmezí 0,01–88 % (Smet et al., 2010a). Rozdíly jsou dané pravděpodobně
charakterem epidemiologie v jednotlivých oblastech případně dalšími faktory včetně selekčního tlaku
specifických skupin antibiotik. Vliv antimikrobiální terapie na selekci bakterií nesoucích AmpC
dokumentovala studie v USA (Donaldson et al., 2006). Na farmě mléčného skotu s frekventovaným
použitím ceftiofuru pro léčbu respiračních onemocnění telat prokázali vysokou prevalenci E. coli s
produkcí CMY-2 (88 %). Z České republiky je dostupná studie zabývající se výskytem AmpC u E. coli z
jatečných krůt a kuřat, která uvádí velice nízkou prevalenci (≤ 0,01 %) CMY-2 enzymu (Kolar et al. 2010).
48
Záchyt CMY-2 u bakterií z volně žijících zvířat poukazuje na obecné rozšíření této beta-laktamázy
(Jamborova et al. 201526
; Loncaric et al., 2013; Poirel et al., 2012d; Stalder et al., 2014).
5.1.4 Karbapenemázy
Rezistence ke karbapenemům je považována za jeden z nejzávažnějších mechanizmů rezistence,
který významně limituje terapeutické možnosti nozokomiálních infekcí vyvolaných multirezistentími
bakteriemi (Papp-Wallace et al., 2011). Podobně jako ostatní beta-laktamázy štěpí karbapenemázy
beta-laktamový kruh antibiotika a jako donor molekuly vody potřebné pro reakci je využíván serinový
zbytek (serinové beta-laktamázy) nebo kationty zinku (metalo-beta-laktamázy). Producenti
karbapenemáz hydrolyzují prakticky všechna beta-laktamová antibiotika a obvykle nejsou inhibováni
terapeuticky dostupnými inhibitory. Často produkují další typy beta-laktamáz a vykazují rezistenci
k několika antibiotickým skupinám. Podobně jako v epidemiologii ESBL je i pro šíření karbapenemáz
zásadní jejich vazba na MGE a částečně také sdružení s úspěšnými bakteriálními klony.
5.1.4.1 Charakteristika metalo-beta-laktamáz
Metalo-beta-laktamázy (MBL) náleží do molekulární třídy B. Vykazují hydrolytickou aktivitu vůči
všem penicilinům, cefalosporinům a karbapenemům kromě monobaktamů a aztreonamu. Nejsou
inhibovány kyselinou klavulanovou, sulbaktamem a tazobaktamem. Tento typ beta-laktamáz se nachází
inherentně na chromozomu u některých bakterií, např. Bacillus spp. (Lim et al., 1988), Stenotrophomonas
maltophilia (Saino et al., 1982), Aeromonas spp. (Iaconis a Sanders, 1990) a dalších. První získaná MBL,
karbapenemáza IMP, byla prokázána u P. aeruginosa v Japonsku (Osano et al., 1994). Brzy poté byly MBL
detekovány také u Enterobacteriaceae, kdy byl v Japonsku izolován kmen S. marcescens s IMP-1 (Ito et
al., 1995). MBL byly zpočátku nacházeny především u pseudomonád a acinetobakterů, v posledním
desetiletí však dochází k jejich celosvětovému šíření především u zástupců čeledi Enterobacteriaceae
(Papagiannitsis et al., 2015c28
).
Nejvýznamnější získané MBL představují IMP, VIM a NDM (Dortet et al., 2014b; Nordmann et al.,
2012a; Walsh et al., 2005), zatímco jiné jako GIM a SIM se vyskytují spíše sporadicky u acinetobakterů a
pseudomonád (Castanheira et al., 2004; Gupta et al., 2012; Lee et al., 2005). Enterobakterie produkující
MBL jsou v některých státech velmi rozšířené. Jsou zde odpovědné za menší i rozsáhlejší epidemie
ve zdravotnických zařízeních (Nordmann et al., 2012a). Geny pro karbapenemázy IMP a VIM jsou obvykle
přítomny v bakteriálním genomu ve formě genové kazety integronů třídy 1 nesené různými typy plazmidů
(Papagiannitsis et al., 2015c28
; Zhao a Hu, 2011a, b), které hrají významnou roli v jejich šíření. Potenciál
karbapenemáz je možné dokumentovat na příkladu nové MBL popsané v roce 2008 u pacienta
49
ve Švédsku (Yong et al., 2009), která byla pojmenována podle předpokládaného (a později potvrzeného)
místa původu v hlavním městě Indii jako „New-Delhi Metallo-beta-lactamase“, zkráceně NDM. Jedná se
o jednu z klinicky nejvýznamnějších karbapenemáz, která byla za několik let od prvního záchytu
dokumentována po celém světě (Berrazeg et al., 2014). Je rozšířena především u nemocničních kmenů
K. pneumoniae a E. coli (Nordmann a Poirel, 2014). Na šíření této karbapenemázy se podílí nejrůznější
typy plazmidů (Nordmann a Poirel, 2014; Studentova et al., 201527
). Problematika MGE v šíření
karbapenemáz bude stručně popsána v kapitole 7.10.
5.1.4.2 Charakteristika karbapenemáz molekulární třídy A
Karbapenámy této skupiny náleží mezi serinové beta-laktamázy. Mají schopnost hydrolyzovat
peniciliny, cefalosporiny, karbapenemy a aztreonam a jsou citlivé k inhibitorům beta-laktamáz. Tato třída
zahrnuje karbapenemázy KPC, SME, GES a IMI/NMC. Jednotliví zástupci se liší různou mírou
karbapenemázové aktivity. První dokumentovanou karbapenemázou této skupiny byla SME-1
identifikována u S. marcescens ve Velké Británii v roce 1982 (Queenan a Bush, 2007). SME, NMC a IMI
jsou dokumentovány zřídka, což pravděpodobně souvisí s lokací kódujících genů na chromozomu.
Karbapenemáza KPC vykazuje vysokou karbapenemázovou aktivitu a je z této skupiny enzymů
nejvýznamnější. Je kódována přenosnými plazmidy a frekventně dokumentována u nemocničních kmenů
K. pneumoniae a jiných druhů čeledi Enterobacteriaceae, dále u P. aeruginosa a A. baumannii (Canton et
al., 2012a). Karbapenemáza GES byla popsána ve formě genové kazety integronu nesené konjugativními
plazmidy P. aeruginosa a K. pneumoniae (Queenan a Bush, 2007).
5.1.4.3 Charakteristika karbapenemáz molekulární třídy D
Molekulární třída D zahrnuje téměř 500 sekvenčních variant beta-laktamázy OXA,
karbapenemázovou aktivitou však disponují pouze některé z nich. Většina karbapenemáz skupiny OXA
byla identifikována u acinetobakterů a pseudomonád, u kterých jsou kódující geny lokalizovány
na chromozomu nebo neseny mobilními genetickými elementy. U zástupců Enterobacteriaceae
(především E. coli a K. pneumoniae) jsou nejrozšířenějšími karbapenemázami této skupiny enzymy
OXA-48 (Nordmann a Poirel, 2014). Byla popsána řada sekvenčních variant odvozených od OXA-48, např.
OXA-181, OXA-16 a OXA-204 (Kasap et al., 2013; Potron et al., 2011, 2013). Karbapenemázy skupiny
OXA-48 vykazují vysokou hydrolytickou aktivitu vůči penicilinům, zatímco aktivita vůči karbapenemům a
širokospektrým cefalosporinům je nízká (Walther-Rasmussen a Hoiby, 2006).
50
5.1.4.4 Metody detekce producentů karbapenemáz
Přesná a včasná diagnostika producentů karbapenemáz je základním předpokladem úspěšné
léčby infekce. Je rovněž nezbytná pro implementaci preventivních opatření pro zabránění jejich dalšího
šíření (Temkin et al., 2014). V současnosti existuje řada metod založená na detekci fenotypu a genotypu.
Pro odhalení potenciálních producentů se využívá výsledek kvalitativního nebo kvantitativního
stanovení citlivosti ke karbapenemům a srovnání s doporučenými hraničními hodnotami
(„breakpointy”) uvedenými v metodických listech European Committee for Antimicrobial Susceptibility
Testing (EUCAST, 2016) a Clinical and Laboratory Standards Institute (CLSI, 2015). Producenti
karbapenemáz vykazují sníženou citlivost alespoň k jednomu z karbapenemů (imipenemu, meropenemu
nebo ertapenemu). Hraniční hodnoty pro klinickou rezistenci se výrazně odlišují od hodnot
epidemiologických předělů (ECOFF – „epidemiological cut-off”). Hodnota ECOFF vychází ze standardního
rozložení MIC v populaci sledované bakterie. Z klinického pohledu jsou kmeny E. coli a K. pneumoniae
citlivé k meropenemu dosahují-li hodnoty MIC ≤ 2 mg/l, zatímco ECOFF operuje s hodnotou ≤ 0,125 mg/l.
Pro vyhledávání producentů karbapenemáz používají komerčně dostupné selektivní půdy, které však
selhávají při odhalování variant s nízkou karbapenemázovou aktivitou (např. OXA-48 a IMP). Produkci
karbapenemáz u suspektních kmenů je nutné potvrdit specifickými metodami.
Mezi základní metody pro detekci karbapenemázy využívané v diagnostických laboratořích patří
metody fenotypové, které jsou založené na schopnosti některých látek, např. EDTA a kyseliny fenylborité,
inhibovat tyto enzymy (Giske et al., 2011). Jejich specifita je však nízká a nejsou vhodné pro průkaz
některých karbapenemáz (např. OXA-48). Další skupinu tvoří testy založené na detekci hydrolýzy
karbapenemu, které jsou považovány za vysoce citlivé a specifické. Zahrnují např. Test CarbaNP, který
využívá kolorimetrické vizualizace hydrolýzy imipenemu (Dortet et al., 2012; Nordmann et al., 2012b).
Jeho výhodou je možnost detekce producentů karbapenemáz přímo v klinickém materiálu (Dortet et al.,
2014a). Další metoda vykazující vysokou specifitu a citlivost je založena na průkazu degradačních
produktů pomocí MALDI-TOF hmotnostní spektrometrie, která je schopná odlišit od sebe základní klinicky
významné karbapenemázy (Hrabak et al., 2011a). Molekulárně-genetické metody využívají PCR detekci
kódujících genů (Cole et al., 2009; Monteiro et al., 2012) nebo DNA mikročipy (Bogaerts et al., 2011).
5.1.4.5 Molekulární epidemiologie producentů karbapenemáz
Problematika karbapenemáz je dnes sledována především u enterobakterií. Z evropských zemí
jsou nejvyšší prevalence producentů karbapenemáz dokumentovány v Řecku a Itálii. Další státy, ve
kterých jsou karbapenemázy rozšířené, zahrnují Francii, Polsko, Německo a Velkou Británii. Producenti
karbapenemáz jsou odpovědní za menší i rozsáhlé nemocniční „outbreaky” (Canton et al. 2014). Byli
51
sporadicky izolováni také u hospitalizovaných pacientů v České republice, nicméně jejich celkový výskyt
je i nadále nízký (Canton et al., 2012a; Hrabak et al., 2015). Nejčastější celosvětově rozšířené skupiny
karbapenemáz u humánních izolátů představují metalo-beta-laktamázy IMP, NDM a VIM a
karbapenemázy KPC a OXA-48.
NDM je nejvýznamnější karbapenemázou vůbec. V současné době dochází k jejímu
celosvětovému šíření z endemických oblastí na indickém subkontinentu, kde je prevalence nosičství
producentů NDM odhadována na 5–15 %. Producenti NDM zde byli izolováni také z půdy a vody (Walsh
et al., 2011). Prostředí je tedy považováno za významný faktor v epidemiologii NDM v Indii. Sekundární
rezervoáry představují Balkán, Arabský poloostrov a severní Afrika (Nordmann a Poirel, 2014). Za úspěch
NDM je mimo jiné zodpovědná vazba na různé typy vysoce konjugativních plazmidů a asociace s geny
rezistence k různým skupinám antibiotik, které podporují selekci producentů této karbapenemázy
(Nordmann et al., 2012a).
Celosvětově je popisována také karbapenemáza KPC-2, jejíž šíření je spojeno především s vazbou
na epidemicky úspěšný rizikový klon K. pneumoniae ST258 (Temkin et al., 2014). Endemické oblasti
KPC-2 představují Řecko a Itálie (Nordmann a Poirel, 2014). Producenti OXA-48 byli spojeni s řadou
nemocničních „outbreaků“ například v Polsku a Turecku (Arana et al., 2015; Cuzon et al., 2011;
Dautzenberg et al., 2014; Kola et al., 2015; Voulgari et al., 2013). Za pravděpodobný zdroj jsou
považovány státy severní Afriky, Turecko a Indie (Nordmann a Poirel, 2014; Poirel et al., 2012e). Menší
„outbreaky“ byly popsány i v českých nemocnicích (J. Hrabák, LF UK v Plzni, osobní sdělení).
Varianta VIM-2 se endemicky šíří v jižní Evropě a jihovýchodní Asii, dále také v Africe a v některých
evropských zemích. VIM-1 je frekventovaná především u izolátů K. pneumoniae v řeckých nemocnicích
(Papagiannitsis et al., 201632
; Papagiannitsis et al., 2015a; Zhao a Hu, 2011a). Karbapenemáza IMP se
vyskytuje endemicky na asijském kontinentu, zejména v Japonsku, Číně a na Taiwanu, z Evropských zemí
je nejčastěji dokumentována v Řecku. Předpokládá se, že k primární selekci izolátů s IMP došlo před jejich
celosvětovým rozšířením v Japonsku jako důsledek vysoké spotřeby karbapenemů (Nordmann a Poirel,
2014; Zhao a Hu, 2011b).
5.1.4.6 Producenti karbapenemáz u zvířat a v prostředí
Šíření enterobakterií s produkcí karbapenemáz mimo nemocnice do zdravé lidské populace,
ke zvířatům a do prostředí se stalo v posledních letech aktuálním tématem (EFSA, 2013). Role vodního
prostředí v šíření karbapenemáz byla zdokumentována v zemích s celkově špatnými hygienickými
podmínkami a nedostatečnou sanitací (Walsh et al., 2011). Ojedinělé záchyty enterobakterií
produkujících karbapenemázy v odpadních vodách nebo ve vodních tocích byly hlášeny také v Evropě
52
(Galler et al., 2014; Poirel et al., 2012a). Byly popsány i případy izolace E. coli a K. pneumoniae s NDM-1
nebo OXA-48 u psů a koček v Německu a USA (Shaheen et al., 2013; Stolle et al., 2013). Izoláty E. coli a
Salmonella spp. s VIM-1 byly sporadicky nalezeny v rámci aktivní surveillance u drůbeže a prasat
v Německu (Fischer et al., 2012, 2013a). Ve všech případech se s nejvyšší pravděpodobností jedná
o kmeny humánního původu. Rizika šíření producentů karbapenemáz mimo nemocnice by nemělo být
podceňováno. Nicméně ve vědecké komunitě převažuje názor, že k jejich masivní šíření ke zvířatům, jak
bylo sledováno v případě CTX-M beta-laktamáz, v budoucnu nedojde (EFSA, 2013; Poirel et al., 2014).
Vzhledem ke klinické závažnosti tohoto rezistentního mechanizmu zahájila EU monitoring producentů
karbapenemáz v chovech potravinových zvířat. V rámci tohoto programu nebyli doposud žádní
producenti karbapenemáz dokumentováni (EFSA, 2016).
První případ izolace producentů karbapenemáz u volně žijících zvířat byl popsán v Německu.
Jednalo se o izolát Salmonella Corvalis s NDM-1 z dravého ptáka luňáka obecného (Fischer et al., 2013b).
Monitoringu šíření karbapenemáz do prostředí a k volně žijícím zvířatům se věnujeme na našem
pracovišti od roku 2013. Testování obsáhlého souboru 3 000 izolátů gramnegativních bakterií ze vzorků
trusu různých druhů volně žijících zvířat přineslo pozitivní výsledky. V jedné z největších hnízdních kolonií
racků australských (Chroicocephalus novaehollandiae) v Novém Jižním Walesu v Austrálii byly prokázány
izoláty E. coli s produkcí metalo-betalaktamázy IMP-4 (Dolejska et al., 201630
). Tato studie dokumentuje
masivní šíření karbapenemáz do prostředí v této oblasti. Další záchyty různých druhů enterobakterií
nesoucí geny karbapenemáz KPC a IMP byly pozorovány u vrány americké v USA a Kanadě (M. Dolejská
et al., nepublikovaná data).
53
5.2 Mechanizmy rezistence k fluorochinolonům
Fluorochinolony jsou důležitými antibiotiky pro léčbu infekcí člověka i zvířat. V humánní medicíně
jsou lékem volby při shigelóze a těžkých formách salmonelových infekcí. Nárůst spotřeby fluorochinolonů
byl následován rychlým vzestupem a šířením rezistentních mikrobů. Z pohledu antimikrobiální rezistence
patří flurochinolony k nejrizikovějším skupinám antibiotik, jelikož rezistence k nim vzniká velice rychle
(Hooper a Rubinstein, 2003). V Evropě je v rámci mezinárodních programů sledována rezistence k FQ
u vybraných zástupců Enterobacteriaceae humánního i veterinárního původu (E. coli, K. pneumoniae,
Salmonella enterica), která je obecně vysoká a vykazuje rostoucí charakter (EARS-Net; EFSA, 2016).
Při zavedení chinolonů do klinické praxe se předpokládalo, že riziko rozvoje rezistence bude malé.
Tyto domněnky vycházely ze dvou faktů. K náhodným mutacím dochází ve frekvencích < 10-7
, tudíž
pravděpodobnost vzniku mnohonásobných mutací (10-14
–10-16
), které by vedly k rezistentnímu fenotypu,
se zdála být velmi nízkou (Zhao et al., 1997). Zároveň jsou chinolony plně syntetickými preparáty, a proto
se existence genů rezistence k této skupině antimikrobiálních látek u rezervoárů v prostředí rovněž
nepředpokládala (Robicsek et al., 2006). Opak je ale pravdou a rezistence k fluorochinolonům se stala
velice běžnou, celosvětově rozšířenou a často také sdruženou s rezistencí ke klinicky významným
beta-laktamům. U gramnegativních bakterií byly později identifikovány také horizontálně přenosné
mechanizmy rezistence k fluorochinolonům. Rezistence k této skupině antimikrobiálních látek dnes
představuje tíživý a rostoucí medicínský problém.
Byla popsána řada funkčně vzdálených mechanizmů rezistence k chinolonům (Obr. 12). Jedná se
o mechanizmy kódované bakteriálních chromozomem, případně jsou geny pro rezistenci neseny
plazmidy. Bakterie mohou měnit podobu cílových struktur chinolonů, tvořit proteiny chránící zásahová
místa antibiotika, omezit propustnost povrchových struktur buňky nebo antibiotikum z buňky aktivně
odčerpávat prostřednictvím efluxních pump. Mohou rovněž disponovat mechanizmem enzymatické
inaktivace antibiotika. Častá je také současná přítomnost několika mechanizmů u jedné bakteriální buňky,
což se může výrazně odrazit ve výsledném fenotypu rezistence. Pro rezistenci k chinolonům je také
typické, že vzniká poměrně rychle po krátkodobém působení antibiotika, ke kterému může dojít i během
antibiotické léčby zejména při podávání nízkých dávek (Hooper a Rubinstein, 2003).
V následujících odstavcích budou jednotlivé mechanizmy rezistence k fluorochinolonům stručně
představeny. Bude popsán jejich genetický základ a objasněn pravděpodobný původ. Důraz bude kladen
na rezistenci kódovanou plazmidy z důvodu jejího potenciálu šíření horizontální cestou. Kapitola bude
doplněna o stručnou informaci k současnému rozšíření plazmidy kódované rezistence
k fluorochinolonům u humánních i veterinárních izolátů včetně několika původních prací autora.
54
5.2.1 Chromozomální mechanizmy rezistence k fluorochinolonům
5.2.1.1 Změny na úrovni buněčných membrán a aktivní eflux
Chinolony musí při svém vstupu do buňky překonat buněčné povrchy bakteriální buňky, tj.
buněčnou stěnu, plazmatickou membránu a v případě gramnegativních bakterií navíc i vnější membránu.
Vnější membrána je tvořena z fosfolipidové vrstvy a z lipopolysacharidů. Hydrofobní chinolony vstupují
do bakteriální buňky obvykle prostou difuzí, zatímco hydrofilní chinolony využívají nespecifických
proteinových kanálků porinů. Bylo prokázáno, že bakterie s přirozenou rezistencí k chinolonům disponují
modifikovanou lipopolysacharidovou vrstvou vnější membrány, která znemožňuje difuzi hydrofobních
látek včetně chinolonů (Hooper a Rubinstein, 2003). Získané mechanizmy rezistence na úrovni
plazmatické membrány zahrnují snížení počtů porinů, změnu jejich konformace, náhradu primární
struktury porinů nebo nadprodukci efluxních pump (Ruiz, 2003).
Mechanizmy rezistence spojené s poriny jsou dané regulací exprese kódujících genů nebo přímo
změnou primární struktury porinu. V případě E. coli byly popsány poriny OmpF a OmpC, které představují
nespecifické difuzní proteiny vnější membrány. Mutace v genu ompF vedou ke snížení počtu porinů
OmpF, a tím ke ztrátě schopnosti akumulace chinolonů uvnitř bakteriální buňky (Bryskier, 2005).
Rezistence může být také spojena s negativní regulací exprese genu ompF prostřednictvím malé
nekódující MicF RNA (Schmidt et al., 1995).
Obr. 12: Mechanizmy rezistence k chinolonům
Vytvořeno podle Aldred et al., 2014.
(1) Chromozomální rezistence podmíněná mutací v genech pro gyrázy/topoizomerázy IV (charakteristická struktura
enzymu je označena barevně – červená-modrá-zelená). Cílová struktura je v takto změněné podobě necitlivá
k chinolonu.
(2) Plazmidy determinovaná rezistence. (2a) Tvorba Qnr proteinů (označen žlutě), které chrání cílová místa DNA před
účinkem chinolonů. (2b) Enzymatická inaktivace chinolonu acetyltransferázou AAC(6’)-Ib-cr. (2c) Tvorba efluxních
pump, které snižují koncentraci antibiotika v buňce.
(3) Chromozomálně podmíněná rezistence. (3a) Snížená exprese porinů vedoucí k poklesu příjmu antibiotika. (3b)
Zvýšená exprese efluxních pump kódovaných chromozomálními geny.
55
Efluxní pumpy jsou struktury, které z bakteriální buňky aktivně odčerpávají různé molekuly
bez nutnosti jejich chemické modifikace. Bylo popsáno několik typů efluxních pump, z nichž nejdůležitější
zahrnují ABC, RND, MSF, SMR a MATE (vysvětlení zkratek a bližší popis viz Nikaido, 1996). Nejčastějším a
nejvíce prostudovaným transportérem u E. coli je třísložkový systém AcrAB-TolC z rodiny RND, který
na rozdíl od ostatních systémů zajišťuje transport z vnitra buňky až do extracelulárního prostoru (Kumar
a Schweizer, 2005). Změna exprese složek této pumpy je zároveň spojena s bakteriální rezistencí
k fluorochinolonům (Obr. 13).
Obr. 13: Mechanizmus rezistence k fluorochinolonům na úrovni buněčných membrán zprostředkovaný
efluxními pumpami a poriny
Vytvořeno podle Lindgren et al., 2003; Piddock, 2002. AcrAB-TolC pumpa je tvořena třemi složkami zahrnujícími efluxní
protein AcrB, protein AcrA, který zajišťuje spojení s vnější membránou, ve které se nachází třetí složka TolC. Exprese genu
acrAB je regulována represorem AcrR a pozitivním regulátorem MarA. Gen kódující tento pozitivní regulátor je součástí
marRAB operonu. Byl popsán mechanizmus, při kterém mutace regulačního genu snižuje expresi porinu a zároveň zvyšuje
aktivitu efluxní pumpy. Konkrétně se jedná o mutace v genu marR vedoucí ke zvýšené expresi operonu a nadprodukci
aktivátoru MarA. Zvýšené množství aktivátoru má za následek zvýšení exprese acrAB (a tím nárůst efluxního proteinu
AcrB) a současný pokles syntézy OmpF. Tento mechanizmus vede jednak ke sníženému příjmu antibiotika a dále k jeho
aktivnímu vylučování z buňky efluxní pumpou.
U gramnegativních bakterií bylo popsáno několik dalších efluxních systémů odpovědných
za rezistenci k chinolonům, několik systémů byla nalezena také u bakterií grampozitivních. Z hlediska
rezistence k fluorochinolonům mají efluxní systémy význam pouze v kombinaci s dalšími mechanizmy,
např. mutacemi v cílových enzymech a změnou v propustnosti plazmatické membrány (Hooper a
Rubinstein, 2003). Efluxní pumpy kódované geny na plazmidech byly rovněž dokumentovány a budou
blíže představeny v kapitole 5.2.2.
56
5.2.1.2 Mutace cílových struktur chinolonů
Chromozomálně zakotvená rezistence k chinolonům může u gramnegativních bakterií vznikat
v důsledku bodových mutací v genech kódujících topoizomerázu II; mutace v topoizomeráze IV spojené
s rezistencí jsou méně časté. Mutace vedou ke změně primární struktury enzymu, což má za následek
snížení specifity cílového místa pro navázání antibiotika. K těmto mutačním změnám dochází v tzv.
oblastech určujících rezistenci k chinolonům (QRDR – „quinolone resistance-determining region”), které
se vyskytují v blízkosti aktivního centra enzymu (Tyr122) interagujícího s DNA. Stupeň rezistence je závislý
na místě mutace a substituované aminokyselině. U kmenů gramnegativních bakterií rezistentních
k chinolonům jsou dokumentovány změny především v podjednotce GyrA, změny v GyrB jsou méně časté
a jsou obvykle spojeny pouze s nízkou hladinou rezistence. Oblast QRDR GyrA se nachází mezi kodony 67
a 106. Nejčastější mutace spojené s vysokým stupněm rezistence probíhají v pozicích 83 a 87 (Hooper a
Rubinstein, 2003; Saenz et al., 2003). V souvislosti s rezistencí k fluorochinolonům byly dokumentovány i
mutace v genu parC. Ty se u izolátů gramnegativních bakterií s vysokou hladinou rezistence nachází
především v kombinaci s mutacemi gyrA. Cílovými místy substitucí v ParC spojených s rezistencí
k fluorochinolonům jsou u E. coli nejčastěji Ser80 a Glu84. Mutace parE se u gramnegativních bakterií
vyskytuje velice zřídka a není obvykle spojena s klinickou rezistencí (Hooper a Rubinstein, 2003). Přehled
nejčastěji popisovaných mutací QRDR u E. coli a jejich vztah k hladině rezistence k chinolonům je uveden
v Tab. 6.
Tab. 6: Příklady substitucí v QRDR topoizomeráz u izolátů E. coli v kontextu rezistence k chinolonům
Data převzata z Minarini a Darini, 2012; Vila et al., 1994. Nejčastěji popisované mutace u E. coli rezistentní
k fluorochinolonům jsou šedě podbarveny. Klinická rezistence podle EUCASTu nebo CLSI k ciprofloxacinu je > 1–2 mg/l a
kyselině nalidixové ≥ 32 mg/l. CIP, ciprofloxacin; NAL, kyselina nalidixová; nt, nebylo testováno.
MIC (mg/l)
GyrA
ParC
CIP NAL Ser83 Asp87 Ser80 Glu84
0,007 2 - - - -
0,06–1 nt - Gly - -
0,03–8 64– > 512 Leu - - -
1 nt Leu Gly - -
1 nt Leu Asn - -
2 nt Leu Tyr Ile -
2– > 128 nt Leu Asn Ile -
4 nt Leu - Arg -
8–64 > 512 Leu Asn - -
8–128 > 512 Leu Tyr - -
8 nt Leu Gly Ile -
16–32 nt Leu Asn Ile Ala/Lys
32– > 128 nt Leu Asn Ile Gly
64 nt Leu Asn Arg -
57
5.2.2 Plazmidy determinovaná rezistence k fluorochinolonům (PMQR)
Pro rezistenci kódovanou geny na plazmidech je v odborné literatuře používán zkrácený název
PMQR („plasmid-mediated quinolone resistance“). Existence mechanizmů rezistence k chinolonům
vázaná na MGE byla v minulosti považována za velice nepravděpodobnou. Rychlost s jakou se rezistence
k fluorochinolonům mezi bakteriemi ve světě rozšiřovala však neodpovídala matematickým modelům
předpokládané četnosti mutací v gyrA a parC. Tato zjištění vedla k hlubším úvahám o existenci plazmidy
determinovaných mechanizmů. V 70. letech byla vyšetřena rozsáhlá sbírka plazmidů, ale žádný
mechanizmus rezistence k chinolonům vázaný na plazmidy nebyl popsán (Burman, 1977). Studie z roku
1987 sice popisuje PMQR u Shigella dysenteriae (Munshi et al., 1987), později se však zjistilo, že rezistence
k chinolonům je u tohoto kmene spojena s chromozomálními mutacemi (Rahman et al., 1994). Původně
se předpokládalo, že plazmidy by mohly nést mutované geny gyrA podobné těm, které byly dříve
identifikovány na bakteriálním chromozomu. Takovéto plazmidy byly připraveny experimentálně
v laboratoři, bylo ale pojeny pouze s drobným nárůstem MIC k chinolonům (Gomez-Gomez et al., 1997).
Jejich přirozený výskyt u bakterií nebyl prokázán.
Fenomén rezistence k chinolonům byl objasněn až v roce 1998 s průkazem plazmidem neseného
genu qnrA (Martinez-Martinez et al., 1998). Tento první popis byl následován objevem mnoha dalších
genů se schopností se přenášet horizontální cestou. Dosud popsané PMQR mechanizmy zahrnují Qnr
proteiny, enzymatickou inakvitaci antibiotika acetyltransferázou AAC(6’)-Ib-cr a efluxní pumpy QepA a
OqxAB.
5.2.2.1 Qnr proteiny
Qnr proteiny náleží do rodiny proteinů s pentapeptidovým repetitivním motivem, přičemž počet
těchto motivů se v rámci jednotlivých rodin Qnr proteinů liší (Vetting et al., 2006). Do současnosti bylo
popsáno 6 rodin Qnr proteinů (QnrA, QnrB, QnrC, QnrD, QnrS, QnrVC), dá se ale předpokládat existence
dalších dosud neobjevených typů. Rezistence k fluorochinolonům zprostředkovaná Qnr proteiny spočívá
v ochraně cílových molekul chinolonů. Qnr proteiny se vážou k DNA gyráze a snižují tak počet zásahových
struktur chinolonů (Robicsek et al., 2006). Přesný mechanizmus protektivního účinku Qnr proteinů však
nebyl zcela objasněn. Předpokládá se, že dochází ke změně struktury vazebného místa chinolonů, proto
není antibiotikem rozpoznáno nebo se mění vazebná schopnost DNA gyrázy k DNA (Poirel et al., 2012c).
Nomenklatura Qnr proteinů
Z důvodu narůstajícího počtu popisovaných qnr genů byla stanovena pravidla jejich klasifikace a
pojmenovávání nových sekvenčních variant. Třídění do rodin je založeno na odlišnostech
58
v aminokyselinové sekvenci proteinu Qnr. Hranice pro zařazení proteinu do stejné Qnr rodiny je
minimálně 70 % podobnost. Rozdíly v aminokyselinové sekvenci v rámci rodiny dávají za vznik novým
variantám, např. QnrA1, QnrA2 atd. (Jacoby et al., 2008). Byla vytvořena databáze
(http://www.lahey.org/qnrStudies/), jejíž správci zajištují přidělování názvů nově popsaným qnr genům a
zároveň evidují aktuální seznamy popsaných variant. V současné době tato databáze čítá 105 variant genu
qnr (ke dni 23. 2. 2016).
Proteiny skupiny QnrA
QnrA byl prvním popsaným PMQR nalezeným u klinického izolátů K. pneumoniae. Kódující gen
qnrA1 byl nesen na plazmidu pMG252 (Martinez-Martinez et al., 1998). QnrA je tvořen
218 aminokyselinovými zbytky. Původně se předpokládalo, že gen qnrA je vysoce konzervativní. Později
však byla u izolátu Klebsiella oxytoca z Číny popsána další varianta qnrA2, která se liší od qnrA1
ve 4 aminokyselinách (Nordmann a Poirel, 2005). Další tři variaty qnrA3-5 byly nalezeny na chromozomu
Shewanella algae (Poirel et al., 2005), následoval popis qnrA6 u Proteus mirabilis (Cambau et al., 2006) a
poslední varianta qnrA7 byla identifikovaná u S. algae v Číně (viz databáze
http://www.lahey.org/qnrStudies/).
Proteiny skupiny QnrB
QnrB jsou vysoce heterogenní skupinou, která k dnešnímu dni (23. 2. 2016) čítá 80 sekvenčních
variant (http://www.lahey.org/qnrStudies/). První gen qnrB byl popsán skupinou G. Jacobyho (Jacoby et
al., 2006). Při studiu sbírky K. pneumoniae z Indie pozorovali horizontální přenos nízké hladiny rezistence
k chinolonům na recipientní kmeny. V té době jediný známý PMQR gen qnrA však neprokázali (Strahilevitz
et al., 2009). Zjistili přítomnost nového genu, který byl pojmenován qnrB1. Geny qnrB obvykle obsahují
dva iniciační kodony ATG, u některých variant však první kodon chybí. Z tohoto důvodu se popsané
proteiny QnrB liší v délce, která čítá 214 nebo 226 aminokyselinových zbytků. Pro popis nových variant je
zohledňována pouze oblast proteinu ohraničená druhým iniciačním kodonem (Jacoby et al., 2008).
S QnrA a QnrS sdílí QnrB přibližně 40 % podobnost sekvence aminokyselin.
Proteiny skupiny QnrS
Gen qnrS byl poprvé identifikován na konjugativním plazmidu u kmene Shigella flexneri
izolovaného v roce 2003 v Japonsku (Hata et al., 2005). Je přepisován do proteinu QnrS o délce
218 aminokyselinových zbytků (Robicsek et al., 2006). S první identifikovanou variantou QnrA sdílí 59 %
podobnost proteinové sekvence. Doposud bylo popsáno jeho 9 variant
59
(http://www.lahey.org/qnrStudies/, ke dni 20. 2. 2016), přičemž kosmopolitní rozšíření vykazují pouze
QnrS1 a QnrS2. Gen qnrS1 je typický spíše pro zástupce čeledi Enterobacteriaceae (převážně E. coli a
Salmonella), zatímco qnrS2 se zdá být vázán na aeromonády (Dobiasova et al., 201433
; Dobiasova et al.,
201529
; Jamborova et al., 201526
; Literak et al., 201213
; Tausova et al. 201210
; Wasyl et al., 2014). Současná
epidemiologie naznačuje šíření těchto genů u zvířat a v prostředí.
Ostatní Qnr proteiny
Další varianty Qnr proteinů jsou v bakteriálních populacích méně časté v porovnání s výše
popsanými variantami. QnrC je tvořen 221 aminokyselinami a byl poprvé identifikován u klinického izolátu
P. mirabilis v Číně. Kódující gen byl nesen konjugativním plazmidem pHS9 (Wang et al., 2009a). Geny qnrC
se vyskytují v nízké prevalenci a zdají se být vysoce konzervativní. Prozatím byla nalezena pouze jediná
varianta genu (http://www.lahey.org/qnrStudies/, ke dni 23. 2. 2016).
QnrD byl identifikován u humánních izolátů Salmonella Kentucky a S. Bovismorbificans. Protein
je tvořen 214 aminokyselinovými zbytky. Gen qnrD (dnes přejmenován na qnrD1) byl lokalizován
na malém nekonjugativním plazmidu (Cavaco et al., 2009). Nedávno byla popsána nová sekvenční
varianta qnrD2 u humánního izolátu S. Hadar ve Švýcarsku (Abgottspon et al., 2014).
Kódující geny proteinu QnrVC byly zjištěny na chromozomu izolátu Vibrio cholerae z roku 1998.
Tyto PMQR determinant řadíme mezi atypické členy Qnr rodiny (Fonseca et al., 2008). Proti ostatním qnr
genům se qnrVC vyskytují ve formě genové kazety integronů. Nefunkční varianta tohoto genu byla
nalezena také na plazmidu (Fonseca et al. 2008). Kromě vibrií byly identifikovány u jiných skupin
gramnegativních bakterií vázaných na vodní prostředí, jako jsou aeromonády a pseudomonády (Fonseca
a Vicente, 2013; Pons et al., 2013). Sporadicky byly také zjištěny u enterobakterií (Tacao et al., 2014).
V současné době je známo 6 sekvenčních variant (http://www.lahey.org/qnrStudies/, ke dni 23. 2. 2016).
5.2.2.2 Aminoglykozidová N-acetyltransferáza AAC(6’)-Ib-cr
AAC(6’)-Ib-cr je prvním popsaným bifunkčním enzymem, který je schopný modifikovat strukturně
odlišná antibiotika – aminoglykozidy a fluorochinolony. Gen aac(6’)-Ib-cr byl popsán v roce 2006 jako
sekvenční varianta genu aac(6’)-Ib kódující aminoglykozidovou N-acetyltransferázu. Tento enzym
katalyzuje acetylaci aminoglykozidů tobramycinu, amikacinu a kanamycinu vedoucí ke ztrátě jejich
antimikrobiální aktivity. Acetylace probíhá na aminoskupině piperazylinového substituentu ciprofloxacinu
a norfloxacinu. Chinolony bez N-piperazinylového substituentu tedy nejsou k účinku tohoto enzymu
citlivé. Bylo popsáno přes 30 variant genu aac(6’)-Ib, rezistence k chinolonům je však spojena s typickou
záměnou ve dvou kodonech. Sekvenční analýza genu aac(6’)-Ib-cr prokázala mutace vedoucí k substituci
60
aminokyselin Trp102Arg a Asp179Tyr. Substituce Asp179Tyr zvyšuje afinitu k substrátu a má tedy zásadní
význam při vazbě chinolonu, zatímco záměna Trp102Arg slouží spíše ke stabilizaci. AAC(6’)-Ib-cr zajišťuje
nižší hladinu rezistence k fluorochinolonům v porovnání s proteiny Qnr (Robicsek et al., 2006). Gen
aac(6’)-Ib-cr se vyskytuje ve formě kazety integronů třídy 1 a v současné době je rozšířen především díky
asociaci s geny pro ESBL na společných plazmidech (Dolejska et al., 201212
; Jacoby et al., 2014).
5.2.2.3 Efluxní pumpy QepA a OqxAB
Efluxní pumpy QepA a OqxAB zajištují rezistenci aktivním odčerpáváním antibiotika z buňky.
Kódující geny OqxAB byly poprvé popsány na konjugativním plazmidu pOLA52 u izolátu E. coli z prostředí
prasečí farmy (Sorensen et al., 2003). Později byl gen oqxAB nalezen na plazmidu u humánního klinického
izolátu E. coli v Jižní Koreji a také na chromozomu K. pneumoniae (Kim et al., 2009). Náleží do rodiny RND
(„resistance-nodulation-cell division”) a zajišťuje odčerpávání chinoxacilinového derivátu olaquindoxu,
který byl dlouhodobě používán jako antibiotický růstový stimulátor v chovech prasat. Jedná se
o multifunkční pumpu, která přenáší další molekuly včetně chloramfenikolu (Hansen et al., 2007; Hansen
et al., 2004).
Efluxní pumpa QepA náleží do rodiny MFS („major facilitator superfamily“) a je posledním
popsaným genem PMQR. Je tvořena 551 aminokyselinovými zbytky a podmiňuje rezistenci k hydrofilním
fluorochinolonům. Gen qepA1 byl identifikován na plazmidu pHA u klinického izolátu E. coli v Japonsku
(Yamane et al., 2007). Sekvenční analýza plazmidu prokázala, že se v blízkosti genu qepA1 nachází gen
rmtB kódující 16S rRNA metylázu, která podmiňuje rezistenci k aminoglykozidům, tyto dva typy rezistence
jsou tedy často přítomné společně. Druhá později popsaná varianta QepA2 obsahuje záměnu dvou
aminokyselin, substrátová specifita pumpy je však identická s QepA1 (Cattoir et al., 2008c). Gen qepA se
vyskytuje v nízké prevalenci (Jacoby et al., 2014).
5.2.3 Původ genů PMQR a jejich biologická role
Narůstající prevalence a výskyt nových variant genů qnr iniciovalo hledání jejich původu. Podobně
jako u jiných mechanizmů rezistence se předpokládala existence rezervoárů v prostředí. Pátrání vyústilo
v první nález genu qnrA3 u S. algae, která obývá sladkovodní a mořské prostředí. Gen qnrA3 byl
lokalizován na chromozomu, nebyl obklopen žádnými MGE a zároveň vykazoval obsah bazí G+C
charakteristický pro rod Shewanella, což podpořilo domněnku, že se u této bakterie vyskytuje přirozeně
(Poirel et al., 2005). Byl také popsán v genomu dalších bakteriálních druhů jako Vibrio parahaemolyticus
a Photobacterium profundum (Saga et al., 2005). Výsledky analýz blízkého okolí genu qnrA3 u S. algae,
61
které se shodovalo s klinickými izoláty, ukazuje na původ tohoto genu u Schewanella spp. a příbuzných
bakterií (Lascols et al., 2008).
Další důkazy o původu PMQR přinesla in silico analýza genomu Vibrio splendidus, u kterého byl
prokázán úsek kódující protein s vysokou podobností sekvence aminokyselin s proteiny QnrS1 a QnrS2
(Cattoir et al., 2007). Nízké hladiny chinolonů nalezené v povrchových vodách pravděpodobně přispívají
k udržování rezervoárů PMQR genů u vodních mikroorganizmů, které tak mohou v prostředí
kontaminovaném antibiotikem získat určitou selekční výhodu (Al-Ahmad et al., 1999; Batt et al., 2006;
Strahilevitz et al., 2009; Tamtam et al., 2008). Varianty genu qnrS jsou často nalézány na plazmidech
vodních bakterií jako Aeromonas spp. (Cattoir et al., 2008b; Dobiasova et al., 201433
), které mohou
ve vodním prostředí představovat zdroj genů pro významné patogeny člověka.
Geny vykazující vysokou sekvenční homologii s genem qnrB byly nalezeny u mořských bakterií
(Sanchez et al., 2008; Venter et al., 2004). Za rezervoár qnrB genů pro humánní klinické izoláty je
považován Citrobacter spp., v jehož genomu byly identifikovány různé varianty tohoto genu. Tento
bakteriální druh je rozšířen ve vodním prostředí a zároveň patří mezi významné oportunní patogeny
člověka (Jacoby et al., 2011). Zdroj PMQR genů kódujících efluxní pumpy nebyl zcela objasněn.
Za původce se předpokládají zástupci Actinomycetales, jelikož membránové transportéry této skupiny
bakterií vykazují významnou sekvenční homologii s pumpou QepA a zároveň obsah G+C bazí kódujícího
genu qepA je blízký aktinomycetám (Poirel et al., 2012c).
Předpokládá se, že předci qnr genů u bakterií v prostředí plní vlastní biologickou úlohu než čistě
ochranu před inhibičním účinkem chinolonů. Jedna z hypotéz tvrdí, že Qnr by mohly sloužit jako antitoxin
chránící DNA gyrázu a topoizomerázu IV před účinkem přirozeně se vyskytujících toxinů těchto enzymů
(Ellington a Woodford, 2006). V sekvenci genu qnrB bylo nalezeno vazebné místo pro protein LexA, který
se účastní SOS odpovědi (Wang et al., 2009b). Qnr proteiny by tak mohly hrát úlohu v ochraně DNA.
5.2.4 Klinický význam PMQR
Samotná přítomnost genu qnr je spojena pouze s mírným navýšením MIC k chinolonům, která
nepřesahuje hraniční hodnoty definované pro klinickou rezistenci (Obr. 14). Míra navýšení MIC je závislá
na mnoha faktorech, které zahrnují typ PMQR genu, počet kopií a transkripční aktivita genu, typ chinolonu
a další. Přítomnost Qnr proteinů je obecně spojena s vyšším nárůstem hodnoty MIC vůči ciprofloxacinu
(nárůst MIC 8–32krát) v porovnání s kyselinou nalidixovou (2–4krát). Míra navýšení MIC spojená
s AAC(6’)-Ib-cr nebo QepA je nižší v porovnání s proteiny Qnr (Strahilevitz et al., 2009). Příklady hodnot
MIC ciprofloxacinu popsaných u kmenů E. coli a Salmonella enterica nesoucích různé skupiny PMQR
determinant jsou uvedeny v Tab. 7.
62
Výše uvedené charakteristiky spojené s PMQR tedy přináší otázku jejich vlastního klinického
významu tohoto mechanizmu rezistence. Přítomnost PMQR genu usnadňuje tvorbu spontánních mutací
v chromozomálních genech pro topoizomerázu II, což vede ke vzniku klinické rezistence k FQ (MartinezMartinez
et al., 1998). To je možné vysvětlit tím, že izoláty nesoucí PMQR již disponují jistou mírou
odolnosti vůči fluorochinolonům a snadněji tak podléhají in vivo selekci přídatných chromozomálních
mechanizmů rezistence během antimikrobiální léčby (Nordmann a Poirel, 2005). Tento fenomén je blíže
vysvětlen v následující kapitole. Význam PMQR také souvisí s jejich schopností se efektivně šířit
horizontální cestou mezi bakteriemi. Z klinického hlediska je také důležité, že většina plazmidů nesoucích
PMQR geny je zároveň sdružena s geny rezistence k dalším antibiotikům včetně cefalosporinů nebo
karbapenemů. Získáním genu PMQR tak může recipientní bakterie nabýt profilu multirezistence (Jacoby
et al., 2014).
Obr. 14: Distribuce MIC ciprofloxacinu v populaci E. coli
Upraveno podle Canton a Morosini, 2011. S, citlivý: R, rezistentní. Izoláty (červené), které přesahují hodnotu
MIC > 1 mg/l (na základě hraničních hodnot EUCAST) nebo > 2 mg/l (podle CLSI) jsou z klinického hlediska hodnoceny jako
rezistentní k ciprofloxacinu. Populace s klinickou citlivostí k ciprofloxacinu však zahrnuje také izoláty se sníženou citlivostí
(MIC v rozmezí 0,05–1 nebo 0,05–2 mg/l). Izoláty (žluté) s hodnotou MIC nad ECOFF (> 0,05 mg/l) jsou tedy považovány
za rezistentní z mikrobiologického hlediska. Takovéto izoláty obvykle nesou jednobodové mutace v gyrA nebo plazmidově
determinovanou rezistenci, která není spojena s rezistencí z klinického pohledu. Klinická rezistence je naopak spojena
s minimálně dvěma mutacemi v gyrA nebo kombinací mutací gyrA a parC. Zcela citlivá populace (zelená) má hodnoty MIC
pod hladinou ECOFF.
63
Tab. 7: Vliv PMQR genů a jejich kombinací s chromozomálními mutacemi gyrA nebo parC na hodnoty MIC
a MPC ciprofloxacinu
Bakteriální druh
Mechanizmus rezistence Ciprofloxacin (mg/l)
PMQR Mutace gyrA/parC MIC MPC
E. coli - - 0,002 1
- gyrA 0,125 4
qnrA - 0,125 8
qnrA gyrA 0,5 16
qnrB - 0,125 2
qnrB gyrA 0,5 8
qnrS1 - 0,125 4
qnrS1 gyrA 1 8
Salmonella enterica
ser. Typhimurium
- - 0,015 0,125
- parC 0,015 0,125
- gyrA 0,25 2–4
- parC+gyrA 4 64
aac(6')-Ib-cr - 0,06 1
aac(6')-Ib-cr parC 0,06 1
aac(6')-Ib-cr gyrA 1 8–16
aac(6')-Ib-cr parC+gyrA 16 128
qepA - 0,125 2
qepA parC 0,125 2
qepA gyrA 2 32
qepA parC+gyrA 16 128
qnrB4 - 0,5 4
qnrB4 parC 0,5 4
qnrB4 gyrA 1–2 16–32
qnrB4 parC+gyrA 8 64
qnrS1 - 0,5 2
qnrS1 parC 0,5 2
qnrS1 gyrA 1 8–16
qnrS1 parC+gyrA 8 64
Upraveno podle Canton a Morosini, 2011. PMQR, plazmidy determinovaná rezistence k chinolonům; MIC, minimální
inhibiční koncentrace; MPC, mutačně preventivní koncentrace. Problematika MPC je vysvětlena v kapitole 5.2.5.
5.2.5 PMQR a mutačně selekční koncentrace
Ke stanovení in vitro citlivosti k antimikrobiální látce se začal využívat parametr tzv. mutačně
preventivní koncentrace MPC („mutation prevention concentration”). MPC je definována jako nejnižší
koncentrace antibiotika potřebná k inhibici růstu nejméně citlivé buňky ve vysoce denzních bakteriálních
populacích (populace s koncentrací buněk okolo 1010
). V praxi pak hodnota MPC umožňuje stanovit
pravděpodobnost selekce rezistentních bakterií v průběhu terapie antibiotiky (Blondeau, 2009).
V případě, že koncentrace chinolonu přesahuje MPC, je nízké riziko vzniku buněk s jednobodovými
mutacemi (Obr. 15). Experimentálně bylo však prokázáno, že přítomnost qnr genu významně zvyšuje
hodnotu MPC. Například přítomnost qnrA je odpovědná za více než desetinásobné navýšení této
hodnoty. Nízká hladina rezistence spojená s přítomností qnr genu pravděpodobně neumožní bakteriální
64
populaci přežít inhibiční účinek chinolonu, ale významně navýší počet mutantů s vysokou hladinou
rezistence. Přítomnost genu qnr tedy hraje pro buňku významnou úlohu pro vznik klinické rezistence
k chinolonům v důsledku tvorby bodových mutacích v genech pro gyrázu a topoizomerázu. Závěrem je
tedy možné konstatovat, že klinický důsledek přítomnosti PMQR genů spočívá v navýšení MIC chinolonů
a rozšíření mutačně selekčního okna, společně vedoucí ke sníženého terapeutického účinku chinolonů
(Jacoby et al., 2014; Poirel et al., 2008a; Poirel et al., 2006; Walsh et al., 2005).
Obr. 15: Vliv koncentrace antibiotika na selekci rezistentních mutant
Upraveno podle Canton a Morosini, 2011. MPC, mutačně-preventivní koncentrace; MIC, minimální inhibiční koncentrace;
c, koncentrace antibiotika v mg/l; T, čas v hodinách. Křivky A–C reprezentují kinetiku antibiotika v makroorganizmu v čase
během antimikrobiální léčby. Složení bakteriální populace při dané terapeutické dávce je znázorněno ve čtvercích. Křivka
C - koncentrace antibiotika je pod hodnotou MIC a složení mikrobiální populace se nemění. Křivka B - koncentrace
antibiotika nedosahuje hodnoty MPC a nachází se v oblasti mutačně-selekčního okna. Při této koncentraci antibiotika
v makroorganizmu tedy dochází k selekci rezistentních mutant. Křivka A - koncentrace antibiotika převyšuje hodnotu
MPC, růst citlivých bakterií je inhibován a riziko selekce rezistentních mutant je nízké.
5.2.6 Metody detekce bakterií s PMQR
Jelikož je přítomnost PMQR genů u bakterií spojena pouze s mírným navýšením MIC
k chinolonům, unikají naší pozornosti při laboratorní diagnostice. Klinická rezistence k ciprofloxacinu je
definována hodnotou > 1 mg/l nebo 2 mg/l. Exprese genů PMQR mírně navyšuje MIC ciprofloxacinu
na 0,06–0,2 mg/l, tedy na hodnotu výrazně pod hraničními hodnotami pro klinickou rezistenci. Bakteriální
izoláty s MIC nad hodnotou ECOFF (> 0,05 mg/l) je nutné považovat za potenciální nositele plazmidy
A
B
C
Populace
bez antibiotika
Populace v přítomnosti
antibiotika
Mutačně selekční okno
Buňka rezistentní k antibiotiku
Buňka citlivá k antibiotiku
Koncentraceantibiotika(mg/l)
Čas (h)
65
determinované rezistence k chinolonům. Vyšetřením antimikrobiální citlivosti diskovým difuzním testem
nebo mikrodiluční metodou neumožňuje tyto izoláty odhalit a ty jsou pak chybně interpretovány jako
citlivé k fluorochinolonům. Další komplikací v detekci jsou časté kombinace různých mechanizmů
rezistence k fluorochinolonům, kterými je například současná přítomnost genu PMQR a mutace genů
v QRDR oblasti kódující gyrázu. Chromozomální mutace výrazně navyšují MIC a mohou tak maskovat
přítomnost PMQR genu. V detekci PMQR mechanizmů nachází uplatnění především metody molekulární
biologie jako multiplex PCR doplněné stanovením primární sekvence genu (Ciesielczuk et al., 2013).
V běžných klinických laboratořích se z důvodu časové a technické náročnosti a diskutabilního klinického
významu nepoužívají. Detekce PMQR genů se provádí spíše pro epidemiologické účely.
5.2.7 Charakteristické vlastnosti izolátů s PMQR
Epidemiologie genů PMQR je v určitém ohledu podobná té, která je dnes popisována
pro širokospektré beta-laktamázy. Podobně jako kmeny produkující ESBL i izoláty enterobakterií nesoucí
geny PMQR jsou obvykle multirezistentní. Kromě fluorochinolonů často odolávají beta-laktamům,
aminoglykozidům, chloramfenikolu, tetracyklinu, sulfonamidům, trimetoprimu a rifampicinu. Plazmidově
kódovaná rezistence k fluorochinolonům je také sdružena s klinicky významnými přenosnými
mechanizmy rezistence zahrnující ESBL, AmpC nebo karbapenemázy. Obecně tedy platí, že
u multirezistentních izolátů jsou geny PMQR častější a zároveň izoláty nesoucí PMQR obvykle disponují
dalšími mechanizmy rezistence k chinolonům, zejména mutacemi v genech kódujících gyrázu. Šíření
PMQR není až na drobné výjimky spojeno se specifickými epidemickými klony, jak je tomu v případě ESBL.
Mezi nejčastěji dokumentované PMQR s kosmopolitním rozšířením patří qnrB1, qnrB19, qnrS1 a
aac(6’)-Ib-cr. Ostatní PMQR geny se vyskytují sporadicky nebo jsou spojeny s určitými oblastmi,
především s asijským kontinentem (Jacoby et al., 2014; Manuel Rodriguez-Martinez et al., 2011).
Geny PMQR byly identifikovány u různých zástupců čeledi Enterobacteriaceae v různých
geografických oblastech a zdrojích. Výskyt genů PMQR u enterobakterií celosvětově narůstá (Strahilevitz
et al., 2009), nicméně stanovení hodnoty přesné prevalence není možné hned z několika důvodů. Jak bylo
výše diskutováno, v klinických laboratořích jsou využívány pro stanovení citlivosti k antibiotikům převážně
metody fenotypové, které od sebe nemohou jednotlivé mechanizmy rezistence k chinolonům odlišit.
Použití různých kritérií při výběru izolátů pro screening genů PMQR, která zúžují výchozí soubor vzorků,
také znesnadňuje činit závěry o jejich prevalenci (Jacoby et al., 2014).
PMQR geny jsou asociovány s nejrůznějšími typy mobilních genetických elementů zahrnujících
zejména integrony, inzerční sekvence a plazmidy. Plazmidy nesoucí geny PMQR dosahují variabilní
velikosti 7-320 kb a náleží do různých tříd (Dobiasova et al., 201529
, 201634
; Dolejska et al., 2013a,b14,17
).
66
Varianty qnrA a qnrB se typicky vyskytují na velkých multirezistentních konjugativních plazmidech v okolí
inzerční sekvence ISCR1. Tyto plazmidy zároveň nesou některé z beta-laktamáz SHV-12, CTX-M-9,
CTX-M-14, FOX-5, DHA-1, IMP-4 nebo KPC-3. Naopak geny qnrD byly popsány pouze na malých
mobilizovatelných plazmidech, které nenesou žádnou přídatnou rezistenci (Carattoli, 2013; Dolejska et
al. 2013a17
; Jacoby et al., 2014; Strahilevitz et al., 2009).
5.2.8 Výskyt PMQR u člověka, zvířat a v prostředí
Prevalence genů PMQR je u humánních klinických izolátů odhadována na přibližně 10 %. Mezi
různými enterobakteriálními druhy z nozokomiálních i komunitních infekcí dominují varianty qnrB a
aac(6’)-Ib-cr. Hlavními nositeli jsou K. pneumoniae, Enterobacter spp., E. coli a Salmonella enterica (Jacoby
et al., 2014). Klinické izoláty nesoucí PMQR obvykle disponují multirezistentním fenotypem, produkují
ESBL nebo náleží k významné epidemické linii (např. E. coli ST131 sdružená s aac(6’)-Ib-cr). Častá je
zejména asociace aac(6’)-Ib-cr s genem blaCTX-M-15 u klinických izolátů E. coli z důvodu jejich společné
lokace na multirezistentních plazmidech (Dolejska et al., 2011b9
; Jacoby et al., 2014). Výskytu PMQR genů
v běžné střevní mikroflóře 530 zdravých dětí různých věkových skupin se věnovala naše recentní práce.
Selektivní izolací na médiu s ciprofloxacinem (0,05 mg/l) byl identifikován pouze jediný izolát E. coli
s genem qnrS1 (Literak et al., 20117
). Dominantní výskyt PMQR u nozokomiálních kmenů potvrdila naše
studie zaměřená na pediatrické onkologické pacienty ve Fakultní nemocnici Brno. Dvě třetiny
multirezistentních kmenů Enterobacteriaceae produkujících ESBL zároveň nesly PMQR gen. Častá byla
kombinace dvou genů zároveň, konkrétně variant qnrB1 a aac(6’)-Ib-cr (Dolejska et al., 201212
).
Geny PMQR jsou dokumentovány také u potravinových zvířat zejména u drůbeže (Jones-Dias et
al., 2013; Li et al., 2014; Szmolka et al., 2011; Veldman et al., 2011). Nejvýznamnější práci v této oblasti
představuje recentní panevropská studie (Veldman et al., 2011). Rozsáhlý soubor izolátů Salmonella
enterica a E. coli pocházející z člověka, potravinových zvířat, potravin a prostředí z 13 evropských zemí byl
v této studii vyšetřen na přítomnost genů PMQR. Frekventovaný výskyt genů qnrB a qnrS byl pozorován
zejména u různých serovarů Salmonella enterica z krůt. V České republice byly PMQR geny
dokumentovány u izolátů E. coli z jateční drůbeže (Literak et al., 201316
) a z prostředí krůtích farem
(M. Röderová et al., LF UP v Olomouci, nepublikovaná data). Soubor kmenů z jateční drůbeže navíc
obsahoval multirezistentní kmeny ExPEC (Literak et al., 201316
). V chovech drůbeže představují
fluorochinolony antibiotika s nejvyšší spotřebou a jejich terapeutické či profylaktické použití vede k selekci
rezistentních kmenů. Drůbež je považována za pravděpodobný rezervoár kmenů s vysokou hladinou
rezistence k fluorochinolonům spojenou jak s mutacemi v gyrázách a topoizomerázách tak s geny PMQR.
Potravní řetězec může tedy do jisté míry přispívat k přenosu těchto kmenů ke člověku.
67
Enterobakterie nesoucí geny PMQR byly izolovány i v běžné střevní mikroflóře volně žijících zvířat.
Ve 37 % vzorků trusu synantropních havranů polních odebraných v devíti hnízdních lokalitách v rámci
Evropy byly nalezeny enterobakterie s geny PMQR (Literak et al., 201213
). V rámci lokalit byly
zaznamenány velké rozdíly v prevalenci těchto genů, nejvyšší byla sledována v České republice (60 %),
naopak žádný PMQR gen nebyl zachycen na hnízdišti ve Švýcarsku. Rozdílné výsledky byly ovlivněny spíše
charakterem dané lokality (přítomnost významných zdrojů v prostředí) než jejich obecným rozšířením
v dané zemi. Nejfrekventovanější byla varianta qnrS1. Podobná studie byla realizována u příbuzného
druhu vrány americké v USA dokumentující vyšší prevalenci v porovnání s Evropou, která v jednotlivých
lokalitách dosahovala 33-81 % (Halova et al., 2014). Rovněž spektrum jednotlivých PMQR genů se lišilo a
významně dominoval gen qnrB různých alelových variant. PMQR izoláty byly v minulosti také
identifikovány z volně žijících druhů vodních ptáků (Literak et al., 2010a4
; Tausova et al., 201210
; Veldman
et al., 2013). Kontaminované vodní prostředí je tedy nutné považovat za možný zdroj těchto determinant
rezistence. Výše uvedené práce dokumentují významné šíření plazmidově nesené rezistence
k chinolonům do životního prostředí.
68
69
6. Mobilní genetické
elementy v šíření
rezistence
70
71
Horizontální přenos genů (HGT) je proces, při kterém dochází k fyzickému přesunu DNA z jedné
buňky do druhé bez nutnosti buněčného dělení. Přenos je následován začleněním této genetické
informace do genomu recipientní buňky. V literatuře se rovněž setkáváme s pojmem laterární přenos
(LGT – „lateral gene transfer”), který vyjadřuje prakticky totéž. HGT představuje odlišný proces
v porovnání s přenosem vertikální cestou, při kterém je genetická informace předávána z rodičů na
potomky. HGT překonává nejrůznější bariéry přenosu související například s časovou, geografickou a
fylogenetickou vzdáleností. Tok genů může probíhat i mezi nepříbuznými prokaryotickými buňkami a také
napříč taxonomickými doménami (z bakteriálních do eukaryotických buněk a obráceně). Přenos genů je
zprostředkován vektory – mobilními genetickými elementy. Jedná se o elementy různého typu disponující
rozmanitou strukturou a způsoby přenosu. MGE mají obrovský dopad na složení a velikost bakteriálního
genomu a významně přispívají k adaptaci bakterií.
Mikroorganizmy disponují schopností přizpůsobit se životu v nejrůznějších ekologických nikách,
mimo jiné díky rychlé a efektivní výměně genetické informace. Přenos genů horizontální cestou do určité
míry kompenzuje jinak vysoce klonální charakter života prokaryotických organizmů a má významné
dopady na jejich adaptaci a evoluci (Ochman a Wilson, 1987). Bylo prokázáno, že 17 % genomu E. coli a
Salmonella bylo za posledních 100 miliónů let získáno v důsledku HGT (Lawrence a Ochman, 1998). HGT
má za důsledek tzv. mozaikový charakter bakteriálních genomů. Tyto genomy jsou tvořeny variabilními
úseky DNA, které byly získány od různých předků v různých časových bodech během evoluce. Tento
proces umožňuje bakteriím získat řadu vysoce výhodných vlastností. Přenos a začlenění fragmentu DNA
kódujícího virulenci může změnit komenzální kmen E. coli na patogenní v jednom jediném kroku.
V případě získání genů rezistence k antibiotikům se jedná o přesmyk z kmene původně citlivého
k antibiotikům na kmen rezistentní.
Horizontální přenos genů zprostředkovaný mobilními genetickými elementy má dnes významnou
úlohu zejména v procesu vzniku, evoluce a šíření antimikrobiální rezistence se závažnými dopady
na zdraví člověka a zvířat. Následující kapitoly jsou věnovány toku genů v bakteriálních populacích
s důrazem na geny rezistence k antibiotikům, jeho zákonitostem a mechanizmům, kterými probíhá.
Budou představeny jednotlivé typy MGE gramnegativních bakterií, bude popsána jejich struktura a
mechanizmus přenosu mezi genomy. Největší pozornost bude věnována plazmidům, které představují
nejefektivnější elementy v šíření antibiotické rezistence.
72
6.1 Horizontální přenos genů u bakterií
Přenos genetické informace z jednoho genomu na druhý probíhá v několika dílčích krocích.
V první řadě musí být připravena nukleová kyselina (DNA nebo RNA) k vlastnímu přenosu. Tento krok
může být spojen s nejrůznějšími mechanizmy s ohledem na typ přenosu a charakter přenášené molekuly.
Zahrnuje například sbalení nukleové kyseliny do fágové hlavičky v případě přenosu pomocí bakteriofága,
replikaci plazmidu při přenosu plazmidové DNA konjugací nebo pasivní uvolnění DNA do okolního
prostředí v důsledku buněčné lýze. Přípravný krok je následován vlastním přenosem, který může, jako
tomu je v případě bakteriální konjugace, vyžadovat fyzický kontakt buněk dárce a příjemce. Aby se tato
přenesená nukleová kyselina stala součástí recipientní bakterie a mohla být předávána do další generace,
musí v dalším kroku dojít k její stabilizaci v recipientní buňce. To je umožněno jejím začleněním
do cílového genomu homologní rekombinací nebo transpozicí. Získaná genetická informace se může
v buňce udržovat také v podobě samostatně se replikujícího elementu (Thomas a Nielsen, 2005).
Mechanizmy přenosu DNA mezi bakteriemi horizontální cestou zahrnují transformaci, transdukci
a konjugaci a jsou graficky znázorněny na Obr. 16.
Obr. 16: Horizontální přenos genetické informace transdukcí (A), konjugací (B) a transformací (C)
Upraveno podle Gyles a Boerlin, 2014. (A) Transdukce vyžaduje přenos DNA zprostředkovaný bakteriofágem. Po kontaktu
fága s recipientní buňkou dochází k injekci DNA do recipientní buňky. (B) MGE v podobě plazmidu je přenášen z jedné
buňky do druhé konjugací, která vyžaduje fyzický kontakt buněk zprostředkovaný pily. Gen přenášený konjugací v podobě
plazmidu se může začlenit do chromozomu recipientní bakterie (1) nebo zůstane volně v cytoplazmě v podobě
samostatně se replikující jednotky (2). Může také dojít k výměně dílčích genů/inzerčních sekvencí a transpozonů
s bakteriálním chromozomem (3) nebo jiným plazmidem přítomným v buňce (4). (C) Transformace je zprostředkována
příjmem volné DNA (v lineární nebo kružnicové podobě) z okolního prostředí.
73
6.1.1 Transformace
Jedná se o příjem volné molekuly (případně fragmentu DNA) z okolního prostředí následovaný
jejím stabilním začleněním do genomu recipientní buňky. DNA se do prostředí dostává obvykle jako
důsledek lýze bakteriální buňky při buněčné smrti. Transformace byla popsána v roce 1928 F. Griffithem
(Griffith, 1928) jako přirozený proces (přirozená transformace) některých druhů bakterií. Transformace je
rovněž jedním ze základních nástrojů molekulární genetiky. Je využívána jako technika v oblasti genového
inženýrství pro přenos genetického materiálu do prokaryotických i eukaryotických buněk. V takovém
případě mluvíme o transformaci umělé. Bez ohledu na typ transformace je recipientní bakterie, která
přijala volnou DNA, označována jako transformant (Mascaretti, 2003; Snyder a Champness, 2007). Proces
transformace je schematicky znázorněn na Obr. 17.
Obr. 17: Přesun fragmentu DNA (A) nebo plazmidu (B) do recipientní bakteriální buňky transformací
Vytvořeno podle Snyder a Champness, 2007.
Pro příjem cizorodé DNA musí být buňka kompetentní, tj. ve stavu, kdy jsou přítomné receptory
DNA na buněčném povrchu a proteiny specifické pro transformaci. Stav kompetence může být pro řadu
mikroorganizmů přirozený (přirozená kompetence) nebo může být navozen uměle v laboratorních
podmínkách (umělá kompetence). Byla popsána řada klinicky významných grampozitivních (např. Bacillus
DNA fragmenty
chromozom
příjem DNA fragmentu
integrace DNA
rekombinací
rozklad DNA
stabilní
transformace
nestabilní
transformace
stabilní
transformace
příjem plazmidu
plazmid
chromozom
74
subtilis, Streptococcus pneumoniae, E. faecalis) a gramnegativních bakterií (např. Neisseria spp.,
Acinetobacter spp., Pseudomonas spp., Aeromonas spp., Campylobacter spp., E. coli) schopných
přirozené transformace (Baur et al., 1996; Mascaretti, 2003; Snyder a Champness, 2007).
Přijatá DNA může sloužit jako zdroj uhlíku a dusíku, k opravě vlastní poškozené DNA nebo může
být začleněna do genomu buňky rekombinací jako alternativa pohlavního rozmnožování eukaryot vedoucí
ke zvýšení diverzity a zrychlení evoluce (Mascaretti, 2003; Snyder a Champness, 2007). Toto téma
přehledně shrnuje recentní publikace Seitze a Blokescheho (Seitz a Blokesch, 2013).
6.1.1.1 Úloha transformace v šíření rezistence k antibiotikům
Transformované geny mohou být zdrojem výhodných vlastností včetně rezistence k antibiotikům.
Byl prokázán přenos úseku chromozomální DNA spojené s rezistencí k meticilinu (SCCmecII) do buněk
S. aureus (Morikawa et al., 2012) nebo získání mobilního genetického elementu a genů udílející profil
multirezistence u Acinetobacter baylyi procesem transformace (Domingues et al., 2012b; Perron et al.,
2012). Transformace je rovněž významným mechanizmem v přenosu rezistence k penicilinu u důležitých
humánních patogenů Neisseria meningitidis a N. gonorrhoeae (Spratt et al., 1992).
Transformace má význam především ve vodním prostředí s vysokou koncentrací bakterií a volné
DNA lyzovaných buněk jakým je například odpadní voda (Dodd, 2012). Schopnost přirozené transformace
v podmínkách přirozených vodních ekosystémů byla experimentálně prokázána také u E. coli (Baur et al.,
1996).
6.1.2 Transdukce
Přenos genetického materiálu z jedné bakteriální buňky do druhé zprostředkovaný
bakteriofágem se nazývá transdukce. Bakteriofágy, neboli viry bakterií, byly první zkoumané organizmy
pro jejich využití v molekulární biologii. Genom bakteriofágů se skládá z jednovláknové nebo
dvouvláknové DNA nebo RNA a dosahuje velikosti jednotek až stovek kilobazí. Virulentní bakteriofágy
po pomnožení v bakteriální buňce vyvolávají její lýzi, zatímco životní cyklus temperovaného bakteriofága
zahrnuje nelytickou fázi zvanou lyzogenie. Při tomto procesu dochází k začlenění genetické informace
fága do bakteriálního chromozomu ve formě profága (Mascaretti, 2003; Snyder a Champness, 2007).
Transdukce byla popsána v roce 1952 Zinderem a Lederbergem (Zinder, 1955). Tvorba virových
partikulí při lytickém cyklu bakteriofága, který mimo jiné zahrnuje balení virové DNA do fágové hlavičky,
je vysoce specializovaný proces. V některých případech však může dojít k chybnému sbalení části
bakteriální DNA chromozomální či plazmidové. Při infekci další bakteriální buňky tímto fágem se uvolněná
bakteriální DNA může začlenit do chromozomu bakterie rekombinací nebo transpozicí. Pokud se do
75
fágové hlavičky sbalil plazmid, tak se po uvolnění v recipientní bakteriální buňce může samostatně
replikovat. Buňka, která přijala DNA transdukcí, se nazývá transduktant (Mascaretti, 2003; Snyder a
Champness, 2007).
6.1.2.1 Úloha transdukce v šíření rezistence k antibiotikům
Význam bakteriofágů v přenosu nejrůznějších genů S. aureus byl zdokumentován už v 60. letech
(Dowell a Rosenblum, 1962). Transdukce je u této patogenní bakterie nejvýznamnějším mechanizmem
horizontálního přenosu genů rezistence k různým skupinám antibiotik včetně meticilinu (Cohen a
Sweeney, 1970; Maslanova et al., 2013). Hraje také důležitou roli v šíření virulentního potenciálu (Suzuki
et al., 2012).
Fágy jsou považovány za nejpočetnější mikroorganizmy v prostředí zahrnující oceány, jezera,
půdu a rovněž místa ovlivněná člověkem jako například čistírny odpadních vod (Brown-Jaque et al., 2015;
Calero-Caceres et al., 2014; Parsley et al., 2010). V těchto ekosystémech dosahují několikanásobně vyšší
koncentrace v porovnání s bakteriemi a jsou zde schopné dlouhodobě přežívat a odolávat nepříznivým
faktorům vnějšího prostředí (Muniesa et al., 2013). Geny rezistence k chinolonům (qnrA, qnrS) a
beta-laktamovým antibiotikům (blaSHV, blaTEM, blaCTX-M) byly nalezeny ve vzorcích fágové DNA izolované
z městských odpadních vod, v říční vodě a odpadní vodě z hospodářské produkce (Colomer-Lluch et al.,
2011a; Colomer-Lluch et al., 2011b, 2014; Marti et al., 2014; Parsley et al., 2010). Tyto práce svědčí
o významu transdukce v přenosu klinicky významné rezistence k antibiotikům.
Fágové partikule nesoucí geny rezistence byly také nalezeny ve střevním mikrobiomu člověka
(Minot et al., 2011; Modi et al., 2013; Quiros et al., 2014) a v plicích (Fancello et al., 2011). Možný význam
transdukce v přenosu rezistence k antibiotikům v potravním řetězci dokumentuje recentní studie, která
prokázala přítomnost bakteriofágů s geny rezistence ke kanamycinu, chloramfenikolu a ampicilinu
v kuřecím mase (Shousha et al., 2015).
6.1.3 Konjugace
Přenos genetické informace konjugací je proces pohybu DNA z jedné buňky do druhé. Na rozdíl
od transformace a transdukce tedy vyžaduje přímý kontakt těchto dvou buněk. Buňka, která je dárcem
DNA ve formě plazmidu, se označuje jako donorová, zatímco buňka, do které se tato DNA přenáší, se
nazývá recipientní. Pro recipientní buňku, která přijala DNA procesem konjugace, se používá termín
transkonjugant (Snyder a Champness, 2007).
Proces bakteriální konjugace byl popsán v roce 1947 (Lederberg a Tatum, 1953). Bylo
pozorováno, že smíchání dvou různých kmenů E. coli vedlo ke vzniku kmenů s odlišným genetickým
76
profilem než měly buňky původní. V té době se však o existenci plazmidů nevědělo a přesný mechanizmus
konjugace byl proto objasněn až později. Plazmidy schopné přenosu konjugací se označují jako
konjugativní. Konjugativní plazmidy byly identifikovány u mnoha druhů bakterií i archeí a rovněž
u některých eukaryotických buněk. Z gramnegativních bakterií jsou nejlépe prostudovány u E. coli a
Pseudomonas spp., z grampozitivů potom u Enterococcus spp., Streptococcus spp., Staphylococcus spp.,
Bacillus spp. a Streptomyces spp. (Dale a Park, 2004).
Většina konjugativních plazmidů se přenáší pouze mezi úzce příbuznými druhy bakterií. Byla
zdokumentována existence různých plazmidů schopných pohybu mezi prokaryotickou a eukaryotickou
buňkou. Příkladem je Ti plazmid bakterie Agrobacterium tumefaciens, který se přenáší do rostlinných
buněk (Snyder a Champness, 2007). Dále byly popsány IncP plazmidy schopné konjugativní výměny
mezi E. coli a Saccharomyces cerevisiae (Bates et al., 1998).
Bakteriální konjugace je zdrojem genetické variability bakterií a je také nejdůležitějším nástrojem
šíření genů rezistence k antibiotikům v bakteriálních populacích. Mechanizmu konjugativního přenosu
plazmidů a úloze těchto plazmidů v šíření rezistence k antibiotikům bude podrobně věnována kapitola
6.5.8.
6.2 Mobilní genetické elementy
Chromozom představuje hlavní zásobárnu genetického materiálu bakteriální buňky. Nese
veškeré esenciální geny pro zajištění základních životních funkcí. Většina bakterií navíc disponuje
přídatnou genetickou informací ve formě mobilních genetických elementů. Tyto elementy představují
extrachromozomální úseky DNA, které poskytují buňce další výhodné vlastnosti. Některé typy MGE mají
schopnost se začlenit do bakteriálního chromozomu, proto výše uvedená definice není zcela přesná.
Mobilní genetické elementy jsou lépe charakterizovány jako úseky DNA, které zajišťují pohyb genetické
informace v rámci genomů jedné buňky (intracelulární přenos) nebo mezi buňkami (intercelulární
přenos). Byly nalezeny prakticky ve všech dosud popsaných prokaryotických genomech. Intercelulární
pohyb zajišťují výše popsané procesy transformace, transdukce a konjugace. Přesuny v rámci buňky pak
zprostředkovávají transponázy a místně specifické rekombinázy kódované těmito elementy spolu se
systémem homologní rekombinace hostitelské buňky. Tyto procesy pak vedou k delecím, inzercím a jiným
typům přesmyku genetického materiálu.
Mobilní genetické elementy mají zásadní úlohu v evoluci bakterií. Mohou nést geny kódující
faktory virulence, rezistenci k antibiotikům, dezinfekčním látkám, vysoké teplotě, geny pro produkci
toxinů, enzymů degradujících různé polutanty v prostředí a další funkce.
77
Následující kapitoly představují výčet MGE, které hrají důležitou roli v šíření rezistence
k antibiotikům. Soustředí se především na charakteristiku jednotlivých typů těchto elementů, na popis
jejich struktury a mechanizmů jejich šíření mezi genomy. Podrobnější informace k mobilním genetickým
elementům důležitým v epidemiologii ESBL se pak věnuje kapitola 7.
6.2.1 Inzerční sekvence
Inzerční sekvence (IS) jsou nejjednodušší a nejpočetnější mobilní genetické elementy
s významnou úlohou na utváření genomu hostitelské buňky. Mají schopnost se začleňovat do různých
míst genomu mechanizmem, který nevyžaduje sekvenční homologii s cílovou oblastí. Dosahují velikosti
750-2000 bp a obsahují jeden nebo dva čtecí rámce. Obvykle se vyskytují v genomu ve vysokém počtu
kopií. Kódují pouze enzym transponázu pro vlastní přenos, čímž se odlišují od složitějších transpozonů
nesoucích další přídatné geny (Siguier et al., 2006a).
Struktura IS je schematicky znázorněna na Obr. 18A. Až na drobné výjimky je na obou koncích
ohraničena dvěma terminálními obrácenými repeticemi (IR) o délce 10 až 40 bp, repeticí levou
(IRL – „inverted repeat left”) a pravou (IRR – „inverted repeat right”). Obě obrácené repetice obsahují
dvě domény rozpoznávané transponázou. Doména I představuje štěpné místo, zatímco doména II místo
vazebné. IRL navíc obsahuje promotor genu transponázy. Celá výše popsaná struktura IS je obvykle
ohraničena přímými repeticemi (DR – „direct repeat”) o délce 2–14 bp, které netvoří součást IS, ale jsou
generovány při jejím začlenění do cílové sekvence DNA. Délka DR je obvykle charakteristická pro různé
rodiny IS. Absence přímých repetic v okolí IS obvykle vznikají v důsledku následných rekombinačních a
delečních změn po začlenění IS do cílové sekvence (Mahillon a Chandler, 1998; Mahillon et al., 1999).
IS jsou klasifikovány do rodin na základě několika kritérií zahrnujících: (a) sekvenci a délku IR, (b)
sekvenci a délku DR, (c) organizaci otevřeného čtecího rámce a (d) cílové sekvence DNA, do kterých se
začleňují. Primárním ukazatelem příslušnosti do stejné rodiny je vysoká sekvenční homologie genů
kódujících transponázy (Siguier et al., 2014). Klasifikační systém člení bakteriální IS do 26 základních rodin
(Siguier et al., 2006b). Souborná databáze s názvem IS Finder obsahující dosud popsané sekvence je
dostupná na adrese https://www-is.biotoul.fr/. Do roku 2014 bylo zdokumentováno více než 4000
různých IS (Siguier et al., 2015), je však možné předpokládat, že s přibývajícími daty celogenomových
sekvencí bude číslo rychle narůstat.
Nomenklatura IS se řídí určitými pravidly. Původně byla zkratka IS následována přímo číslem
(Campbell et al., 1979), např. IS26. Pro přehlednost se později přistoupilo k jinému systému, který
zohledňuje původ sekvence (Chandler a Mahillon, 2000). Název se skládá z počátečního písmene
78
bakteriálního rodu, u kterého byla IS popsána a je následováno prvními dvěma písmeny jeho druhového
jména a dále pořadovým číslem (např. ISBce1 popsaná u Bacillus cereus).
Pohyb IS je zajištěn dvěma způsoby, a to jejím vyštěpením z místa donorového na místo cílové
nebo se do cílového místa začleňuje kopie elementu. Mechanizmus transpozice je blíže popsán v kapitole
6.2.4. Začlenění IS do cílového genomu je obvykle spojeno s přerušením čtecího rámce a delecemi celých
genů. IS mají rovněž schopnost přemísťovat různé geny ve svém okolí nebo aktivovat jejich expresi. Bylo
například pozorováno, že začlenění IS1 nebo IS10 u Salmonella enterica ovlivňuje expresi efluxní pumpy
AcrAB-TolC, což vede ke zvýšení rezistence k fluorochinolonům (Olliver et al., 2005).
Jednou z nejvýznamnějších IS v šíření rezistence k různým skupinám antibiotik je IS26. Je typická
především pro oblasti multirezistence, ve kterých může být přítomná až v deseti kopiích a ohraničuje geny
rezistence k různým skupinám antibiotik. V epidemiologii rezistence k cefalosporinům a v menší míře
také k fluorochinolonům se uplatňuje ISEcp1, která nejen mobilizuje přilehlé geny rezistence, ale také
zvyšuje jejich expresi (Partridge, 2011). Je spojena především s genem blaCTX-M kódujícím nejvýznamnější
širokospektrou beta-laktamázu CTX-M. Pozornost jí bude blíže věnována v kapitole 7.10.1.
6.2.2 Transpozony
Transpozony se podobají svou strukturou inzerčním sekvencím. Nesou gen pro transponázu, jsou
ohraničeny IR rozpoznávanými při transpozici a jejich začlenění do cílové sekvence je obvykle spojeno
s tvorbou přímých repetic (Obr. 18B). Na rozdíl od IS obvykle nesou také gen pro vlastní regulaci a další
geny, které nejsou potřebné pro přenos elementu (Roberts et al., 2008). Transpozony jsou významné
struktury v šíření rezistence k mnoha skupinám antimikrobiálních látek.
Transpozony s výše popsanou strukturou se označují jako transpozony jednoduché. Složitější
strukturu mají kompozitní transpozony, které jsou ohraničeny dvěma kopiemi stejného typu inzerční
sekvence ve shodné nebo opačné orientaci (Obr. 18C). Příkladem je kompozitní transpozon Tn9 nesoucí
gen rezistence k chloramfenikolu a ohraničený IS1 ve stejné orientaci nebo transpozon Tn10 ohraničený
IS10 v opačné orientaci a spojený s rezistencí k tetracyklinu. Inzerční sekvence ohraničující strukturu
transpozonu nejsou zcela autonomní. V důsledku bodových mutací vytváří aktivní transponázu pouze
jedna ze sekvencí. Při transpozici kompozitního transpozonu jsou obvykle rozpoznávány IR ohraničující
transpozon na obou koncích (OE – „outside end”) a úsek je přenášen jako celek. V případě rozpoznání
vnitřních obrácených repetic (IE – „inside end”) může být transponován vnitřní úsek kompozitního
transpozonu. Transpozice vnitřních úseků vedou k delecím nebo ke vzniku nového typu kompozitního
transpozonu. Některé transpozony disponují schopností potlačovat tento nežádoucí pohyb vnitřních
úseků (Snyder a Champness, 2007).
79
Obr. 18: Struktura inzerčních sekvencí a transpozonů
Levá a pravá obrácené repetice (IRL a IRR) jsou označeny černým trojúhelníkem; oranžové obdélníky ohraničující strukturu
představují přímé repetice (DR) cílové sekvence, do které se MGE začleňuje; geny účastnící se transpozice jsou označeny
šedě; ostatní geny jsou barevně odlišeny podle následujícího klíče: zelená – operon mer tvořený skupinou genů pro
rezistenci ke rtuti; oranžová – aphA1 pro rezistenci k aminoglykozidům; červená - tetA(A) včetně regulačního genu tetR(A)
pro rezistenci k tetracyklinu; žlutá – blaTEM-1 pro rezistenci k beta-laktamům. IE a OE značí vnitřní a vnější konce elementu
rozpoznávané transponázou.
A. Inzerční sekvence s jedním nebo dvěma otevřenými čtecími rámci
B. Jednoduchý transpozon
C. Kompozitní transpozon
80
V genomu gramnegativních bakterií jsou nejrozšířenější transpozony rodiny Tn3. Hrají významnou
úlohu v současné epidemiologii antibiotické rezistence. Nesou gen pro transponázu (tnpA) a gen tnpR
kódující bifunkční protein, který působí jako resolváza napomáhající transpozici a zároveň jako represor
bránící přenosu dalších kopií transpozonu do cílových oblastí. Dále obsahují přídatné geny, které nejsou
spojeny s procesem transpozice. Obvykle se jedná o geny rezistence k různým antibiotikům. Transpozony
Tn3 rodiny zahrnují dvě velké podskupiny, Tn2 a Tn21, které se liší svou organizací a přenášenými geny.
Skupina Tn2 obsahuje tnpA a tnpR v opačné orientaci a nese gen rezistence k beta-laktamovým
antibiotikům blaTEM-1 (Partridge a Hall, 2005). U transpozonů podskupiny Tn21 jsou geny pro transpozici
orientovány stejným směrem. Tn21 je typický svojí kompozitní strukturou zahrnující geny rezistence k
aminoglykozidům (aadA1) a sulfonamidům (sul1) ve formě integronu a operon mer tvořeným sadou genů
podmiňujících rezistenci ke rtuti (Liebert et al., 1999). Tn3 rodina zahrnuje také rozšířený kompozitní
transpozon Tn1721 spojený s rezistencí k tetracyklinu (Allmeier et al., 1992) a Tn4401 kódující
karbapenemázu KPC (Naas et al., 2008).
6.2.3 Struktury příbuzné inzerčním sekvencím
Byly popsány elementy, které se různou mírou odlišují od klasických IS a tvoří jakési pomezí mezi
IS a transpozony (Obr. 19).
Obr. 19: Deriváty inzerčních sekvencí a transpozonů
Vlastní ISCR1 je tvořena pouze genem rcr. Úseky “a” a “b” značí přilehlé sekvence, které mohou být prostřednictvím ISCR1
procesem RC transpozice mobilizovány. Levé a pravé obrácené repetice IRL a IRR jsou označeny černým trojúhelníkem;
oranžové obdélníky ohraničující strukturu představují přímé repetice (DR) cílové sekvence, do které se MGE začleňuje;
Oblasti oriIS a terIS představují počátek a konec RC transpozice; geny účastnící se pohybu elementu jsou označeny šedě;
ostatní geny jsou barevně odlišeny podle následujícího klíče: tmavě zelená – genová kazeta aadA1 pro rezistenci
k aminoglykozidům; modrá - sul1 pro rezistenci k sulfonamidům; žlutá – blaTEM-1 pro rezistenci k beta-laktamům; fialová –
qnrD pro rezistenci k fluorochinolonům.
81
ISCR (CR – „common region”) náleží do rodiny IS91. Tyto elementy obsahují pouze jediný gen
kódující replikázu rcr. Od klasických IS se dále liší absencí terminálních invertovaných repetic a přímých
repetic cílových sekvencí (Partridge, 2011). Jsou ohraničeny oblastí oriIS a terminální sekvencí terIS.
K pohybu v rámci genomu využívají mechanizmus RC transpozice (RC – „rolling circle”) zahrnující replikaci
na otáčející se kružnici, při které není terminální oblast terIS elementu vždy rozpoznána, replikace
pokračuje a tímto způsobem se mohou přenášet i přilehlé DNA sekvence (Siguier et al., 2015). V okolí
ISCR se často nachází integrony a geny rezistence k antibiotikům, které mohou být tímto mechanizmem
mobilizovány. Jedná se o geny rezistence k trimetoprimu a sulfonamidům ve formě genových kazet
integronů, geny rezistence k chinolonům, aminoglykozidům a beta-laktamovým antibiotikům (Partridge,
2011; Partridge et al., 2009). V jediném kroku mohou ISCR přenášet extrémně dlouhé úseky DNA
dosahující až 28 kb (Tavakoli et al., 2000).
Transportérové IS (tIS) vykazují vlastnosti IS i transpozonů současně. Přenáší geny pro regulaci
transkripce, metyltransferázy a geny rezistence k antibiotikům. Jsou obvykle mnohem delší než klasické
IS a vyskytují se v genomu jen v jedné kopii (Siguier et al., 2009). Některé deriváty Tn3 transpozonů (např.
IS1071, ISVsa19 a další) disponují vlastnostmi IS. Nemají systémem místně specifické rekombinace, která
je pro transpozony typická, a také nenesou další přídatné geny (Siguier et al., 2015).
Další skupinu odvozených elementů tvoří deriváty, které nejsou schopné autonomního přenosu.
MITE („miniature inverted repeat transposable element”) jsou malé struktury o velikosti <300 bp, které
pravděpodobně vznikly z inzerčních sekvencí v důsledku interních delecí. Podobně jako IS jsou ohraničeny
dvěma obrácenými repeticemi. Mobilní inzerční kazety (MIC – „mobile insertion cassette“) obsahují ve
své struktuře přenášené geny, nekódují však transponázu. MIC nesoucí gen qnrS2 udílející rezistenci
k fluorochinolonům byla dokumentována u aeromonád (Dobiasova et al., 201529
). U enterobakterií byl
identifikován gen qnrD rovněž ve formě mobilní inzerční kazety (Guillard et al., 2014).
6.2.4 Mechanizmus transpozice
Pohyb transpozonu nebo inzerční sekvence z místa donorového do cílového je obvykle zajištěn
dvěma základními procesy. Transpozice může být buď konzervativní, kdy dochází k vyštěpení elementu
z donorového místa a jeho vložení na místo cílové nebo replikativní, kdy se do cílového místa dostává
jeho kopie. Při konzervativní transpozici zajišťuje transponáza excizi elementu z hostitelské molekuly a
naštěpení cílového úseku, do kterého je následně element přenesen. Specifita cílového místa
na molekule DNA je různá v závislosti na typu transponázy (Snyder a Champness, 2007). Transpozice
probíhá v bakteriální buňce zřídka (v rozmezí 10-3
až 10-8
) a je zároveň přísně regulována. Vysoká
82
frekvence transpozice je pro hostitelskou buňku nežádoucí, zejména z důvodu rizika vzniku inzerčních
mutací (Nagy a Chandler, 2004).
První skupinu tvoří tzv. DDE transpozony, pro které je charakteristická tvorba duplikací v cílové
DNA sekvenci a přítomnost dvou molekul aspartátu (D) a jedné molekuly glutamátu (E) nezbytných
pro transponázovou aktivitu. DDE transpozony zahrnují rozšířené typy Tn3, Tn5, Tn7 nebo Tn10 sdružené
s rezistencí k antibiotikům. Transpozice Tn5 a Tn7 se děje konzervativním “cut and paste” mechanizmem
(Obr. 20A). Transponáza vytváří zlomy v obou DNA řetězcích v okolí transpozonu a v cílové molekule.
Výštěpený transpozon se přemisťuje na cílové místo a donorová molekula je následně degradována (Dale
a Park, 2004; Snyder a Champness, 2007). Naopak Tn3 se pohybuje mechanizmem replikativní
transpozice a s cílovou molekulou fúzuje za tvorby přechodných kointegrátů (Obr. 20B). Kointegrát je
v konečném kroku rozložen místně specifickou rekombinací pomocí resolvázy TnpR kódované
transpozonem. Jiné skupiny transpozonů, které gen pro resolvázu nenesou, využívají rekombinační aparát
hostitelské buňky (RecA).
Zvláštní typ transpozonů představují RC (neboli Y2) transpozony, které byly popsány výše
v souvislosti s ISCR elementy. Přemisťují se mechanizmem replikace na otáčející se kružnici a jejich
transpozice není spojena s duplikací cílového místa. Další méně početnou skupinou jsou Y a
S transpozony, jejichž název je odvozen od aminokyseliny přítomné v aktivním centru transponázy
(tyrosin u Y transpozonů, serin u S transpozonů). Během transpozice se tvoří kružnicové intermediáty
přenášeného transpozonu, čímž se velice podobají přenosu genových kazet integronů, který je
zprostředkován integrázou (Snyder a Champness, 2007). Základní mechanizmy transpozice bakterií
popisuje Obr. 21.
83
A B
Obr. 20: Mechanizmus konzervativní (A) a replikativní (B)
transpozice DDE transpozonů
Vytvořeno podle Snyder a Champness, 2007. Úsek DNA tvořený
transpozonem je označen červeně. Šipky značí tvorbu zlomu v DNA
na konci transpozonu a v cílové sekvenci.
(A)
(1) V sekvencích ohraničujících transpozon se vytváří dvouřetězcový
zlom. V cílové DNA jsou zlomy jednořetězcové.
(2) Volné 3’ konce transpozonu jsou připojeny k 5’ konci cílové DNA.
(3) DNA polymeráza vyplní mezery vedoucí ke vzniku krátkých
duplikací cílové sekvence, které ohraničují transpozon. Donorová
DNA je po transpozici degradována.
(B)
(1) Modře je označeno cílové místo transpozice, v jehož okolí
dochází k tvorbě zlomů. K sekvenci ohraničující transpozon stejně
tak jako v cílové DNA se vytváří jednořetězcové zlomy.
(2) Volné 3’ konce transpozonu jsou připojeny k 5’ konci cílové DNA.
(3) Od 3’ volných konců cílové DNA probíhá replikace oběma směry
zahrnující úsek transpozonu a vede ke vzniku kointegrátu.
(4-5) Vzniklý kointegrát je rozrušen rekombinací katalyzovanou
resolvázou TnpR v místě res.
1
2
3
1
2
3
4
5
res
84
Obr. 21: Srovnání základních mechanizmů transpozice u bakterií
Vytvořeno podle Snyder a Champness, 2007.
DEE transpozony RC transpozony Y transpozony S transpozony
Místo naštěpení cílové DNA
Místo vyštěpení v donorové DNA
Kovalentní spojení tyrozinové rekombinázy
Kovalentní spojení serinové rekombinázy
DNA původního transpozonu
Replikovaná oblast DNA transpozonu
Duplikace cílového místa
Volné 3’OH konce
Konzervativní Replikativní
Donorová DNA
Recipientní DNA
Replikativní
Kruhový
intermediát
84
85
6.2.5 Integrony
Integrony představují expresní systémy, které začleňují otevřené čtecí rámce a převádí je
do funkčních genů (Carattoli, 2001). Jsou významnými elementy v šíření genů rezistence k antibiotikům
a dezinfekčním látkám. Tento typ integronů je v literatuře často označován jako mobilní rezistentní
integron (MRI – „mobile resistance integron”) a je blíže představen v následujících odstavcích. Zvláštní
skupinu potom tvoří tzv. superintegrony vyskytující se na chromozomu vibrií, jejichž význam v přenosu
rezistence k antibiotikům je omezený.
Integrony byly popsány v 80. letech minulého století (Stokes a Hall, 1989). Bioinformatické
analýzy celogenomových dat ukazují, že se jedná o rozšířené typy MGE, které tvoří 10–17 % bakteriálního
genomu. Byly identifikovány převážně v genomu klinicky významných bakterií, ale předpokládá se jejich
prevalentní rozšíření také u komenzálních bakterií přirozeně se vyskytujících ve vodním prostředí a v půdě
(Nield et al., 2001).
6.2.5.1 Obecná struktura MRI integronů
Pro integrony jsou typické tři složky nezbytné pro vlastní funkci. Zahrnují gen pro enzym integrázu
(intI), vazebné místo (attI) a promotor zajišťující expresi genů začleněných ve formě genových kazet.
Základní struktura integronu na příkladu integronů třídy 1 je představena na Obr. 22.
Obr. 22: Složení integronů třídy 1 a proces mobilizace genových kazet
Vytvořeno podle Carattoli, 2001. 5’CS je konzervativní oblast integronu na 5’ konci tvořená genem intI1 kódujícím
integrázu a rekombinačním místem attI1. 3’CS je konzervativní oblast integronu na 3’ konci tvořená geny qacΔE1
(rezistence ke kvartérním amoniovým sloučeninám), sul1 (rezistence k sulfonamidům) a orf5 s neznámou funkcí. attC
představuje aktivní místo rekombinace rozpoznávané integrázou. Integráza IntI1 katalyzuje integraci genových kazet
ve volné kruhové formě do integronu místně specifickou rekombinací. Genové kazety integronu jsou přepisovány ze
společných promotorů Pc a P2.
86
Genové kazety představují otevřené čtecí rámce obvykle o velikosti 500–1000 bp. Vyskytují se
ve dvou formách, a to volně v cytoplazmě v podobě kruhových molekul DNA, které nemají schopnost
vlastní replikace, nebo ve formě lineární začleněné do integronu (Collis a Hall, 1992; Hall a Collis, 1998).
Na 3’ konci obsahují sekvenci attC, která bývá díky své charakteristické délce označována jako 59-be
(be – „base element”). Byly popsány i attC odlišné délky pohybující se v rozmezí 57 až 141 bp (Hall et al.,
1991). Oblast attC představuje aktivní místo rekombinace rozpoznávané integrázou. Genové kazety
obvykle postrádají vlastní promotor a pro expresi využívají společný promotor integronu. Bylo
identifikováno několik genových kazet nesoucích vlastní promotor, např. cmlA kódující rezistenci
k chloramfenikolu (Bissonnette et al., 1991) nebo qnrVC pro rezistenci k chinolonům (da Fonseca a
Vicente, 2012).
Integráza katalyzuje integraci genových kazet do integronu procesem místně specifické
rekombinace. K té dochází mezi místem attC volné kruhové formy genové kazety a attI oblastí integronu.
Pokud integron již obsahuje jednu či více genových kazet, nová kazeta se začleňuje vždy do attI oblasti,
v tomto případě tedy před první genovou kazetu integronu. Integráza také zajišťuje vyčlenění kazety
z integronu. Jedná se o opačný proces v porovnání s integrací, při kterém přechází kazeta zpět do volné
kruhové formy (Hall a Collis, 1998). Ve velmi nízké frekvenci může docházet také k rekombinaci attC
oblasti genové kazety s nespecifickým (sekundárním) místem v genomu. Tento jev byl popsán u kazety
aadB spojené s rezistencí k aminoglykozidům, která byla nalezena na malém plazmidu RSF1010
postrádající integron (Recchia a Hall, 1995).
6.2.5.2 Klasifikace MRI integronů
Integrony jsou klasifikovány do tříd na základě sekvenční homologie integrázy IntI. Dababáze
INTEGRALL (http://integrall.bio.ua.pt/) eviduje dosud popsané integrony. Poskytuje informaci o třídě
integronu, jeho struktuře a bakteriálním druhu, u kterého byl integron nalezen. V současné době čítá
devět tříd integronů.
Integrony třídy 1 (Obr. 22) jsou tvořeny dvěma konzervativními oblastmi ohraničující integron
z obou stran, mezi něž jsou začleněny genové kazety. 5’ konec integronu nese oblast 5’-CS
(CS – „conserved segment”) tvořenou genem intI1, místem attI a dvěma promotory. Promotor Pc
(označovaný také PANT) je hlavní promotor zajišťující expresi genových kazet, zatímco druhý promotor P2
je inaktivní. Konzervovaná oblast integronu na 3’ konci (3’-CS) obsahuje deletovaný gen qacΔE1 pro
rezistenci ke kvartérním amoniovým sloučeninám, následovaný genem sul1 kódující rezistenci
k sulfonamidům a případně také orf5 (a orf6) s neznámou funkcí (Carattoli, 2001). Integrony této skupiny
se u klinických rezistentních izolátů vyskytují nejčastěji a zároveň je pro ně typická vysoká variabilita
genových kazet (http://integrall.bio.ua.pt/).
87
Podobně jako integrony třídy 1 většina integronů třídy 2 obsahuje rekombinační oblast attI2,
promotor Pc a intI2 pro integrázu. Gen intI2 nese v kódující oblasti vnitřní terminální kodon, jehož
důsledkem je tvorba kratšího a inaktivního proteinu IntI2, který nemá schopnost rozpoznávat attC místo
genových kazet a katalyzovat jejich začlenění do integronu. Tato vlastnost může být vysvětlením jejich
nízké variability v porovnání s integrony třídy 1 (Deng et al., 2015).
Integrony třídy 3 kódují funkční integrázu, která však v porovnáním s integrázou IntI1 vykazuje
výrazně nižší aktivitu (Collis et al., 2002). Byly prokázány ve spojitosti s beta-laktamázami GES (Correia et
al., 2003) a IMP-1 (Arakawa et al., 1995). Méně časté integrony tříd 4-9 byly nalezeny u různých druhů
rodu Vibrio nebo u nekultivovatelných bakterií (http://integrall.bio.ua.pt/) a nejsou obvykle spojeny
s rezistencí k antibiotikům. Integrony třídy 4 náleží mezi superintegrony a budou blíže popsány níže.
6.2.5.3 Mobilizace integronů
Integrony představují elementy, které nejsou schopny vlastního přenosu. Vyskytují se však jako
součást jiných MGE (IS, transpozonů, MITE, genomových ostrovů), které zajišťují jejich intracelulární
pohyb. Horizontální přenos integronů mezi buňkami je umožněn především konjugativními plazmidy.
Nejběžnější mechanizmy intracelulárního pohybu integronů shrnuje Obr. 23. Integron se přenáší do cílové
molekuly DNA jako součást transpozonu (Obr. 23A). Integron ohraničený obrácenými repeticemi (IRi a
IRt), který není vnořen do transpozonu, se může taktéž přenášet do cílového místa transpozicí. V tomto
případě je přenos zajištěn transponázami poskytovanými in trans (Obr. 23B). Další možností je výměna
integronu rekombinací mezi dvěma homologními oblastmi prostřednictvím proteinů RecA s funkcí
resolvázy (Obr. 23C).
Integrony třídy 1 se obvykle vyskytují jako součást transpozonu Tn402. Transponáza kódovaná tni
geny rozpoznává obrácené repetice ohraničující transpozon - IRi na 5’ konci a IRt na 3’ konci integronu.
U většiny v současné době popisovaných integronů je tni oblast deletována a pohyb je zajištěn vnořením
celé struktury do plazmidu nebo dalšího transpozonu, nejčastěji Tn21 (Partridge, 2011; Partridge et al.,
2009).
88
Obr. 23: Způsoby mobilizace integronů třídy 1
Vytvořeno podle Domingues et al., 2012a. Genové kazety integronu jsou vyjádřeny oranžovým kruhem. Gen A značí cílové
místo, do kterého se integron přenáší jedním ze tří uvedených mechanizmů. Moduly tniA a tnp obsahují kódující geny pro
tvorbu transponázy TnpA nebo TniA. IR značí obrácené repetice a ohraničují (Obr. 23A) transpozon na obou stranách.
V případě transpozice do genu A (Obr. 23A a B) dochází k tvorbě přímých repetic (DR) cílové sekvence. RecA je protein s
funkcí resolvázy účastnící se procesu homologní rekombinace (Obr. 23C). IRi je obrácená repetice u genu integrázy, IRt je
obrácená repetice u genu tni a společně ohraničují sekvenci integronu.
A. Pohyb integronu transpozicí zprostředkovaný jeho vložením do transpozonu
B. Pohyb integronu transpozicí zajištěný transponázou kódovanou in trans
integron
transpozon
integron
transpozon
integron
integron
89
C. Pohyb integronu zprostředkovaný homologní rekombinací
6.2.5.4 Rezistence sdružená s integrony
Organizace integronu zajišťuje současnou expresi všech genových kazet z jediného promotoru.
Hladina exprese jednotlivých kazet je závislá na řadě faktorů (např. síle promotoru nebo pozici kazety).
Přítomnost genové kazety v integronu nemusí být vždy spojena s rezistencí k antibiotiku. Genové kazety
lokalizované ve variabilní oblasti integronu v prvním případně druhém pořadí (tedy blíže promotoru)
vykazují vyšší expresi v porovnání s kazetami od promotoru vzdálenými (Collis a Hall, 1995). Tato vlastnost
integronů je pravděpodobným vysvětlením limitovaného počtu genových kazet u klinicky významných
integronů.
V integronech nalézáme různé kombinace genových kazet. Některé z nich jsou sdíleny napříč
různými třídami integronů (Partridge et al., 2009). Integrony obvykle nesou 1–3 kazety, byly však popsány
integrony až s 8 genovými kazetami (Naas et al., 2001). Kazety kódují rezistenci k beta--laktamům,
aminoglykozidům, chloramfenikolu, trimetoprimu, rifampicinu, erytromycinu, chinolonům, fosfomycinu
a linkomycinu (Partridge et al., 2009). Mezi nejrozšířenější patří kazety kódující různé sekvenční varianty
acetyltransferáz (geny aacA) a adenyltransferáz (aadA) podmiňujících rezistenci k aminoglykozidům a
dihydrofolát reduktáz (dfrA) spojených s rezistencí k trimetoprimu (Deng et al., 2015; Partridge et al.,
2009). Integrony hrají také významnou roli v epidemiologii karbapenemáz IMP a VIM (Partridge et al.,
2009; Papagianitsis et al., 2015c28
). Geny pro tyto beta-laktamázy jsou v integronech běžně sdruženy
s výše zmíněnými kazetami pro rezistenci k aminoglykozidům a trimetoprimu (http://integrall.bio.ua.pt/).
integron
integron
90
V epidemiologii antibiotické rezistence jsou z integronů nejdůležitější zástupci třídy 1. Nachází se
u různých druhů gramnegativních bakterií (zejména enterobakterií, pseudomonád, acinetobakterů a
vibrií), které kromě klinických izolátů zahrnují i izoláty ze zvířat, potravin, půdy a vody. V menším měřítku
se vyskytují také u klinických izolátů grampozitivních bakterií (Domingues et al., 2012a).
6.2.5.5 Superintegrony
Tyto neobvyklé integrony byly popsány u V. cholerae (Mazel et al., 1998). Svoji strukturou se
podobají MRI integronům (Obr. 24). Na 5’ konci nesou gen pro integrázu, která katalyzuje začlenění
nových genových kazet do cílového místa integronu attI. Vazebná místa attC rozpoznávaná integrázou
jsou označovaná jako sekvence VCR („vibrio cholerae repeated”) a na rozdíl od MRI integronů vykazují
vysokou sekvenční homologii a podobnou délku (Rowe-Magnus a Mazel, 1999). Dosud identifikované
superintegrony nesou 36–219 genových kazet a představují tak 0,7–3,1 % celkové velikosti genomu
(Boucher et al., 2006). Obsahují geny kódující virulenční faktory (Ogawa a Takeda, 1993; Rowe-Magnus
et al., 2003), rezistenci k antibiotikům (Melano et al., 2002) a proteiny účastnící se metabolizmu
bakteriální buňky (Barker a Manning, 1997). Některé genové kazety superintegronů nesou vlastní
promotor a jsou přepisovány v opačném směru (Rowe-Magnus a Mazel, 1999).
Předpokládá se, že superintegrony představují předchůdce MRI integronů. Superintegrony byly
identifikovány na chromozomu V. cholerae ve sbírce z předantibiotické éry. Proces evoluce MRI integronů
a jejich další šíření bylo nejspíše spojeno se selekčním tlakem antibiotik (Mazel et al., 1998; Rowe-Magnus
a Mazel, 1999). Úspěšný experimentální přenos genových kazet ze superintegronů do MRI integronů
podpořil teorie původu MRI v superintegronech (Rowe-Magnus et al., 2002).
Obr. 24: Chromozomální superintegron V. cholerae
Vytvořeno podle Snyder a Champness, 2007. VCR – repetitivní oblasti představující rekombinační attC místo. Šipky
indikují směr transkripce genových kazet.
130 kb, 3 % genomu, 179 genových kazet
91
6.2.6 Integrativní konjugativní elementy
Další skupinu tvoří integrativní konjugativní elementy neboli ICE („integrative conjugative
elements”), které sdílí vlastnosti plazmidů a bakteriofágů. Podobně jako plazmidy zajišťují vlastní přenos
konjugací, ale nejsou schopny autonomní replikace. Začleňují se do bakteriálního chromozomu obvykle
místně specifickou rekombinací a využívají tak replikační systém hostitelské buňky, což je vlastnost typická
pro bakteriofágy (Wozniak a Waldor, 2010). Cílovým místem je nejčastěji 3’ konec genů pro tRNA. Různé
elementy se liší mírou specifity cílového místa začlenění (Bellanger et al., 2014). ICE byly dokumentovány
u různých druhů grampozitivních i gramnegativních bakterií (Franke a Clewell, 1981; Toleman a Walsh,
2011; Zakharova a Viktorov, 2015). Podílí se na horizontálním přenosu genů rezistence k antibiotikům a
těžkým kovům nebo faktorů patogenity (Zakharova a Viktorov, 2015).
ICE jsou velice heterogenními mobilními elementy, které byly jako skupina vytvořeny až v roce
2002 (Burrus et al., 2002; Pembroke et al., 2002). Řada z nich byla dříve řazena mezi transpozony (např.
Tn916) nebo plazmidy (např. pSAM2). Jejich současná klasifikace je založena na stupni sekvenční
homologie genů pro integrázu a typu řazení kódujících genů. Velikost ICE je variabilní a pohybuje se
v rozmezí desítek až stovek tisíc párů bazí. Obvykle se vyskytují pouze v jedné kopii v daném genomu.
Vyznačují se modulárním charakterem, kdy se geny zajišťující danou funkci nachází společně ve formě
klasterů. Integráza, kterou kódují, zajišťuje excizi ICE z donorového místa a jeho inzerci do místa cílového
mechanizmem typickým pro bakteriofágy λ (Zakharova a Viktorov, 2015).
Prvním popsaným elementem této skupiny byl Tn916 u E. faecalis přenášející rezistenci
k tetracyklinu (Franke a Clewell, 1981). Dalším dobře prostudovaným ICE je SXT/R391 V. cholerae (Waldor
et al., 1996). Dosahuje velikosti 100 kb a nese geny rezistence k sulfonamidům, trimetoprimu,
streptomycinu a chloramfenikolu. Příklady ICE jsou uvedeny na Obr. 25.
Nové ICE rychle přibývají především díky rostoucímu množství dat z celogenomového
sekvenování. V roce 2012 byla vytvořena databáze těchto elementů ICEberg (Bi et al., 2012), kterou je
možné nalézt na odkazu http://db-mml.sjtu.edu.cn/ICEberg/.
92
Tn916 u E. faecalis
Tn4371 u Pseudomonas aeruginosa PA7
Obr. 25: Příklady integrativních konjugativních elementů
Vytvořeno volně podle Boyd a Mulvey, 2013. Geny pro konjugaci jsou vyznačeny tmavě šedě; další typy MGE jsou
zvýrazněny světle šedou; barevně jsou označeny geny rezistence k antibiotikům - tet(M) pro tetracyklin (červeně), sph pro
streptomycin (fialově), blmt pro bleomycin (zeleně), aph pro neomycin (oranžově).
6.2.7 Genomové ostrovy
Genomové ostrovy (GEI – „genomic islands”) byly nalezeny na chromozomu některých druhů
bakterií. Představují dlouhé úseky DNA (10-200 kb) s charakteristickou strukturou (Obr. 26), které se
podobně jako ICE začleňují k 3’ konci genu pro tRNA. Integrace GEI do chromozomu je zajištěna místně
specifickou rekombinací zprostředkovanou vlastním enzymem podobným fágové integráze. Od okolní
sekvence se odlišují procentuálním zastoupením G+C. Jsou ohraničeny přímými repeticemi cílové
sekvence o délce 16-20 bp. Nesou plazmidové konjugační systémy nebo fágové geny, které zajišťují
mobilitu celé struktury konjugací nebo transdukcí. Obsahují také další typy MGE (IS, transpozony), které
způsobují přeskupení genů v rámci GEI, delece a inzerce genů (Dobrindt et al., 2004; Snyder a
Champness, 2007).
93
Původně byly popisovány ve spojitosti s patogenitou u extraintestinálně patogenních kmenů
E. coli a byly proto označovány jako ostrovy patogenity (PAI- „pathogenicity island“) (Hacker et al., 1990).
Kromě nejrůznějších virulenčních faktorů kódují další funkce zahrnující metabolizmus sukrózy a
aromatických sloučenin, rezistenci k těžkým kovům a antimikrobiálním látkám případně ovlivňují fitness
hostitelské bakterie nebo její schopnost symbiózy. Jeden z nejlépe prostudovaných GEI spojený
s antibiotickou rezistencí u klinicky významným gramnegativních bakterií je SGI1 („salmonella genomic
island 1”). Byl poprvé identifikován u multirezistentního kmene Salmonella Typhimurium DT104 (Boyd et
al., 2000). SGI1 o velikosti 43 kb nese geny rezistence k aminoglykozidům (aadA2), amfenikolům (floR),
tetracyklinu (tetG), ampicilinu (blaPSE-1) a sulfonamidům (sul1). Dalším významným GEI je SSCmec
(SSC – „staphylococcal cassette chromosome”) u S. aureus rezistentní k meticilinu (Shore a Coleman,
2013).
A. Obecná struktura
B. Salmonella genomic island 1 (SGI1) u Salmonella Typhimurium DT104
Obr. 26: Genomový ostrov
Vytvořeno volně podle Dobrindt et al., 2004; Fluit, 2005.
(A) Genom - cílová oblast v genomu bakterie, do které se v okolí tRNA začleňuje genomový ostrov; IS – inzerční sekvence;
DR – přímé repetice. Oblast označená jako konjugace nese sadu genů pro zajištění konjugativního přenosu celé
struktury genomového ostrovu.
(B) Geny kódující rezistenci k antibiotikům jsou označeny barevně podle následujícího klíče: tmavě zelená – addA2
pro rezistenci k aminoglykozidům; tmavě modrá – qacEΔ1 pro rezistenci ke kvartérním amoniovým sloučeninám;
světle modrá – sul1 pro rezistenci k sulfonamidům; fialová – floR pro rezistenci k florfenikolu; červená – tetG
pro rezistenci k tetracyklinu; žlutá – blaPSE-1 pro rezistenci k beta-laktamům. Mobilní elementy (inzerční sekvence,
geny pro integrázu, resolvázu) jsou vyznačeny šedě; IRt a IRi - invertované repetice integronu.
genomgenom genomový ostrov
94
6.2.8 Plazmidy
Plazmidy představují extrachromozomální mobilní genetické elementy schopné autonomní
replikace. Jsou charakteristickými strukturami prokaryotických buněk, ale byly identifikovány také
u některých eukaryot (kvasinek). Významně ovlivňují základní biologické vlastnosti svých hostitelů,
poskytují jim selektivní výhodu a podílejí se na jejich diverzitě a evoluci (Funnel a Phillips, 2004).
Plazmidy představují jedny z největších MGE s komplexní strukturou. Jejich velikost se různí od
několika párů bazí až po stovky kilobazí. Jeden z největších plazmidů popsaný u Streptomyces clavuligerus
dosahuje 1.8 Mbp, čímž se blíží velikosti bakteriálního chromozomu (Alvarez-Alvarez et al., 2014). Obvykle
se vyskytují ve formě kovalentně uzavřené kružnicové molekuly tvořené dvěma vlákny DNA, byly však
popsány plazmidy lineární nebo jednovláknové (Snyder a Champness, 2007).
Na plazmidy je někdy pohlíženo jako na buněčné parazity, jelikož nenesou genetickou informaci
pro zajištění základních funkcí bakteriální buňky. Za určitých okolností však svým hostitelům poskytují
selekční výhody, např. v přítomnosti antibiotika, chemických polutantů, v prostředích s omezeným
spektrem živin apod. Plazmidy jsou významné především z klinického pohledu, jelikož se významně podílí
na udržování a šíření rezistence k antibiotikům (Funnel a Phillips, 2004).
V následujících kapitolách jsou představeny základní charakteristiky plazmidů gramnegativních
bakterií, je popsána jejich základní organizační struktura, mechanizmy replikace, kontroly počtu kopií,
nástroje pro stabilní udržování v hostitelských buňkách a způsoby horizontálního šíření v bakteriálních
populacích. Poslední kapitoly jsou věnovány popisu plazmidů v kontextu funkcí, které poskytují svému
hostiteli s důrazem na rezistenci k antibiotikům.
6.2.8.1 Základní organizace plazmidů
Pro plazmidy je charakteristická modulární
struktura (Obr. 27) tvořená geny zajišťující základní
funkce plazmidu, které jsou součástí konzervativní
oblasti neboli kostry plazmidu, a geny pro přídatné
funkce přítomné ve variabilní plazmidové oblasti
(Norman et al., 2009). Základní struktura plazmidů je
představena na Obr. 28.
Obr. 27: Základní struktura plazmidů
Vytvořeno podle Norman et al., 2009.
95
Obr. 28: Schematické znázornění struktury konjugativních (A) a mobilizovatelných (B) plazmidů
Konzervativní oblast každého plazmidu nese geny pro vlastní replikaci, které zajišťují sladění
replikace plazmidu s buněčným cyklem hostitele. Replikační oblast rovněž reguluje počet kopií plazmidu
a zabraňuje tak vzniku nadměrné energetické zátěže pro buňku, které by mohlo nastat
při nekontrolovaném množení plazmidu. Počet kopií plazmidů na buňku se liší a je charakteristický pro
daný typ plazmidu. Malé plazmidy se obvykle vyskytují v desítkách až stovkách kopií, jsou tzv.
vysokokopiové, zatímco velké plazmidy čítají 1–10 kopií na buňku, jsou tedy nízkokopiové. Počet kopií
zásadním způsobem ovlivňuje mechanizmy jejich stabilní propagace v bakteriálních populacích (Dale a
Park, 2004). Další genetická výbava konzervativní oblasti se u jednotlivých skupin plazmidů různí.
Nízkokopiové plazmidy obvykle obsahují v blízkosti oblasti pro replikaci plazmidu moduly pro zajištění
stabilní segregace při dělení buňky. V případě plazmidů schopných horizontálního přenosu do jiných
buněk pak kostra plazmidu obsahuje sadu genů pro mobilizaci nebo konjugaci. Konzervativní oblast
plazmidů náležících do stejné skupiny je vysoce homologická, nicméně i v této oblasti může plazmid
prodělávat genetické přestavby (Norman et al., 2009).
Plazmidy představují mozaikové struktury s vysokou plasticitou. Variabilní oblast plazmidu nese
geny pro přídatné funkce hostitelské buňky včetně genů rezistence k antibiotikům a obsahuje různé typy
mobilních genetických elementů (inzerční sekvence, transpozony, integrony), které podporují další
replikáza
A
toxin-antitoxin
parsystém
restriktáza
DNAmetyláza
transpozon
iterony
MobB
MobA
B
Rezistence k antibiotiku nebo jiná přídatná funkce
MGE
Jiné
RepA
RepB
RepC
Replikace
Stabilita
Horizontální přenos
96
přestavby této oblasti vedoucí ke zvyšování diverzity a komplexnosti plazmidu. Mozaikový charakter
plazmidů a příklady jejich evoluce popisuje Obr. 29. Proces rekombinace mezi homologními oblastmi dvou
plazmidů vedoucí k jejich fúzi je představen na Obr. 30. Tento typ přestaveb může plazmidu poskytnout
mnohé benefity; může rozšiřovat hostitelské spektrum plazmidu, zvyšovat frekvenci jeho horizontálního
přenosu nebo poskytovat hostitelské bakterii další selekční výhody.
Obr. 29: Mozaikový charakter a plasticita plazmidů včetně příkladů jejich evoluce
(A) Příklad mozaikového charakteru variabilní oblasti plazmidu. Genová kazeta je součástí integronu, který je vnořen do
kompozitního transpozonu v oblasti multirezistence plazmidu. (B)–(F) evoluční změny spojené s plasticitou plazmidů, (B)
homologní rekombinace vedoucí k inverzím, (C) integrace dalších genů rezistence a mobilních genetických elementů, (D)
začlenění plazmidu nebo jeho části do chromozomu prostřednictvím homologní rekombinace; (E) fúze dvou plazmidů jako
důsledek rekombinace mezi kopiemi stejného elementu na různých plazmidech; (F) ztráta genu z oblasti multirezistence.
A
B
C
D
E
F
97
Obr. 30: Rekombinace mezi homologními oblastmi plazmidů vedoucí k plazmidovým fúzím
Obrázek popisuje fúzi multirezistentního plazmidu pEQ1 z inkompatibilní skupiny IncHI1 (zvýrazněn oranžově) a plazmidu
skupiny IncX1 (zvýrazněn modře) nesoucí gen rezistence k fluorochinolonům qnrS1 a gen blaTEM-1 integrovaný do Tn2
(Dolejska et al., 201424
). Kódující geny jsou vyznačeny šipkou, přičemž orientace šipky určuje směr transkripce. Geny
rezistence k antibiotikům jsou vyznačeny žlutou, modrou nebo zelenou barvou. Místo homologní rekombinace v oblasti
IS26 mezi IncX1 a pEQ1 plazmidy je zvýrazněno červeným křížkem. Homologní rekombinace mezi IS26 obou plazmidů
vedla ke vzniku plazmidu pEQ2 tvořeného kompletní sekvencí plazmidů pEQ1 a IncX1. Důsledkem této fúze je přerušení
transpozonu Tn2.
98
6.2.8.2 Nomenklatura plazmidů
Původně byly plazmidy pojmenovávány podle fenotypu, který kódují. Například Ti plazmid
(Ti – „tumor inducing”) z Agrobacterium tumefaciens získal jméno podle schopnosti indukovat nádory
rostlin (Engler et al., 1975). Jeden z prvních popsaných plazmidů ColE1, identifikovaný u Shigella a E. coli
v Japonsku, nese gen pro tvorbu kolicinu E1 (Snyder a Champness, 2007). Dalším příkladem je Tol plazmid
kódující enzymy pro degradaci toluenu (Williams a Murray, 1974). V současnosti se od tohoto přístupu
ustupuje především z důvodu, že jeden plazmid obvykle kóduje různé funkce kromě té, podle které byl
původně pojmenován. Dnešní nomenklatura využívá systému písmen a číslic. Název plazmidu začíná
písmenem “p”, následuje jedno nebo více velkých písmem reprezentující iniciály autora nebo zkratku
laboratoře, ve které byl plazmid popsán. Název je zakončen sledem číslic charakteristických pouze
pro daný plazmid (Snyder a Champness, 2007). Jeden z nejznámějších plazmidových vektorů pBR322
využívaných v biotechnologii zkonstruoval Bolivar a Rodriguez (Bolivar et al., 1977).
6.2.8.3 Replikace plazmidů
Plazmidy se replikují nezávisle na replikaci bakteriálního chromozomu, proto jsou spolu
s chromozomem a fágovou DNA řazeny mezi replikony. Nesou jeden nebo více specifických sekvencí
označovaných jako počátek replikace oriV („origin of replication vegetative“), které zajišťují iniciaci
replikace (Funnel a Phillips, 2004). Genetická informace plazmidu kóduje pouze některé proteiny
pro replikaci, obvykle pouze ty, které jsou potřebné pro její zahájení v místě oriV. Ostatní proteiny jako
DNA polymerázy, ligázy, primázy, helikázy a další jsou propůjčovány od hostitelské buňky. Počátek
replikace obsahuje specifické repetitivní úseky zvané iterony a A+T bohaté oblasti. V prvním kroku se Rep
protein kódovaný plazmidem váže na sekvence iteronů. Tato vazba vyvolá místní denaturaci DNA
nezbytnou pro správnou funkci DNA polymerázy. Rep slouží také jako podvojný regulátor replikace.
V nízké koncentraci replikaci aktivuje, naopak ve vysoké koncentraci působí jako inhibitor. Zároveň
interaguje s dalšími replikačními proteiny tvořenými hostitelskou buňkou (Dale a Park, 2004; Funnel a
Phillips, 2004).
Replikace plazmidů probíhá jedním ze tří základních mechanizmů zahrnujících (a) replikaci typu
théta, (b) replikaci na otáčející se kružnici a (c) mechanizmus nahrazení řetězce neboli „strand-displacement“
(Obr. 31–33). Replikace théta je specifická pro chromozom a některé plazmidy
gramnegativních bakterií. Většina velkých a nízkokopiových plazmidů se replikuje tímto mechanizmem.
Své jméno získala díky struktuře připomínající řecké písmeno théta, která se tvoří rozvolněním dsDNA
v místě oriV (Obr. 31). Replikací mechanizmem otáčející se kružnice disponují RC plazmidy (RC – „rolling
circle”). Jedná se obvykle o malé plazmidy s vysokým počtem kopií v buňce. Jednotlivé kroky replikace,
které popisuje Obr. 32, připomínají množení ssDNA fágů nebo přenos plazmidu při bakteriální konjugaci
99
(Snyder a Champness, 2007). Replikace mechanizmem nahrazení řetězce je typická pro IncQ plazmidy.
V počátku replikace dochází k tvorbě charakteristické vlásenkové konformace, která umožnuje zahájení
syntézy nového řetězce (Obr. 33). Během replikace je pak vytěsňován jeden řetězec ve formě D-smyčky
(del Solar et al., 1998).
Obr. 31: Replikace bakteriálního plazmidu typu théta
Vytvořeno podle Snyder a Champness, 2007. Replikace probíhá jedním nebo oběma směry od RNA primeru. V případě
jednosměrné replikace (A) se vytvoří pouze jedna replikační vidlice pohybující se kolem molekuly směrem k počátku
replikace. Následně dojde k rozestupu těchto dvou dceřiných molekul DNA. Při obousměrné replikaci (B) se dvě replikační
vidlice pohybují navzájem opačným směrem od oriV dokud se nepotkají, což vede k rozestupu molekul.
oriV
A
B
oriV
oriV
oriV
oriV
oriV
100
Obr. 32: Replikace na otáčející se kružnici
Vytvořeno podle del Solar et al., 1998. V prvním kroku rozpoznává Rep protein palidromatické sekvence DSO („double
strand origin“). Následuje vytvoření zlomu v jednom z řetězců a kovalentní spojení Rep proteinu s fosfátem na 5’ konci
tohoto řetězce. Volný 3’ konec působí jako primer pro DNA polymerázu, která syntetizuje nový řetězec podle matrice
nenaštěpeného vlákna za tvorby kružnicové dsDNA (dvouvláknová, ds – „double strand“). Současně dochází k odvíjení
původního naštěpeného vlákna za tvorby uzavřené kružnicové ssDNA. Výsledkem je tedy jedna molekula finální dsDNA a
jedna ssDNA (jednovláknová, ss – „single strand“), u které musí dojít k dokončení replikace. V následující fázi se tvoří
komplementární vlákno k odvíjenému řetězci ssDNA a to odlišným mechanizmem oproti prvnímu kroku. RNA polymeráza
vytváří primer, který se váže do oblasti SSO („single strand origin“) a zahajuje syntézu (Khan, 1997, 2000).
Obr. 33: Iniciace replikace IncQ plazmidů při
replikaci mechanizmem náhrady řetězce
Vytvořeno podle del Solar et al., 1998. Replikace se
účastní tři replikační protein RepA (5’-3’ helikáza),
RepB (primáza) a RepC (iniciace replikace). Replikace
je zahájena v palidromatických sekvencích ssiA a ssiB
interakcí iteronů s RepA a RepC (vyobrazena pouze
interakce s RepC, RepB se váže do oblastí bohatých
na AT v blízkosti vazby RepC). Interakce s replikačními
proteiny převádí DNA v počátku replikace
do jednovláknové formy za vzniku vlásenky. V této
podobě je ssi oblast lépe přístupná pro RepB s funkcí
primázy, který tyto palidromatické sekvence
rozpoznává a specificky se k nim váže. Během
replikace RepA s funkcí helikázy odděluje původní
vlákna DNA. Nově syntetizované vlákno je zvýrazněno
modře. Šipky značí směr syntézy (5’-3’) nového
vlákna.
DSO
Rep zlom
3’ konec
slouží jako
primer
spojení
Rep s 5’
koncem
zlom a spojení Rep
proteinem
DNA
polymeráza III
DNA ligáza
SSO
ssDNA
RNA
primer
DNA
polymeráza III
SSO
RNA
polymeráza
101
6.2.8.4 Regulace replikace plazmidů
Replikace plazmidu je energeticky náročný proces. Plazmidy disponují vlastními autoregulačními
mechanizmy, které zajišťují udržování optimálního počtu kopií v závislosti na velikosti plazmidu, frekvenci
replikace a kódovaných genech. Plazmidy s vysokým počtem kopií jsou obvykle malé a replikují se
mechanizmem otáčející se kružnice. Naopak nízkokopiové plazmidy, které jsou obvykle velké (> 30 kb),
využívají replikaci typu théta a jejich množení je obvykle spjato s replikací bakteriálního chromozomu
(Funnel a Phillips, 2004).
K regulaci počtu kopií využívají dvou základních mechanizmů. Při prvním mechanizmu založeném
na principu protismyslné (antisense) RNA dochází k inhibici tvorby primeru nebo Rep proteinu, které jsou
potřebné pro iniciaci replikace. Druhý mechanizmus využívá interakci iteronů s Rep proteiny.
Regulace replikace ColE1 plazmidů probíhá prostřednictvím malé RNA (RNA I). K inhibici replikace
dochází prostřednictvím interakce RNA I s molekulou RNA II. Oba typy RNA jsou navzájem
komplementární, jelikož jsou přepisovány z opačných řetězců stejného úseku plazmidu. V případě
absence RNA I dochází k vazbě molekuly RNA II k DNA v místě oriV za tvorby hybridního RNA-DNA
komplexu. V této formě je vlákno RNA I štěpeno RNázou, která uvolňuje 3’ hydroxylovou skupinu sloužící
jako primer pro zahájení replikace DNA polymerázou. RNA I se vytváří při vysokém počtu kopií plazmidu
v buňce. Váže se na komplementární molekulu RNA II za tvorby dsRNA duplexu, což vede k inhibici
replikace (Funnel a Phillips, 2004; Snyder a Champness, 2007).
Podobným mechanizmem disponují některé IncFII plazmidy, které na rozdíl od ColE1 plazmidů
nevyužívají protismyslné RNA k inhibici tvorby RNA primeru, ale jejím prostřednictvím potlačují translaci
Rep proteinu. Gen repA kódující Rep protein je u těchto plazmidů přepisován ze dvou různých promotorů.
Promotor PcopB zajišťuje transkripci repA a současně copB. Druhý promotor PrepA přítomný v sekvenci genu
copB pak přepisuje pouze gen repA. Bezprostředně po vstupu plazmidu do buňky probíhá transkripce
repA z obou promotorů, což zajišťuje rychlý nárůst Rep proteinu. Plazmidová DNA se množí až
do dosažení požadovaného počtu kopií. Translace proteinu CopB, který působí jako represor PrepA, vede
k poklesu Rep proteinu a zastavení replikace (Snyder a Champness, 2007).
Druhá skupina plazmidů využívá pro kontrolu počtu kopií iterony. Jak bylo výše popsáno, iterony
jsou repetitivní sekvence nezbytné pro iniciaci replikace, mají ale rovněž schopnost regulovat množení
plazmidu. Tohoto mechanizmu využívají především nízkokopiové IncF nebo IncP plazmidy. S rostoucí
koncentrací plazmidů v buňce roste také množství Rep proteinu. Rep proteiny pak vytváří dimery, které
se vážou k sekvencím iteronů na dvou rozdílných molekulách plazmidů. U takto zpárovaných plazmidů
pak nemůže probíhat replikace. Iteronů je také využíváno k zábraně replikace vzájemně inkompatibilních
plazmidů. Pokud jsou v buňce přítomné dva plazmidy se stejnou sekvencí iteronů, dojde k párování těchto
102
plazmidů v homologních oblastech iteronů vedoucí k inhibici jejich replikace (Funnel a Phillips, 2004;
Snyder a Champness, 2007).
6.2.8.5 Inkompatibilita plazmidů
Bakteriální buňka může nést jeden nebo mnoho různých plazmidů za splnění podmínky, že každý
z těchto plazmidů nese odlišný počátek replikace oriV. Plazmidy se stejným počátkem replikace obvykle
nejsou schopny se množit v téže buňce a jsou pak považovány za neslučitelné neboli inkompatibilní
(Snyder a Champness, 2007). Pojem inkompatibilita plazmidů (Inc) je tedy definována jako neschopnost
dvou různých plazmidů se stabilně udržovat v jedné hostitelské buňce (Novick et al., 1976; Novick a
Hoppensteadt, 1978). Plazmidy ze stejné skupiny inkompatibility sdílí podobné mechanizmy replikace
včetně kontrolních systémů a procesu segregace do dělících se dceřiných buněk (Novick, 1987). Tento
fenomén je přiblížen v následujících odstavcích.
Při buněčném dělení obvykle nedochází k rovnoměrnému rozdělení plazmidu do dceřiných
buněk. V případě, že se jedná o plazmidy z různých Inc skupin, replikují se v nových buňkách až
do dosažení požadovaného počtu kopií. Před buněčným dělením tedy každý z plazmidů dosáhne stejného
počtu kopií jako v původní donorové buňce (Obr. 34). Pokud však buňka nese dva plazmidy ze stejné Inc
skupiny, nemůže být v důsledku sdílení stejných mechanizmů kontroly replikace zajištěno dostatečné
namnožení obou plazmidů. Kontrolní systémy totiž nerozeznávají dva plazmidy jako odlišné a náhodně
replikují jeden nebo druhý. Jeden z plazmidů pak obvykle bývá méně zastoupen (Obr. 35). Při buněčném
dělení má plazmid s menším počtem kopií v buňce také nižší pravděpodobnost rovnoměrné distribuce
do dceřiných buněk a do některé z buněk se nemusí vůbec přenést (Snyder a Champness, 2007).
Dalším faktorem, který ovlivňuje kompatibilitu plazmidů, je způsob jejich rozestupu do dceřiných
buněk při buněčném dělení. I jinak odlišné plazmidy, které disponují stejným mechanizmem segregace,
jsou vzájemně inkompatibilní. Takovéto plazmidy vytváří při procesu segregace páry a každá
z dceřiných buněk pak nese pouze jeden plazmid z tohoto páru. Při buněčném dělení tedy dochází
ke ztrátě jednoho či druhého plazmidu (Snyder a Champness, 2007).
103
Obr. 34: Stabilní udržování dvou plazmidů ze stejných inkompatibilních skupin při buněčném dělení
Vytvořeno podle Snyder a Champness, 2007.
Obr. 35: Ztráta plazmidů náležících do stejné inkompatibilní skupiny při buněčném dělení
Vytvořeno podle Snyder a Champness, 2007.
nerovnoměrná
distribuce plazmidů
ztráta plazmidu A
nerovnoměrná
distribuce plazmidů
každý z plazmidů
reguluje vlastní počet kopií
nerovnoměrná distribuce
plazmidů
ztráta plazmidu B
nerovnoměrná
distribuce
plazmidů
104
6.2.8.6 Koexistence plazmidů ze stejné Inc skupiny
Plazmidy ze stejné Inc skupiny se mohou za určitých okolností stabilně množit v jedné buňce. Jde
o případy, kdy jsou oba plazmidy vysokokopiové a nesou odlišné geny antibiotické rezistence nebo jiné
selekční faktory. Zároveň musí působit kontinuální selekční tlak, který zajistí stabilitu obou plazmidů.
Problém udržování plazmidů ze stejné Inc skupiny se týká především plazmidů nízkokopiových.
Mezi tyto plazmidy náleží IncF, které se v buňce nachází obvykle v jedné kopii (Snyder a Champness,
2007). Pro stabilní udržování využívají různé mechanizmy zahrnující segregační a adikční systémy, které
budou popsány níže. Fenomém inkompatibility rovněž mohou překonávat svým mozaikových
charakterem spojeným s přítomností dvou nebo i více replikonů na jednom plazmidu (Johnson a Nolan,
2009; Osborn et al., 2000). Sdružování FII replikonu s příbuznými replikony skupin FIA či FIB bylo popsáno
a představuje důležitý proces v evoluci plazmidů skupiny IncF (Bergquist et al., 1982; Bergquist et al.,
1986; Osborn et al., 2000).
Mozaikové IncF plazmidy obsahující více replikonů jsou popisovány u E. coli a Klebsiella spp.
ve spojitosti s klinicky významnou rezistencí (Villa et al., 2010). Multirezistentní IncF plazmidy nesoucí
replikony FIA a FIB spolu s blaCTX-M udílející ESBL fenotyp, aac(6’)-Ib-cr pro plazmidově determinovanou
rezistenci k fluorochinolonům a dalšími geny pro rezistenci k jiným antibiotickým skupinám byly
zdokumentovány (Albrechtova et al., 2012b11
; Tausova et al., 201210
). Šíření beta-laktamázy CTX-M-15
mezi různými sekvenčními typy K. pneumoniae zprostředkované IncF plazmidy bylo popsáno
u pediatrických pacientů na Klinice dětské onkologie. U těchto kmenů byly nalezeny dva IncFIIK plazmidy
spolu přítomné v jedné buňce. Oba plazmidy byly multireplikonové a vykazovaly minimální odlišnosti
v sekvenci genu copA kódující FIIK replikon. Menší z plazmidů pKDO1 nesl replikon FIIK sekvenční varianty
7 (FIIK7) a dále replikon náležící do Rep-3 rodiny. Větší plazmid pKPN-CZ obsahoval replikon FIBK a dále
FIIK sekvenční varianty 8 (FIIK8) (Dolejska et al., 2013a17
). Bylo prokázáno, že pro koexistenci dvou
příbuzných IncF plazmidů postačuje pouze několika mutací v genu copA (Osborn et al., 2000).
6.5.8.7 Klasifikace plazmidů Enterobacteriaceae
Fenoménu inkompatibility je využíváno při klasifikaci plazmidů do skupin. První pokusy
o vytvoření systému byly učiněny Hedgesem a Dattou v 70. letech minulého století. Pro detekci různých
skupin inkompatibilních plazmidů Enterobacteriaceae byla navržena sada DNA prób homologických
k oblastem kódujícím replikační funkce (Couturier et al., 1988). Na základě této prvotní metodiky bylo
později vyvinuto několik technik založených na detekci replikonů pomocí PCR (Carattoli et al., 2005a;
Fekete et al., 2002; Gotz et al., 1996; Johnson et al., 2012a; Johnson et al., 2007). Mezi ty nejpoužívanější
patří metoda PBRT („PCR-based replicon typing“) vyvinutá týmem A. Carattoli (Carattoli et al., 2005a),
105
která se stala užitečným nástrojem pro studium epidemiologie rezistentních plazmidů (Carattoli, 2009).
Touto metodikou je možné detekovat plazmidy nejvýznamnějších inkompatibilních skupin zahrnující FIA,
FIB, FIC, FIIA, HI1, HI2, I1-Igamma, L/M, N, P, W, T, A/C, K, B/O, X2 a Y. Výše popsaný fenomén, kdy některé
plazmidy nesou více různých replikonů, však přináší problémy při klasifikaci.
Novým přístupem je pak klasifikace plazmidů na základě relaxáz (Compain et al., 2014; Francia et
al., 2004; Garcillan-Barcia et al., 2009; Pilar Garcillan-Barcia et al., 2015) nebo plazmidových segregačních
systémů (Bousquet et al., 2015). Tato schémata však zatím nejsou všeobecně přijímána.
Plazmidy Enterobacteriaceae byly původně klasifikovány do 26 základních inkompatibilních
skupin (Funnel a Phillips, 2004). Díky rychle přibývajícímu množství sekvenčních dat v genových bankách
jsou některé plazmidy překlasifikovány a jsou rovněž identifikovány nové inkompatibilní skupiny.
Nedávno byla vyvinuta online aplikace pro in silico detekci a charakterizaci plazmidů Enterobacteriaceae
s využitím dat celogenomového sekvenování (Carattoli et al., 2014), která je volně dostupná
na https://cge.cbs.dtu.dk/services/PlasmidFinder/. Tato databáze je průběžně aktualizována na základě
současných poznatků.
6.2.8.8 Horizontální přenos plazmidů
Nejefektivnější nástroj přenosu plazmidů mezi buňkami představuje konjugace. Plazmidy
schopné tohoto přenosu se nazývají konjugativní plazmidy. Konjugace je složitý proces, na kterém se
podílí skupina genů uspořádaná na plazmidu ve specifické oblasti Tra („transfer“ neboli přenos). Tato
oblast zaujímá podstatnou část celkové genetické informace plazmidu. V případě IncF plazmidů, u kterých
je mechanizmus konjugace podrobně zdokumentován, oblast Tra dosahuje přes 30 kb a je tvořena
až 60 geny. Geny tra u IncF plazmidů zajišťují (Snyder a Champness, 2007) (a) biosyntézu a sestavování
pilu (traA,B,C,E,F,G,H,L,K,Q,U,V,W), (b) stabilizaci konjugačního páru (traG,N), (c) konjugativní
metabolizmus (traD,I,M,Y,Z), (d) regulaci přenosu (traJ, finO, finP) a (e) povrchovou exkluzi (traS, T).
Proces konjugace je blíže popsán v následujících odstavcích a graficky shrnut na Obr. 36.
106
replikace komplementárních
vláken
donor (F+) recipient (F-) donor recipient
konjugační kanál
spojovací protein
tvorba konjugačního páru
spojovací protein
aktivuje relaxázu
relaxáza zlom jednoho řetězce
v místě oriT
oriT
helikáza přenos řetězce
relaxáza3’OH
primer
recyklizace přeneseného
řetězce
donor (F+) transkonjugant (F+)
konjugativní
plazmid
Mob
plazmid
tvorba konjugačního páru
a spojovacího proteinu
F plazmidem
spojovací protein aktivuje
relaxázu Mob plazmidu
zlom v oriT
oriT
relaxáza
primáza
přenos řetězce
relaxáza
syntéza
komplementárních
vláken
rozpad páru
Obr. 36: Schéma přenosu konjugativního plazmidu
Vytvořeno podle Snyder a Champness, 2007.
Obr. 37: Schéma přenosu Mob plazmidu
Vytvořeno podle Snyder a Champness, 2007.
107
V prvním kroku konjugačního procesu musí dojít ke kontaktu mezi donorovou a recipientní
buňkou. Ten je zajištěn buď prostou kolizí nebo v případě gramnegativních bakterií prostřednictvím
konjugativních (sex) pilů, které rozpoznávají příslušné receptory na recipientní buňce. Pily představují
struktury tvořené proteiny piliny. Nacházejí se na povrchu bakteriální buňky, dosahují průměru 10 nm a
obsahují centrální kanál (Snyder a Champness, 2007). Struktura pilů se mezi jednotlivými plazmidovými
transferovými systémy značně liší. Komplexní transferové systémy (např. IncF plazmidů) disponují
dlouhými a tenkými pily se schopností kontrakce pro zajištění úzkého kontaktu buněk, což je výhodné
především pro konjugaci v tekutých médiích. Naopak neohebné (tuhé) pily zajišťují konjugaci na pevných
podkladech (Funnel a Phillips, 2004).
V dalším kroku konjugace dochází ke stabilizaci spojení donorové a recipientní buňky a k tvorbě
konjugačního kanálu, kterým prochází přenášené vlákno DNA. Některé tra geny, které se podílí na tvorbě
konjugačního kanálu, byly identifikovány, ale jeho přesná struktura doposud popsána nebyla (Samuels et
al., 2000). Specifita přenosu je zajištěna spojovacími („coupling”) proteiny, které se váží ke konjugačnímu
kanálu a aktivují enzym relaxázu. Relaxáza je specifická DNA endonukleáza, která vytváří jednořetězcové
zlomy v okolí oblasti oriT („origin of transfer”), od které je zahájen přenos DNA. Zlomené vlákno DNA
přechází ve směru 5’-3’ s navázanou molekulou relaxázy do recipientní buňky. Recyklizace jednovláknové
DNA je po přenosu zajištěna relaxázou. 3’ konec přenášeného vlákna slouží v donorové buňce jako primer
pro zahájení syntézy komplementárního vlákna mechanizmem otáčející se kružnice. V recipientní buňce
primáza syntetizuje RNA primer potřebný pro tvorbu komplementárního vlákna. Po přenosu DNA se
konjugační pár rozpadá (Snyder a Champness, 2007).
Proces konjugace je regulován na mnoha úrovních. Z důvodu vysoké energetické náročnosti je
transkripce genů tra po většinu času reprimována. Vysoce konjugativní genetické elementy obvykle
kódují různé povrchové exkluzní systémy, které regulují nepotřebný přenos mezi buňkami obsahující
stejné nebo vysoce příbuzné plazmidy. Například u F plazmidů se tvoří vnější membránový protein TraT
bránící stabilnímu spojení buněk, které již obsahují IncF plazmidy (F+). Případně se tvoří protein vnitřní
membrány TraS, který znemožňuje vstup DNA do buňky při náhodném spojení dvou F+ buněk (Snyder a
Champness, 2007).
Konjugace je ovlivněna celou řadou fyziologických parametrů (hustotou buněk, teplotou,
hladinou kyslíku, růstovou fází). Například konjugační systém plazmidů skupiny inkompatibility IncH je
vysoce termosenzitivní a plazmidy této skupiny jsou přenášeny při teplotním optimu 20° C (Taylor, 2009).
Další skupinu představují mobilizovatelné (Mob) plazmidy, které kódují pouze některé z výše
popsaných funkcí a pro svůj přenos do recipientních buněk využívají aparát vytvořený konjugativním
plazmidem (Snyder a Champness, 2007). Mob plazmidy nesou počátek přenosu oriT a mob geny
pro tvorbu relaxázy a helikázy. Proces mobilizace je v podstatě identický s konjugací (Obr. 37). V prvním
108
kroku dochází ke kontaktu buněk a tvorbě kanálu, což je zajištěno plazmidem konjugativním. Spojovací
protein tvořený opět konjugatvním plazmidem aktivuje relaxázu mobilizovatelného plazmidu. Relaxáza
se váže do oriT, kde vytváří zlom v jednom z vláken. Následně je 5’ konec DNA vlákna vtahován relaxázou
do recipientní buňky. Mezi nejznámější mobilizovatelné plazmidy Enterobacteriaceae asociované
s rezistencí k antibiotikům patří ColE plazmidy. K přenosu využívají konjugační aparát IncFI, IncI1 a IncP
plazmidů (Smillie et al., 2010).
Plazmidy, které nekódují vlastní přenos se mohou šířit horizontální cestou prostřednictvím
bakteriofágů, transformací nebo po jejich integraci do molekul přenosných plazmidů také konjugací nebo
mobilizací (Smillie et al., 2010).
6.2.8.9 Hostitelské rozmezí plazmidů
Jednotlivé skupiny plazmidů se odlišují rozmezím hostitelských bakterií, ve kterých se mohou
replikovat. Z tohoto pohledu rozlišujeme plazmidy s úzkým spektrem hostitelů, např. ColE nebo pBR322,
které se replikující pouze v E. coli a příbuzných druzích. Druhou skupinu představují plazmidy se širokým
spektrem hostitelů (např. RK2, RSF1010 nebo RC plazmidy). Až na drobné výjimky platí pravidlo, že
plazmidy gramnegativních bakterií se nereplikují v buňkách grampozitivních bakterií a obráceně.
Hostitelské rozmezí plazmidů je určováno charakterem replikačního počátku oriV (Snyder a Champness,
2007).
Plazmidy s širokým spektrem hostitelů disponují řadou nástrojů (Funnel a Phillips, 2004).
Například specifická struktura oriV oblasti IncP plazmidů která splňuje požadavky různých druhů
bakteriálních hostitelů (Popowska a Krawczyk-Balska, 2013). Rovněž IncQ plazmidy jsou vysoce
promiskuitní a mají schopnost množit se v buňkách gramnegativních i grampozitivních bakterií. Nesou
genetickou informaci pro tvorbu dalších proteinů potřebných pro replikaci (např. helikázu a primázu) a
jsou tedy nezávislé na replikačních proteinech kódovaných chromozomem hostitelské buňky (Meyer,
2009).
Hostitelská specifita plazmidů má své dopady na antibiotickou rezistenci. Plazmidy nesoucí geny
rezistence se schopností replikovat se v širokém spektru hostitelů a horizontálně se přenášet
do nepříbuzných bakterií mají vyšší potenciál šířit přenášený gen rezistence v bakteriálních populacích.
Dalším nástrojem pro rozšíření spektra hostitelských bakterií je přítomnost dvou a více různých
replikonů v jedné molekule plazmidu (Funnel a Phillips, 2004). Tento problém byl představen v kapitole
6.5.8.6. Příkladem je pGS500 u klinických izolátů K. pneumoniae obsahující replikon alfa, který plazmid
řadí mezi úzkospektré IncFII plazmidy a replikon beta příbuzný plazmidům IncN se širokým rozmezím
hostitelských buněk (Osborn et al., 2000). Tyto typy plazmidů jsou dokumentovány i ve spojitosti
109
s antibiotickou rezistencí. Mohou vznikat fúzí dvou celých plazmidů nebo výměnou jejich částí homologní
rekombinací (Dolejska et al., 201424
). Přítomnost dvou i více různých funkčních replikonů však nemusí
automaticky zajistit větší rozmezí hostitelů. Typickým příkladem jsou IncF plazmidy, které nesou dva a
více příbuzných F replikonů (např. FIA, FIB, FIIA, FIIK atd.), úzce vázané na buňky enterobakterií, zejména
E. coli a K. pneumoniae (Funnel a Phillips, 2004).
6.2.8.10 Mechanizmy stabilního udržování plazmidů
Plazmidy disponují různými mechanizmy pro stabilní udržování se v hostitelské buňce. Nástroje
vysokokopiových plazmidů se odlišují od těch, které k přežití používají plazmidy s nízkým počtem kopií
na buňku. Tyto strategie zahrnují aktivní segregační mechanizmy, adikční systémy nebo specifické
nástroje pro rozdělování plazmidových multimerů.
Segregační stabilita plazmidů
Jedná se o aktivní proces uplatňovaný především nízkokopiovými plazmidy, který zajišťuje přenesení
alespoň jedné kopie plazmidu do nově vzniklých dceřiných buněk při cytokinezi. Bez tohoto systému by
docházelo k jejich náhodné distribuci, což je v případě plazmidů s jednou či dvěma kopiemi na buňku
spojeno s rizikem jejich ztráty při buněčném dělení. Tato funkce, označovaná jako Par („partitioning”), je
v principu totožná se segregací bakteriálního chromozomu (Snyder a Champness, 2007).
Bylo popsáno několik typů Par systémů, které se liší uspořádáním kódujících genů a aminokyselinovou
sekvencí proteinů. Mezi nejrozšířenější plazmidové segregační systémy patří ParA-ParB, SopA-SopB,
RepA-RepB, ParM-ParR a další (Cerin a Hackett, 1993). Pro všechny Par systémy je společná přítomnost
dvou plazmidově kódovaných proteinů Par a specifického vazebného místa v plazmidové sekvenci, které
funguje podobně jako centromera (Obr. 38). Jeden z Par proteinů (ParB v případě systému ParA-ParB
nebo SopB u systému SopA-SopB) se váže na oba plazmidy v této specifické sekvenci (parC2/sopC) a dává
vznik plazmidovému páru. Druhý Par protein (ParA/SopA), který disponuje ATPázovou aktivitou, se váže
na ParB/SopB spojující plazmidový pár. Navíc využívá energii uvolněnou z ATP k pohybu plazmidu
do středu hostitelské buňky. Polymerací podjednotek ParA/SopA se vytváří vlákno, které postupně
oddaluje plazmidy z páru a segreguje je do dceřiných buněk (Bouet et al., 2007).
110
Obr. 38: Schéma segregace plazmidů při buněčném dělení
Vytvořeno podle Bouet et al., 2007.
Plazmidové adikční systémy
Plazmidy disponují systémy, které
využívají k vlastní proliferaci smrt hostitelské
buňky, která ztratila plazmid. Plazmidové
adikční systémy se skládají ze dvou hlavních
komponent (Obr. 39). Jedna z komponent plní
funkci toxinu a druhá představuje protilátku
neboli antitoxin, která toxin inaktivuje. Pokud
buňka nese plazmid, vytváří se obě komponenty. V případě ztráty plazmidu a tím i genů pro syntézu
adikčního systému se žádná z komponent nově nevytváří, v buňce však přetrvává toxin a jeho antitoxin
vytvořený před ztrátou plazmidu. Antitoxin je labilní, brzy se rozkládá účinkem enzymů a stabilnější toxin
pak usmrcuje buňky bez plazmidu (Funnel a Phillips, Funnel, 2004; Rawlings, 1999).
parB parC2
Obr. 39: Schéma plazmidového adikčního systému
Vytvořeno podle Funnel a Phillips, 2004.
SopA-SopB systém
sopA sopB sopC
ParA-ParB systém
parC1 parA
ParA/SopA
ParB/SopB
centromera
111
Adikční systémy klasifikujeme do tří základních skupin na základě kroku v letálním účinku toxinu,
který je antitoxinem inhibován, na (a) klasické proteinové systémy, (b) restrikčně modifikační systémy a
(c) systémy regulované protismyslnou RNA.
Klasické proteinové systémy (známé pod názvem systém toxin-antitoxin) jsou založeny na inhibici
toxinu jeho přímou vazbou s antitoxinem (Funnel a Phillips, 2004; Obr. 40). Jsou rozšířené na
multirezistentních plazmidech E. coli a koliformních bakterií nesoucích geny pro širokospektré beta-laktamázy
CTX-M a další klinicky významné mechanizmy rezistence. Prevalentní adikční systémy (nesené
zejména IncF plazmidy) zahrnují CcdAB, PemKI, VagCD a RelBE (Mnif et al., 2010; Tamang et al., 2013).
Např. toxin CcdB inhibuje podjednotku DNA gyrázy GyrA a je inaktivován antitoxinem CcdA (Dao-Thi et
al., 2005).
Obecnou funkcí restrikčně modifikačních (RM) systémů je ochrana buňky před cizorodou DNA
(Obr. 40). Představují tak hlavní bariéru horizontálního toku genů (Tock a Dryden, 2005), ale jsou rovněž
nástrojem pro stabilní udržování plazmidů v buňce. Funkci toxinu plní restrikční enzym napadající
specifickou sekvenci DNA na chromozomu hostitelské bakterie. Modifikační systém, který chrání cílová
místa toxinu jejich metylací, pak působí jako antitoxin (Kobayashi, 2001). R-M systém EcoRII je rozšířený
v sekvencích multirezistentních IncN a IncF plazmidů (Carattoli et al., 2010; Dolejska et al., 2013a,b14,17
;
Kayama et al., 2015; Woodford et al., 2009).
Třetí typ plazmidového adikčního systému je založen na postranskripční inhibici syntézy toxinu
prostřednictvím protismyslné RNA (Obr. 40). V případě ztráty plazmidu je pak antitoxin rychle degradován
RNázou. Mezi známé systémy nesené rezistentními plazmidy enterobakterií patří Hok-Sok, SrnB a PndAC
(Brouwer et al., 2014; Doumith et al., 2012; Funnel a Phillips, 2004; Yang et al., 2015). V případě Hok-Sok
systémů kóduje gen hok transmembránový protein s funkcí toxinu, který rychle vyvolává ztrátu
membránového potenciálu. Tvorba Hok toxinu je regulována Sok-RNA, která je komplementární
k začátku genu hok a plní tak funkci protismyslné RNA (Thisted a Gerdes, 1992).
Pro IncF plazmidy je charakteristická přítomnost několika různých adikčních systémů na jednom
plazmidu současně (Dolejska et al., 2013a17
; Doumith et al., 2012; Woodford et al., 2009). Tato vlastnost
je jedním z vysvětlení jejich úspěchu v celosvětovém šíření širokospektrých beta-laktamáz skupiny CTXM.
Například na IncF plazmidech multirezistentního epidemického klonu E. coli ST131 s produkcí CTX-M-
15 bylo nalezeno až 5 různých adikčních systémů (Doumith et al., 2012).
112
Klasický proteinový systém (typ A)
Restrikčně modifikační systém (typ B)
Systém regulovaný protismyslnou RNA (typ C)
Obr. 40: Plazmidové adikční systémy
Vytvořeno podle Funnel a Phillips, 2004.
113
Systém rozdělování multimerních plazmidových forem
Vysokokopiové plazmidy jsou náchylné k tvorbě dimerních až multimerních struktur v důsledku
homologní rekombinace mezi identickými DNA sekvencemi jednotlivých kopií plazmidů. Multimery se
snadněji replikují pravděpodobně v důsledku přítomnosti několika počátků replikace. Tvorba těchto
struktur však může vést k problémům při segregaci plazmidů během buněčného dělení. Plazmidy
s vysokým počtem kopií nedisponují systémem aktivní segregace jako plazmidy nízkokopiové a do buňky
se rozestupují náhodně. Přítomnost plazmidových multimerů, které jsou rozpoznávány při segregaci jako
jeden plazmid, je spojena s rizikem, že se do jedné z dceřiných buněk nedostane žádná kopie plazmidu
(Snyder a Champness, 2007). Plazmidy však využívají různé místně specifické rekombinační systémy, které
tyto multimerní formy rozdělují. Mezi nejlépe charakterizované patří cer-XerC,D popsaný u ColE1
plazmidů. Resolváza XerCD kódovaná chromozomem hostitelské buňky rozpoznává oblast plazmidu cer
a místně specifickou rekombinací převádí dimerní struktury zpět na monomery (Crozat et al., 2014).
6.2.8.11 Funkce kódované plazmidy
Kromě genetické informace pro základní funkce plazmidů jakými jsou replikace, stabilní udržování
se v buňce a horizontální přenos, plazmidy kódují různé funkce, které dávají hostitelské buňce selekční
výhodu. Hrají úlohu v patogenezi, poskytují determinanty rezistence k široké paletě antimikrobiálních
látek, dezinfekčních přípravků a těžkých kovů nebo kódují enzymy degradující organické polutanty. Jeden
plazmid může nést současně geny pro několik výše uvedených funkcí (Obr. 41). V následujících odstavcích
jsou tyto plazmidy přenášené funkce gramnegativních bakterií blíže představeny. Pozornost se soustředí
zejména na sdružení přídatných funkcí s geny rezistence k antibiotikům nesené plazmidy. První kapitola
věnovaná jedné z klinicky nejvýznamnějších funkcí plazmidů, rezistenci k antibiotikům, je pouze stručným
úvodem do problému. Plazmidy odpovědné za šíření rezistence ke klinicky významným antibiotikům
(na příkladu šíření širokospektrých beta-laktamáz) budou blíže popsány v kapitole 7.10.3.
Rezistence k antibiotikům
Plazmidy poskytují hostitelské buňce schopnost odolávat inhibičnímu účinku prakticky všech
skupin antimikrobiálních látek. Mezi nejčastější mechanizmy asociované s plazmidy patří rezistence
k beta-laktamům, tetracyklinům, sulfonamidům, aminoglykozidům, amfenikolům, makrolidům,
trimetoprimu a chinolonům. Tomuto tématu se podrobně věnuje recentní publikace A. Carattoli
(Carattoli, 2009).
114
Obr. 41. Klebsiella pneumoniae ST416 nesoucí IncFIIK plazmidy sdružené s rezistencí k šesti antibiotickým skupinám a dalšími přídatnými funkcemi
Kmen K. pneumoniae ST416 produkující CTX-M-15 byl izolován z pacientů na Klinice dětské onkologie ve Fakultní nemocnici Brno (Dolejska et al., 201212
). U kmene byla stanovena kompletní
sekvence plazmidů technikou nové generace sekvenování s cílem charakterizovat kontext genu blaCTX-M-15 a identifikovat další přídatné faktory, které se mohly podílet na šíření a udržování
kmene v nemocničním prostředí (Dolejska et al., 2013a17
). Kmen obsahoval dva IncFIIK plazmidy, pKDO1 (127 508 bp; GenBank JX424423) a pKPN-CZ (207 819 bp; JX424424). Oba plazmidy
byly multireplikonové a vykazovaly drobné odlišnosti v sekvenci genu copA kódující FIIK replikon. pKDO1 nesl replikon FIIK sekvenční varianty 7 (FIIK7) a dále replikon náležící do Rep-3 rodiny.
Větší plazmid pKPN-CZ obsahoval replikon FIBK a dále FIIK sekvenční varianty 8 (FIIK8). Plazmid pKDO1 byl spojen s antibiotickou rezistencí. Obsahoval oblast multirezistence o velikosti 40 kb
(detail šedé oblasti) s geny rezistence k šesti antibiotickým skupinám zahrnující beta-laktamy (blaCTX-M-15, blaTEM-1, blaOXA-1), fluorochinolony (qnrB1, aac(6‘)-Ib-cr), tetracykliny [tet(A)],
aminoglykozidy [aac(3‘)-II, strAB, aac(6‘)-Ib-cr], sulfonamidy (sul2) a trimetoprim (dfrA14). Na plazmidu pKPN-CZ byly identifikovány různé geny kódující přídatné funkce, které se mohly podílet
na virulenci a perzistenci studovaného kmene (detail červené oblasti). Jednalo se o geny pro produkci biofilmu, geny zajišťující rezistenci k vysokým teplotám, odolnost k těžkým kovům a sady
genů kódující potenciální virulenční faktory (například systém pro příjem železitých iontů). Výše popsané variabilní oblasti obou plazmidů byly vnořeny do kostry plazmidů v okolí genů pro
replikaci (zelená oblast). Konzervativní oblast obou plazmidů dále obsahovala sadu genů pro konjugativní přenos (Tra; žlutá) a stabilní udržování plazmidu (modrá).
114
115
Rezistentní plazmidy dosahují obvykle velikosti > 20 kb, nesou nástroje pro stabilní udržování se
v hostitelské buňce (popsané výše v kap. 6.5.8.8) a obvykle disponují schopností konjugativního přenosu
mezi buňkami. Začleňování genů není náhodné a probíhá v charakteristických cílových místech plazmidu.
Oblast, která již nese nějaký gen rezistence, je pak náchylnější k dalším genetickým přestavbám. Geny
rezistence jsou na plazmidech přítomné v multirezistentní oblasti označované jako MRR oblast
(„multidrug resistance region”) vnořené do základní kostry plazmidu. Tato oblast je vysoce plastická a
vykazuje mozaikový charakter (Obr. 42). Díky tomuto uspořádání pak rezistentní plazmid může buňce
poskytnout fenotyp rezistence k různým antibiotickým skupinám současně. Geny pro rezistence nesené
plazmidy tvoří součást jiných mobilních elementů (transpozonů, integronů) nebo se nachází v blízkosti
inzerčních sekvencí. Tato organizace zajišťuje v hostitelské buňce jejich přemisťování na jiné místo v rámci
téže molekuly plazmidu případně i mobilizaci mezi různými genofory (Norman et al., 2009).
Rezistentní plazmidy enterobakterií náleží do různých Inc skupin. Byla popsána spojitost mezi Inc
skupinou a genem rezistence. Například plazmidy skupin IncF, IncA/C, IncL/M, IncN a IncI1 se významně
podílí na šíření beta-laktamáz CTX-M a CMY-2 (Carattoli, 2009, 2013). Tyto skupiny plazmidů v kontextu
šíření klinicky významných mechanizmů rezistence budou popsány v kapitole 7.10.3.
Rezistence ke kovům a biocidům
Jelikož se těžké kovy v prostředí nachází přirozeně, je také rezistence bakterií k těmto látkám
velice běžná (Datta a Hughes, 1983). Místa ovlivněná člověkem (nemocnice, nemocniční i průmyslové
odpadní vody, zemědělská půda, těžební oblasti) obsahují zvýšené podíly bakterií s touto rezistencí
(Altimira et al., 2012; Bharagava et al., 2014; Heck et al., 2015; Mourao et al., 2015; Nakahara et al., 1977;
Sutterlin et al., 2014; Xiao et al., 2013).
Antimikrobiální aktivity některých kovů je využíváno například v dezinfekčních přípravcích
v nemocnicích nebo při úpravě vody. V současnosti nachází těžké kovy také uplatnění v lékařství
při přípravě nanočástic, které se vyznačují zvýšenou antibakteriální aktivitou a snadnou distribucí
v lidském organizmu (Silver, 2003; Silver a Phung, 2005). Rezistence k těmto látkám může tedy významně
komplikovat prevenci a terapii infekčních onemocnění. Toxickému účinku kovů se bakterie brání různými
mechanizmy zahrnující aktivní odčerpávání kovu, jeho enzymatickou modifikaci nebo tvorbu proteinů
vázajících kov. Tato rezistence je obvykle kódovaná geny ve formě operonů nesených velkými (100-300
kb) plazmidy různých Inc skupin. Na plazmidech byly nalezeny geny pro rezistenci ke stříbru, arsenu,
kadmiu, kobaltu, chromu, mědi, rtuti, niklu, olovu, teluru nebo zinku.
116
Obr. 42: Organizace MRR oblasti plazmidu pEQ1 a její srovnání s příbuznými oblastmi jiných plazmidů
Vytvořeno podle Dolejska et al., 201424
. Plazmid pEQ1 (GenBank KF362121) byl identifikován u izolátů E. coli z koní hospitalizovaných na Klinice chorob koní, VFU Brno. Náležel do skupiny
IncHI1 a nesl multirezistentní oblast s geny rezistence k šesti skupinám antibiotik (geny rezistence vyznačeny barevně, orientace genu označena šipkou) zahrnující beta-laktamy (blaCTX-M-
1), tetracykliny [tet(A)], aminoglykozidy [aphA1a, aac(3‘)-IId, strAB), sulfonamidy (sul2), makrolidy [mph(A)] a amfenikoly (catA1) a operon mer pro rezistenci ke rtuti jako součást ΔTn21. Geny
rezistence byly v této oblasti neseny různými rodinami transpozonů (hranice transpozonu vyznačena čárou) a sdruženy s inzerčními sekvencemi (šedé čtverce). Multirezistentní oblasti
s různou mírou sekvenční homologie byly identifikovány na příbuzných IncHI1 plazmidech pO111_1 z E. coli O111 (AL010961) a pHCM1 ze Salmonella Typhi (AL513383). Silná šedá čára v
sekvenci plazmidů pO111_1 a pHCM1 značí > 99 % podobnost s multirezistentní oblastí pEQ1.
117
Rezistence ke kovům bývá často sdružena s odolností vůči antibiotikům (Silver, 2003; Silver a
Phung, 2005). Příkladem je multirezistentní epidemický klon K. pneumoniae ST258 odpovědný za šíření
karbapenemázy KPC-3. Tento klon nese plazmid ze skupiny IncFIIK a zároveň genové klastery
pcoABCDRSE, arsRDABC a silPABCRSE pro rezistenci k mědi, arsenu a stříbru (Garcia-Fernandez et al.,
2012). Příbuzný IncFIIK plazmid byl také popsán v České republice u klinických izolátů K. pneumoniae
s produkcí CTX-M-15 (Dolejska et al., 2013a17
). Také plazmidy odpovědné za celosvětové šíření
karbapenemázy NDM-1 nesou geny rezistence k několika těžkým kovům (Dolejska et al., 2013c15
; Huang
et al., 2013).
Jeden z nejčastějších transpozonů asociovaný s rezistentními plazmidy je Tn21. Představuje
vysoce úspěšný transpozon s pandemickým rozšířením u klinických i komenzálních izolátů z člověka,
zvířat i prostředí. Tn21 obsahuje ve své sekvenci mer operon pro rezistenci ke rtuti a integrony třídy 1
s genovými kazetami pro odolnost k různým antibiotikům (Hobman et al., 2002; Liebert et al., 1999).
Operon mer je obvykle přítomný na plazmidech kódujících geny pro karbapenemázy a ESBL (Chen et al.,
2009; Dolejska et al., 201424
; Fernandez-Alarcon et al., 2011; Papagiannitsis et al., 201632
; Villa et al.,
2013a,b21
).
Rezistence k biocidům je nejčastěji podmíněna transportními systémy vázanými na chromnozom.
Jedinou prevalenční determinantou ve formě genové kazety na konjugativních plazmidech je qacE1 (nebo
její deletovaná forma qacEΔ1). Poskytuje rezistenci ke kvartérním amoniovým sloučeninám. Jako součást
integronů se nachází na multirezistentních plazmidech ve spojitosti s rezistencí k sulfonamidům,
aminoglykozidům a beta-laktamům (Bean et al., 2009; Pal et al., 2015; Pastrana-Carrasco et al., 2012).
Virulence
Virulenční faktory usnadňují přežívání bakterie v hostitelském organizmu. Zajišťují adhezi a invazi
v těle hostitele nebo interferují s jeho imunitním systémem. Geny pro virulenční faktory mohou být
neseny chromozomem nebo plazmidy. Virulentní plazmidy jsou popisovány zejména ve spojitosti
s patogenními kmeny E. coli. Jedná se o velké nízkokopiové plazmidy obvykle náležící do skupiny IncF
(Johnson a Nolan, 2009). Bylo prokázáno, že většina humánních kmenů ETEC nese na plazmidech geny
kódující kolonizační faktory (Gaastra a Svennerholm, 1996; Turner et al., 2006). Překvapivé výsledky
přinesla také studie, která zdokumentovala, že většina izolátů E. coli O157:H7 nesla virulentní plazmid
pO157 (Burland et al., 1998).
Vedle virulence mohou plazmidy kódovat další důležité vlastnosti včetně rezistence
k antibiotikům. Významné skupiny plazmidů, které spojují tyto dvě funkce, náleží do skupin IncF a IncI1.
Všechny dosud popsané IncI1 plazmidy nesou geny pro pily čtvrtého typu, který napomáhá adhezi a invazi
118
kmenů STEC (Johnson a Nolan, 2009). Mimo jiné je pro ně charakteristická asociace s rezistencí
k antibiotikům včetně produkce ESBL (Carattoli, 2009). Multirezistentní IncF plazmidy klinických izolátů
K. pneumoniae nesou virulenční faktory, např. systém získávání železa nebo TraT protein udávající
rezistenci k séru a snižující fagycytózu makrofágy (Dolejska et al., 2013a17
; Garcia-Fernandez et al., 2012).
U salmonel byl popsán rezistentní plazmid pSLF (IncF) nesoucí vysoce konzervativní lokus spvRABCD, který
umožňuje salmonelám pronikat do buněk hostitele při extraintestinální fázi infekce a přežívat uvnitř
makrofágů (Rodicio et al., 2011).
Další plazmidy kódovanou funkcí, která může hrát úlohu v patogenezi, představuje tvorba
biofilmu. Bakterie produkující biofilm ulpívají na nejrůznějších površích, jsou spojené s dlouhodobou
perzistencí bakterie a její zvýšenou odolností k inhibičnímu účinku antibiotik. Doposud bylo popsáno
pouze několik rezistentních plazmidů s geny pro tvorbu biofilmu, například pOLA52 u E. coli nebo
pKPN-CZ u K. pneumoniae (Dolejska et al., 2013a17
; Norman et al., 2008).
Výše uvedené příklady podtrhují významnou spojitost mezi plazmidy determinovanou virulencí a
rezistencí k antibiotikům. Selekční tlak spojený s používáním antibiotik tak může nepřímo selektovat
virulenční faktory. Zároveň častá lokalizace genů virulence na rezistentních konjugativních plazmidech je
spojena s rizikem dalšího šíření patogenního potenciálu v bakteriálních populacích.
Produkce bakteriocinů
Bakteriociny jsou antimikrobiální proteiny s baktericidní aktivitou, které se významně podílí
na udržování mikrobiální diverzity. Na rozdíl od antibiotik působí proti úzkému rozmezí cílových bakterií,
obvykle proti druhům příbuzným produkčním kmenům. Kmen produkující bakteriocin musí zároveň tvořit
protein, který zajišťuje ochranu před vlastním poškozením buňky. Kmeny E. coli jsou běžnými producenty
bakteriocinů, jejichž tvorba je spojena s přítomností Col plazmidů (Jeziorowski a Gordon, 2007).
Prvním popsaným kolicinem byl ColE1 nesený mobilizovatelnými ColE1 plazmidy (Dougan et al.,
1978). Další skupinu plazmidů nesoucích geny pro bakteriociny představují konjugativní ColV plazmidy
skupiny IncF. Obsahují gen pro produkci mikrocinu V a jsou rozšířené u extraintestinálně patogenních
kmenů APEC a UPEC (Jeziorowski a Gordon, 2007). Na těchto plazmidech jsou asociovány s rezistencí
k antibiotikům a virulencí (Johnson a Nolan, 2009; Johnson et al., 2004). Další typy bakteriocinů, koliciny
B a M, byly nalezeny ve spojitosti s rezistentními IncF plazmidy kmenů E. coli produkující CTX-M-15
nebo SHV-12 (Dolejska et al., 2011d8
; Smet et al., 2010b). Geny pro tvorbu kolicinu Ib spolu s geny
pro beta-laktamázy CTX-M-1 nebo CMY-2 byly popsány také na IncI1 plazmidech (Lin et al., 2015; Wang
et al., 2014; Zurfluh et al., 2014).
119
Další funkce nesené plazmidy
Některé plazmidy nesou geny propůjčující bakteriím schopnost biologicky degradovat organické
sloučeniny, které se běžně v přírodě nevyskytují. Jsou známé pod termínem degradativní plazmidy. Kódují
část příslušné degradační dráhy pro utilizaci kafru, toluenu, naftalenu, n-alkanů, polyaromatických
uhlovodíků, bifenylu, pesticidů a dalších organických látek. Obvykle se jedná o veliké konjugativní
plazmidy ze skupiny inkompatibility P u Pseudomonas spp. (Funnel a Phillips, 2004). Nachází praktické
využití při bioremediacích.
Další skupinu plazmidů sdruženou s přídatnými funkcemi představují symbiotické megaplazmidy.
Byly popsány u půdních rhizobií a nesou geny pro symbiotickou fixaci dusíku (Ding a Hynes, 2009).
Na rezistentních plazmidech byly také nalezeny geny pro rezistenci k vysokým teplotám.
U klinických kmenů K. pneumoniae byl popsán gen clpK na multirezistentních IncF plazmidech, jehož
produkt udílí hostitelským buňkám schopnost odolávat vysoké teplotě (Bojer et al., 2010; Dolejska et al.,
2013a17
; Garcia--Fernandez et al., 2012). Tato funkce by mohla ovlivňovat perzistenci kmenů
v nemocničním prostředí.
Nedávno byly popsány rezistentní konjugativní plazmidy nesoucí fos operon pro metabolizmus
krátkých fruktooligosacharidů (Dolejska et al., 201424
). Jednalo se o první studii, která zdokumentovala
sdružení genů pro antimikrobiální rezistenci s geny pro metabolizmus cukrů. Tyto plazmidy byly
identifikovány u kmenů E. coli z koní a jejich prostředí (Dolejska et al., 2011a5
). Struktura fos operonu a
místo integrace do plazmidu jsou představeny na Obr. 43. Fruktooligosacharidy jsou běžně
metabolizovány mléčnými bakteriemi, zatímco kmeny E. coli je nejsou schopny za normálních okolností
využívat (Obr. 44). Jelikož tato skupina sacharidů představuje významnou složku rostlinné potravy koní,
kmeny E. coli schopné tyto cukry využívat jako přídatný zdroj energie pravděpodobně získávají určitou
selekční výhodu ve střevním traktu koní.
Plazmidy, které nenesou přídatné geny a nemění tak fenotyp bakteriálního hostitele, se označují
jako plazmidy kryptické. Při studium potenciálních nových funkcí nesených plazmidy nachází uplatnění
funkční genomika (Jorgensen et al., 2015).
120
Optickádenzita(600nm)
Obr. 43: Struktura variabilní oblasti plazmidu pEQ1 s fos operonem pro metabolizmus krátkých
fruktooligosacharidů a její srovnání s příbuznými sekvencemi
Vytvořeno podle Dolejska et al., 201424
. Operon fos je tvořen sedmi geny vyznačenými zelenými šipkami, které určují
směr transkripce. Šedé šipky označují mobilní genetické elementy (inzerční sekvence a transpozony). Operony fos s
vysokou sekvenční homologií (93-99,7 %) ale s odlišným genetickým kontextem byly identifikovány na chromozomu E. coli
a E. cloacae. Místo integrace operonu se v rámci těchto sekvencí různí. V případě pEQ1 plazmidu byl operon součástí
kompozitního transpozonu ohraničeného dvěma inzerčními sekvencemi IS903. V této podobě byl operon vnořen
do transpoziční jednotky v konzervované oblasti plazmidu (oranžová oblast) mezi geny orfX a orfY. Transpozice jednotky
byla spojena duplikaci cílové sekvence (červené obdélníky) o velikosti 5 bp ohraničující transpozon na obou stranách.
E. coli Top10 + pEQ1 (5 nM kestóza)
E. coli Top10 + pEQ1 (5 nM nystóza)
E. coli Top10 + pEQ1 (směs scFOS, 0,2 %)
E. coli Top10 (5 nM kestóza)
E. coli Top10 (5 nM nystóza)
E. coli Top10 (směs scFOS, 0,2 %)
Čas (h)
Obr. 44: Růst buněk E. coli nesoucích plazmid
pEQ1 s fos operonem v přítomnosti krátkých
fruktooligosacharidů
Převzato z Dolejska et al., 201424
. scFOS je směs
krátkých fruktooligosacharidů. Růst buněk byl
sledován v minimálním médiu s přídavkem výše
uvedených cukrů.
121
7. Epidemiologie
širokospektrých
beta-laktamáz
ATGTTAACGTCCAGCTTGCCATAGTCGGATAGCTACG
TTGCGAGGTGCTAGG AGCTAGCTATGGGTA
GACTGATATTGT TACTTAGATCGATCCG
CGTTAGTCTAT TTGATCGGAC
AGTACTGATCTG GCTTAGTCTACAAT
ATTCAGGAG TCGTAGCTTAAC
ACGCCTAT TATAGTC
GGATC AGCGGTG
ATGCC CCAATG
TCTG GCACG
122
123
Narůstající rezistence zástupců čeledi Enterobacteriaceae k cefalosporinům spojená s produkcí
beta-laktamáz se širokým spektrem účinku (ESBL, AmpC) představuje rostoucí klinický problém humánní
i veterinární medicíny. Tyto enzymy jsou popisovány u komenzálních i patogenních druhů a vyznačují se
kosmopolitním rozšířením. Bakterie produkující ESBL jsou identifikovány z případů komunitních i
nozokomiálních infekcí, jsou izolovány z travíciho traktu potravinových zvířat a nalézáme je rovněž
v prostředí a u zvířat volně žijících. Pro producenty ESBL je navíc charakteristické sdružení s rezistencí
k dalším antibiotikům, čímž je podporováno jejich udržování v bakteriálních populacích selekčním tlakem
antibiotik z různých funkčních tříd.
V současné epidemiologii ESBL je skloňována zejména beta-laktamáza CTX-M, jejíž šíření je
přirovnáváno ke světové epidemii či pandemii. Geny kódující CTX-M se sdružují s inzerčními sekvencemi,
integrony a transpozony, které se podílí na expresi genu, jeho šíření a na vytváření výhodnějších
kombinací s dalšími genetickými platformami. V této podobě se geny blaCTX-M začleňují do komplexnějších
genetických stuktur zahrnujících zejména plazmidy různých inkompatibilních skupin a specifické
bakteriální klony, které podporují jejich šíření. Na plazmidech jsou geny pro CTX-M sdruženy s dalšími
klinicky významnými mechanizmy, například AmpC beta-laktamázami, karbapenemázami,
aminoglykozidovými metylázami a PMQR. Šíření úspěšných klonů (zejména E. coli a K. pneumoniae) a
mobilních genetických elementů utváří dnešní epidemiologii CTX-M.
Následující kapitoly jsou zaměřeny na výše uvedené aspekty šíření ESBL. Úvodní kapitoly blíže
charakterizují beta-laktamázu CTX-M, vysvětlují její původ a věnují se faktorům, které ovlivňují její
úspěšné šíření. Další kapitoly, které obsahují řadu původních prací autora, přináší stručné informace
k současné epidemiologii producentů ESBL u člověka, zvířat a v prostředí. Poslední kapitoly jsou pak
věnovány MGE v šíření beta-laktamáz s důrazem na enzymy rodiny CTX-M.
7.1 Charakteristika beta-laktamáz CTX-M
V posledních dvaceti letech pozoroval svět zásadní změnu v epidemiologii producentů
širokospektrých beta-laktamáz. Do konce 90. let dominovaly v Evropě mezi ESBL beta-laktamázy TEM a
SHV, zatímco producenti CTX-M tvořili minoritní podíl. Mezi nejčastější producenty ESBL patřily
nemocniční kmeny K. pneumoniae s SHV-2 nebo SHV-5 (Gniadkowski et al., 1998). V roce 1989 byly
současně v Japonsku, Evropě a Severní Americe popsány případy klinických izolátů produkujících CTX-M
(Bauernfeind et al., 1992; Bauernfeind et al., 1990; Matsumoto et al., 1988). Během následujících let se
CTX-M enzymy rychle rozšířily po celém světě a nahradily dříve frekventované skupiny TEM a SHV.
Z počátku byly popisovány především u nemocničních kmenů K. pneumoniae, později došlo k jejich šíření
v populaci E. coli (Pitout et al., 2005). Postupně začaly pronikat do zdravé populace člověka, k farmovým
zvířatům a také do prostředí. Změnu epidemiologie názorně dokumentují dlouholeté lokální studie z Itálie
124
a Rakouska (Brigante et al., 2005; Eisner et al., 2006). Prevalence CTX-M beta-laktamáz mezi ESBL
producenty byla v letech 1998–1999 velmi nízká (0–12,5 %), během pěti let však mnohonásobně vzrostla
na 38–85 %. Podobná čísla dokumentuje USA, kde během let 2000–2005 došlo k rapidnímu nárůstu
kmenů produkujících CTX-M z 25 % na 90 % (Lewis et al., 2007).
V současné době je jejich rozšíření kosmopolitní a má rostoucí charakter. CTX-M představují
nejběžnější ESBL u bakterií původem z člověka, zvířat i prostředí. Nachází se zejména u E. coli,
K. pneumoniae, Salmonella Typhimurium, ale i u jiných zástupců čeledi Enterobacteriaceae. Distribuci
jednotlivých typů cefalosporináz (ESBL a AmpC) v populace izolátů E. coli z člověka, zvířat chovaných
ze záliby (psi, kočky, koně) a vybraných skupin potravinových zvířat v Evropě dokumentuje Obr. 45.
Distribuci jednotlivých variant CTX-M enzymů v různých komoditách se pak blíže věnují kapitoly 7.4–7.8.
Obr. 45: Distribuce jednotlivých skupin cefalosporináz (ESBL a AmpC) u E. coli humánního i
veterinárního původu v Evropě
Vytvořeno podle Ewers et al., 2012. CTX-M-G1 a CTX-G9 značí enzymy podskupin 1 a 9 bez přesného určení sekvenční
varianty.
člověk zvířata chovaná ze záliby
drůbež skot a prasata
125
Název CTX-M pochází ze schopnosti těchto enzymů účinněji degradovat cefotaxim v porovnání
s ceftazidimem, čímž se odlišují od ESBL typu SHV a TEM. Enzymy CTX-M náleží do molekulární třídy A
serinových beta-laktamáz a vyznačují se vysokou heterogenitou (D'Andrea et al., 2013). Třídíme je do
šesti základních podskupin: 1, 2, 8, 9, 25 a KLU, které se mezi sebou liší v aminokyselinové sekvenci ≥ 10 %
(Obr. 46). Číslo podskupiny představuje archetypální enzym dané skupiny (např. CTX-M-1
pro skupinu 1, CTX-M-2 pro skupinu 2 atd.). Variabilita v rámci skupiny je naopak nízká a dosahuje
maximálně 5 %. Bylo rovněž popsáno několik hybridních struktur CTX-M beta-laktamáz, které vykazují
charakteristiky dvou různých skupin. Příkladem jsou CTX-M-64, CTX-M-123 a CTX-132, které představují
hybridní varianty CTX-M-14 a CTX-M-15 a vznikly pravděpodobně v důsledku rekombinace geny těchto
dvou beta-laktamáz (D'Andrea et al., 2013; He et al., 2013; Liu et al., 2015).
Obr. 46: Fylogenetický strom CTX-M
beta-laktamáz
Vytvořeno podle Zhao a Hu, 2013. Délka
větve koresponduje s počtem změn
v aminokyselinové sekvenci. Měřítka
s označením 0,05 a 0,05 představují míru
odlišnosti aminokyselinové sekvence, tj. 5 %
respektive 0,5 %.
126
Nejvíce CTX-M-variant obsahují podskupiny 1 a 9 a zároveň představují nejrozšířenější ESBL
(D’Andrea et al. 2013). V současnosti mezi zástupci čeledi Enterobacteriaceae dominují varianty
CTX-M-14 a CTX-M-15, dále také CTX-M-2, CTX-M-3 a CTX-M-1 (Canton et al., 2012b; Zhao a Hu, 2013).
Jednotlivé sekvenční varianty se mohou lišit různou mírou aktivity k cefalosporinům. Například
CTX-M-15 a CTX-M-32 se liší od CTX-M-1 a CTX-M-3 substitucí Asp240→Gly, díky které mají
mnohonásobně vyšší schopnost hydrolýzy ceftazidimu (Cartelle et al., 2004; Poirel et al., 2002a). Recentní
studie španělských autorů se věnovala evoluci CTX-M podskupiny 1 (Novais et al., 2010). Ve své práci
dokumentují úlohu selekčního tlaku cefalosporinů (ceftazidimu a cefotaximu) v rychlé diverzifikaci
enzymu CTX-M-3. Antibiotika tedy nehrají pouze úlohu v selekci bakterií nesoucích determinanty
rezistence, ale představují také významný faktor v evoluci rezistentních variant.
7.2 Původ CTX-M
Jako zdroj genu blaCTX-M u klinicky významných bakterií byl identifikován chromozom Kluyvera spp.
(Obr. 47). Kluyvera spp. náleží do čeledi Enterobacteriaceae, vyskytuje se především v prostředí a vykazuje
omezenou patogenitu pro člověka a zvířata (Farmer et al., 1981). Byla izolována jako minoritní součást
běžné střevní mikroflóry člověka, kde plní funkci saprofyta či oportunního patogena a dokumentována z
případů infekcí močových cest a měkkých tkání (Sarria et al., 2001).
Beta-laktamázy podskupiny CTX-M-1 jsou vysoce homologické s enzymem KLUC-1
identifikovaným u Kluyvera cryocrescens (Decousser et al., 2001). Podobné souvislosti byly nalezeny
v případě dalších podskupin CTX-M. Enzymy podskupiny 1 a 2 vykazují vysokou míru podobnosti
aminokyselinové sekvence s chromozomálními cefotaximázami Kluyvera ascorbata (Humeniuk et al.,
2002; Rodriguez et al., 2004). Získané CTX-M beta-laktamázy podskupin 8, 9 a 25 jsou příbuzné enzymům
popsaným u Kluyvera georgiana (Margarita Rodriguez et al., 2010; Olson et al., 2005; Poirel et al., 2002b).
Jednotlivé podskupiny CTX-M enzymů mají pravděpodobně svůj původ u různých druhů rodu Kluyvera.
Variabilita v rámci skupiny je pak dána mikroevolucí genu po jeho přenosu k sekundárnímu hostiteli
v důsledku selekčního tlaku cefalosporinů (D'Andrea et al., 2013). Na mobilizaci genů pro CTX-M beta-laktamázy
z přirozených rezervoárů ke klinicky významným bakteriím se pravděpodobně podílely
inzerční sekvence, zejména ISEcp1. Proces mobilizace genů blaCTX -M bude vysvětlen v kapitole 7.10.1.
127
Obr. 47: Vrozené cefotaximázy Kluyvera spp. jako zdroje beta-laktamáz rodiny CTX-M
Vytvořeno podle Zhao a Hu, 2013. Příbuznost vrozených cefalosporináz Kluyvera spp. a získaných CTX-M beta-laktamáz
Enterobacteriaceae je stanovena na základě aminokyselinové sekvence enzymu a podobnosti okolních sekvencí
sdružených s genem pro cefalosporinázu. Předpona „c“ před názvem některých vrozených cefalosporináz Kluyvera spp.
značí jejich lokalizaci na chromozomu. Získaná cefalosporináza pKLUC-2 vykazující 100 % sekvenční homologii s vrozenou
cefalosporinázou KLUC-2 z K. cryocrescens, byla popsána na plazmidu u klinického izolátu Enterobacter cloacae.
7.3 Faktory ovlivňující šíření CTX-M
Současná epidemiologie beta-laktamázy CTX-M je příkladem rychlého a globálního šíření klinicky
významného mechanizmu rezistence řízené plazmidy. Důvod pozoruhodného úspěchu této skupiny beta-laktamáz
nebyl zcela objasněn. Pravděpodobně se jedná o souhru několika faktorů zahrnující přítomnost
genu blaCTX-M na vysoce konjugativních plazmidech, nízké energetické nároky pro bakteriální buňku
potřebné pro expresi blaCTX-M genu a přítomnost příbuzných genetických elementů u bakteriálních
hostitelů umožňující výměnu genů např. rekombinací. Dalším faktorem v jejich expanzivním šíření je
vazba na úspěšné klony bakterií (Canton a Coque, 2006; D'Andrea et al., 2013; Rogers et al., 2011;
Rossolini et al., 2008; Woodford et al., 2011). Mobilním genetickým elementům a epidemickým klonům
v šíření ESBL včetně CTX-M budou blíže věnovat kapitoly 7.9 a 7.10. Producenti CTX-M obvykle vykazují
rezistenci k dalším antibiotikům zahrnující zejména aminoglykozidy, fluorochinolony, tetracykliny a
sulfonamidy. Kromě cefalosporinů se na jejich selekci mohou podílet i antibiotika z jiných funkčních tříd
(Canton a Ruiz-Garbajosa, 2011).
Bylo identifikováno několik rizikových faktorů kolonizace nebo infekce bakteriemi s produkcí
ESBL. Zahrnují především terapii cefalosporiny (případně i dalšími antibiotiky), hospitalizaci v nemocnici,
pobyt v léčebně dlouhodobě nemocných, cestování do oblastí s endemických výskytem ESBL, chirurgické
zákroky atd. (Laupland et al., 2008a; Laupland et al., 2008b; Lytsy et al., 2008). V případě potravinových
zvířat jsou významnými faktory profylaktické použití cefalosporinů, vlastní charakter produkce,
128
přeplněnost prostor chovu a s tím související hygienické podmínky a další (Dolejska et al., 2011c6
;
Hammerum et al., 2014; Hering et al., 2014).
7.4 Rozšíření ESBL u humánních izolátů
V posledním desetiletí je pozorován významný nárůst prevalence enterobakterií rezistentních
k cefalosporinům u hospitalizovaných pacientů a v komunitě. Tento trend se týká celého světa včetně
Evropy a zahrnuje patogenní i komenzální bakteriální druhy. Z důvodu klinické závažnosti tohoto
mechanizmu rezistence se monitoringem výskytu producentů ESBL zabývají programy na lokální, národní
i mezinárodních úrovni. V Evropě se jedná především o integrovaný systém EARS-Net (Antimicrobial
resistance interactive database), který v současné době koordinuje ECDC (European Centre for Disease
and Prevention Control), a do něhož je zapojena i Česká Republika (http://ecdc.europa.eu/). V porovnání
s Evropou je prevalence producentů ESBL v Jižní Americe a Asii vyšší, naopak Severní Amerika
dokumentuje dlouhodobě nižší výskyt. Zároveň v rámci Evropy jsou pozorovány značné geografické
odlišnosti.
Pro současnou epidemiologii ESBL u humánních izolátů v Evropě je charakteristická obecná
dominance beta-laktamázy CTX-M-15. Nicméně v některých zemích převládají jiné typy CTX-M, např.
CTX-M-14 a CTX-M-9 ve Španělsku a Portugalsku nebo CTX-M-1 v Itálii a Francii (Smet et al., 2010a).
Beta-laktamáza CTX-M-15 převažuje také u klinických izolátů enterobakterií v České republice
(Cekanova et al., 2009; Micenkova et al., 2014; Papagiannitsis et al., 2015b). Tato varianta rovněž
dominovala u izolátů čeledi Enterobacteriaceae (zejména K. pneumoniae) s produkcí ESBL v rektálních
výtěrech kolonizovaných pacientů hospitalizovaných na Klinice dětské onkologie (Obr. 48; Dolejska et al.,
201212
). U většiny izolátů byl gen blaCTX-M-15 prokázán na příbuzných IncFIIK plazmidech, které mohly hrát
významnou úlohu v šíření ESBL mezi bakteriemi na sledovaném oddělení. Úspěch této beta-laktamázy
dokumentuje také španělská studie (Diaz et al., 2010). V rámci národní surveillance
nebyla beta-laktamáza CTX-M-15 ve sbírce ESBL izolátů z roku 2000 prokázána. V opakovaném vyšetření
v roce 2006 se stala však třetí nejčastější variantou po beta-laktamázách CTX-M-14 a SHV-12. Podobně
v Polsku, kde na počátku šíření CTX-M enzymů dominovala varianta CTX-M-3 v souvislosti s diseminací
vysoce konjugativního epidemického plazmidu pCTX-M-3, postupně převládá varianta CTX-M-15 (Empel
et al., 2008; Golebiewski et al., 2007; Izdebski et al., 2013; Pobiega et al., 2013). K jejímu pronikání dochází
také ve státech Jižní Ameriky, kde nahrazuje variantu CTX-M-2 (Bonelli et al., 2014). Častý nález této
beta-laktamázy mimo jiné souvisí s šířením epidemického klonu E. coli ST131, který je sdružen
s CTX-M-15, o čemž bude blíže pojednávat kapitola 7.9.
129
Obr. 48: Charakterizace kmenů K. pneumoniae produkujících ESBL z pacientů Kliniky dětské onkologie
Vytvořeno podle Dolejska et al., 201212
. Dendrogram byl vytvořen na základě makrorestrikčních profilů genomové DNA.
Kmeny s podobností profilu ≥ 80 % (ohraničeno červenou linií) byly vyhodnoceny jako epidemiologicky příbuzné. Kmeny
náležely k jednomu ze sedmi sekvenčním typům (ST), byly multirezistentní a nesly plazmidově determinované geny
rezistence k fluorochinolonům. Písmeno za inkompatibilní (Inc) skupinou plazmidu vyjadřuje restrikční profil plazmidu
nesoucího gen pro ESBL. Plazmidy se stejným profilem jsou považovány za identické. U různých pacientů byly nalezeny
kmeny se stejnými genotypem a fenotypem.
Produkce ESBL je častá u původců nozokomiálních infekcí v souvislosti s život ohrožující
bakteriémií a neonatální sepsí (Canton et al., 2008). Hospitalizovaní pacienti jsou také vystaveni
zvýšenému riziku kolonizace gastrointestinálního traktu (GIT) kmeny s produkcí ESBL v porovnání se
zdravými jedinci v komunitě (Ben-Ami et al., 2006; Castillo Garcia et al., 2007; Garrido et al., 2014).
Z České republiky jsou dostupná recentní data z Olomoucka, která uvádí nosičství enterobakterií s ESBL
u 8 % hospitalizovaných pacientů a 3 % jedinců z komunity (Husickova et al., 2012). Pro nozokomiální
kmeny je charakteristická rezistence k různým skupinám antibiotik, terapeutické možnosti léčby infekcí
těmito kmeny jsou tedy omezené. Účinné jsou karbapenemy a v případě nezávažných infekcí je možné
podat kombinace beta-laktamů s inhibitory beta-laktamáz. Při prokázané in vitro citlivosti se v závislosti
na charakteru infekce často přistupuje k léčbě chinolony nebo aminoglykozidy (Canton a Coque, 2006).
Kmen
Pacient
ST
ESBL
qnrB1
aac(6)-Ib-cr
Plazmid(Inc)
42 X 280 CTX-M-15 + +
56 D 280 CTX-M-15 + + FIIK (A)
18 O 280 CTX-M-15 - + FIIK (B)
15 N 627 SHV-2 - -
43 AA 627 SHV-2 - -
30 K 627 SHV-2 - -
33 U 627 SHV-2 - -
35 V 627 SHV-2 - -
44 BB 627 SHV-2 - -
39 Y 627 SHV-2 + + FIIK (D)
4 C 321 CTX-M-15 + +
8 G 321 CTX-M-15 + + FIIK (A)
38 X 321 CTX-M-15 - -
41 D 321 CTX-M-15 + + FIIK (A)
2 A 321 CTX-M-15 + +
20 K 323 CTX-M-15 + +
27 K 323 CTX-M-15 + +
12 K 323 CTX-M-15 + +
25 S 323 CTX-M-15 + +
19 P 323 CTX-M-15 + + FIIK (D)
11 J 323 CTX-M-15 + + FIIK (D)
5 D 323 CTX-M-15 + + FIIK (D)
6 E 628 SHV-12 - -
17 N 628 CTX-M-15 + + FIIK (A)
7 F 416 CTX-M-15 + + FIIK (A)
9 H 416 CTX-M-15 + + FIIK (A)
16 L 416 CTX-M-15 + + FIIK (A)
22 A 416 CTX-M-15 + + FIIK (A)
49 A 416 CTX-M-15 + + FIIK (A)
55 A 416 CTX-M-15 + + FIIK (A)
13 L 416 CTX-M-15 + + FIIK (A)
23 L 416 CTX-M-15 + + FIIK (E)
3 B 416 CTX-M-15 + +
46 T 626 CTX-M-15 + + FIIK (C)
52 T 626 CTX-M-15 + + FIIK (C)
29 T 626 CTX-M-15 + + FIIK (C)
PFGE
100
95
90
85
80
75
70
65
60
PFGE
42
56
18
15
43
30
33
35
44
39
4 n
8
38
41
2n
20
27
12
25
19
11
5
6
17
7
9
16
22
49
55
13 n
23
3
46
52
29
130
Kmeny E. coli produkující CTX-M-15 jsou časté v případech komunitních i nozokomiálních
močových infekcí (Martin et al., 2016; Pitout et al., 2005). K zajímavým výsledkům dospěla studie
španělských autorů, která prokázala kolonizaci GIT kmeny E. coli s produkcí ESBL u 70 % komunitních
pacientů s močovou infekcí (Rodriguez-Bano et al., 2008; Valverde et al., 2008). Zároveň 27 % rodinných
příslušníků těchto pacientů neslo ve střevním traktu kmen E. coli s ESBL. Výsledky těchto studií naznačují,
že kolonizovaní jedinci jsou vystaveni vyššímu riziku rozvoje močové infekce vyvolané ESBL kmenem a
mohou být také zdrojem pro další osoby. Rizikové je v tomto ohledu cestování do oblastí s vysokým
výskytem ESBL. Byla prokázána spojitost mezi zvýšenou kolonizací GIT producenty ESBL a pobytem v Indii,
jihovýchodní Asii, Africe a na Středním východě (Dhanji et al., 2011; Peirano et al., 2011; Tangden et al.,
2010; Tham et al., 2010). Recentní kanadská studie zdokumentovala nosičství ESBL v GIT u 46 % osob po
návratu z výše uvedených oblastí oproti 4 % zjištěným u lidí, kteří po dobu 6 měsíců do zahraničí
nevycestovali (Peirano et al., 2011).
7.5 Výskyt ESBL u izolátů z potravinových zvířat
Odborných publikací zaměřených na studium producentů ESBL v posledních deseti letech rapidně
narůstá. Bakterie s tímto mechanizmem rezistence byly dokumentovány u všech skupin potravinových
zvířat. Jejich výskyt se různí s ohledem na mnoho faktorů zahrnujících geografickou oblast, druh zvířete,
charakter konkrétního chovu, lokality atd. Porovnání hodnot prevalencí ESBL či konkrétních variant těchto
enzymů popsaných v odborné literatuře naráží na úskalí z důvodu použití odlišných metodických přístupů
různými autory. Programy na národní a mezinárodní úrovni sjednocují metodické přístupy pro izolaci a
charakterizaci cílových bakterií rezistentních k cefalosporinům třetí generace. Mechanizmus rezistence je
v rámci těchto programů však obvykle stanoven jen na úroveň fenotypu odlišující producenty ESBL a
AmpC beta-laktamáz. Určení dalších charakteristik metodami molekulární biologie, zejména stanovení
konkrétní varianty beta-laktamázy, sekvenčního typu bakterie a plazmidu nesoucího tento mechanizmus
rezistence, se obvykle neprovádí. Tato informace je však zásadní pro pochopení epidemiologie
producentů ESBL v potravním řetězci.
První izoláty s produkcí ESBL byly u potravinových zvířat zachyceny v letech 2000–2001. Jednalo
se o kmeny E. coli z jatečných kuřat ve Španělsku vyšetřených v rámci národního monitorovacího
programu (Brinas et al., 2003). Byly nalezeny kmeny s CTX-M-14 a SHV-12 v celkové prevalenci 1,6 %.
Návazná studie provedená o 3 roky později prokázala nárůst na 5 % (Brinas et al., 2005). Další pilotní
práce pak pochází z Francie a Japonska, které dokumentují u drůbeže výskyt CTX-M-1, CTX-M-2 a
CTX-M-14 (Girlich et al., 2007; Kojima et al., 2005). Následně byly tyto varianty identifikovány také
v chovech skotu a prasat v Evropě a Japonsku (Aarestrup et al., 2006; Blanc et al., 2006; Liebana et al.,
131
2006; Meunier et al., 2006; Shiraki et al., 2004). Vysoký podíl izolátů E. coli a Salmonella spp. s ESBL
u drůbeže dnes dokumentuje Španělsko, Itálie, Nizozemí a Polsko. Naopak jejich výskyt u skotu a prasat
je v Evropě obecně nízký (EFSA, 2011).
V současné době jsou u izolátů E. coli a Salmonella spp. z potravinových zvířat nejčastěji
nacházeny varianty CTX-M-1, -2, -9, -14, -15, -32, SHV-2, -12 a TEM-52. Nejrozšířenější variantou CTX-M
enzymů u bakterií z potravinových zvířat v Evropě je CTX-M-1 (EFSA, 2011; Ewers et al., 2012). Izoláty
s produkcí CTX-M-1 tvoří u skotu a prasat 70 % producentů ESBL (Ewers et al., 2012). Beta-laktamáza
CTX-M-14 je pak typická především pro Asii, dále je popisována ve Středomoří, jižní Evropě, ve Velké
Británii a Belgii (Ewers et al., 2012). Variantu CTX-M-2 dokumentuje střední a severní Evropa, Velká
Británie a Irsko (EFSA, 2011). Beta-laktamáza CTX-M-15, která je typická spíše pro humánní klinické
izoláty, je nacházena u enterobakterií z potravinových zvířat omezeně. V Evropě je sporadicky
prokazována například u skotu (Endimiani et al., 2012; Fischer et al., 2014; Geser et al., 2012; Hunter et
al., 2010; Madec et al., 2012), ojediněle také u prasat a drůbeže (Fischer et al., 2014; Randall et al., 2011).
V České republice byl první záchyt producentů ESBL popsán v roce 2010 u drůbeže (Kolar et al.,
2010). Jednalo se o 7 (2,3 %) izolátů E. coli z krůt a brojlerů, u kterých byla zjištěna přítomnost ESBL variant
CTX-M-1, CTX-M-14 nebo SHV-12. Výskytu ESBL u drůbeže jsme se věnovali také na našem pracovišti.
V letech 2006-2007 bylo ve spolupráci se Státním veterinárním ústavem vyšetřeno 40 krůtích farem
(Dolejska et al., 2011d8
). Kmeny E. coli s produkcí ESBL byly prokázány v prostředí 20 % testovaných
farem. Dominovala beta-laktamáza SHV-12 nesená konjugativními IncFII plazmidy. Většina analyzovaných
plazmidů vykazovala identický restrikční profil, což ukazuje na šíření genu blaSHV-12 horizontální cestou
mezi nepříbuznými izoláty E. coli zprostředkovaný dominantní plazmidovou linií.Na různých farmách byly
nalezeny izoláty s identickým genetickým profilem (Obr. 49). Tato studie upozorňuje na možné šíření
těchto kmenů z líhní v zahraničí, ze kterých pochází krůťata zakoupená pro chovy v České republice. Další
studie se věnovala vyšetření jatečně opracovaných těl brojlerů z 12 jatek v ČR na přítomnost E. coli
rezistentní k cefalosporinům a fluorochinolonům (Literak et al., 201316
). Ačkoliv výskyt izolátů E. coli
s rezistencí k fluorochinolonům byl vysoký, žádné ESBL izoláty prokázány nebyly.
ESBL izoláty byly v České republice u skotu a prasat prokázány poprvé v roce 2012 (Bardon et al.,
2013). Vyšetřením jatečných těl byly identifikovány izoláty E. coli s ESBL (bez určení konkrétní varianty)
v 17 % vzorků. Na farmě s frekventovaným použitím ceftiofuru pro terapii a prevenci mastitid byly
z 39 % dojnic prokázány izoláty E. coli s genem blaCTX-M-1 neseným plazmidem ze skupiny IncN (Dolejska et
al., 2011c6
). Většina izolátů vykazovala stejný genetický profil. Studie poukazuje na význam selekčního
tlaku ceftiofuru na klonální a horizontální šíření ESBL v tomto konvenčním chovu. V certifikovaném
organickém chovu, ve kterém tato skupina antibiotik zvířatům podávána nebyla, byl identifikován jeden
izolát s produkcí ESBL (Dolejska et al., 2011c6
).
132
Obr. 49: Typizace E. coli s produkcí ESBL z prostředí krůtích farem v ČR
Vytvořeno podle Dolejska et al., 2011d8
. Příbuznost izolátů byla stanovena makrorestrikční analýzou genomové DNA
následovanou separací fragmentů pulzní gelovou elektroforézou (PFGE). Podobnost PFGE profilů izolátů znázorňuje
dendrogram vlevo. Izoláty jsou vyhodnoceny jako příbuzné, pokud vykazují alespoň 85 % podobnost PFGE profilů. Kmeny
s identickým genotypem byly nalezeny například na farmách I, Y, A (kmen s profilem A1) nebo na farmách K a L (kmeny
s profily D1 nebo B).
7.6 Výskyt ESBL u izolátů ze zvířat chovaných ze záliby
Výskyt producentů ESBL je sledován u cílových skupin zvířat, zejména u psů, koček a koní. První
izolát s produkcí ESBL (varianta SHV-12) byl prokázán u psa s močovou infekcí ve Španělsku v roce 1998
(Teshager et al., 2000). Brzy poté byly publikovány další práce dokumentující jejich výskyt u psů v Itálii a
Portugalsku (Carattoli, 2008; Carattoli et al., 2005b; Costa et al., 2004; Feria et al., 2002; Pomba et al.,
2009). Podobně jako u potravinových zvířat rovněž u zvířat chovaných ze záliby v současnosti dominuje
beta-laktamáza CTX-M, konkrétně varianta CTX-M-1. Další frekventovanou beta-laktamázou je CTX-M-
15, která se vyskytuje přibližně u 15 % izolátů s ESBL (Ewers et al., 2012).
Nejvíce prací je zaměřeno na psy z důvodu jejich blízkého kontaktu s člověkem a vyplývajících
rizik zoonotického přenosu rezistentních a patogenních bakterií. Prevalence nosičství producentů ESBL
ve střevě psů se v jednotlivých zemích značně liší (Ewers et al., 2012). Popsané rozdíly v sobě odráží
jednak specifickou epidemiologii dané oblasti, odlišné metodické postupy při odběru vzorků a kultivaci
producentů ESBL a v neposlední řadě také to, zda vzorek pochází od zdravého jedince nebo od zvířete
s prokázaným infekčním onemocněním. Nejvyšší čísla dokumentuje například Nizozemí, kde byly tyto
izoláty selektivní kultivací prokázány u 45–55 % zdravých i průjmujících psů (Hordijk et al., 2013). V České
republice se tímto problémem zabývala pouze jedna studie z našeho pracoviště, která prokázala izoláty
E. coli s CTX-M-1 u 4 % zdravých psů (Albrechtová et al., 2012a).
PFGE
Počet
Farma
ESBL
E 1 W SHV-12
G 1 W CTX-M-1
D1 6 K, L SHV-12
D4 1 P SHV-12
D3 3 P SHV-12
D2 1 P SHV-12
H 1 P SHV-12
B 1 K, L CTX-M-14
C 1 I SHV-12
A1 4 I, Y, A SHV-12
A2 1 A SHV-12
I 1 W SHV-12
F 3 B SHV-12
133
Beta-laktamáza CTX-M-15 je u izolátů ze zdravých i nemocných psů často popisována v souvislosti
s humánním pandemickým klonem E. coli ST131 (Albrechtova et al., 2012b11
; Albrechtova et al., 201425
;
Bogaerts et al., 2015; Ewers et al., 2010; Haenni et al., 2014). Ze psů byly také izolovány enterobakterie
s produkcí karbapenemáz OXA-48, NDM-5 a VIM-1 (Stolle et al., 2013). Původ těchto kmenů je s nejvyšší
pravděpodobností humánní.
Výskytem enterobakterií s produkcí ESBL u koní se zabývalo pouze několik prací (Damborg et al.,
2012; Dierikx et al., 2012; Ewers et al., 2010; Maddox et al., 2012a; Schmiedel et al., 2014; Vo et al.,
2007). Hospitalizace a antibiotická terapie představují významné faktory pro kolonizaci GIT koní ESBL
kmeny (Damborg et al., 2012; Maddox et al., 2012b). Nosičství enterobakterií s tímto mechanizmem
rezistence u zdravých koní však nebyla věnována dostatečná pozornost. Vyšetřením hospitalizovaných
koní na přítomnost producentů ESBL se zabývala také naše výzkumná skupina (Dolejska et al., 2011a5
).
Studie byla realizována na Klinice chorob koní (VFU Brno), která je největší klinikou v České republice.
Selektivní kultivací vzorků trusu byly nalezeny multirezistentní kmeny E. coli s produkcí CTX-M-1 u třetiny
vyšetřených koní. Současně však byly také prokázány ve stěrech z prostředí stájových boxů a u hmyzu
odchyceném na klinice. Frekventovaný nález kmenů s identickým genotypem u koní a v prostředí ukazuje
na nozokomiální šíření ESBL kmenů mezi hospitalizovanými jedinci a na pravděpodobnou perzistenci
těchto kmenů v prostředí nemocnice. Z jednoho ošetřovatele na klinice byl izolován kmen identický s tím,
který dominoval ve střevě koní. Gen pro beta-laktamázu CTX-M-1 byl u většiny vyšetřených izolátů
nalezen na multirezistentních konjugativních IncHI1 plazmidech. Horizontální přenos genů rezistence
představoval významný faktor v šíření CTX-M-1 mezi kmeny E. coli na klinice.
7.7 Šíření ESBL v prostředí – význam odpadních vod
Humánní i veterinární odpady jsou považovány za důležité zdroje rezistentních bakterií
pro přilehlé vodní ekosystémy (Gao et al., 2014; Li et al., 2015; Rizzo et al., 2013; Schijyen et al., 2015;
Tennstedt et al., 2003). V rozvojovém světě je nedostatečná sanace odpadu spojena s kontaminací
vodních toků a zdrojů pitné vody rezistentními bakteriemi. Enterobakterie produkující ESBL byly
izolovány v 10–33 % vzorků studniční, kohoutkové a balené pitné vody v Číně, Bangladéši a Demokratické
republice Kongo (De Boeck et al., 2012; Talukdar et al., 2013; Zhang et al., 2015). Příkladem je také šíření
bakterií s karbapenemázou NDM-1 v Novém Dillí v povrchové a pitné vodě (Walsh et al., 2011).
Kontaminace vodního prostředí antropogenními odpady se týká i světa rozvinutého. Do vodních toků se
rezistentní bakterie dostávají cestou ČOV, které nejsou schopné rezistentní bakterie spolehlivě odstranit.
V odpadních vodách se běžně vyskytují nízké koncentrace antibiotik, například fluorochinolonů,
trimetoprimu nebo sulfonamidů, které jsou v ČOV obtížně odstraňovány (Gobel et al., 2005; Golet et al.,
134
2002). Multirezistentní kmeny tak mohou být přítomnými antibiotiky selektovány. Vývoj pokročilých
technologií čištění odpadních vod, které zajistí redukci rezistentních a patogenních bakterií, je nezbytný
pro omezení šíření těchto kmenů do prostředí.
Recentní práce dokumentují vysokou úroveň kontaminace vody odcházející z ČOV do vodních
toků bakteriemi s produkcí ESBL (Amos et al., 2014; Blaak et al., 2015; Ojer-Usoz et al., 2014; Reinthaler
et al., 2010). Problematikou ESBL bakterií v odpadních vodách jsme se zabývali na našem pracovišti.
Po dobu 45 dní byly odebírány vzorky na odtoku z brněnské komunální ČOV do řeky Svratky (Dolejska et
al., 2011b9
). Enterobakterie s ESBL byly izolovány ve dvou třetinách vzorků. Podobně jako v jiných studiích
i v našem souboru dominovala ESBL typu CTX-M-15. Významným výsledkem byl průkaz multirezistentní
patogenní klonální linie E. coli ST131, ke které náleželo 73 % izolovaných kmenů E. coli. Cestou odpadních
vod se tedy do prostředí dostávají bakterie, které se vyznačují nejen rezistencí k různým antibiotickým
skupinám, ale také zvýšenou patogenitou. Kmeny s patogenním působením ve střevě a rovněž kmeny
ExPEC tvoří významný podíl v populaci koliformních bakterií odpadních vod (Dolejska et al., 2011b9
; Franz
et al., 2015).
Šíření rezistentních a patogenních bakterií do vodních toků může být spojeno se vznikem
zdravotních rizik pro člověka. Nizozemská studie prokázala ESBL izoláty v rekreačních vodách v blízkosti
ČOV (Blaak et al., 2014a). Porovnáním sledovaných fenotypových a genotypových charakteristik byly
prokázány identické kmeny v odpadní i povrchové rekreační vodě. Kontaminované povrchové vody
mohou být také potenciálním zdrojem rezistentních bakterií pro zvířata. Enterobakterie s ESBL byly
prokázány například u vodních ptáků (Guenther et al., 2011). Tomuto tématu se blíže věnuje následující
kapitola.
7.8 Výskyt ESBL izolátů u volně žijících zvířat
První práce popisující bakterie s ESBL u volně žijících zvířat byla publikovaná v roce 2006 (Costa
et al., 2006). V následujících letech aktivní monitoring u různých druhů volně žijících savců a ptáků
potvrdilo jejich obecné rozšíření. Souhrnný přehled prací publikovaných do roku 2011, které dokumentují
výskyt E. coli s produkcí ESBL u volně žijících zvířat nedávno zpracoval tým německých autorů (Guenther
et al., 2011). Z této rešerše a dalších aktuálních publikací vyplývá, že ESBL byly u volně žijících zvířat
popsány na všech kontinentech s výjimkou Antarktidy (Bonnedahl et al., 2014; Dolejska et al., 201630
;
Guenther et al., 2011). Nejvíce studií pochází z Evropy (Guenther et al., 2011), nikoli z důvodu vyšší
prevalence ESBL producentů v porovnání s ostatními částmi světa, ale díky aktivnímu výzkumu několika
evropských týmů.
135
Spektrum ESBL variant popsaných u volně žijících zvířat prakticky zrcadlí současnou epidemiologii
v humánní i veterinární provenienci. Nejčastější ESBL představuje CTX-M, zejména pak varianty
CTX-M-1 a CTX-M-15, omezeně také CTX-M-9, CTX-M-14 a CTX-M-32 (Guenther et al., 2011). O původu
kmenů rovněž svědčí nález specifických klonálních linií u volně žijících zvířat, které jsou opakovaně
prokazovány u hospodářských zvířat a člověka (Guenther et al., 2011; Jamborova et al., 201526
).
Enterobakterie produkující ESBL byly izolovány z vodních ptáků (Guenther et al., 2011; Literak et
al., 2010a4
; Stedt et al., 2015; Tausova et al., 201210
; Veldman et al., 2013), dále u zástupců skupiny
krkavcovitých (Jamborova et al., 201526
; Loncaric et al., 2013), dravců (Guenther et al., 2012a; Pinto et al.,
2010) a drobných hlodavců (Guenther et al., 2012b; Ho et al., 2015; Literak et al., 20092
). Ojediněle byly
také zachyceny u vysoké zvěře, divokých prasat, šelem, zajícovitých a ryb (Costa et al., 2006; Literak et al.,
2010b3
; Sousa et al., 2011).
Nejvíce prací se soustředí na vodní ptactvo, u kterého jsou navíc ze všech druhů volně žijících
ptáků dokumentovány nejvyšší prevalence ESBL. V některých zemích se pohybují v desítkách procent a
významně přesahují čísla popsaná pro člověka a hospodářská zvířata. Například španělská recentní studie
prokázala producenty ESBL u 75 % vyšetřených racků (Stedt et al., 2015). Producenti ESBL byly popsáni
také u racků a jiných druhů vodních ptáků v České republice (Dolejska et al., 20091
; Tausova et al., 201210
).
Pro racky je typická úzká vazba na prostředí ovlivněné lidskou činností a konzumace odpadu na skládkách
a v blízkosti farem. Z tohoto pohledu rackové představují vhodný model pro studium šíření rezistentních
bakterií do prostředí. Frekventovaný záchyt ESBL u vodních ptáků může poukazovat na fekální
kontaminaci povrchových vod odpady z měst a hospodářské produkce.
U vodních ptáků byly identifikovány bakterie s rezistencí ke karbapenemům. Tato antibiotika ze
skupiny beta-laktamů jsou výhradně humánními přípravky a slouží jako léky poslední volby při terapii
závažných infekcí (Dolejska et al., 201630
). Izoláty s touto rezistencí byly prokázány u 40 % racků z kolonie
v Novém Jižním Walesu (Austrálie). Rezistence ke karbapenemům byla spojena s přítomností genu
skupiny blaIMP-4. Karbapenemáza IMP-4 je rozšířená u klinických izolátů v Austrálii (AGAR;
www.agargroup.org), naopak v ostatních částech světa se vyskytuje zřídka. Výsledky této studie ukazují
na humánní původ těchto kmenů, kterými byli rackové kolonizováni pravděpodobně v důsledku
přiživování se na odpadcích na blízké skládce komunálního odpadu. Přímý důkaz o přenosu rezistentních
bakterií mezi racky a odpadem produkovaným člověkem přináší americká studie, která ve vzorcích z racků
a odpadních vod prokázala kmeny E. coli se stejným ribotypizačním profilem (Nelson et al., 2008).
Kolonizovaná volně žijící zvířata mohou rezistentní bakterie dále šířit a představovat možné
sekundární zdroje pro člověka a potravinová zvířata. V tomto jsou významní zejména migrující ptáci, kteří
136
mohou rezistentní kmeny přenášet mezi různými státy případně či kontinenty (Hernandez et al., 2010;
Hernandez et al., 2013).
7.9 Rizikové a úspěšné klony E. coli v šíření ESBL
Jedním z hlavních faktorů, který se odráží v narůstající prevalenci Enterobacteriaceae s produkcí
ESBL, je expanze multirezistentních klonálních linií (Obr. 50, Tab. 8). Některé z těchto úspěšných linií navíc
disponují extraintestinálně patogenním charakterem a vyznačují se zoonotickým potenciálem. Významné
multirezistentní linie E. coli sdružené s CTX-M zahrnují ST10, ST23, ST69, ST131, ST167, ST410, ST617 a
další (Ewers et al., 2012; Woodford et al., 2011).
Nejvýznamnější klon v současné době představuje E. coli ST131. V literatuře je někdy tento klon
označován pod plným názvem E. coli B2-O25b:H7-ST131, který v sobě vedle sekvenčního typu (ST131)
dále zahrnuje fylogenetickou skupinu (B2) a sérotyp (O25b:H7). Je odpovědný za celosvětové šíření beta-laktamázy
CTX-M-15, ale byl prokázán i ve spojitosti s dalšími variantami CTX-M enzymů (např.
CTX-M-3, -14, -27), jinými skupinami cefalosporináz (CMY-2, SHV-12) a nedávno také s karbapenemázami
KPC, NDM a VIM (Accogli et al., 2014; Nicolas-Chanoine et al., 2014). Kromě multirezistentního fenotypu,
který mimo jiné zahrnuje rezistenci k fluorochinolonům, se vyznačuje vysokou virulencí spojenou
s přítomností genů pro různé virulenční faktory. E. coli ST131 je častým původcem infekcí močových cest,
bakteriémií a neonatálních sepsí, vyvolává také infekce ran, pneumonie a intraabdominální infekce
(Banerjee a Johnson, 2014).
Podobnost restrikčních profilů genomové DNA E. coli ST131 stanovených pulzní gelovou
elektroforézou se pohybuje v rozmezí 60–100 %, což ukazuje na vysokou genetickou variabilitu tohoto
klonu. Komparativní analýzy rozsáhlých sbírek kmenů potvrdily existenci několika subklonálních linií, které
se odlišují profilem antibiotické rezistence a přítomností specifických mutací v základním genomu
(Johnson et al., 2013a; Price et al., 2013). Geny rezistence jsou u této linie obvykle neseny
multirezistentními IncF plazmidy (Nicolas-Chanoine et al., 2014).
Prevalence ST131 mezi klinickými izoláty E. coli je různá v závislosti na geografické oblasti a
hostiteli a dosahuje až 30 %. Díky častému výskytu tohoto klonu není překvapující, že je rovněž izolován
ze zdravých i nemocných zvířat, především psů a také v potravinách (Albrechtová et al., 2012b11
; Ewers et
al., 2010; Giufre et al., 2012; Schink et al., 2013; Vincent et al., 2010). Šíření ST131 do prostředí a k volně
žijícím zvířatům bylo rovněž zdokumentováno (Dolejska et al., 2011b9
; Jamborova et al., 201526
; Vignaroli
et al., 2013). V současné době probíhá na našem pracovišti komparativní analýza různých genetických
markerů u rozsáhlého souboru izolátů této linie. Výsledky ukazují na cirkulaci identických izolátů v
137
nemocnicích, v prostředí odpadních vod a také u volně žijících živočichů (I. Jamborová et al., VFU Brno,
nepublikovaná data).
Faktory, které stojí za úspěchem expanzivního klonu E. coli ST131 nebyly doposud objasněny.
Zřejmě jde o souhru vlastností tohoto klonu zahrnující efektivní mezilidský přenos, zvýšenou schopnost
kolonizace, perzistenci ve střevě a močových cestách, vyšší virulenci a rozsáhlejší rezistenci k antibiotikům
v porovnání s jinými kmeny (Banerjee a Johnson, 2014; Nicolas-Chanoine et al., 2014).
Tab. 8: Linie E. coli v šíření klinicky významných beta-laktamáz
Převzato z Ewers et al., 2012 a doplněno o naše práce (Jamborova et al., 201526
a I. Jamborová et al., VFU Brno,
nepublikovaná data).
Klonální
komplex
(počet)
Beta-laktamáza
Potvrzená přítomnost Rozšíření
Zvířata chovaná
ze záliby
Potravinová
zvířata
Volně žijící
zvířata
Člověk Zvířata Člověk
STC131 CTX-M-3,-9,-14,-15,-27,-32 x x x x globální globální
(n=1013) SHV-5,-7,-12
AmpC (CMY-2)
NDM-1
STC648 CTX-M-14,-15,-32 x x x x globální globální
(n=119) AmpC (CMY-2)
NDM-1
STC405 CTX-M-1,-3,-14,-15 x x x Evropa globální
(n=101) AmpC (CMY-2)
NDM-1
STC38 CTX-M-1,-9,-14,-15,-27,-32 x x x x Evropa globální
(n=83) AmpC (CMY-2)
OXA-48
NDM-1
STC101 CTX-M-1,-14,-15 x x x Evropa Evropa,
Asie,
Afrika
(n=50) AmpC (CMY-2)
NDM-1
STC31 (n=30) CTX-M-14,-15 x x Německo globální
STC23 CTX-M-1,-3,-14,-15 x x x x Evropa globální
(n=85) SHV-12,-44
AmpC (CMY-2)
NDM-1
TEM-52
STC117 CTX-M-1,-2,-14,-15 x x x x Evropa Evropa,
Asie(n=22) AmpC (CMY-2)
STC10 CTX-M-1,-2,-14,-15,-27 x x x x globální globální
(n=227) SHV-5,-12
AmpC (CMY-2)
TEM-52
STC69 (n=16) CTX-M-1,-14,-27 x x x x Evropa globální
AmpC (CMY-2)
STC95 (n=15) CTX-M-3,-14,-15 x - globální
STC73 (n=11) CTX-M-14,-15 x x Německo globální
138
Obr. 50: Distribuce širokospektrých beta-laktamáz u významných linií E. coli
Upraveno podle Ewers et al., 2012. STC představuje soubor kmenů příbuzných sekvenčních typů definovaný jako klonální
komplex. Počty izolátů náležících k danému komplexu jsou uvedeny v závorce. Graf zohledňuje zejména výskyt
širokospektrých beta-laktamáz. Některé ST jsou zároveň významnými producenty AmpC beta-laktamáz a karbapenemáz.
Významné linie se zvýšenou schopností kolonizace a perzistence představují multirezistentní
ExPEC kmeny ST405 a ST648, které u člověka vyvolávají závažné infekce. Jsou asociovány nejen
s CTX-M (CTX-M-1, -15, -32), ale také s AmpC beta-laktamázou CMY-2 a karbapenemázou NDM (Ewers
et al., 2012; Hornsey et al., 2011; Tamang et al., 2013). E. coli ST648 produkující CTX-M-15 je považována
za novou expanzivní klonální linii ze zoonotickým potenciálem, na jejímž šíření se pravděpodobně
významně podílí zvířata chovaná ze záliby (Ewers et al., 2014). Tato linie byla prokázána u pacientů
v nemocnicích, u hospodářských zvířat (drůbeže a prasat), u psů, koní a volně žijících zvířat (Cortes et al.,
2010; Ewers et al., 2014; Guenther et al., 2012a; Zong a Yu, 2010).
E. coli ST10 představuje vysoce heterogenní skupinu komenzálních i patogenních kmenů (EAEC,
ETEC, ExPEC). Je dokumentována u lidí z případů komunitních i nozokomiálních infekcí, dále
u potravinových zvířat, v potravinách a v prostředí, Obr. 51 (Jamborova et al., 201526
; Manges a Johnson,
2012). ExPEC linie ST69 je prokazována z infekcí močových cest, ale nachází se také u potravinových zvířat,
především drůbeže (Blaak et al., 2014b; Leverstein-van Hall et al., 2011; Manges a Johnson, 2012).
139
Obr. 51: eBURST diagram sekvenčních typů E. coli nesoucích cefalosporinázy (AmpC/ESBL) a/nebo
plazmidově determinovanou rezistenci k fluorochinolonům z trusu havranů polních v Evropě
Převzato z Jamborova et al., 201526
. Diagram dělí kmeny do tří klonálních komplexů (STC10, STC23 a STC155). Sekvenční
typy lišící se v jedné alele jsou vzájemně propojeny čárou. Každý ST je reprezentován uzlem. Sekvenční typy identifikované
v této studii jsou označeny růžovým kroužkem. Nejpočetnější linii v této studii představovala E. coli ST10.
7.10 Mobilní genetické elementy v šíření ESBL
Geny kódující ESBL jsou sdruženy s inzerčními sekvencemi, integrony, transpozony případně
dalšími MGE. V této podobě jsou pak začleněny buď do bakteriálního chromozomu nebo jsou neseny
konjugativními plazmidy. Asociace s MGE významně přízpívá k šíření bla genů v bakteriálních populacích
a utváří charakteristický obraz současné epidemiologie producentů ESBL. V následujícím textu jsou
představeny nejvýznamnější MGE v šíření ESBL, přičemž pozornost je soustředěna především na ty, které
mobilizují gen beta-laktamázy CTX-M. Text je doplněn grafickým znázorněním genetického kontextu
dalších ESBL genů vedle blaCTX-M (Obr. 55). Pro úplnost jsou znázorněny i struktury nesoucí jiné skupiny
klinicky významných beta-laktamáz (Obr. 56–58).
140
7.10.1 ISEcp1 v šíření ESBL
Pro blaCTX-M geny různých sekvenčních variant je charakteristické jejich sdružení s inzerční
sekvencí ISEcp1. Tato sekvence byla nalezena v souvislosti s blaCTX-M podskupin 1, 2, 25 a 9 (Canton et al.,
2012b; Zhao a Hu, 2013). Podílí se také na mobilizaci genů spojených s jinými mechanizmy rezistence,
například s AmpC beta-laktamázami nebo PMQR (Cattoir et al., 2008a; Partridge, 2011). ISEcp1 přenáší
sekvence lokalizované za svým 3’ koncem a zároveň poskytuje přilehlému genu protomor a tím zvyšuje
jeho expresi (Canton et al., 2012b).
7.10.1.1 Struktura modulu ISEcp1-blaCTX-M
ISEcp1 náleží do rodiny IS1380, obsahuje gen kódující transponázu tvořenou
420 aminokyselinovými zbytky a dvě nedokonalé obrácené repetice. Inzerční sekvence je v modulu
ISEcp1-blaCTX-M u klinických izolátů následována krátkou oblastí označovanou jako „spacer“. Na základě
vysoké sekvenční homologie této oblasti s genetickým kontextem chromozomálních genu blaklu
u Kluyvera spp. se předpokládá, že sekvence „spaceru“ byla přenesena spolu s genem pro beta-laktamázu
z chromozomu rezervoárových bakterií. Sekvence „spaceru“ vykazují v rámci CTX-M podskupiny vysokou
sekvenční homologii, což může ukazovat na mobilizaci genu z rezervoárových bakterií jedinou
transpoziční událostí (Canton et al., 2012b). Délka sekvence významně ovlivňuje sílu exprese a tím i
hladinu rezistence k cefalosporinům (Ma et al., 2011). V případě blaCTX-M podskupiny 1 sekvence dosahuje
velikosti 48–128 bp, u ostatních podskupin se pohybuje v rozmezí 34 až 52 bp.
Při 3’ konci platformy ISEcp1-blaCTX-M se obvykle nachází orf477, IS903 nebo příbuzné elementy.
Gen orf477 byl identifikován v okolí blaCTX-M na chromozomu Kluyvera spp., dá se tedy předpokládat, že
byl z rezervoárových druhů mobilizován spolu s genem pro vlastní beta-laktamázu, Obr. 51 (Zhao a Hu,
2013). Sekvence ISEcp1 může být přerušena vnořením jiných inzerčních sekvencí (IS1, IS10, ISCR1, IS26),
které ovlivňují schopnost mobilizace modulu ISEcp1-blaCTX-M. Nejčastěji je popisována transpozice IS26,
která probíhá do různých oblastí ISEcp1 sekvence. Příklady struktur okolí genů blaCTX-M sdružených
s ISEcp1 jsou uvedeny na Obr. 52.
141
Obr. 51: Kontext genu blaCTX-M-3 klinických izolátů a srovnání s chromozomální variantou Kluyvera spp.
Vytvořeno podle Rodríguez et al., 2004. Okolí genu blaCTX-M-3 klinických izolátů vykazuje vysokou úroveň podobnosti
s genetickým okolím rezervoárových druhů. Homologická oblast (vyznačená šedým stínováním) zahrnuje „spacer“
(červená), gen blaCTX-M-3 a část orf477 včetně alternativní obrácené repetice (IRR-like). Tato repetice může být během
transpozice chybně rozpoznávána ISEcp1, což vede k mobilizaci celého ISEcp1-blaCTX-M modulu. Repetice je obvykle
zakončena guanosinem, který pravděpodobně hraje důležitou úlohu v procesu transpozice.
Obr. 52: Struktura okolí blaCTX-M genů sdružených s ISEcp1
Vytvořeno podle Canton et al., 2012. Obrácené a přímé repetice nejsou ve struktuře znázorněny. Barevný obdelník před
blaCTX-M označuje sekvenci „spaceru.”
7.10.1.2 ISEcp1 v mobilizaci a expresi genu blaCTX-M
ISEcp1 sdružená s genem blaCTX-M zajišťuje dvojí funkci, jednak expresi genu a dále jeho mobilizaci.
Tato podvojná funkce je jedním z faktorů úspěšného šíření beta-laktamázy CTX-M. Gen blaCTX-M postrádá
silný promotor a pro vlastní expresi využívá promotoru ISEcp1. Rezervoárové bakterie rodu Kluyvera tuto
inzerční sekvenci v okolí genu blaklu postrádají. Hladina exprese je tedy u nich nízká a neprojeví se
142
fenotypem rezistence k cefalosporinům. Druhou funkcí, kterou ISEcp1 zajišťuje, je pohyb genu blaCTX-M
mezi genofory. Charakteristická struktura modulu ISEcp1-blaCTX-M umožňuje dvojí typ přenosu, který je
představen na Obr. 53. Během procesu transpozice rozpoznává transponáza obrácené repetice (IRL a IRR)
ohraničující ISEcp1 a inzerční sekvence je přenášena z donorového místa do místa cílového jako
samostatná jednotka. V důsledku chybnému rozpoznání alternativních pravých obrácených repetic (IRRlike)
lokalizovaných v okolí sdružených genů nastává nedokonalá transpozice celé jednotky, v tomto
případě tedy i genu blaCTX-M. Alternativní IRR byly identifikovány i v okolí chromozomálních genů blaklu
Kluyvera spp. a s nejvyšší pravděpodobností tak hrály zásadní úlohu v mobilizaci genu z rezervoárových
bakterií (Canton et al., 2012b; Lartigue et al., 2008).
Obr. 53: Transpozice inzerční sekvence nesprávným rozpoznáním pravé obrácené repetice vedoucí
k přenosu přilehlého genu rezistence
IRL, leva obrácená repetice; IRR, pravá obrácená repetice: IRR-like, alternativní obrácená repetice pravá vykazuje určitou
míru sekvenční homologie s IRR; (1) Transponáza rozpoznává obrácené repetice ohraničující inzerční sekvenci (IRL a IRR)
a přenáší se pouze oblast inzerční sekvence. (2) Transponáza chybně rozpoznává alternativní IRR (IRR-like) a přenáší kromě
vlastní inzerční sekvence i přilehlý gen.
Proces mobilizace genu blaCTX-M zprostředkovaný ISEcp1 z chromozomu rezervoárových bakterií
na plazmid klinických izolátů se podařilo prokázat v laboratorních podmínkách (Obr. 54). Zároveň bylo
zjištěno, že mobilizace blaCTX-M genu prostřednictvím ISEcp1 je indukována stresovými faktory, kterými
může být zvýšená teplota nebo účinkem některých antibiotik, například cefalosporinů. Na základě těchto
výsledků je spekulováno, že na šíření blaCTX-M by mohlo kromě rostoucí spotřeby antibiotik mít také vliv
globální oteplování (Lartigue et al., 2006; Nordmann et al., 2008).
1 2
143
Obr. 54: Mobilizace genu blaCTX-M-2 z chromozomu Kluyvera ascorbata prostředictvím ISEcp1B
Schéma znázorňuje kroky experimentálního přenosu genu popsané v publikaci autorů Lartigue et al., 2006. (1) Přenos
plazmidového vektoru s ISEcp1B (šedá šipka) elektroporací do buněk K. ascorbata nesoucích blaCTX-M-2 na chromozomu
(žlutá šipka). (2) Transpozice ISEcp1B před blaCXT-M-2 vedoucí k nárůstu exprese bla genu. Buňky obsahující transponovanou
jednotku byly selektovány na kultivační půdě s přídavkem cefalosporinu (cefotaximu). (3) Přenos konjugativního plazmidu
do buněk K. ascorbata. (4) Transpozice jednotky ISEcp1B-blaCTX-M-2 na konjugativní plazmid indukovaná cefotaximem nebo
teplotou 40o
C. (5) Přenos plazmidu nesoucího jednotku ISEcp1B-blaCTX-M-2 konjugací do recipientních buněk E. coli.
7.10.2 Další mobilní elementy sdružené s ESBL
Druhou významnou inzerční sekvencí mobilizující bla geny je ISCR1. Byla popsána především
ve spojitosti s blaCTX-M podskupin 2 a 9 (Zhao a Hu, 2013). Modul ISCR1-blaCTX-M se obvykle nachází mezi
sekvencí integronů třídy 1 a duplikovanou 3’ oblastí integronu tvořenou Δorf3 a qacEΔ1/sul1 (Obr. 55).
Gen blaCTX-M v toto případě netvoří klasickou genovou kazetu integronu. Podobně jako ISEcp1 se i ISCR1
účastní mobilizace a exprese sdružených genů a je odpovědná za přenos blaCTX-M genů z chromozomu
rezervoárových bakterií. Vnoření jednotky do integronu proběhlo pravděpodobně procesem homologní
rekombinace mezi dvěma úseky DNA sdruženými s ISCR1. Další IS identifikované v okolí blaCTX-M zahrnují
například IS1, IS5, IS10, IS26, IS50A, IS1294, IS1326, IS1300, IS4321 a IS6100 (Zhao a Hu, 2013).
Na mobilizaci genů se mohou podílet bakteriofágy (Colomer-Lluch et al., 2011b; Oliver et al.,
2005). Na 5’ konci genu blaCTX-M-10 byla identifikována oblast sekvence bakteriofága obsahující gen
pro DNA invertázu, která se účastní procesu mobilizace (Obr. 55). Charakteristická struktura blízkého okolí
genu blaCTX-M ukazuje na jeho přenos z rezervoárové bakterie K. cryocrescens transdukcí (Oliver et al.,
2001).
1 2
3
45
144
Kódující geny širokospektrých beta-laktamáz typu TEM, například TEM-52, jsou obvykle neseny
transpozony Tn3 rodiny (Obr. 55). Do transpozonů se mohou integrovat také blaCTX-M geny sdružené
s inzerčními sekvencemi (Partridge et al., 2011; Zong et al., 2015).
Obr. 55: ISCR1 a sekvence odvozené od bakteriofágů sdružené s blaCTX-M
Vytvořeno podle Canton et al., 2012b; Smet et al., 2010a. Obrácené a přímé repetice nejsou ve struktuře znázorněny.
Obr. 56: Příklady genetického kontextu další skupin ESBL
Vytvořeno podle Canton et al., 2012b; Smet et al., 2010a. Obrácené a přímé repetice nejsou znázorněny. blaTEM-52 je
součástí transpozonů rodiny Tn3; geny blaSHV rodiny jsou obvykle neseny kompozitvními transpozony ohraničenými
na obou stranách IS26. Geny pro jiné skupiny ESBL (VEB-1, GES-1, OXA-10) se vyskytují ve fromě genové kazety integronů.
Tn2
145
Obr. 57: Příklady kontextu genů AmpC beta-laktamáz sdružených s inzerčními sekvencemi
Vytvořeno podle Canton et al., 2012b; Smet et al., 2010a. Obrácené a přímé repetice nejsou ve struktuře znázorněny.
Beta-laktáza DHA-1 je sdružena s ISCR1 ve struktuře blízké okolí genů blaCTX-M skupin 2 a 9. Modul ISCR1-blaDHA-1 je včleněn
mezi integron třídy 1 a duplikovanou 3’ oblast integronu. Rozšířená beta-laktamáza skupiny CMY-2 je sdružena s ISEcp1.
Obr. 58: Příklady kontextu genů klinicky významných karbapenemáz
Vytvořeno podle Nordmann et al., 2012a. Obrácené a přímé repetice nejsou ve struktuře znázorněny. Geny
karbapenemáz KPC a 0XA-48 jsou součástí kompozitních transpozonů. Geny metalo-beta-laktamáz NDM jsou sdruženy
s ISAba125 a genem rezistence k bleomycinu. Jiné rodiny metalo-beta-laktamáz (VIM a IMP) jsou genovými kazetami
integronů třídy 1, sporadicky také třídy 3.
7.10.3 Plazmidy v šíření ESBL
V šíření ESBL hrají významnou roli epidemické plazmidy z různých inkompatibilních skupin. Jsou
dokumentovány celosvětově u různých druhů čeledi Enterobacteriaceae, zejména E. coli, Salmonella spp.
a Klebsiella spp. ze zvířat, člověka a prostředí. Nejvýznamnější plazmidy v šíření ESBL (CTX-M, TEM, SHV),
AmpC beta-laktamáz (CMY-2) a karbapenemáz náleží do inkompatibilních skupin F, A/C, N, HI2, I1, K a
L/M. Kromě genů beta-laktamáz obvykle nesou také geny rezistence k antibiotikům z jiných funkčních
tříd, které podporují jejich perzistenci v prostředí se selekčním tlakem širokého spektra antibiotik.
Některé třídy rezistentních plazmidů disponují nástroji pro proliferaci v hostitelských bakteriálních
Tn4401
Tn1999
146
buňkách, jak bylo popsáno v kapitole 6.5.8.10. Jsou sdruženy s faktory virulence, geny pro stabilní
propagaci plazmidu při buněčném dělení a dalšími faktory, které zvyšují celkové fitness bakteriálního
hostitele (Carattoli, 2009, 2013). Následující odstavce blíže charakterizují plazmidy vybraných
inkompatibilních skupin, které se významně podílí na šíření ESBL v enterobakteriálních populacích.
7.10.3.1 Virulentní plazmidy rodiny IncF v šíření CTX-M-15
Plazmidy skupiny IncF patří mezi nejlépe charakterizované plazmidy. Jsou nízkokopiové a replikují
se v poměrně úzkém spektru hostitelů limitovaném na čeleď Enterobacteriaceae (Osborn et al., 2000).
Patří mezi nejčastěji detekované plazmidy u humánních i veterinárních klinických izolátů této skupiny
bakterií včetně patogenních kmenů APEC a UPEC (Carattoli, 2008; Carattoli, 2009; Johnson et al., 2012b;
Johnson et al., 2007; Woodford et al., 2009). Jejich dobrou adaptaci na enterobakterie podporuje také
skutečnost, že byly frekventovaně detekovány ve sbírkách z předantibotické éry (Datta et al., 1980).
V současnosti představují nejvýznamnější plazmidy v celosvětovém šíření CTX-M-15 (Carattoli, 2009,
2013).
Na rozdíl od plazmidů jiných inkompatibilních skupin se IncF vyznačují vysokou variabilitou
základní kostry. Mají proměnlivou velikost (50-200 kb), nesou různý počet replikonů a mohou se rovněž
lišit mírou konjugačních schopností. Vysoká proměnlivost a rychlá evoluce stojí za úspěchem těchto
plazmidů. Zvyšují fitness bakteriálního hostitele, kterému poskytují různé virulenční faktory (bakteriociny,
siderofory, cytotoxiny, adherenční faktory) a multirezistentní fenotyp (Osborn et al., 2000). Disponují
adikčními systémy pro stabilní udržování v hostitelské buňce (Woodford et al., 2009). Bylo prokázáno, že
IncF plazmidy asociované s CTX-M obsahují vyšší počet těchto systémů než ty, které nesou jiné typy
širokospektrých beta-laktamáz. Například na plazmidech nesoucích geny blaCTX-M-15 nebo blaCTX-M-9 bylo
identifikováno až 5 různých systémů (Mnif et al., 2010). Tato charakteristická asociace s adikčními
systémy je jedním z dalších faktorů určujících úspěch CTX-M beta-laktamáz.
Plazmidy IncF rodiny sdružené s genem blaCTX-M-15 obvykle obsahují replikon FII, mohou však nést
další příbuzné replikony FIA nebo FIB a vykazovat multireplikonový charakter (Villa et al., 2010). Gen
kódující CTX-M-15 je součástí multirezistentní oblasti, která nese geny pro úzkospektré beta-laktamázy
OXA-1 a TEM-1 a determinanty rezistence k fluorochinolonům a aminoglykozidům, zejména aac(6′)-Ib-cr
(Albrechtova et al., 2012b11
; Dolejska et al., 2013a17
; Woodford et al., 2009). Další mechanizmy rezistence
k beta-laktamům sdružené s IncF zahrnují jiné varianty CTX-M (-1, -2, -3, -9, -14, -24, -27), beta-laktamázy
SHV (-2, -5, -12) a AmpC (CMY-2, DHA-1) nebo karbapenemázu KPC-2. Častá je také přítomnost genů qnr,
qepA pro rezistenci k fluorochinolonům a armA a rmtB podmiňující rezistenci k aminoglykozidům
(Carattoli, 2009, 2013).
147
7.10.3.2 Multirezistentní IncA/C2 plazmidy v šíření beta-laktamáz
Tato skupina plazmidů se dostala do popředí zájmu až v posledních letech díky šíření klinicky
významných mechanizmů rezistence k cefalosporinům a karbapenemům. IncA/C jsou velké (140–200 kb),
konjugativní a nízkokopiové plazmidy s širokým spektrem hostitelů, které využívají mechanizmus théta
replikace kontrolovaný iterony. Byly identifikovány u různých druhů gramnegativních bakterií, zejména
K. pneumoniae, E. coli, Salmonella enterica, Yersinia pestis, Vibrio cholerae, Aeromonas hydrophila a
Pseudomonas spp. ze zvířat, člověka i prostředí (Harmer a Hall, 2015). Kombinace vlastností těchto
plazmidů zahrnující široké spektrum hostitelů, multirezistentní fenotyp a efektivní přenos konjugací stojí
za jejich současným úspěchem.
Uspořádání genů základní kostry IncA/C plazmidů je velice stabilní a celkově se tyto plazmidy
vyznačují vysokou homologií primární nukleotidové sekvence (99 %). Analýza genu repA pro replikaci
plazmidu prokázala existenci dvou linií A/C1 a A/C2, k jejichž diverzifikaci došlo nejspíše před stovkami tisíc
let (Carattoli et al., 2006; Harmer a Hall, 2015). V kostře IncA/C plazmidů, která obsahuje geny
pro zajištění základních funkcí, byly identifikovány přinejmenším tři preferenční cílová místa
pro začleňování inzerčních sekvencí, tranpozonů, genů rezistence k antibiotikům a těžkým kovům,
zejména ke rtuti (Harmer a Hall, 2015; McIntosh et al., 2008).
V současné epidemiologii je významná linie A/C2, která je rozdělována do dvou podskupin
na základě charakteristických znaků v konzervativní oblasti plazmidu (Harmer a Hall, 2015). IncA/C
plazmidům je věnována pozornost díky jejich asociaci s AmpC beta-laktamázami skupiny CMY-2. Kódující
gen blaCMY-2 je vnořen do specifického místa v Tra oblasti plazmidu ve formě platformy ISEcp1-blaCMY-2-blc-sugE
(Fernandez-Alarcon et al., 2011). IncA/C plazmidy nesoucí blaCMY-2 jsou kosmopolitně rozšířeny
u E. coli a salmonel z hospodářských zvířat, v prostředí a jsou popisovány z případů humánních
nozokomiálních infekcí (Bortolaia et al., 2014; Carattoli, 2008; Carattoli, 2009; Guo et al., 2014; Hopkins
et al., 2006; Mataseje et al., 2010; Mulvey et al., 2009).
IncA/C plazmidy se podílí na přenosu ESBL (CTX-M-2, CTX-M-3) a některých karbapenemáz
(Carattoli, 2009; Randall et al., 2011). Hrály také významnou úlohu v celosvětovém rozšíření metalo-beta-laktamázy
NDM-1 mezi klinickými izoláty K. pneumoniae a E. coli (Carattoli, 2013; Dortet et al., 2014b;
Walsh et al., 2011). Pro Austrálii je typická vazba genů karbapenemázy IMP-4 rodiny na plazmidy této
skupiny (Dolejska et al., 201630
; Espedido et al., 2008). V naší recentní práci byla prokázána spojitost
IncA/C plazmidů s šířením karbapenemáz VIM u klinických izolátů K. pneumoniae v Řecku (Papagiannitsis
et al., 201632
).
148
7.10.3.3 IncN s širokým spektrem hostitelů v šíření CTX-M-1
IncN plazmidy patří mezi nejrozšířenější skupiny rezistentních plazmidů u Enterobacteriaceae
humánního i veterinárního původu, což souvisí jednak s jejich schopností se replikovat v širokém spektru
hostitelů a také s vysokou frekvencí konjugativního přenosu. Podobně jako ostatní skupiny epidemických
plazmidů také IncN disponují systémy, které zajišťují jejich stabilní udržování v hostitelské buňce.
V základní kostře plazmidů byla nalezena dvě cílová místa pro integraci přenosných genetických elementů
a genů rezistence, která se vyskytují mezi geny fipA a nuc a dale v blízkém okolí genů pro restrikčně
modifikační systém EcoRII, Obr. 59 (Carattoli et al., 2010; Dolejska et al., 2013b14
; Eikmeyer et al., 2012).
Obr. 59: Schematické znázornění struktury vybraných IncN plazmidů
Vytvořeno podle Dolejska et al., 2013b14
. Plazmid pHHA45 (GenBank, JX065630) byl izolován z E. coli v trusu prasat
v Dánsku. Představuje epidemický IncN plazmid ST1 sdružený s blaCTX-M-1. R46 (AY046276) je referenčním IncN plazmidem.
Plazmid pKT58A byl identifikován u E. coli z vodního ptáka v Polsku. Je epidemickým IncN plazmidem podskupiny ST3
sdružený s qnrS1. Charakteristické oblasti kostry společné pro IncN plazmidy jsou označeny barevně podle následujícího
klíče: fialová – gen rep pro replikaci plazmidu; zelená – geny zajišťující odolnost plazmidu vůči restrikčním a modifikačním
systémům buňky; světle modrá – geny pro stabilní propagaci plazmidu; oranžová – geny pro přenos plazmidu konjugací.
Mobilní genetické elementy (inzerční sekvence, transpozony, integrony) jsou označeny šedě. Modrý kruh značí místo
počátku přenosu plazmidu, oriT. Místa četné integrace genů rezistence do kostry IncN plazmidu (fipA, nuc a EcoRII) jsou
označeny tmavě modře. Oranžovou barvou jsou vyznačeny geny rezistence k antibiotikům, těžkým kovům a dezinfekčním
látkám. Šedé stínování mezi jednotlivými plazmidy vyjadřuje homologické oblasti plazmidů s podobností > 99 %.
IncN plazmidy jsou sdruženy s některými variantami ESBL, AmpC beta-laktamázami a
karbapenemázami, geny pro rezistenci k chinolonům, aminoglykozidům, tetracyklinu, sulfonamidům a
těžkým kovům. Potravinová zvířata jsou považována za rezervoár těchto plazmidů (Carattoli, 2009,
2011; Johnson et al., 2007). Jejich vysoká prevalence byla zjištěna vyšetřením běžné střevní mikroflóry
zdravých kuřat (Johnson et al., 2007). IncN plazmidy se významně podílí na šíření beta-laktamázy
CTX-M-1 v populaci E. coli a Salmonella enterica u lidí i zvířat v řadě evropských zemí (Bortolaia et al.,
2010a; Bortolaia et al., 2010b; Dolejska et al., 2013b14
; Moodley a Guardabassi, 2009). Studie v Dánsku
prokázala identické IncN plazmidy nesoucí gen blaCXT-M-1 u komenzálních izolátů E. coli ve střevní
mikroflóře prasat a pracovníků této farmy (Moodley a Guardabassi, 2009).
149
V roce 2011 byla publikována metoda pMLST („plasmid multilocus sequence typing“)
pro subtypizaci IncN založená na multilokusové sekvenční analýze tří genů přítomných v základní kostře
plazmidu (Garcia-Fernandez et al., 2011). Zároveň byla vytvořena veřejně dostupná databáze “Plasmid
MLST Dababase”, která shromažďuje podrobné informace o plazmidech charakterizovaných touto
metodou (http://pubmlst.org/plasmid/). V současné době je v ní evidováno 16 různých sekvenčních typů
IncN plazmidů (ke dni 20. 2. 2016). Využití této metody pro typizaci rozsáhlých sbírek IncN plazmidů
umožnila definovat specifické linie v rámci této plazmidové rodiny sdružené s určitými mechanizmy
rezistence (Obr. 60). Linie ST1 je v databázi zastoupena nejčastěji a je úzce vázaná na gen blaCTX-M-1. Byla
identifikována u izolátů E. coli a Salmonella spp. z hospodářských zvířat, zvířat chovaných ze záliby,
člověka i prostředí v Evropě (Dolejska et al., 2013b14
; Dobiasova et al., 201320
). Komparativní analýza
plazmidů IncN-ST1 nesoucích blaCTX-M-1 prokázala vysokou homogenitu této linie (Dolejska et al., 2013b14
).
Geny PMQR (zejména qnrS1) jsou u E. coli a salmonel v Evropě vázány především na IncN-ST3 plazmidy,
jejichž kompletní nukleotidová sekvence byla nedávno popsána (Dolejska et al., 2013b14
). Třetí
nejvýznamnější linií je IncN-ST11 odpovědná za lokální šíření karbapenemázy VIM-1 mezi humánními
klinickými izoláty v Řecku (Garcia-Fernandez et al., 2011; Giakkoupi et al., 2003).
qnrS1-ST1 E. coli vodní pták ČR
qnrS1-ST1 Salmonella spp. drůbež Nizozemí
blaCTX-M-1-ST1 E. coli skot, kůň, člověk ČR
blaCTX-M-1-ST1 E. coli prase, odpadní voda Dánsko, ČR
blaCTX-M-1-ST1 E. coli drůbež Itálie
qnrB19-ST8 E. coli kůň ČR
qnrB19-ST8 Salmonella spp. člověk Nizozemí
qnrS1-ST3 Salmonella spp., E. coli člověk, vodní pták Nizozemí, Slovensko
qnrS1-ST3 E. coli vodní pták Polsko
Obr. 60: Dominantní linie IncN plazmidů v šíření genů CTX-M-1 a Qnr
Převzato z Dolejska et al., 2013b14
. Dendrogram sestaven na základě enzymatických restrikčních profilů plazmidové DNA.
7.10.3.4 Multirezistentní IncHI plazmidy
IncHI jsou konjugativní plazmidy čeledi Enterobacteriaceae a dalších zástupců gramnegativních
bakterií. Jsou charakteristické svou velikostí dosahující více než 150 kb, a vysokou plasticitou. Ačkoliv by
replikace tak obrovského genetického aparátu IncHI plazmidů měla být pro buňku energetickou zátěží,
bylo prokázáno, že naopak zvyšují fitness bakteriální buňky a udržují se v prostředí bez antibiotik
(Dahlberg a Chao, 2003; Dionisio et al., 2005).
84.9
90.3
88.9
84.0
71.3
93.8
65.5
39.7
RFLP plazmidy
100
90
80
70
60
50
40
7
8
2
3
4
13
14
10
11
6
150
Konjugační systém IncHI plazmidů je termosenzitivní a optimální teplota pro jejich konjugační
přenos se pohybuje v rozmezí 22–30o
C (Taylor a Levine, 1980). Předpokládá se tedy, že prostředí
(zejména voda) hraje významnou úlohu v jejich šíření. Při teplotě 37o
C může konjugační přenos probíhat,
nicméně frekvence se mnohonásobně snižuje. Teplota neovlivňuje vlastní morfologii H pilu, ale významně
inhibuje tvorbu konjugačního páru (Garcia et al., 2007; Taylor, 2009; Taylor a Levine, 1980).
IncHI plazmidy představují vehikuly rezistence k antibiotikům. Jejich význam byl dokumentován
už v 80. letech v souvislosti s globálním šířením multirezistentního fenotypu u původců břišního tyfu
(Hasan et al., 2005; Taylor et al., 1985). V dnešní epidemiologii jsou skloňovány v kontextu šíření klinicky
významné rezistence k cefalosporinům a karbapenemům u Enterobacteriaceae. Kromě rezistence
k antibiotikům nesou genetickou informaci pro rezistenci ke kolicinu a k širokému spektru kovů (teluru,
arsenu, mědi, stříbru a rtuti), které mohou napomáhat jejich udržování v prostředí zatíženém těmito
látkami (Johnson et al., 2006; Minh-Duy a Wain, 2008; Whelan et al., 1995).
Plazmidy této rodiny se dělí do tří heterogenních podskupin HI1, HI2 a HI3. Navzdory minimální
sekvenční homologií jsou vzájemně inkompatibilní pravděpodobně v důsledku vysoké podobnosti
replikačního aparátu (Minh-Duy a Wain, 2008; Whiteley a Taylor, 1983). IncHI1 plazmidy jsou dobře
adaptovány na kmeny salmonel. Snížení vlastní biologické zátěže pro hostitelské buňky probíhá
prostřednictvím modulace transkripce chromozomálních genů regulačními proteiny H-NS, které tyto
plazmidy kódují (Doyle et al., 2007). U Salmonella Typhi a S. Paratyphi jsou IncHI1 odpovědné
za multirezistentní fenotyp zahrnující beta-laktamy, tetracykliny, chloramfenikol, streptomycin a
sulfonamidy (Phan et al., 2009). IncHI1 plazmidy byly popsány izolátů E. coli s produkcí CTX-M-1 z trusu
koní (Dolejska et al., 2011a5
). Kromě genů rezistence k antibiotikům byl na plazmidech identifikován
operon pro metabolizmus fruktooligosacharidů (Dolejska et al., 201424
). Sdružení rezistentních plazmidů
s přídatnou metabolickou funkcí pravděpodobně udílí kmenům E. coli určitou výhodu ve střevní
mikroflóře koní pod selekčním tlakem antibiotik.
IncHI2 plazmidy přispívají k šíření beta-laktamáz CTX-M-2 a CTX-M-9 u nozokomiálních kmenů
S. enterica a E. coli ve Španělsku, Francii a Belgii (Fernandez et al., 2007; Garcia et al., 2005). Identické
plazmidy nesoucí tyto beta-laktamázy byly zjištěny také u drůbeže, což podtrhuje jejich zoonotický
potenciál (Fernandez et al., 2007). Komparativní analýza sbírky IncHI2 plazmidů sdružených s genem
blaCTX-M-2 navíc prokázala jejich vysokou podobnost s plazmidy APEC kmenů z USA (Garcia et al., 2007;
Johnson et al., 2006). Nedávno bylo také upozorněno na souvislost mezi IncHI2 a šířením karbapenemázy
IMP-4 mezi klinickými a environmentálními druhy enterobakterií v Austrálii (Dolejska et al., 201630
;
Sidjabat et al., 2015).
151
7.10.3.5 Zoonotický potenciál IncI1 v šíření širokospektrých beta-laktamáz
Další skupinou plazmidů s významnou úlohou v šíření ESBL jsou IncI1 plazmidy. Dosahují velikosti
okolo 100 kb, vyznačují se vysokou frekvencí konjugace a úzkým spektrem hostitelů v rámci čeledi
Enterobacteriaceae (Carattoli, 2009). V sekvencích všech dosud popsaných IncI1 plazmidů byl
identifikován soubor genů kódující pily čtvrtého typu, které jsou považovány za faktory virulence
přispívající k adhezi a invazi patogenních kmenů E. coli (Kim a Komano, 1997). Vyšetřením rozsáhlé sbírky
humánních a aviárních izolátů E. coli byla prokázána vyšší prevalence IncI1 plazmidů u patogenních
kmenů v porovnání s komenzálními (Johnson et al., 2007). Charakteristické virulenční faktory a přenášené
geny rezistence k antibiotikům pravděpodobně napomáhají jejich globálnímu šíření. Experimentálně bylo
také zjištěno, že nevytváří biologickou zátěž pro hostitelskou buňku a dlouhodobě perzistují a ochotně se
přenáší konjugací v prostředí bez selekčního tlaku antibiotik (Handel et al., 2015). V sekvencích IncI1
plazmidů se také běžně nachází geny pro produkci kolicinu, jehož produkce může zvyšovat selekční
výhodu hostitelských kmenů.
Současné poznatky ukazují na kosmopolitní rozšíření IncI1 a podobně, jak bylo dokumentováno
u IncN plazmidů, také na roli potravního řetězce v jejich šíření. Nesou geny pro ESBL různých typů
(TEM-52, CTX-M-1, -2, -3, -9, -14, -15, -24) a AmpC beta-laktamázu CMY-2 (Carattoli, 2009). Dostupnost
metodiky plazmidové MLST pro subtypizaci IncI1 plazmidů ukázala na jejich vysokou diverzitu
(ke 20. 2. 2016 popsáno 217 sekvenčních typů). Zároveň odhalila dominanci některých vývojových linií
(ST3, ST7, ST12) a jejich spojitost s určitými typy beta-laktamáz (Garcia-Fernandez et al., 2008).
IncI1 plazmidy sdružené s blaCTX-M-1 byly prokázány u geneticky různorodých kmenů E. coli a
Salmonella enterica z různých zdrojů a geografických oblastí. Jejich přítomnost byla zjištěna ve střevě
zdravých lidí, u hospodářských zvířat (prasata, drůbež, skot), zvířat chovaných ze záliby a v prostředí
v Evropě, Austrálii, Africe a Severní Americe (Ben Sallem et al., 2014; de Been et al., 2014; Dobiasova et
al., 201320
; Haenni et al., 2014; Klimes et al., 201318
; Zurfluh et al., 2014). V naprosté většině případů
náleží do jedné ze dvou linií ST3 nebo ST7. Nizozemská studie prokázala geneticky příbuzné plazmidy
(ST7-CTX-M-1) u humánních klinických izolátů E. coli a kmenů z drůbeže a drůbežího masa (Leverstein-van
Hall et al., 2011). Autoři poukazují na rezervoár těchto plazmidů u drůbeže a význam potravního
řetězce v jejich šíření k patogenům člověka. Kosmopolitně je také rozšířen subtyp ST12 nesoucí gen
blaCMY-2 u humánních i veterinárních izolátů E. coli a Salmonella enterica, přičemž drůbež je považována
za jejich pravděpodobný rezervoár (Accogli et al., 201319
; Bortolaia et al., 2014; Dierikx et al., 2013; Folster
et al., 2010; Folster et al., 2012; Sidjabat et al., 2014; Tamang et al., 2012).
152
7.10.3.6 IncL/M v globálním šíření OXA-48
Plazmidy této skupiny jsou prokazovány v souvislosti s ESBL (CTX-M-3, SHV-5) a
karbapenemázami KPC, IMP, NDM a OXA-48 (Carattoli, 2008; Carattoli, 2013; Carattoli et al., 2015;
Woodford et al., 2009). Byly odpovědné za masivní šíření CTX-M-3 v polských nemocnicích a sporadicky
byly prokázány ve východní Evropě a Francii (Baraniak et al., 2002; Carattoli, 2009; Golebiewski et al.,
2007). V Austrálii IncL/M plazmidy přenáší gen pro metalo-beta-laktamázu IMP-4 (Espedido et al., 2008).
V posledních letech nabyly na svém významu díky globálnímu rozšíření OXA-48. Diseminace IncL/M
plazmidů sdružených s blaOXA-48 mezi různými zástupci čeledi Enterobacteriaceae je dokumentována
především v nemocnicích (Nordmann, 2014) včetně České republiky (J. Hrabák, LF UK v Plzni, osobní
sdělení). Hrozí jejich postupné pronikání do zdravé lidské populace a ke zvířatům chovaným ze záliby
(Stolle et al., 2013; Zurfluh et al., 2015). Sekvenční analýzy ukazují na vysokou homologii této plazmidové
linie (Carattoli et al., 2015; Poirel et al., 2012b; Pérez-Vázquez, 2016).
V 70. letech byly IncL/M plazmidy děleny na dvě vzájemně kompatibilní skupiny IncL a IncM
(Hedges et al., 1974). Vysoká úroveň sekvenční homologie vedla později k jejich zařazení do společné
inkompatibilní skupiny (Richards a Datta, 1979). Současná epidemiologie však naznačuje, že původní
členění bylo správné a opětovně bylo navrženo vytvoření dvou skupin (Carattoli et al., 2015). Plazmidy
sdružené s OXA-48 přísluší k IncL, zatímco ty, které nesou geny pro ESBL a jiné typy karbapenemáz patří
do IncM.
7.10.3.7 IncK v šíření CTX-M-14 a CMY-2
Na IncK plazmidy je upozorňováno v souvislosti s šířením beta-laktamázy CTX-M-14. Byly
identifikovány u izolátů E. coli z prasat a skotu (Cottell et al., 2011; Hansen et al., 2014; Liao et al., 2015;
Liebana et al., 2006). Ve Španělsku a Velké Británii bylo také pozorováno jejich šíření mezi humánními
klinickými izoláty (Dhanji et al., 2012; Valverde et al., 2009). Hrají také úlohu v epidemiologii producentů
CMY-2 (de Been et al., 2014; Porres-Osante et al., 2015).
153
8. Závěr
Rezistence bakterií k širokospektrým antimikrobiálním látkám ohrožuje medicínu 21. století,
komplikuje léčbu infekcí, zvyšuje nemocnost a úmrtnost a má rovněž významné dopady na světovou
ekonomiku. Za kritický je považován především rostoucí trend prevalence komenzálních i patogenních
zástupců čeledi Enterobacteriaceae rezistentních k cefalosporinům vyšších generací, karbapenemům a
fluorochinolonům, které řadíme mezi antibiotika určená k léčbě závažných a život ohrožujících infekcí.
Recentní studie včetně několik původních prací našeho týmu upozorňují na podobnosti molekulárně-genetických
charakteristik kmenů produkujících širokospektré beta-laktamázy izolovaných ze střeva
zvířat s kmeny z kolonizovaných osob nebo z případů humánních infekcí. S ohledem na negativní dopady
cefalosporinů na selekci, udržování a šíření rizikových rezistentních mechanizmů je snahou regulovat a
významně snižovat jejich spotřebu především v chovech potravinových zvířat, k čemuž přistupuje i Česká
republika. Všeobecným zájmem a cílem je zachovat klinickou účinnosti antimikrobiálních látek v terapii
humánních infekcí.
Genetická informace pro rezistenci ke sledovaným skupinám antibiotik je nesena mobilními
genetickými elementy a vázána na úspěšné klony bakterií, které společně podporují šíření multirezistence
v bakteriálních populacích. Naše recentní práce komentované v textu a doložené kopiemi publikačních
výstupů upozorňují na klíčovou roli horizontálního přenosu genů rezistence k rizikovým beta-laktamům a
fluorochinolonům prostřednictvím plazmidů a popisují význam četných genetických přestaveb v
plazmidových sekvencích vedoucí ke zvyšování komplexnosti oblastí multirezistence. Zároveň poukazují
na možnou úlohu sdružování multirezistentních konjugativních plazmidů s rezistencí k dezinfekčním
látkám, těžkým kovům, virulencí, produkcí bakteriocinů a dalšími funkcemi, v obecně rostoucím
charakteru antibiotické rezistence. Zdá se, že vedle rezistence k antibiotikům poskytují tyto plazmidy
nesené přídatné funkce bakteriální buňce jisté benefity a navyšují její celkové fitness. Předmětem dalšího
výzkumu je studium těchto sdružených funkcí a jejich vliv na udržování plazmidy determinovaných
mechanizmů rezistence v prostředí bez antibiotik.
Tato habilitační práce představila problematiku rezistence ke klinicky významným antibiotikům
humánní i veterinární medicíny v kontextu “jednoho zdraví” zahrnující člověka, zvířata a životní prostředí.
Výsledky našeho několikaletého výzkumu dokumentují zoonotický potenciál rezistentních bakterií,
poukazují na sdílení multirezistentních virulentních klonů člověkem a zvířaty, popisují cesty jejich přenosu
do prostředí a k volně žijícím zvířatům a v neposlední řadě dokládají zásadní význam vybraných rodin
mobilních genetických elementů v diseminaci rezistentních mechanizmů. Znalost epidemiologie
antibiotické rezistence a schopnost jednotlivé mechanizmy spolehlivě a rychle odhalit, je nezbytným
předpokladem pro omezení výskytu a šíření multirezistentních bakterií.
154
155
Seznam literatury
Aarestrup, F. M., 2006, Antimicrobial resistance in bacteria of animal origin: Washington, D.C., ASM Press, 441 pp.
Aarestrup, F. M., H. Hasman, Y. Agerso, L. B. Jensen, S. Harksen, and B. Svensmark, 2006, First description of blaCTXM-1-carrying
Escherichia coli isolates in Danish primary food production: Journal of Antimicrobial
Chemotherapy, v. 57, p. 1258-1259.
Abgottspon, H., K. Zurfluh, M. Nueesch-Inderbinen, H. Haechler, and R. Stephan, 2014, Quinolone resistance
mechanisms in Salmonella enterica Serovars Hadar, Kentucky, Virchow, Schwarzengrund, and 4,5,12:i:-,
isolated from humans in switzerland, and identification of a novel qnrD variant, qnrD2, in S. Hadar:
Antimicrobial Agents and Chemotherapy, v. 58, p. 3560-3563.
Accogli, M., D. Fortini, M. Giufre, C. Graziani, M. Dolejska, A. Carattoli, and M. Cerquetti, 2013, IncI1 plasmids
associated with the spread of CMY-2, CTX-M-1 and SHV-12 in Escherichia coli of animal and human origin:
Clinical Microbiology and Infection, v. 19, p. E238-E240.
Accogli, M., T. Giani, M. Monaco, M. Giufre, A. Garcia-Fernandez, V. Conte, F. D'Ancona, A. Pantosti, G. M. Rossolini,
and M. Cerquetti, 2014, Emergence of Escherichia coli ST131 sub-clone H30 producing VIM-1 and KPC-3
carbapenemases, Italy: Journal of Antimicrobial Chemotherapy, v. 69, p. 2293-2296.
Al-Ahmad, A., F. D. Daschner, and K. Kummerer, 1999, Biodegradability of cefotiam, ciprofloxacin, meropenem,
penicillin G, and sulfamethoxazole and inhibition of waste water bacteria: Archives of Environmental
Contamination and Toxicology, v. 37, p. 158-163.
Albrechtova, K., M. Dolejska, A. Cizek, D. Tausova, J. Klimes, L. Bebora, and I. Literak, 2012b, Dogs of nomadic
pastoralists in northern Kenya are reservoirs of plasmid-mediated cephalosporin- and quinolone-resistant
Escherichia coli, including pandemic clone B2-O25-ST131: Antimicrobial Agents and Chemotherapy, v. 56,
p. 4013-4017.
Albrechtová, K., I. Literák, and A. Čížek, 2012a, Výskyt izolátů Escherichia coli s produkcí širokospektrých betalaktamáz
a plazmidově přenášenou rezistencí k fluorochinolonům u definovaných souborů psů a koček v
České a Slovenské republice: Veterinářství, p. 277-282.
Albrechtova, K., I. Papousek, H. De Nys, M. Pauly, E. Anoh, A. Mossoun, M. Dolejska, M. Masarikova, G. Metzger, E.
Couacy-Hymann, C. Akouka-Koffi, R. M. Wittig, J. Klimes, A. Cizek, F. H. Leendertz, I. Literak, 2014, Low
Rates of Antimicrobial-Resistant Enterobacteriaceae in Wildlife in Taï National Park, Côte d'Ivoire,
Surrounded by Villages with High Prevalence of Multiresistant ESBL-Producing Escherichia coli in People
and Domestic Animals: PLoS One, v. 9, p. e113548.
Aldred, K. J., R. J. Kerns, N. Osheroff, 2014. Mechanism of Quinolone Action and Resistance: Biochemistry, v. 53, p.
1565-1574.
Allen, H. K., L. A. Moe, J. Rodbumrer, A. Gaarder, and J. Handelsman, 2009, Functional metagenomics reveals diverse
ß-lactamases in a remote Alaskan soil: Isme Journal, v. 3, p. 243-251.
Allmeier, H., B. Cresnar, M. Greck, and R. Schmitt, 1992, Complete nucleotide-sequence of Tn1721 : gene
organization and a novel gene-product with features of a chemotaxis protein: Gene, v. 111, p. 11-20.
Allocati, N., M. Masulli, M. F. Alexeyev, and C. Di Ilio, 2013, Escherichia coli in Europe: An overview: International
Journal of Environmental Research and Public Health, v. 10, p. 6235-6254.
Altimira, F., C. Yanez, G. Bravo, M. Gonzalez, L. A. Rojas, and M. Seeger, 2012, Characterization of copper-resistant
bacteria and bacterial communities from copper-polluted agricultural soils of central Chile: BMC
Microbiology, v. 12, p. 1-12.
Alvarez, M., J. H. Tran, N. Chow, and G. A. Jacoby, 2004, Epidemiology of conjugative plasmid-mediated AmpC ßlactamases
in the United States: Antimicrobial Agents and Chemotherapy, v. 48, p. 533-537.
Alvarez-Alvarez, R., A. Rodriguez-Garcia, Y. Martinez-Burgo, V. Robles-Reglero, I. Santamarta, R. Perez-Redondo, J.
F. Martin, and P. Liras, 2014, A 1.8-Mb-reduced Streptomyces clavuligerus genome: relevance for
secondary metabolism and differentiation: Applied Microbiology and Biotechnology, v. 98, p. 2183-2195.
Ambler, R. P., 1980, The structure of beta-lactamases: Philosophical Transactions of the Royal Society of London
Series B-Biological Sciences, v. 289, p. 321-331.
Amos, G. C. A., P. M. Hawkey, W. H. Gaze, and E. M. Wellington, 2014, Waste water effluent contributes to the
dissemination of CTX-M-15 in the natural environment: Journal of Antimicrobial Chemotherapy, v. 69, p.
1785-1791.
Andriole, V. T., 2005, The quinolones: past, present, and future. Clinical Microbiology and Infection, v. 41, p. S113-
119.
156
Applebaum, P. C., P. A. Hunter, 2000, The fluoroquinolone antibacterials: past, present and future perspectives:
International Journal of Antimicrobial Agents, v. 16, p. 5-15.
Arakawa, Y., M. Murakami, K. Suzuki, H. Ito, R. Wacharotayankun, S. Ohsuka, N. Kato, and M. Ohta, 1995, A novel
integron-like element carrying the metallo-ß-lactamase gene blaIMP: Antimicrobial Agents and
Chemotherapy, v. 39, p. 1612-1615.
Arana, D. M., D. Saez, P. Garcia-Hierro, V. Bautista, S. Fernandez-Romero, M. Angel de la Cal, J. I. Alos, and J. Oteo,
2015, Concurrent interspecies and clonal dissemination of OXA-48 carbapenemase: Clinical microbiology
and infection: the official publication of the European Society of Clinical Microbiology and Infectious
Diseases, v. 21, p. 148.e1-4.
Baede, V. O., J. A. Wagenaar, E. M. Broens, B. Duim, W. Dohmen, R. Nijsse, A. J. Timmerman, and J. Hordijk, 2015,
Longitudinal study of extended-spectrum-ß-lactamase- and AmpC-producing Enterobacteriaceae in
household dogs: Antimicrobial Agents and Chemotherapy, v. 59, p. 3117-3124.
Banerjee, R., and J. R. Johnson, 2014, A new clone sweeps clean: The enigmatic emergence of Escherichia coli
sequence type 131: Antimicrobial Agents and Chemotherapy, v. 58, p. 4997-5004.
Baquero, F., J.-L. Martinez, and R. Canton, 2008, Antibiotics and antibiotic resistance in water environments: Current
Opinion in Biotechnology, v. 19, p. 260-265.
Baraniak, A., J. Fiett, A. Sulikowska, W. Hryniewicz, and M. Gniadkowski, 2002, Countrywide spread of CTX-M-3
extended-spectrum ß-lactamase-producing microorganisms of the family Enterobacteriaceae in Poland:
Antimicrobial Agents and Chemotherapy, v. 46, p. 151-159.
Bardon, J., V. Husickova, M. Chroma, and M. Kolar, 2013, Prevalence and characteristics of Escherichia coli strains
producing extended-spectrum ß-lactamases in slaughtered animals in the Czech Republic: Journal of Food
Protection, v. 76, p. 1773-1777.
Barker, A., and P. A. Manning, 1997, VlpA of Vibrio cholerae O1: the first bacterial member of the α2-microglobulin
lipocalin superfamily: Microbiology, v. 143, p. 1805-1813.
Barlow, M., and B. G. Hall, 2002, Origin and evolution of the AmpC ß-lactamases of Citrobacter freundii:
Antimicrobial Agents and Chemotherapy, v. 46, p. 1190-1198.
Barnes, E. M., 1958, The effect of antibiotic supplements on the faecal streptococci (Lancefield group D) of poultry:
British Veterinary Journal, p. 333-344.
Bates, S., A. M. Cashmore, and B. M. Wilkins, 1998, IncP Plasmids Are unusually effective in mediating conjugation
of Escherichia coli and Saccharomyces cerevisiae: Involvement of the Tra2 mating system: Journal of
Bacteriology, v. 180, p. 6538-6543.
Batt, A. L., I. B. Bruce, and D. S. Aga, 2006, Evaluating the vulnerability of surface waters to antibiotic contamination
from varying wastewater treatment plant discharges: Environmental Pollution, v. 142, p. 295-302.
Bauernfeind, A., J. M. Casellas, M. Goldberg, M. Holley, R. Jungwirth, P. Mangold, T. Rohnisch, S. Schweighart, and
R. Wilhelm, 1992, A new plasmidic cefotaximase from patients infected with Salmonella typhimurium:
Infection, v. 20, p. 158-163.
Bauernfeind, A., H. Grimm, and S. Schweighart, 1990, A new plasmidic cefotaximase in a clinical isolate of Escherichia
coli: Infection, v. 18, p. 294-298.
Baur, B., K. Hanselmann, W. Schlimme, and B. Jenni, 1996, Genetic transformation in freshwater: Escherichia coli is
able to develop natural competence: Applied and Environmental Microbiology, v. 62, p. 3673-3678.
Bean, D. C., D. M. Livermore, and L. M. C. Hall, 2009, Plasmids imparting sulfonamide resistance in Escherichia coli:
Implications for persistence: Antimicrobial Agents and Chemotherapy, v. 53, p. 1088-1093.
Belanger, L., A. Garenaux, J. Harel, M. Boulianne, E. Nadeau, and C. M. Dozois, 2011, Escherichia coli from animal
reservoirs as a potential source of human extraintestinal pathogenic E. coli: FEMS Immunology and Medical
Microbiology, v. 62, p. 1-10.
Bellanger, X., S. Payot, N. Leblond-Bourget, and G. Guedon, 2014, Conjugative and mobilizable genomic islands in
bacteria: evolution and diversity: FEMS Microbiology Reviews, v. 38, p. 720-760.
Ben Sallem, R., K. Ben Slama, B. Rojo-Bezares, N. Porres-Osante, A. Jouini, N. Klibi, A. Boudabous, Y. Saenz, and C.
Torres, 2014, IncI1 Plasmids Carrying blaCTX-M-1 or blaCMY-2 Genes in Escherichia coli from healthy humans
and animals in Tunisia: Microbial Drug Resistance, v. 20, p. 495-500.
Ben-Ami, R., M. J. Schwaber, S. Navon-Venezia, D. Schwartz, M. Giladi, I. Chmelnitsky, A. Leavitt, and Y. Carmeli,
2006, Influx of extended-spectrum ßlactamase producing enterobacteriaceae into the hospital: clinical
Infectious Diseases, v. 42, p. 925-934.
Benvenis, R., and J. Davies, 1973, Aminoglycoside antibiotic-inactivating enzymes in Actinomycetes similar to those
present in clinical isolates of antibiotic-resistant bacteria: Proceedings of the National Academy of Sciences
of the United States of America, v. 70, p. 2276-2280.
157
Bergquist, P. L., H. E. D. Lane, L. Malcolm, and R. A. Downard, 1982, Molecular homology and incompatibility in the
IncFI plasmid Group: Journal of General Microbiology, v. 128, p. 223-238.
Bergquist, P. L., S. Saadi, and W. K. Maas, 1986, Distribution of basic replicons having homology with RepFIA, RepFIB,
and RepFIC among IncF group plasmids: Plasmid, v. 15, p. 19-34.
Berrazeg, M., S. M. Diene, L. Medjahed, P. Parola, M. Drissi, D. Raoult, and J. M. Rolain, 2014, New Delhi metallobeta-lactamase
around the world: An eReview using Google Maps: Eurosurveillance, v. 19, p. 2-15.
Bharagava, R. N., S. Yadav, and R. Chandra, 2014, Antibiotic and heavy metal resistance properties of bacteria
isolated from the aeration lagoons of common effluent treatment plant (CETP) of tannery industries
(Unnao, India): Indian Journal of Biotechnology, v. 13, p. 514-519.
Bhullar, K., N. Waglechner, A. Pawlowski, K. Koteva, E. D. Banks, M. D. Johnston, H. A. Barton, G. D. Wright, 2012,
Antibiotic resistance is prevalent in an isolated cave microbiome: PLoS ONE, v. 7, p. e34953.
Bi, D., Z. Xu, E. M. Harrison, C. Tai, Y. Wei, X. He, S. Jia, Z. Deng, K. Rajakumar, and H.-Y. Ou, 2012, ICEberg: a webbased
resource for integrative and conjugative elements found in Bacteria: Nucleic Acids Research, v. 40,
p. D621-D626.
Biju, C., A. Befekadu, S. Reji, K. Afework, W. Lan, and J. John, 2012, Entero-aggregative- haemorrhagic
Escherichia coli (EAHEC) serotype O104:H4 -The evolving “Superbug”, Bangladesh Journal of Medical
Sciences, p. 4-11.
Kim, B., H., M. Wang, C. H. Park, E.-C. Kim, G. A. Jacoby, and D. C. Hooper, 2009, oqxAB encoding a multidrug efflux
pump in human clinical isolates of Enterobacteriaceae: Antimicrobial Agents and Chemotherapy, v. 53, p.
3582-3584.
Bishop, R. E., and J. H. Weiner, 1992, Coordinate Regulation of murein peptidase activity aad Ampc ß-lactamase
synthesis in Escherichia coli: FEBSLetters, v. 304, p. 103-108.
Bissonnette, L., S. Champetier, J. P. Buisson, and P. H. Roy, 1991, Characterization of the nonenzymatic
chloramphenicol resistance (cmlA) gene of the In4 integron of Tn1696 - Similarity of the product to
transmembrane transport proteins: Journal of Bacteriology, v. 173, p. 4493-4502.
Blaak, H., P. de Kruijf, R. A. Hamidjaja, A. H. A. M. van Hoek, A. M. d. R. Husman, and F. M. Schets, 2014a, Prevalence
and characteristics of ESBL-producing E. coli in Dutch recreational waters influenced by wastewater
treatment plants: Veterinary Microbiology, v. 171, p. 448-459.
Blaak, H., R. A. Hamidjaja, A. H. A. M. van Hoek, L. de Heer, A. M. d. R. Husman, and F. M. Schets, 2014b, Detection
of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli on flies at poultry farms: Applied
and Environmental Microbiology, v. 80, p. 239-246.
Blaak, H., G. Lynch, R. Italiaander, R. A. Hamidjaja, F. M. Schets, and A. M. d. R. Husman, 2015, Multidrug-resistant
and extended spectrum beta-lactamase-producing Escherichia coli in Dutch surface water and wastewater:
PLOS ONE, v. 10, p- 1-16.
Blanc, V., R. Mesa, M. Saco, S. Lavilla, G. Prats, E. Miro, F. Navarro, P. Cortes, and M. Llagostera, 2006, ESBL- and
plasmidic class C ß-lactamase-producing E. coli strains isolated from poultry, pig and rabbit farms:
Veterinary Microbiology, v. 118, p. 299-304.
Blondeau, J. M., 2009, New concepts in antimicrobial susceptibility testing: the mutant prevention concentration
and mutant selection window approach: Veterinary Dermatology, v. 20, p. 383-396.
Bobrowski, M. M., M. Matthew, P. T. Barth, N. Datta, N. J. Grinter, A. E. Jacob, P. Kontomichalou, J. W. Dale, and J.
T. Smith, 1976, Plasmid-determined ß-lactamase indistinguishable from the chromosomal ß-lactamase of
Escherichia coli: Journal of Bacteriology, v. 125, p. 149-157.
Bogaerts, P., T.-D. Huang, W. Bouchahrouf, C. Bauraing, C. Berhin, F. El Garch, Y. Glupczynski, and G. ComPath Study,
2015, Characterization of ESBL- and AmpC-producing Enterobacteriaceae from diseased companion
animals in Europe: Microbial Drug Resistance, v. 21, p. 643-650.
Bogaerts, P., A. M. Hujer, T. Naas, R. R. de Castro, A. Endimiani, P. Nordmann, Y. Glupczynski, and R. A. Bonomo,
2011, Multicenter evaluation of a new DNA microarray for rapid detection of clinically relevant bla genes
from ß-lactam-resistant gram-negative bacteria: Antimicrobial Agents and Chemotherapy, v. 55, p. 4457-
4460.
Bojer, M. S., C. Struve, H. Ingmer, D. S. Hansen, and K. A. Krogfelt, 2010, Heat Resistance mediated by a new plasmid
encoded Clp ATPase, ClpK, as a possible novel mechanism for nosocomial persistence of Klebsiella
pneumoniae: PLOS One, v. 5, p. 1-9.
Bolivar, F., R. L. Rodriguez, P. J. Greene, M. C. Betlach, H. L. Heyneker, H. W. Boyer, J. H. Crosa, and S. Falkow, 1977,
Construction and characterization of new cloning vehicles. II. A multipurpose cloning system: Gene, v. 2,
p. 95-113.
158
Bonelli, R. R., B. M. Moreira, and R. C. Picao, 2014, Antimicrobial resistance among Enterobacteriaceae in South
America: History, current dissemination status and associated socioeconomic factors: Drug Resistance
Updates, v. 17, p. 24-36.
Bonnedahl, J., J. Hernandez, J. Stedt, J. Waldenstrom, B. Olsen, and M. Drobni, 2014, Extended-spectrum
ßlactamases in Escherichia coli and Klebsiella pneumoniae in gulls, Alaska, USA: Emerging Infectious
Diseases, v. 20, p. 897-899.
Bonnet, R., 2004, Growing group of extended-spectrum ß-lactamases: The CTX-M enzymes: Antimicrobial Agents
and Chemotherapy, v. 48, p. 1-14.
Bortolaia, V., L. Guardabassi, M. Bisgaard, J. Larsen, and A. M. Bojesen, 2010a, Escherichia coli producing CTX-M-1,-
2, and-9 group ß-lactamases in organic chicken egg production: Antimicrobial Agents and Chemotherapy,
v. 54, p. 3527-3528.
Bortolaia, V., L. Guardabassi, M. Trevisani, M. Bisgaard, L. Venturi, and A. M. Bojesen, 2010b, High diversity of
extended-spectrum ß-lactamases in Escherichia coli isolates from Italian broiler flocks: Antimicrobial
Agents and Chemotherapy, v. 54, p. 1623-1626.
Bortolaia, V., K. H. Hansen, C. A. Nielsen, T. R. Fritsche, and L. Guardabassi, 2014, High diversity of plasmids
harbouring blaCMY-2 among clinical Escherichia coli isolates from humans and companion animals in the
upper Midwestern USA: Journal of Antimicrobial Chemotherapy, v. 69, p. 1492-1496.
Boucher, Y., C. L. Nesbo, M. J. Joss, A. Robinson, B. C. Mabbutt, M. R. Gillings, W. F. Doolittle, and H. W. Stokes,
2006, Recovery and evolutionary analysis of complete integron gene cassette arrays from Vibrio: BMC
Evolutionary Biology, v. 6, p. 1-14.
Bouet, J.-Y., K. Nordstrom, and D. Lane, 2007, Plasmid partition and incompatibility - the focus shifts: Molecular
Microbiology, v. 65, p. 1405-1414.
Bousquet, A., S. Henquet, F. Compain, N. Genel, G. Arlet, and D. Decre, 2015, Partition locus-based classification of
selected plasmids in Klebsiella pneumoniae, Escherichia coli and Salmonella enterica spp.: An additional
tool: Journal of Microbiological Methods, v. 110, p. 85-91.
Boxall, A. B. A., P. Johnson, E. J. Smith, C. J. Sinclair, E. Stutt, and L. S. Levy, 2006, Uptake of veterinary medicines
from soils into plants: Journal of Agricultural and Food Chemistry, v. 54, p. 2288-2297.
Boyd, D. A., and M. R. Mulvey, 2013, The VanE operon in Enterococcus faecalis N00-410 is found on a putative
integrative and conjugative element, Tn6202: Journal of Antimicrobial Chemotherapy, v. 68, p. 294-299.
Boyd, D. A., G. A. Peters, L. K. Ng, and M. R. Mulvey, 2000, Partial characterization of a genomic island associated
with the multidrug resistance region of Salmonella enterica Typhymurium DT104: FEMS Microbiology
Letters, v. 189, p. 285-291.
Bradford, P. A., 2001, Extended-spectrum ß-lactamases in the 21st century: Characterization, epidemiology, and
detection of this important resistance threat: Clinical Microbiology Reviews, v. 14, p. 933-951.
Brigante, G., F. Luzzaro, M. Perilli, G. Lombardi, A. Coli, G. M. Rossolini, G. Amicosante, and A. Toniolo, 2005,
Evolution of CTX-M-type ß-lactamases in isolates of Escherichia coli infecting hospital and community
patients: International Journal of Antimicrobial Agents, v. 25, p. 157-162.
Brinas, L., M. A. Moreno, T. Teshager, Y. Saenz, M. C. Porrero, L. Dominguez, and C. Torres, 2005, Monitoring and
characterization of extended-spectrum ß-lactamases in Escherichia coli strains from healthy and sick
animals in Spain in 2003: Antimicrobial Agents and Chemotherapy, v. 49, p. 1262-1264.
Brinas, L., M. A. Moreno, M. Zarazaga, C. Porrero, Y. Saenz, M. Garcia, L. Dominguez, and C. Torres, 2003, Detection
of CMY-2, CTX-M-14, and SHV-12 ß-lactamases in Escherichia coli fecal-sample isolates from healthy
chickens: Antimicrobial Agents and Chemotherapy, v. 47, p. 2056-2058.
Brouwer, M. S. M., A. Bossers, F. Harders, A. van Essen-Zandbergen, D. J. Mevius, and H. E. Smith, 2014, Complete
genome sequences of IncI1 plasmids carrying extended-spectrum ß-lactamase genes: Genome
announcements, v. 2, p. 1-2.
Brown-Jaque, M., W. Calero-Caceres, and M. Muniesa, 2015, Transfer of antibiotic-resistance genes via phagerelated
mobile elements: Plasmid, v. 79, p. 1-7.
Bryskier, 2005, Antimicrobial agents: Antibacterials and Antifungals, Washington D.C., American Society for
Microbiology Press, 1426 pp.
Burland, V., Y. Shao, N. T. Perna, G. Plunkett, H. J. Sofia, and F. R. Blattner, 1998, The complete DNA sequence and
analysis of the large virulence plasmid of Escherichia coli O157 : H7: Nucleic Acids Research, v. 26, p. 4196-
4204.
Burman, L. G., 1977, Apparent absence of transferable resistance to nalidixic-acid in pathogenic Gram-negative
bacteria: Journal of Antimicrobial Chemotherapy, v. 3, p. 509-516.
Burrus, V., G. Pavlovic, B. Decaris, and G. Guedon, 2002, Conjugative transposons: the tip of the iceberg: Molecular
Microbiology, v. 46, p. 601-610.
159
Bush, K., 2010, Alarming ß-lactamase-mediated resistance in multidrug-resistant Enterobacteriaceae: Current
Opinion in Microbiology, v. 13, p. 558-564.
Bush, K., 2013, The ABCD's of ß-lactamase nomenclature: Journal of Infection and Chemotherapy, v. 19, p. 549-559.
Bush, K., and G. A. Jacoby, 2010, Updated functional classification of ß-lactamases: Antimicrobial Agents and
Chemotherapy, v. 54, p. 969-976.
Bush, K., G. A. Jacoby, and A. A. Medeiros, 1995, A functional classification scheme for ß-lactamases and its
correlation with molecular-structure: Antimicrobial Agents and Chemotherapy, v. 39, p. 1211-1233.
Calero-Caceres, W., A. Melgarejo, M. Colomer-Lluch, C. Stoll, F. Lucena, J. Jofre, and M. Muniesa, 2014, Sludge as a
potential important source of antibiotic resistance genes in both the bacterial and bacteriophage fractions:
Environmental Science & Technology, v. 48, p. 7602-7611.
Cambau, E., C. Lascols, W. Sougakoff, C. Bebear, R. Bonnet, J. D. Cavallo, L. Gutmann, M. C. Ploy, V. Jarlier, C. J.
Soussy, and J. Robert, 2006, Occurrence of qnrA-positive clinical isolates in French teaching hospitals
during 2002-2005: Clinical Microbiology and Infection, v. 12, p. 1013-1020.
Campbell, A., D. E. Berg, E. M. Lederberg, P. Starlinger, D. Botstein, R. P. Novick, and W. Szybalski, 1979,
Nomenclature of transposable elements in prokaryotes: Plasmid, v. 2, p. 466-473.
Canton, R., M. Akova, Y. Carmeli, C. G. Giske, Y. Glupczynski, M. Gniadkowski, D. M. Livermore, V. Miriagou, T. Naas,
G. M. Rossolini, O. Samuelsen, H. Seifert, N. Woodford, P. Nordmann, and C. European Network, 2012a,
Rapid evolution and spread of carbapenemases among Enterobacteriaceae in Europe: Clinical
Microbiology and Infection, v. 18, p. 413-431.
Canton, R., and T. M. Coque, 2006, The CTX-M ß-lactamase pandemic: Current Opinion in Microbiology, v. 9, p. 466-
475.
Canton, R., J. Maria Gonzlez-Alba, and J. Carlos Galan, 2012b, CTX-M enzymes: origin and diffusion: Frontiers in
Microbiology, v. 3, p. 1-19.
Canton, R., and M.-I. Morosini, 2011, Emergence and spread of antibiotic resistance following exposure to
antibiotics: FEMS Microbiology Reviews, v. 35, p. 977-991.
Canton, R., A. Novais, A. Valverde, E. Machado, L. Peixe, F. Baquero, and T. M. Coque, 2008, Prevalence and spread
of extended-spectrum ß-lactamase-producing Enterobacteriaceae in Europe: Clinical Microbiology and
Infection, v. 14, p. 144-153.
Canton, R., and P. Ruiz-Garbajosa, 2011, Co-resistance: an opportunity for the bacteria and resistance genes:
Current Opinion in Pharmacology, v. 11, p. 477-485.
Carattoli, A., 2001, Importance of integrons in the diffusion of resistance: Veterinary Research, v. 32, p. 243-259.
Carattoli, A., 2008, Animal reservoirs for extended spectrum ß-lactamase producers: Clinical Microbiology and
Infection, v. 14, p. 117-123.
Carattoli, A., 2009, Resistance plasmid families in Enterobacteriaceae: Antimicrobial Agents and Chemotherapy, v.
53, p. 2227-2238.
Carattoli, A., 2011, Plasmids in Gram negatives: Molecular typing of resistance plasmids: International Journal of
Medical Microbiology, v. 301, p. 654-658.
Carattoli, A., 2013, Plasmids and the spread of resistance: International Journal of Medical Microbiology, v. 303, p.
298-304.
Carattoli, A., R. Aschbacher, A. March, C. Larcher, D. M. Livermore, and N. Woodford, 2010, Complete nucleotide
sequence of the IncN plasmid pKOX105 encoding VIM-1, QnrS1 and SHV-12 proteins in Enterobacteriaceae
from Bolzano, Italy compared with IncN plasmids encoding KPC enzymes in the USA: Journal of
Antimicrobial Chemotherapy, v. 65, p. 2070-2075.
Carattoli, A., A. Bertini, L. Villa, V. Falbo, K. L. Hopkins, and E. J. Threlfall, 2005a, Identification of plasmids by PCRbased
replicon typing: Journal of Microbiological Methods, v. 63, p. 219-228.
Carattoli, A., S. Lovari, A. Franco, G. Cordaro, P. Di Matteo, and A. Battisti, 2005b, Extended-spectrum ß-lactamases
in Escherichia coli isolated from dogs and cats in Rome, Italy, from 2001 to 2003: Antimicrobial Agents and
Chemotherapy, v. 49, p. 833-835.
Carattoli, A., V. Miriagou, A. Bertini, A. Loli, C. Colinon, L. Villa, J. M. Whichard, and G. M. Rossolini, 2006, Replicon
Typing of plasmids encoding resistance to newer ß-lactams: Emerging Infectious Diseases, v. 12, p. 1145-
1148.
Carattoli, A., S. N. Seiffert, S. Schwendener, V. Perreten, and A. Endimiani, 2015, Differentiation of IncL and IncM
plasmids associated with the spread of clinically relevant antimicrobial resistance: PLOS One, v. 10, p. 1-
14.
Carattoli, A., F. Tosini, W. P. Giles, M. E. Rupp, S. H. Hinrichs, F. J. Angulo, T. J. Barrett, and P. D. Fey, 2002,
Characterization of plasmids carrying CMY-2 from expanded-spectrum cephalosporin-resistant Salmonella
160
strains isolated in the United States between 1996 and 1998: Antimicrobial Agents and Chemotherapy, v.
46, p. 1269-1272.
Carattoli, A., E. Zankari, A. Garcia-Fernandez, M. V. Larsen, O. Lund, L. Villa, F. M. Aarestrup, and H. Hasman, 2014,
In Silico detection and typing of plasmids using PlasmidFinder and plasmid multilocus sequence typing:
Antimicrobial Agents and Chemotherapy, v. 58, p. 3895-3903.
Cartelle, M., M. D. Tomas, F. Molina, R. Moure, R. Villanueva, and G. Bou, 2004, High-level resistance to ceftazidime
conferred by a novel enzyme, CTX-M-32, derived from CTX-M-1 through a single Asp240-Gly substitution:
Antimicrobial Agents and Chemotherapy, v. 48, p. 2308-2313.
Castanheira, M., M. A. Toleman, R. N. Jones, F. J. Schmidt, and T. R. Walsh, 2004, Molecular characterization of a ßlactamase
gene, blaGIM-1, encoding a new subclass of metallo-ß -lactamase: Antimicrobial Agents and
Chemotherapy, v. 48, p. 4654-4661.
Castillo Garcia, F. J., C. Seral Garcia, M. Pardos De la Gandara, M. I. Millan Lou, and C. Pitart Ferre, 2007, Prevalence
of fecal carriage of ESBL-producing Enterobacteriaceae in hospitalized and ambulatory patients during two
non-outbreak periods: European Journal of Clinical Microbiology & Infectious Diseases, v. 26, p. 77-8.
Cattoir, V., P. Nordmann, J. Silva-Sanchez, P. Espinal, and L. Poirel, 2008a, ISEcp1-mediated transposition of qnrBlike
gene in Escherichia coli: Antimicrobial Agents and Chemotherapy, v. 52, p. 2929-2932.
Cattoir, V., L. Poirel, C. Aubert, C.-J. Soussy, and P. Nordmann, 2008b, Unexpected occurrence of plasmid-mediated
quinolone resistance determinants in environmental Aeromonas spp: Emerging Infectious Diseases, v. 14,
p. 231-237.
Cattoir, V., L. Poirel, D. Mazel, C.-J. Soussy, and P. Nordmann, 2007, Vibrio splendidus as the source of plasmidmediated
Qnrs-like quinolone resistance determinants: Antimicrobial Agents and Chemotherapy, v. 51, p.
2650-2651.
Cattoir, V., L. Poirel, and P. Nordmann, 2008c, Plasmid-mediated quinolone resistance pump Qepa2 in an
Escherichia coli isolate from France: Antimicrobial Agents and Chemotherapy, v. 52, p. 3801-3804.
Cavaco, L. M., E. Abatih, F. M. Aarestrup, and L. Guardabassi, 2008, Selection and persistence of CTX-M-producing
Escherichia coli in the intestinal flora of pigs treated with amoxicillin, ceftiofur, or cefquinome:
Antimicrobial Agents and Chemotherapy, v. 52, p. 3612-3616.
Cavaco, L. M., H. Hasman, S. Xia, and F. M. Aarestrup, 2009, qnrD, a novel gene conferring transferable quinolone
resistance in Salmonella enterica Serovar Kentucky and Bovismorbificans strains of human origin:
Antimicrobial Agents and Chemotherapy, v. 53, p. 603-608.
Cekanova, L., M. Kolar, M. Chroma, P. Sauer, M. Sedlackova, and D. Koukalova, 2009, Prevalence of ESBL-positive
bacteria in the community in the Czech Republic: Medical Science Monitor, v. 15, p. BR202-BR206.
Cerin, H., and J. Hackett, 1993, The parVP region of the Salmonella-Typhimurium virulence plasmid pSLT contains
four loci required for incompatibility and partition: Plasmid, v. 30, p. 30-38.
Chandler, M., and J. Mahillon, 2000, Insertion sequence nomenclature: ASM News, v. 66, p. 324-324.
Chen, Y.-T., T.-L. Liao, Y.-M. Liu, T.-L. Lauderdale, J.-J. Yan, and S.-F. Tsai, 2009, Mobilization of qnrB2 and ISCR1 in
plasmids: Antimicrobial Agents and Chemotherapy, v. 53, p. 1235-1237.
Cheng, W., J. Li, Y. Wu, C. Su, Y. Qian, Y. G. Zhu, H. Chen, 2016, Behavior of antibiotics and antibiotic resistance genes
in eco-agricultural system: A case study: Journal of Hazardous Materials, v. 304, p. 18-25.
Ciesielczuk, H., M. Hornsey, V. Choi, N. Woodford, and D. W. Wareham, 2013, Development and evaluation of a
multiplex PCR for eight plasmid-mediated quinolone-resistance determinants: Journal of Medical
Microbiology, v. 62, p. 1823-1827.
CLSI, 2013, Performance standards for antimicrobial susceptibility testing, twenty-third informational supplement
M100-S23, Wayne, PA, Clinical and Laboratory Standards Institute.
CLSI, 2015, Performance standards for antimicrobial susceptibility testing, twenty-third informational supplement
M100-S25, Wayne, PA, Clinical and Laboratory Standards Institute.
Cohen, S., and H. M. Sweeney, 1970, Transduction of methicillin resistance in Staphylococcus aureus dependent on
an unusual specificity of recipient strain: Journal of Bacteriology, v. 104, p. 1158-1167.
Cole, J. M., A. N. Schuetz, C. E. Hill, and F. S. Nolte, 2009, Development and evaluation of a real-time PCR assay for
detection of Klebsiella pneumoniae carbapenemase genes: Journal of Clinical Microbiology, v. 47, p. 322-
326.
Collis, C. M., and R. M. Hall, 1992, Gene cassettes from the insert region of integrons are excised as covalently closed
circles: Molecular Microbiology, v. 6, p. 2875-2885.
Collis, C. M., and R. M. Hall, 1995, Expression of antibiotic resistance genes in the integrated cassettes of integrons:
Antimicrobial Agents and Chemotherapy, v. 39, p. 155-162.
Collis, C. M., M. J. Kim, S. R. Partridge, H. W. Stokes, and R. M. Hall, 2002, Characterization of the class 3 integron
and the site-specific recombination system it determines: Journal of Bacteriology, v. 184, p. 3017-3026.
161
Colomer-Lluch, M., L. Imamovic, J. Jofre, and M. Muniesa, 2011a, Bacteriophages carrying antibiotic resistance
genes in fecal waste from cattle, pigs, and poultry: Antimicrobial Agents and Chemotherapy, v. 55, p. 4908-
4911.
Colomer-Lluch, M., J. Jofre, and M. Muniesa, 2011b, Antibiotic resistance genes in the bacteriophage DNA fraction
of environmental samples: PLOS One, v. 6., p. 1-11.
Colomer-Lluch, M., J. Jofre, and M. Muniesa, 2014, Quinolone resistance genes (qnrA and qnrS) in bacteriophage
particles from wastewater samples and the effect of inducing agents on packaged antibiotic resistance
genes: Journal of Antimicrobial Chemotherapy, v. 69, p. 1265-1274.
Compain, F., A. Poisson, S. Le Hello, C. Branger, F.-X. Weill, G. Arlet, and D. Decre, 2014, Targeting relaxase genes
for classification of the predominant plasmids in Enterobacteriaceae: International Journal of Medical
Microbiology, v. 304, p. 236-242.
Correia, M., F. Boavida, F. Grosso, M. J. Salgado, L. M. Lito, J. M. Cristino, S. Mendo, and A. Duarte, 2003, Molecular
characterization of a new class 3 integron in Klebsiella pneumoniae: Antimicrobial Agents and
Chemotherapy, v. 47, p. 2838-2843.
Cortes, P., V. Blanc, A. Mora, G. Dahbi, J. E. Blanco, M. Blanco, C. Lopez, A. Andreu, F. Navarro, M. Pilar Alonso, G.
Bou, J. Blanco, and M. Llagostera, 2010, Isolation and characterization of potentially pathogenic
antimicrobial-resistant Escherichia coli strains from chicken and pig farms in Spain: Applied and
Environmental Microbiology, v. 76, p. 2799-2805.
Costa, D., P. Poeta, L. Brinas, Y. Saenz, J. Rodrigues, and C. Torres, 2004, Detection of CTX-M-1 and TEM-52 ßlactamases
in Escherichia coli strains from healthy pets in Portugal: Journal of Antimicrobial Chemotherapy,
v. 54, p. 960-961.
Costa, D., P. Poeta, Y. Saenz, L. Vinue, B. Rojo-Bezares, A. Jouini, M. Zarazaga, J. Rodrigues, and C. Torres, 2006,
Detection of Escherichia coli harbouring extended-spectrum ß-lactamases of the CTX-M, TEM and SHV
classes in faecal samples of wild animals in Portugal: Journal of Antimicrobial Chemotherapy, v. 58, p. 1311-
1312.
Cottell, J. L., M. A. Webber, N. G. Coldham, D. L. Taylor, A. M. Cerdeno-Tarraga, H. Hauser, N. R. Thomson, M. J.
Woodward, and L. J. V. Piddock, 2011, Complete sequence and molecular epidemiology of IncK epidemic
plasmid encoding blaCTX-M-14: Emerging Infectious Diseases, v. 17, p. 645-652.
Couturier, M., F. Bex, P. L. Bergquist, and W. K. Maas, 1988, Identification and classification of bacterial plasmids:
Microbiological Reviews, v. 52, p. 375-395.
Crozat, E., F. Fournes, F. Cornet, B. Hallet, and P. Rousseau, 2014, Resolution of multimeric forms of circular plasmids
and chromosomes: Microbiology spectrum, v. 2, p. 1-16.
Cuzon, G., J. Ouanich, R. Gondret, T. Naas, and P. Nordmann, 2011, Outbreak of OXA-48-Positive carbapenemresistant
Klebsiella pneumoniae Isolates in France: Antimicrobial Agents and Chemotherapy, v. 55, p. 2420-
2423.
D'Andrea, M. M., F. Arena, L. Pallecchi, and G. M. Rossolini, 2013, CTX-M-type ß-lactamases: A successful story of
antibiotic resistance: International Journal of Medical Microbiology, v. 303, p. 305-317.
D’Costa, V. M., C. E. King, L. Kalan,M. Morar, W. W. L. Sung, C. Schwarz, D. Froese, G. Zazula, F. Calmels, R. Debruyne,
G. B. Golding, H. N. Poinar, 2011, Antibiotic resistance is ancient: Nature, v. 477, p. 457–461.
D'Costa, V. M., K. M. McGrann, D. W. Hughes, and G. D. Wright, 2006, Sampling the antibiotic resistome: Science,
v. 311, p. 374-377.
da Costa, P. M., L. Loureiro, and A. J. F. Matos, 2013, Transfer of multidrug-resistant bacteria between intermingled
ecological niches: The Interface Between Humans, Animals and the Environment: International Journal of
Environmental Research and Public Health, v. 10, p. 278-294.
da Costa, P. M., P. Vaz-Pires, and F. Bernardo, 2008, Antimicrobial resistance in Escherichia coli isolated in
wastewater and sludge from poultry slaughterhouse wastewater plants: Journal of Environmental Health,
v. 70, p. 40-45.
da Fonseca, E. L., and A. C. P. Vicente, 2012, Functional characterization of a cassette-specific promoter in the class
1 integron-associated qnrVC1 gene: Antimicrobial Agents and Chemotherapy, v. 56, p. 3392-3394.
Dahlberg, C., and L. Chao, 2003, Amelioration of the cost of conjugative plasmid carriage in Eschericha coli K12:
Genetics, v. 165, p. 1641-1649.
Dale, J. W., and S. F. Park, 2004, Molecular genetics of bacteria, 4th ed. , West Sussex, John Wiley & Sons, 358 pp.
Damborg, P., P. Marskar, K. E. Baptiste, and L. Guardabassi, 2012, Faecal shedding of CTX-M-producing Escherichia
coli in horses receiving broad-spectrum antimicrobial prophylaxis after hospital admission: Veterinary
Microbiology, v. 154, p. 298-304.
Dao-Thi, M. H., L. Van Melderen, E. De Genst, H. Afif, L. Buts, L. Wyns, and R. Loris, 2005, Molecular basis of gyrase
poisoning by the addiction toxin CcdB: Journal of Molecular Biology, v. 348, p. 1091-1102.
162
Datta, N., S. Dacey, V. Hughes, S. Knight, H. Richards, G. Williams, M. Casewell, and K. P. Shannon, 1980, Distribution
of genes for trimethoprim and gentamicin resistance in bacteria and their plasmids in a general hospital:
Journal of General Microbiology, v. 118, p. 495-508.
Datta, N., and V. M. Hughes, 1983, Plasmids of the same Inc groups in Enterobacteria before and after the medical
use of antibiotics: Nature, v. 306, p. 616-617.
Datta, N., and P. Kontomichalou, 1965, Penicillinase synthesis controlled by infectious R factors in
Enterobacteriaceae: Nature, v. 208, p. 239-&.
Dautzenberg, M. J., J. M. Ossewaarde, M. E. de Kraker, A. van der Zee, S. van Burgh, S. C. de Greeff, H. A. Bijlmer, H.
Grundmann, J. W. C. Stuart, A. C. Fluit, A. Troelstra, and M. J. Bonten, 2014, Successful control of a hospitalwide
outbreak of OXA-48 producing Enterobacteriaceae in the Netherlands, 2009 to 2011:
Eurosurveillance, v. 19, p. 30-41.
de Been, M., V. F. Lanza, M. de Toro, J. Scharringa, W. Dohmen, Y. Du, J. Hu, Y. Lei, N. Li, A. Tooming-Klunderud, D.
J. J. Heederik, A. C. Fluit, M. J. M. Bonten, R. J. L. Willems, F. de la Cruz, and W. van Schaik, 2014,
Dissemination of cephalosporin resistance genes between Escherichia coli strains from farm animals and
humans by specific plasmid lineages: PLOS Genetics, v. 10, p. 1-17.
De Boeck, H., B. Miwanda, O. Lunguya-Metila, J.-J. Muyembe-Tamfum, E. Stobberingh, Y. Glupczynski, and J. Jacobs,
2012, ESBL-positive Enterobacteria isolates in drinking water: Emerging Infectious Diseases, v. 18, p. 1019-
1020.
De Rycke, J., A. Milon, and E. Oswald, 1999, Necrotoxic Escherichia coli (NTEC): two emerging categories of human
and animal pathogens: Veterinary Research, v. 30, p. 221-233.
Decousser, J. W., L. Poirel, and P. Nordmann, 2001, Characterization of a chromosomally encoded extendedspectrum
class A ß-lactamase from Kluyvera cryocrescens: Antimicrobial Agents and Chemotherapy, v. 45,
p. 3595-3598.
Deng, Y., X. Bao, L. Ji, L. Chen, J. Liu, J. Miao, D. Chen, H. Bian, Y. Li, and G. Yu, 2015, Resistance integrons: class 1, 2
and 3 integrons: Annals of Clinical Microbiology and Antimicrobials, v. 14, p. 1-11.
Denisuik, A. J., P. R. S. Lagace-Wiens, J. D. Pitout, M. R. Mulvey, P. J. Simner, F. Tailor, J. A. Karlowsky, D. J. Hoban, H.
J. Adam, G. G. Zhanel, and Cara, 2013, Molecular epidemiology of extended-spectrum ß-lactamase-, AmpC
ß-lactamase- and carbapenemase-producing Escherichia coli and Klebsiella pneumoniae isolated from
Canadian hospitals over a 5 year period: CANWARD 2007-11: Journal of Antimicrobial Chemotherapy, v.
68, p. i57-i65.
Dhanji, H., P. Khan, J. L. Cottell, L. J. V. Piddock, J. Zhang, D. M. Livermore, and N. Woodford, 2012, Dissemination of
pCT-like IncK plasmids harboring CTX-M-14 extended-spectrum ß-lactamase among clinical Escherichia coli
isolates in the United Kingdom: Antimicrobial Agents and Chemotherapy, v. 56, p. 3376-3377.
Dhanji, H., R. Patel, R. Wall, M. Doumith, B. Patel, R. Hope, D. M. Livermore, and N. Woodford, 2011, Variation in
the genetic environments of blaCTX-M-15 in Escherichia coli from the faeces of travellers returning to the
United Kingdom: Journal of Antimicrobial Chemotherapy, v. 66, p. 1005-1012.
Diancourt, L., V. Passet, J. Verhoef, P. A. D. Grimont, and S. Brisse, 2005, Multilocus Sequence typing of Klebsiella
pneumoniae nosocomial isolates: Journal of Clinical Microbiology, v. 43, p. 4178-4182.
Diaz, M. A., J. R. Hernandez-Bello, J. Rodriguez-Bano, L. Martinez-Martinez, J. Calvo, J. Blanco, A. Pascual, and I.
Spanish Grp Nosocomial, 2010, Diversity of Escherichia coli strains producing extended-spectrum ßlactamases
in Spain: Second Nationwide Study: Journal of Clinical Microbiology, v. 48, p. 2840-2845.
Dibner, J. J., and J. D. Richards, 2005, Antibiotic growth promoters in agriculture: History and mode of action: Poultry
Science, v. 84, p. 634-643.
Dierikx, C., J. van der Goot, T. Fabri, A. van Essen-Zandbergen, H. Smith, and D. Mevius, 2013, Extended-spectrumß-lactamase-
and AmpC-ß-lactamase-producing Escherichia coli in Dutch broilers and broiler farmers:
Journal of Antimicrobial Chemotherapy, v. 68, p. 60-67.
Dierikx, C. M., E. van Duijkeren, A. H. W. Schoormans, A. van Essen-Zandbergen, K. Veldman, A. Kant, X. W.
Huijsdens, K. van der Zwaluw, J. A. Wagenaar, and D. J. Mevius, 2012, Occurrence and characteristics of
extended-spectrum-ß-lactamase- and AmpC-producing clinical isolates derived from companion animals
and horses: Journal of Antimicrobial Chemotherapy, v. 67, p. 1368-1374.
Ding, H., and M. F. Hynes, 2009, Plasmid transfer systems in the rhizobia: Canadian Journal of Microbiology, v. 55,
p. 917-927.
Dionisio, F., I. C. Conceicao, A. C. R. Marques, L. Fernandes, and I. Gordo, 2005, The evolution of a conjugative
plasmid and its ability to increase bacterial fitness: Biology Letters, v. 1, p. 250-252.
Dobiasova, H., M. Dolejska, 2016, Prevalence and diversity of IncX plasmids carrying fluoroquinolone and β-lactam
resistance genes in Escherichia coli originating from diverse sources and geographical areas: Journal of
Antimicrobial Chemotherapy, v tisku.
163
Dobiasova, H., M. Dolejska, I. Jamborova, E. Brhelova, L. Blazkova, I. Papousek, M. Kozlova, J. Klimes, A. Cizek, and I.
Literak, 2013, Extended spectrum beta-lactamase and fluoroquinolone resistance genes and plasmids
among Escherichia coli isolates from zoo animals, Czech Republic: FEMS Microbiology Ecology, v. 85, p.
604-611.
Dobiasova, H., I. Kutilova, V. Piackova, T. Vesely, A. Cizek, and M. Dolejska, 2014, Ornamental fish as a source of
plasmid-mediated quinolone resistance genes and antibiotic resistance plasmids: Veterinary Microbiology,
v. 171, p. 413-421.
Dobiasova, H., P. Videnska, and M. Dolejska, 2015, Complete sequences of IncU plasmids harboring quinolone
resistance genes qnrS2 and aac(6')-Ib-cr in Aeromonas spp. from ornamental fish: Antimicrobial agents and
chemotherapy, v. 60, p. 653-7.
Dobrindt, U., B. Hochhut, U. Hentschel, and J. Hacker, 2004, Genomic islands in pathogenic and environmental
microorganisms: Nature Reviews Microbiology, v. 2, p. 414-424.
Dodd, M. C., 2012, Potential impacts of disinfection processes on elimination and deactivation of antibiotic
resistance genes during water and wastewater treatment: Journal of Environmental Monitoring, v. 14, p.
1754-1771.
Dolejska, M., B. Bierosova, L. Kohoutova, I. Literak, and A. Cizek, 2009, Antbiotic-resistant Salmonella and Escherichia
coli isolates with integrons and extended-spectrum beta-lactamases in surface water and sympatric blackheaded
gulls: Journal of Applied Microbiology, v. 106, p. 1941-1950.
Dolejska, M., E. Brhelova, H. Dobiasova, J. Krivdova, J. Jurankova, A. Sevcikova, L. Dubska, I. Literak, A. Cizek, M.
Vavrina, L. Kutnikova, and J. Sterba, 2012, Dissemination of IncFIIK-type plasmids in multiresistant CTX-M-
15-producing Enterobacteriaceae isolates from children in hospital paediatric oncology wards:
International Journal of Antimicrobial Agents, v. 40, p. 510-515.
Dolejska, M., E. Duskova, J. Rybarikova, D. Janoszowska, E. Roubalova, K. Dibdakova, G. Maceckova, L. Kohoutova, I.
Literak, J. Smola, and A. Cizek, 2011a, Plasmids carrying blaCTX-M-1 and qnr genes in Escherichia coli isolates
from an equine clinic and a horseback riding centre: Journal of Antimicrobial Chemotherapy, v. 66, p. 757-
764.
Dolejska, M., P. Frolkova, M. Florek, I. Jamborova, M. Purgertova, I. Kutilova, A. Cizek, S. Guenther, and I. Literak,
2011b, CTX-M-15-producing Escherichia coli clone B2-O25b-ST131 and Klebsiella spp. isolates in municipal
wastewater treatment plant effluents: Journal of Antimicrobial Chemotherapy, v. 66, p. 2784-2790.
Dolejska, M., Z. Jurcickova, I. Literak, L. Pokludova, J. Bures, A. Hera, L. Kohoutova, J. Smola, and A. Cizek, 2011c,
IncN plasmids carrying blaCTX-M-1 in Escherichia coli isolates on a dairy farm: Veterinary Microbiology, v. 149,
p. 513-516.
Dolejska, M., M. Masarikova, H. Dobiasova, I. Jamborova, R. Karpiskova, M. Havlicek, N. Carlile, D. Priddel, A. Cizek,
and I. Literak, 2016, High prevalence of Salmonella and IMP-4-producing Enterobacteriaceae in the silver
gull on Five Islands, Australia: The Journal of Antimicrobial Chemotherapy, v. 71, p. 63-70.
Dolejska, M., M. Matulova, L. Kohoutova, I. Literak, J. Bardon, and A. Cizek, 2011d, Extended-spectrum betalactamase-producing
Escherichia coli in turkey meat production farms in the Czech Republic: National
survey reveals widespread isolates with blaSHV-12 genes on IncFII plasmids: Letters in Applied Microbiology,
v. 53, p. 271-277.
Dolejska, M., L. Villa, H. Dobiasova, D. Fortini, C. Feudi, and A. Carattoli, 2013a, Plasmid content of a clinically
relevant Klebsiella pneumoniae clone from the Czech Republic producing CTX-M-15 and QnrB1:
Antimicrobial Agents and Chemotherapy, v. 57, p. 1073-1076.
Dolejska, M., L. Villa, H. Hasman, L. Hansen, and A. Carattoli, 2013b, Characterization of IncN plasmids carrying
blaCTX-M-1 and qnr genes in Escherichia coli and Salmonella from animals, the environment and humans:
Journal of Antimicrobial Chemotherapy, v. 68, p. 333-339.
Dolejska, M., L. Villa, M. Minoia, L. Guardabassi, and A. Carattoli, 2014, Complete sequences of IncHI1 plasmids
carrying blaCTX-M-1 and qnrS1 in equine Escherichia coli provide new insights into plasmid evolution: Journal
of Antimicrobial Chemotherapy, v. 69, p. 2388-2393.
Dolejska, M., L. Villa, L. Poirel, P. Nordmann, and A. Carattoli, 2013c, Complete sequencing of an IncHI1 plasmid
encoding the carbapenemase NDM-1, the ArmA 16S RNA methylase and a resistance-nodulation-cell
division/multidrug efflux pump: Journal of Antimicrobial Chemotherapy, v. 68, p. 34-39.
Domingues, S., G. J. Da Silva, and K. M. Nielsen, 2012a, Integrons: Vehicles and pathways for horizontal
dissemination in bacteria: Mobile Genetic Elements, v. 2, p. 211-223.
Domingues, S., K. Harms, W. F. Fricke, P. J. Johnsen, G. J. da Silva, and K. M. Nielsen, 2012b, Natural transformation
facilitates transfer of transposons, integrons and gene cassettes between bacterial species: PLOS
Pathogens, v. 8, p. 1-15.
164
Donaldson, S. C., B. A. Straley, N. V. Hegde, A. A. Sawant, C. DebRoy, and B. M. Jayarao, 2006, Molecular
epidemiology of ceftiofur-resistant Escherichia coli isolates from dairy calves: Applied and Environmental
Microbiology, v. 72, p. 3940-3948.
Donneberg, M. S., 2013, Escherichia coli: Virulence Mechanisms of a Versatile Pathogen: San Diego, CA, Academic
Press, 417 pp.
Dortet, L., L. Brechard, L. Poirel, and P. Nordmann, 2014a, Rapid detection of carbapenemase-producing
Enterobacteriaceae from blood cultures: Clinical Microbiology and Infection, v. 20, p. 340-344.
Dortet, L., L. Poirel, and P. Nordmann, 2012, Rapid detection of carbapenemase-producing Pseudomonas spp:
Journal of Clinical Microbiology, v. 50, p. 3773-3776.
Dortet, L., L. Poirel, and P. Nordmann, 2014b, Worldwide dissemination of the NDM-type carbapenemases in Gramnegative
bacteria: Biomed Research International, v. 2014, p.1-12.
Doss, S. A., G. S. Tillotson, N. L. Barg, and S. G. B. Amyes, 1995, In-vitro and in-vivo selection of Staphylococcusaureus
mutants resistant to ciprofloxacin: Journal of Antimicrobial Chemotherapy, v. 35, p. 95-102.
Dougan, G., J. H. Crosa, and S. Falkow, 1978, Mobilization of Escherichia coli plasmid ColE1 (colicin E1) and ColE1
vectors used in recombinant DNA experiments: Journal of Infectious Diseases, v. 137, p. 676-680.
Doumith, M., H. Dhanji, M. J. Ellington, P. Hawkey, and N. Woodford, 2012, Characterization of plasmids encoding
extended-spectrum ß-lactamases and their addiction systems circulating among Escherichia coli clinical
isolates in the UK: Journal of Antimicrobial Chemotherapy, v. 67, p. 878-885.
Dowell, C. E., and E. D. Rosenblum, 1962, Staphylococcal transducing particle: Journal of Bacteriology, v. 84, p. 1076-
1079.
Doyle, M., M. Fookes, A. Ivens, M. W. Mangan, J. Wain, and C. J. Dorman, 2007, An H-NS-like stealth protein aids
horizontal DNA transmission in bacteria: Science, v. 315, p. 251-252.
Drago, L., L. Nicola, R. Mattina, and E. De Vecchi, 2010, In vitro selection of resistance in Escherichia coli and
Klebsiella spp. at in vivo fluoroquinolone concentrations: BMC Microbiology, v. 10, p. 1-7.
Dunne, E. F., P. D. Fey, P. Kludt, R. Reporter, F. Mostashari, P. Shillam, J. Wicklund, C. Miller, B. Holland, E. Stamey,
T. J. Barrett, J. K. Rasheed, F. C. Tenover, E. M. Ribot, and F. J. Angulo, 2000, Emergence of domestically
acquired ceftriaxone-resistant Salmonella infections associated with AmpC ß-lactamase: JAMA-The Journal
of the American Medical Association, v. 284, p. 3151-3156.
EFSA, 2011, Scientific opinion on the public health risks of bacterial strains producing extended-spectrum βlactamases
and/or AmpC β-lactamases in food and food-producing animals, European Food Safety
Authority, EFSA Journal, p. 2322
EFSA, 2013, Scientific Opinion on carbapenem resistance in food animal ecosystems, European Food Safety
Authority, EFSA Journal, p. 3501.
EFSA, 2016, The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria
from humans, animals and food in 2014, European Food Safety Authority, EFSA Journal, p. 4380.
Eikmeyer, F., A. Hadiati, R. Szczepanowski, D. Wibberg, S. Schneiker-Bekel, L. M. Rogers, C. J. Brown, E. M. Top, A.
Puehler, and A. Schlueter, 2012, The complete genome sequences of four new IncN plasmids from
wastewater treatment plant effluent provide new insights into IncN plasmid diversity and evolution:
Plasmid, v. 68, p. 13-24.
Eisner, A., E. J. Fagan, G. Feierl, H. H. Kessler, E. Marth, D. M. Livermore, and N. Woodford, 2006, Emergence of
Enterobacteriaceae isolates producing CTX-M extended-spectrum ß-lactamase in Austria: Antimicrobial
Agents and Chemotherapy, v. 50, p. 785-787.
Ellington, M. J., and N. Woodford, 2006, Fluoroquinolone resistance and plasmid addiction systems: self-imposed
selection pressure?: Journal of Antimicrobial Chemotherapy, v. 57, p. 1026-1029.
Elliott, S. D., and E. M. Barnes, 1959, Changes in serological type and antibiotic resistance of Lancefield group D
streptococci in chickens receiving dietary chlortetracycline: Journal of General Microbiology, v. 20, p. 426-
433.
EMEA, 2012, Sales of veterinary antimicrobial agents in 19 EU/EEA countries in 2010: Second ESCAV report,
EMA/88728/2012, European Medicines Agency.
EMEA, 2013, Sales of veterinary antimicrobial agents in 26 EU/EEA countries in 2013: Fifth ESCVAC report,
EMA/38934/2015, European Medicines Agency.
Empel, J., A. Baraniak, E. Literacka, A. Mrowka, J. Fiett, E. Sadowy, W. Hryniewicz, M. Gniadkowski, and P. L. S. G.
Beta, 2008, Molecular Survey of ß-lactamases conferring resistance to newer ß-lactams in
Enterobacteriaceae isolates from Polish hospitals: Antimicrobial Agents and Chemotherapy, v. 52, p. 2449-
2454.
165
Endimiani, A., A. Rossano, D. Kunz, G. Overesch, and V. Perreten, 2012, First countrywide survey of third-generation
cephalosporin-resistant Escherichia coli from broilers, swine, and cattle in Switzerland: Diagnostic
Microbiology and Infectious Disease, v. 73, p. 31-38.
Engler, G., M. Holsters, M. Vanmontagu, J. Schell, J. P. Hernalsteens, and R. Schilperoort, 1975, Agrocin 84 sensitivity
- A plasmid determined property in Agrobacterium tumefaciens: Molecular and General Genetics, v. 138,
p. 345-349.
Espedido, B. A., S. R. Partridge, and J. R. Iredell, 2008, blaIMP-4 in different genetic contexts in Enterobacteriaceae
isolates from Australia: Antimicrobial Agents and Chemotherapy, v. 52, p. 2984-2987.
EUCAST, 2016, European Committee for Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of
MICs and zone diameters, Version 6.0, valid from 2016-01-01, p. 91.
Ewers, C., A. Bethe, T. Semmler, S. Guenther, and L. H. Wieler, 2012, Extended-spectrum ß-lactamase-producing
and AmpC-producing Escherichia coli from livestock and companion animals, and their putative impact on
public health: a global perspective: Clinical Microbiology and Infection, v. 18, p. 646-655.
Ewers, C., A. Bethe, I. Stamm, M. Grobbel, P. A. Kopp, B. Guerra, M. Stubbe, Y. Doi, Z. Zong, A. Kola, K. Schaufler, T.
Semmler, A. Fruth, L. H. Wieler, and S. Guenther, 2014, CTX-M-15-D-ST648 Escherichia coli from
companion animals and horses: another pandemic clone combining multiresistance and extraintestinal
virulence?: Journal of Antimicrobial Chemotherapy, v. 69, p. 1224-1230.
Ewers, C., M. Grobbel, I. Stamm, P. A. Kopp, I. Diehl, T. Semmler, A. Fruth, J. Beutlich, B. Guerra, L. H. Wieler, and S.
Guenther, 2010, Emergence of human pandemic O25:H4-ST131 CTX-M-15 extended-spectrum-ßlactamase-producing
Escherichia coli among companion animals: Journal of Antimicrobial Chemotherapy,
v. 65, p. 651-660.
Fajardo, A., J. L. Martinez, 2008, Antibiotics as signals that trigger specific bacterial responses: Current Opinion in
Microbiology, v. 11, p. 161-167.
Fancello, L., C. Desnues, D. Raoult, and J. M. Rolain, 2011, Bacteriophages and diffusion of genes encoding
antimicrobial resistance in cystic fibrosis sputum microbiota: Journal of Antimicrobial Chemotherapy, v.
66, p. 2448-2454.
Farmer, J. J., G. R. Fanning, G. P. Huntleycarter, B. Holmes, F. W. Hickman, C. Richard, and D. J. Brenner, 1981,
Kluyvera, a new (redefined) genus in the family Enterobacteriaceae: identification of Kluyvera ascorbata
sp. nov and Kluyvera cryocrescens sp.-nov. in clinical specimens: Journal of Clinical Microbiology, v. 13, p.
919-933.
Fekete, P. Z., J. Gerardin, E. Jacquemin, J. G. Mainil, and B. Nagy, 2002, Replicon typing of F18 fimbriae encoding
plasmids of enterotoxigenic, and verotoxigenic Escherichia coli strains from porcine postweaning diarrhoea
and oedema disease: Veterinary Microbiology, v. 85, p. 275-284.
Feria, C., E. Ferreira, J. D. Correia, J. Goncalves, and M. Canica, 2002, Patterns and mechanisms of resistance to ßlactams
and ß-lactamase inhibitors in uropathogenic Escherichia coli isolated from dogs in Portugal: Journal
of Antimicrobial Chemotherapy, v. 49, p. 77-85.
Fernandez, A. G., A. Cloeckaert, A. Bertini, K. Praud, B. Doublet, F.-X. Weill, and A. Carattolil, 2007, Comparative
analysis of IncHI2 plasmids carrying blaCTX-M-2 or blaCTX-M-9 from Escherichia coli and Salmonella enterica
strains isolated from poultry and humans: Antimicrobial Agents and Chemotherapy, v. 51, p. 4177-4180.
Fernandez-Alarcon, C., R. S. Singer, and T. J. Johnson, 2011, Comparative genomics of multidrug resistance-encoding
IncA/C plasmids from commensal and pathogenic Escherichia coli from Multiple animal sources: PLOS One,
v. 6, p. 1-9.
Finch, R. G., D. Greenwood, S. R. Norrby, and R. J. Whitley, 2003, Antibiotic and chemotherapy, Livingstone,
Edinburgh, UK, Eds. Churchill Livingstone, 1000 pp.
Fischer, J., I. Rodriguez, B. Baumann, E. Guiral, L. Beutin, A. Schroeter, A. Kaesbohrer, Y. Pfeifer, R. Helmuth, and B.
Guerra, 2014, blaCTX-M-15-carrying Escherichia coli and Salmonella isolates from livestock and food in
Germany: Journal of Antimicrobial Chemotherapy, v. 69, p. 2951-2958.
Fischer, J., I. Rodriguez, S. Schmoger, A. Friese, U. Roesler, R. Helmuth, and B. Guerra, 2012, Escherichia coli
producing VIM-1 carbapenemase isolated on a pig farm: Journal of Antimicrobial Chemotherapy, v. 67, p.
1793-1795.
Fischer, J., I. Rodriguez, S. Schmoger, A. Friese, U. Roesler, R. Helmuth, and B. Guerra, 2013a, Salmonella enterica
subsp enterica producing VIM-1 carbapenemase isolated from livestock farms: Journal of Antimicrobial
Chemotherapy, v. 68, p. 478-480.
Fischer, J., S. Schmoger, S. Jahn, R. Helmuth, and B. Guerra, 2013b, NDM-1 carbapenemase-producing Salmonella
enterica subsp enterica serovar Corvallis isolated from a wild bird in Germany: Journal of Antimicrobial
Chemotherapy, v. 68, p. 2954-2956.
166
Fluit, A. C., 2005, Towards more virulent and antibiotic-resistant Salmonella?: FEMS Immunology and Medical
Microbiology, v. 43, p. 1-11.
Folster, J. P., G. Pecic, S. Bolcen, L. Theobald, K. Hise, A. Carattoli, S. Zhao, P. F. McDermott, and J. M. Whichard,
2010, Characterization of extended-spectrum cephalosporin-resistant Salmonella enterica serovar
Heidelberg isolated from humans in the United States: Foodborne Pathogens and Disease, v. 7, p. 181-187.
Folster, J. P., G. Pecic, A. Singh, B. Duval, R. Rickert, S. Ayers, J. Abbott, B. McGlinchey, J. Bauer-Turpin, J. Haro, K.
Hise, S. Zhao, P. J. Fedorka-Cray, J. Whichard, and P. F. McDermott, 2012, Characterization of extendedspectrum
cephalosporin-resistant Salmonella enterica serovar Heidelberg isolated from food animals,
retail meat, and humans in the United States 2009: Foodborne Pathogens and Disease, v. 9, p. 638-645.
Fonseca, E. L., F. Dos Santos Freitas, V. V. Vieira, and A. C. P. Vicente, 2008, New qnr gene cassettes associated with
superintegron repeats in Vibrio cholerae O1: Emerging infectious diseases, v. 14, p. 1129-31.
Fonseca, E. L., and A. C. P. Vicente, 2013, Epidemiology of qnrVC alleles and emergence out of the Vibrionaceae
family: Journal of Medical Microbiology, v. 62, p. 1628-1630.
Francia, M. V., A. Varsaki, M. P. Garcillan-Barcia, A. Latorre, C. Drainas, and F. de la Cruz, 2004, A classification
scheme for mobilization regions of bacterial plasmids: FEMS Microbiology Reviews, v. 28, p. 79-100.
Franke, A. E., and D. B. Clewell, 1981, Evidence for conjugal transfer of a Streptococcus faecalis transposon (Tn916)
from a chromosomal site in the absence of plasmid DNA: Cold Spring Harbor symposia on quantitative
biology, v. 45 Pt 1, p. 77-80.
Franz, E., C. Veenman, A. H. A. M. van Hoek, A. d. R. Husman, and H. Blaak, 2015, Pathogenic Escherichia coli
producing extended-spectrum ß-lactamases isolated from surface water and wastewater: Scientific
Reports, v. 5, p. 1-9.
Funnel, B. E., and G. J. Phillips, 2004, Plasmid biology: Washington, D. C., ASM Press, 638 pp.
Gaastra, W., and A. M. Svennerholm, 1996, Colonization factors of human enterotoxigenic Escherichia coli (ETEC):
Trends in Microbiology, v. 4, p. 444-452.
Galler, H., G. Feierl, C. Petternel, F. F. Reinthaler, D. Haas, A. J. Grisold, J. Luxner, and G. Zarfel, 2014, KPC-2 and
OXA-48 carbapenemase-harbouring Enterobacteriaceae detected in an Austrian wastewater treatment
plant: Clinical Microbiology and Infection, v. 20, p. O132-O134.
Gao, L., J. Hu, X. Zhang, R. Ma, J. Gao, S. Li, M. Zhao, Z. Miao, and T. Chai, 2014, Dissemination of ESBL-producing
Escherichia coli of chicken origin to the nearby river water: Journal of Molecular Microbiology and
Biotechnology, v. 24, p. 279-285.
Garcia, A., F. Navarro, E. Miro, B. Mirelis, S. Campoy, and P. Coll, 2005, Characterization of the highly variable region
surrounding the blaCTX-M-9 gene in non-related Escherichia coli from Barcelona: Journal of Antimicrobial
Chemotherapy, v. 56, p. 819-826.
Garcia, A., F. Navarro, E. Miro, L. Villa, B. Mirelis, P. Coll, and A. Carattoli, 2007, Acquisition and diffusion of blaCTX-M-
9 gene by R478-IncHI2 derivative plasmids: FEMS Microbiology Letters, v. 271, p. 71-77.
Garcia-Fernandez, A., G. Chiaretto, A. Bertini, L. Villa, D. Fortini, A. Ricci, and A. Carattoli, 2008, Multilocus sequence
typing of IncI1 plasmids carrying extended-spectrum ß-lactamases in Escherichia coli and Salmonella of
human and animal origin: Journal of Antimicrobial Chemotherapy, v. 61, p. 1229-1233.
Garcia-Fernandez, A., L. Villa, C. Carta, C. Venditti, A. Giordano, M. Venditti, C. Mancini, and A. Carattoli, 2012,
Klebsiella pneumoniae ST258 producing KPC-3 identified in Italy carries novel plasmids and
OmpK36/OmpK35 porin variants: Antimicrobial Agents and Chemotherapy, v. 56, p. 2143-2145.
Garcia-Fernandez, A., L. Villa, A. Moodley, H. Hasman, V. Miriagou, L. Guardabassi, and A. Carattoli, 2011, Multilocus
sequence typing of IncN plasmids: Journal of Antimicrobial Chemotherapy, v. 66, p. 1987-1991.
Garcillan-Barcia, M. P., M. V. Francia, and F. de la Cruz, 2009, The diversity of conjugative relaxases and its
application in plasmid classification: FEMS Microbiology Reviews, v. 33, p. 657-687.
Garrido, A., C. Seral, M. Jose Gude, C. Casado, M. Gonzalez-Dominguez, Y. Saenz, and F. Javier Castillo, 2014,
Characterization of plasmid-mediated ß-lactamases in fecal colonizing patients in the hospital and
community setting in Spain: Microbial Drug Resistance, v. 20, p. 301-304.
Geser, N., R. Stephan, B. M. Korczak, L. Beutin, and H. Haechler, 2012, Molecular identification of extendedspectrum-ß-lactamase
genes from Enterobacteriaceae isolated from healthy human carriers in
Switzerland: Antimicrobial Agents and Chemotherapy, v. 56, p. 1609-1612.
Giakkoupi, P., A. Xanthaki, M. Kanelopoulou, A. Vlahaki, V. Miriagou, S. Kontou, E. Papafraggas, H. Malamou-Lada,
L. S. Tzouvelekis, N. J. Legakis, and A. C. Vatopoulos, 2003, VIM-1 metallo-ß-lactamase-producing Klebsiella
pneumoniae strains in Greek hospitals: Journal of Clinical Microbiology, v. 41, p. 3893-3896.
Gibson, J. S., J. M. Morton, R. N. Cobbold, H. E. Sidjabat, L. J. Filippich, and D. J. Trott, 2008, Multidrug-resistant E.
coli and Enterobacter extraintestinal infection in 37 dogs: Journal of Veterinary Internal Medicine, v. 22, p.
844-850.
167
Giguère, S., J. F. Prescott, P. M. Dowling (eds.), 2013, Antimicrobial therapy in veterinary medicine: USA, John Wiley
& Sons, Inc.
Gilling, M. R., 2013, Evolutionary consequences of antibiotic use for the resistome, mobilome and microbial
pangenome: Frontiers in Microbiology, v. 4.
Girlich, D., L. Poirel, A. Carattoli, I. Kempf, M.-F. Lartigue, A. Bertini, and P. Nordmann, 2007, Extended-spectrum βlactamase
CTX-M-1 in Escherichia coli isolates from healthy poultry in France: Applied and Environmental
Microbiology, v. 73, p. 4681-4685.
Giske, C. G., L. Gezelius, O. Samuelsen, M. Warner, A. Sundsfjord, and N. Woodford, 2011, A sensitive and specific
phenotypic assay for detection of metallo-β-lactamases and KPC in Klebsiella pneumoniae with the use of
meropenem disks supplemented with aminophenylboronic acid, dipicolinic acid and cloxacillin: Clinical
Microbiology and Infection, v. 17, p. 552-556.
Giufre, M., C. Graziani, M. Accogli, I. Luzzi, L. Busani, M. Cerquetti on behalf of the Escherichia coli Study Group,
2012, Escherichia coli of human and avian origin: detection of clonal groups associated with
fluoroquinolone and multidrug resistance in Italy: Journal of Antimicrobial Chemotherapy, v. 67, p. 860-
867.
Gniadkowski, M., A. Palucha, P. Grzesiowski, and W. Hryniewicz, 1998, Outbreak of ceftazidime-resistant Klebsiella
pneumoniae in a pediatric hospital in Warsaw, Poland: Clonal spread of the TEM-47 extended-spectrum βlactamase
(ESBL)-producing strain and transfer of a plasmid carrying the SHV5-like ESBL-encoding gene:
Antimicrobial Agents and Chemotherapy, v. 42, p. 3079-3085.
Gobel, A., A. Thomsen, C. S. McArdell, A. C. Alder, W. Giger, N. Theiss, D. Loffler, and T. A. Ternes, 2005, Extraction
and determination of sulfonamides, macrolides, and trimethoprim in sewage sludge: Journal of
Chromatography A, v. 1085, p. 179-189.
Golebiewski, M., I. Kern-Zdanowicz, M. Zienkiewicz, M. Adamczyk, J. Zylinska, A. Baraniak, M. Gniadkowski, J.
Bardowski, and P. Ceglowski, 2007, Complete nucleotide sequence of the pCTX-M3 plasmid and its
involvement in spread of the extended-spectrum β-lactamase gene blaCTX-M-3: Antimicrobial Agents and
Chemotherapy, v. 51, p. 3789-3795.
Golet, E. M., A. Strehler, A. C. Alder, and W. Giger, 2002, Determination of fluoroquinolone antibacterial agents in
sewage sludge and sludge-treated soil using accelerated solvent extraction followed by solid-phase
extraction: Analytical Chemistry, v. 74, p. 5455-5462.
Gomez-Gomez, J. M., J. Blazquez, L. E. E. DelosMonteros, M. R. Baquero, F. Baquero, and J. L. Martinez, 1997, In
vitro plasmid-encoded resistance to quinolones: FEMS Microbiology Letters, v. 154, p. 271-276.
Gottlieb, S., D. I. Wigney, P. A. Martin, J. M. Norris, R. Malik, and M. Govendir, 2008, Susceptibility of canine and
feline Escherichia coli and canine Staphylococcus intermedius isolates to fluoroquinolones: Australian
Veterinary Journal, v. 86, p. 147-152.
Gotz, A., R. Pukall, E. Smit, E. Tietze, R. Prager, H. Tschape, J. D. vanElsas, and K. Smalla, 1996, Detection and
characterization of broad-host-range plasmids in environmental bacteria by PCR: Applied and
Environmental Microbiology, v. 62, p. 2621-2628.
Griffith, F., 1928, The significance of pneumococcal types: The Journal of Hygiene, v. 27, p. 113-59.
Guardabassi, L., L. B. Jensen, and H. Kruse, 2008, Antimicrobial use in animals. , Oxford, UK. , Blackwell Publishing,
240 pp.
Gudeta, D. D., V. Bortolaia, A. Jayol, L. Poirel, P. Nordmann, and L. Guardabassi, 2016, Chromobacterium spp.
harbour Ambler class A β-lactamases showing high identity with KPC: Journal of Antimicrobial Agents and
Chemotherapy.
Guenther, S., K. Aschenbrenner, I. Stamm, A. Bethe, T. Semmler, A. Stubbe, M. Stubbe, N. Batsajkhan, Y. Glupczynski,
L. H. Wieler, and C. Ewers, 2012a, Comparable high rates of extended-spectrum-beta-lactamase-producing
Escherichia coli in birds of prey from Germany and Mongolia: PLOS One, v. 7, p. 1-6.
Guenther, S., A. Bethe, A. Fruth, T. Semmler, R. G. Ulrich, L. H. Wieler, and C. Ewers, 2012b, Frequent combination
of antimicrobial multiresistance and extraintestinal pathogenicity in Escherichia coli isolates from urban
rats (Rattus norvegicus) in Berlin, Germany: PLOS One, v. 7, p. 1-10.
Guenther, S., C. Ewers, and L. H. Wieler, 2011, Extended-spectrum beta-lactamases producing E. coli in wildlife, yet
another form of environmental pollution?: Frontiers in Microbiology, v. 2, p. 1-13.
Guerin, E., G. Cambray, N. Sanchez-Alberola, S. Campoy, I. Erill, S. Da Re, B. Gonzalez-Zorn, J. Barbe, M.-C. Ploy, and
D. Mazel, 2009, The SOS response controls integron recombination: Science, v. 324, p. 1034-1034.
Guillard, T., A. Grillon, C. de Champs, C. Cartier, J. Madoux, B. Bercot, A.-L. Lebreil, A. Lozniewski, J. Riahi, V. VernetGarnier,
and E. Cambau, 2014, Mobile insertion cassette elements found in small non-transmissible
plasmids in Proteeae may explain qnrD mobilization: PLOS One, v. 9, p. 1-8.
168
Guo, Y.-F., W.-H. Zhang, S.-Q. Ren, L. Yang, D.-H. Lu, Z.-L. Zeng, Y.-H. Liu, and H.-X. Jiang, 2014, IncA/C plasmidmediated
spread of CMY-2 in multidrug-resistant Escherichia coli from food animals in China: PLOS One, v.
9, p. 1-7.
Gupta, V., S. Sidhu, and J. Chander, 2012, Metallo-β-lactamase producing nonfermentative gram-negative bacteria:
An increasing clinical threat among hospitalized patients: Asian Pacific Journal of Tropical Medicine, v. 5,
p. 718-721.
Gyles, C., and P. Boerlin, 2014, Horizontally transferred genetic elements and their role in pathogenesis of bacterial
disease: Veterinary Pathology, v. 51, p. 328-340.
Hacker, J., L. Bender, M. Ott, J. Wingender, B. Lund, R. Marre, and W. Goebel, 1990, Deletions of chromosomal
regions coding for fimbriae and hemolysins occur in vitro and in vivo in various extraintestinal Escherichia
coli isolates: Microbial Pathogenesis, v. 8, p. 213-225.
Haenni, M., E. Saras, V. Metayer, C. Medaille, and J.-Y. Madec, 2014, High Prevalence of blaCTX-M-1/IncI1/ST3 and
blaCMY-2/IncI1/ST2 plasmids in healthy urban dogs in France: Antimicrobial Agents and Chemotherapy, v.
58, p. 5358-5362.
Hall, R. M., D. E. Brookes, and H. W. Stokes, 1991, Site-specific insertion of genes into integrons: role of the 59-base
element and determination of the recombination cross-over point: Molecular Microbiology, v. 5, p. 1941-
1959.
Hall, R. M., and C. M. Collis, 1998, Antibiotic resistance in gram-negative bacteria: the role of gene cassettes and
integrons: Drug Resistance Updates, v. 1, p. 109-119.
Halova, D., I. Papousek, I. Jamborova, M. Masarikova, A. Cizek, N. Janecko, V. Oravcova, L. Zurek, A. B. Clark, A.
Townsend, J. C. Ellis, and I. Literak, 2014, Plasmid-mediated quinolone resistance genes in
Enterobacteriaceae from American crows: High Prevalence of Bacteria with Variable qnrB Genes:
Antimicrobial Agents and Chemotherapy, v. 58, p. 1257-1258.
Hammerum, A. M., O. E. Heuer, H. D. Emborg, L. Bagger-Skjøt, V. F. Jensen, A. M. Rogues, R. L. Skov, Y. Agersø, C.
T. Brandt, A. M. Seyfarth, A. Muller, K. Hovgaard, J. Ajufo, F. Bager, F. M. Aarestrup, N. Frimodt-Møller, H.
C. Wegener, D. L. Monnet, 2007: Emerging Infectious Diseases, v. 13, p. 1632-1639.
Hammerum, A. M., J. Larsen, V. D. Andersen, C. H. Lester, T. S. S. Skytte, F. Hansen, S. S. Olsen, H. Mordhorst, R. L.
Skov, F. M. Aarestrup, and Y. Agerso, 2014, Characterization of extended-spectrum β-lactamase (ESBL)producing
Escherichia coli obtained from Danish pigs, pig farmers and their families from farms with high
or no consumption of third-or fourth-generation cephalosporins: Journal of Antimicrobial Chemotherapy,
v. 69, p. 2650-2657.
Handel, N., S. Otte, M. Jonker, S. Brul, and B. H. ter Kuile, 2015, Factors That Affect Transfer of the IncI1 β-lactam
resistance plasmid pESBL-283 between E-coli strains: PLOS One, v. 10, p. 1-17.
Hansen, K. H., V. Bortolaia, P. Damborg, and L. Guardabassi, 2014, Strain Diversity of CTX-M-producing
Enterobacteriaceae in individual pigs: insights into the dynamics of shedding during the production cycle:
Applied and Environmental Microbiology, v. 80, p. 6620-6626.
Hansen, L. H., L. B. Jensen, H. I. Sorensen, and S. J. Sorensen, 2007, Substrate specificity of the OqxAB multidrug
resistance pump in Escherichia coli and selected enteric bacteria: Journal of Antimicrobial Chemotherapy,
v. 60, p. 145-147.
Hansen, L. H., E. Johannesen, M. Burmolle, A. H. Sorensen, and S. J. Sorensen, 2004, Plasmid-Encoded multidrug
efflux pump conferring resistance to olaquindox in Escherichia coli: Antimicrobial Agents and
Chemotherapy, v. 48, p. 3332-3337.
Hanson, N. D., 2003, AmpC β-lactamases: what do we need to know for the future?: Journal of Antimicrobial
Chemotherapy, v. 52, p. 2-4.
Harmer, C. J., and R. M. Hall, 2015, The A to Z of A/C plasmids: Plasmid, v. 80, p. 63-82.
Hasan, R., F. J. Cooke, S. Nair, B. N. Harish, and J. Wain, 2005, Typhoid and paratyphoid fever: Lancet, v. 366, p.
1603-1604.
Hata, M., M. Suzuki, M. Matsumoto, M. Takahashi, K. Sato, S. Ibe, and K. Sakae, 2005, Cloning of a novel gene for
quinolone resistance from a transferable plasmid in Shigella flexneri 2b: Antimicrobial Agents and
Chemotherapy, v. 49, p. 801-803.
He, D., S. R. Partridge, J. Shen, Z. Zeng, L. Liu, L. Rao, L. Lv, and J.-H. Liu, 2013, CTX-M-123, a novel hybrid of the CTXM-1
and CTX-M-9 group β-Lactamases recovered from Escherichia coli isolates in China: Antimicrobial
Agents and Chemotherapy, v. 57, p. 4068-4071.
Heck, K., E. G. De Marco, M. W. Duarte, S. P. Salamoni, and S. Van der Sand, 2015, Pattern of multiresistant to
antimicrobials and heavy metal tolerance in bacteria isolated from sewage sludge samples from a
composting process at a recycling plant in southern Brazil: Environmental Monitoring and Assessment, v.
187, p. 1-11.
169
Hedges, R. W., N. Datta, Kontomic.P, and J. T. Smith, 1974, Molecular specificities of R factor-determined betalactamases:
Correlation with plasmid compatibility: Journal of Bacteriology, v. 117, p. 56-62.
Hering, J., K. Hille, C. Froemke, C. von Muenchhausen, M. Hartmann, B. Schneider, A. Friese, U. Roesler, R. Merle,
and L. Kreienbrock, 2014, Prevalence and potential risk factors for the occurrence of cefotaxime resistant
Escherichia coli in German fattening pig farms-A cross-sectional study: Preventive Veterinary Medicine, v.
116, p. 129-137.
Hernandez, J., J. Bonnedahl, I. Eliasson, A. Wallensten, P. Comstedt, A. Johansson, S. Granholm, A. Melhus, B. Olsen,
and M. Drobni, 2010, Globally disseminated human pathogenic Escherichia coli of O25b-ST131 clone,
harbouring blaCTX-M-15, found in Glaucous-winged gull at remote Commander Islands, Russia: Environmental
Microbiology Reports, v. 2, p. 329-332.
Hernandez, J., A. Johansson, J. Stedt, S. Bengtsson, A. Porczak, S. Granholm, D. Gonzalez-Acuna, B. Olsen, J.
Bonnedahl, and M. Drobni, 2013, Characterization and comparison of extended-spectrum β-lactamase
(ESBL) resistance genotypes and population structure of Escherichia coli isolated from Franklin's gulls
(Leucophaeus pipixcan) and humans in Chile: PLOS One, v. 8, p. 1-9.
Ho, P.-L., W.-U. Lo, E. L. Lai, P. Y. Law, S. M. Leung, Y. Wang, and K.-H. Chow, 2015, Clonal diversity of CTX-Mproducing,
multidrug-resistant Escherichia coli from rodents: Journal of Medical Microbiology, v. 64, p.
185-190.
Hobman, J. L., A. M. M. Essa, and N. L. Brown, 2002, Mercury resistance (mer) operons in enterobacteria:
Biochemical Society Transactions, v. 30, p. 719-722.
Hooper, D. C., 2000, Mechanisms of action and resistance of older and newer fluoroquinolones: Clinical Infectious
Diseases, v. 31, p. S24-S28.
Hooper, D. C., and E. Rubinstein, 2003, Quinolone antimicrobial agents: Washington, D. C., ASM Press, 485 pp.
Hopkins, K. L., M. J. Batchelor, E. Liebana, A. P. Deheer-Graham, and E. J. Threlfalla, 2006, Characterisation of CTXM
and AmpC genes in human isolates of Escherichia coli identified between 1995 and 2003 in England and
Wales: International Journal of Antimicrobial Agents, v. 28, p. 180-192.
Hordijk, J., A. Schoormans, M. Kwakernaak, B. Duim, E. Broens, C. Dierikx, D. Mevius, and J. A. Wagenaar, 2013, High
prevalence of fecal carriage of extended-spectrum β-lactamase/AmpC-producing Enterobacteriaceae in
cats and dogs: Frontiers in Microbiology, v. 4, p. 1-5.
Hornish, R. E., and S. F. Kotarski, 2002, Cephalosporins in veterinary medicine - Ceftiofur use in food animals: Current
topics in medicinal chemistry, v. 2, p. 717-31.
Hornsey, M., L. Phee, and D. W. Wareham, 2011, A novel variant, NDM-5, of the New Delhi metallo-β -lactamase in
a multidrug-resistant Escherichia coli ST648 isolate recovered from a patient in the United Kingdom:
Antimicrobial Agents and Chemotherapy, v. 55, p. 5952-5954.
Hrabak, J., 2007, Clinically important β-lactamases of gram-negative bacteria: AmpC: Epidemiologie, mikrobiologie,
imunologie : Casopis Spolecnosti pro epidemiologii a mikrobiologii Ceske lekarske spolecnosti J.E. Purkyne,
v. 56, p. 155-65.
Hrabak, J., V. Studentova, V. Jakubu, V. Adamkova, L. Dvorakova, M. Balejova, T. Bergerova, E. Chmelarova, P. Jezek,
P. Kabelikova, M. Kolar, P. Paterova, R. Tejkalova, C. Papagiannitsis, and H. Zemlickova, 2015, Prevalence
study on carbapenemase-producing Escherichia coli and Klebsiella pneumoniae isolates in Czech hospitals
- results from Czech Part of European Survey on Carbapenemase-Producing Enterobacteriaceae
(EuSCAPE): Epidemiologie Mikrobiologie Imunologie, v. 64, p. 87-91.
Hrabak, J., R. Walkova, V. Studentova, E. Chudackova, and T. Bergerova, 2011a, Carbapenemase activity detection
by matrix-assisted laser desorption ionization-Time of flight Mass spectrometry: Journal of Clinical
Microbiology, v. 49, p. 3222-3227.
Hrabak, J., H. Zemlickova, T. Bergerova, and P. Urbaskova, 2011b, Interpretation of the susceptibility test results in
enterobacteria producing 3rd-and 4th-generation cephalosporin- or carbapenem-hydrolyzing betalactamases:
Epidemiologie Mikrobiologie Imunologie, v. 60, p. 4-9.
Hrabák J., BT. Bergerová, H. Žemličková, P. Urbášková, 2009, Detekce širokospektrých ß-laktamáz (ESBL), ß-laktamáz
AmpC, metalo-ß-laktamáz (MBL) a karbapenemáz KPC u gramnegativních tyček, Zprávy epidemiologie a
mikrobiologie (SZÚ, PRAHA), p. 100-106.
Huang, T.-W., T.-L. Chen, Y.-T. Chen, T.-L. Lauderdale, T.-L. Liao, Y.-T. Lee, C.-P. Chen, Y.-M. Liu, A.-C. Lin, Y.-H. Chang,
K.-M. Wu, R. Kirby, J.-F. Lai, M.-C. Tan, L.-K. Siu, C.-M. Chang, C.-P. Fung, and S.-F. Tsai, 2013, Copy number
change of the NDM-1 sequence in a multidrug-resistant Klebsiella pneumoniae clinical isolate: PLOS One,
v. 8, p. 1-12.
Humeniuk, C., G. Arlet, V. Gautier, P. Grimont, R. Labia, and A. Philippon, 2002, β-lactamases of Kluyvera ascorbata,
probable progenitors of some plasmid-encoded CTX-M Types: Antimicrobial Agents and Chemotherapy, v.
46, p. 3045-3049.
170
Hunter, P. A., S. Dawson, G. L. French, H. Goossens, P. M. Hawkey, E. J. Kuijper, D. Nathwani, D. J. Taylor, C. J. Teale,
R. E. Warren, M. H. Wilcox, N. Woodford, M. W. Wulf, and L. J. V. Piddock, 2010, Antimicrobial-resistant
pathogens in animals and man: prescribing, practices and policies: Journal of Antimicrobial Chemotherapy,
v. 65, p. I3-I17.
Husickova, V., L. Cekanova, M. Chroma, M. Htoutou-Sedlakova, K. Hricova, and M. Kolar, 2012, Carriage of ESBLand
AmpC-positive Enterobacteriaceae in the gastrointestinal tract of community subjects and hospitalized
patients in the Czech Republic: Biomedical Papers-Olomouc, v. 156, p. 348-353.
Iaconis, J. P., and C. C. Sanders, 1990, Purification and characterization of inducible β-lactamases in Aeromonas spp:
Antimicrobial Agents and Chemotherapy, v. 34, p. 44-51.
Ito, H., Y. Arakawa, S. Ohsuka, R. Wacharotayankun, N. Kato, and M. Ohta, 1995, Plasmid-mediated dissemination
of the metallo-β -lactamase gene blaIMP among clinically isolated strains of Serratia. marcescens:
Antimicrobial Agents and Chemotherapy, v. 39, p. 824-829.
Izdebski, R., A. Baraniak, J. Fiett, A. Adler, M. Kazma, J. Salomon, C. Lawrence, A. Rossini, A. Salvia, J. Vidal Samso, J.
Fierro, M. Paul, Y. Lerman, S. Malhotra-Kumar, C. Lammens, H. Goossens, W. Hryniewicz, C. Brun-Buisson,
Y. Carmeli, M. Gniadkowski, on behalf of the MOSAR WP2 and WP5 Study Groups , 2013, Clonal structure,
extended-spectrum β-lactamases, and acquired AmpC-Type cephalosporinases of Escherichia coli
populations colonizing patients in rehabilitation centers in four countries: Antimicrobial Agents and
Chemotherapy, v. 57, p. 309-316.
Jacoby, G., V. Cattoir, D. Hooper, L. Martinez-Martinez, P. Nordmann, A. Pascual, L. Poirel, and M. Wang, 2008, qnr
gene nomenclature: Antimicrobial Agents and Chemotherapy, v. 52, p. 2297-2299.
Jacoby, G. A., 2009, AmpC β-lactamases: Clinical Microbiology Reviews, v. 22, p. 161-182.
Jacoby, G. A., C. M. Griffin, and D. C. Hooper, 2011, Citrobacter spp. as a source of qnrB alleles: Antimicrobial Agents
and Chemotherapy, v. 55, p. 4979-4984.
Jacoby, G. A., J. Strahilevitz, and D. C. Hooper, 2014, Plasmid-mediated quinolone resistance: Microbiology
spectrum, v. 2, p. 1-24.
Jacoby, G. A., K. E. Walsh, D. M. Mills, V. J. Walker, H. Oh, A. Robicsek, and D. C. Hooper, 2006, qnrB, another plasmidmediated
gene for quinolone resistance: Antimicrobial Agents and Chemotherapy, v. 50, p. 1178-1182.
Jamborova, I., M. Dolejska, J. Vojtech, S. Guenther, R. Uricariu, J. Drozdowska, I. Papousek, K. Pasekova, W. Meissner,
J. Hordowski, A. Cizek, and I. Literak, 2015, Plasmid-mediated resistance to cephalosporins and
fluoroquinolones in various Escherichia coli sequence types isolated from rooks wintering in Europe:
Applied and Environmental Microbiology, v. 81, p. 648-657.
Janatova, M., K. Albrechtova, K. J. Petrzelkova, M. Dolejska, I. Papousek, M. Masarikova, A. Cizek, A. Todd, K. Shutt,
B. Kalousova, I Profousova, D. Modry, I. Literak, 2014, Antimicrobial-resistant Enterobacteriaceae from
humans and wildlife in Dzanga-Sangha Protected Area, Central African Republic: Veterinary Microbiology,
v. 171, p. 422-431.
Jeziorowski, A., and D. M. Gordon, 2007, Evolution of microcin V and colicin Ia plasmids in Escherichia coli: Journal
of Bacteriology, v. 189, p. 7045-7052.
Johnson, J. R., and T. A. Russo, 2002a, Extraintestinal pathogenic Escherichia coli: "The other bad E coli": Journal of
Laboratory and Clinical Medicine, v. 139, p. 155-162.
Johnson, J. R., and T. A. Russo, 2002b, Uropathogenic Escherichia coli as agents of diverse non-urinary tract
extraintestinal infections: Journal of Infectious Diseases, v. 186, p. 859-864.
Johnson, J. R., V. Tchesnokova, B. Johnston, C. Clabots, P. L. Roberts, M. Billig, K. Riddell, P. Rogers, X. Qin, S. ButlerWu,
L. B. Price, M. Aziz, M.-H. Nicolas-Chanoine, C. DebRoy, A. Robicsek, G. Hansen, C. Urban, J. Platell, D.
J. Trott, G. Zhanel, S. J. Weissman, B. T. Cookson, F. C. Fang, A. P. Limaye, D. Scholes, S. Chattopadhyay, D.
C. Hooper, and E. V. Sokurenko, 2013a, Abrupt emergence of a single dominant multidrug-resistant strain
of Escherichia coli: Journal of Infectious Diseases, v. 207, p. 919-928.
Johnson, J. W., J. F. Fisher, and S. Mobashery, 2013b, Bacterial cell-wall recycling: Antimicrobial Therapeutics
Reviews: Annals of the New York Academy of Sciences, v. 1277, p. 54-75.
Johnson, T. J., E. M. Bielak, D. Fortini, L. H. Hansen, H. Hasman, C. Debroy, L. K. Nolan, and A. Carattoli, 2012a,
Expansion of the IncX plasmid family for improved identification and typing of novel plasmids in drugresistant
Enterobacteriaceae: Plasmid, v. 68, p. 43-50.
Johnson, T. J., C. M. Logue, J. R. Johnson, M. A. Kuskowski, J. S. Sherwood, H. J. Barnes, C. DebRoy, Y. M.
Wannemuehler, M. Obata-Yasuoka, L. Spanjaard, and L. K. Nolan, 2012b, Associations between multidrug
resistance, plasmid content, and virulence potential among extraintestinal pathogenic and commensal
Escherichia coli from humans and poultry: Foodborne Pathogens and Disease, v. 9, p. 37-46.
Johnson, T. J., and L. K. Nolan, 2009, Pathogenomics of the virulence plasmids of Escherichia coli: Microbiology and
Molecular Biology Reviews, v. 73, p. 750-774.
171
Johnson, T. J., J. Skyberg, and L. K. Nolan, 2004, Multiple antimicrobial resistance region of a putative virulence
plasmid from an Escherichia coli isolate incriminated in Avian colibacillosis: Avian Diseases, v. 48, p. 351-
360.
Johnson, T. J., Y. M. Wannemeuhler, J. A. Scaccianoce, S. J. Johnson, and L. K. Nolan, 2006, Complete DNA sequence
comparative genomics, and prevalence of an IncHI2 plasmid occurring among extraintestinal pathogenic
Escherichia coli isolates: Antimicrobial Agents and Chemotherapy, v. 50, p. 3929-3933.
Johnson, T. J., Y. M. Wannemuehler, S. J. Johnson, C. M. Logue, D. G. White, C. Doetkott, and L. K. Nolan, 2007,
Plasmid replicon typing of commensal and pathogenic Escherichia coli isolates: Applied and Environmental
Microbiology, v. 73, p. 1976-1983.
Jones-Dias, D., V. Manageiro, A. P. Francisco, A. P. Martins, G. Domingues, D. Louro, E. Ferreira, and M. Canica, 2013,
Assessing the molecular basis of transferable quinolone resistance in Escherichia coli and Salmonella spp.
from food-producing animals and food products: Veterinary Microbiology, v. 167, p. 523-531.
Jorgensen, T. S., A. S. Kiil, M. A. Hansen, S. J. Sorensen, and L. H. Hansen, 2015, Current strategies for mobilome
research: Frontiers in Microbiology, v. 5, p. 1-6.
Jukes, T. H., E. L. R. Stokstad, R. R. Taylor, T. J. Cunha, H. M. Edwards, and G. B. Meadows, 1950, Growth-promoting
effect of aureomycin on pigs: Archives of Biochemistry, v. 26, p. 324-325.
Kasap, M., S. Torol, F. Kolayli, D. Dundar, and H. Vahaboglu, 2013, OXA-162, a novel variant of OXA-48 displays
extended hydrolytic activity towards imipenem, meropenem and doripenem: Journal of Enzyme Inhibition
and Medicinal Chemistry, v. 28, p. 990-996.
Kayama, S., N. Shigemoto, R. Kuwahara, K. Oshima, H. Hirakawa, J. Hisatsune, T. Jove, H. Nishio, K. Yamasaki, Y.
Wada, T. Ueshimo, T. Miura, T. Sueda, M. Onodera, M. Yokozaki, M. Hattori, H. Ohge, and M. Sugai, 2015,
Complete nucleotide sequence of the IncN plasmid encoding IMP-6 and CTX-M-2 from emerging
carbapenem-resistant Enterobacteriaceae in Japan: Antimicrobial Agents and Chemotherapy, v. 59, p.
1356-1359.
Khan, S. A., 1997, Rolling-circle replication of bacterial plasmids: Microbiology and Molecular Biology Reviews, v. 61,
p. 442-455.
Khan, S. A., 2000, Plasmid rolling-circle replication: recent developments: Molecular Microbiology, v. 37, p. 477-
484.
Kieser T., M. J. Bibb, M. J. Buttner, K. F. Chater, D. A. Hopwood, 2000, Practical streptomyces genetics:
Norwich: John Innes Foundation, 613 pp.
Kim, S. R., and T. Komano, 1997, The plasmid R64 thin pilus identified as a type IV pilus: Journal of Bacteriology, v.
179, p. 3594-3603.
Kliebe, C., B. A. Nies, J. F. Meyer, R. M. Tolxdorffneutzling, and B. Wiedemann, 1985, Evolution of plasmid-coded
resistance to broad-spectrum cephalosporins: Antimicrobial Agents and Chemotherapy, v. 28, p. 302-307.
Klimes, J., M. Machalkova, M. Dolejska, A. Cizek, D. Janoszowska, P. Alexa, K. Albrechtova, J. Vojtech, I. Literak,
2013, Escherichia coli-producing extended-spectrum beta-lactamases CTX-M-15 in a captive South
American tapir (Tapirus terrestris): Journal of Zoo and Wildlife Medicine, v. 44, p. 173-175.
Kobayashi, I., 2001, Behavior of restriction-modification systems as selfish mobile elements and their impact on
genome evolution: Nucleic Acids Research, v. 29, p. 3742-3756.
Koch, A. L., 2003, Bacterial wall as target for attack: Past, present, and future research: Clinical Microbiology
Reviews, v. 16, p. 673-687.
Koenig, J. E., Y. Boucher, R. L. Charlebois, C. Nesbo, O. Zhaxybayeva, E. Bapteste, M. Spencer, M. J. Joss, H. W. Stokes,
and W. F. Doolittle, 2008, Integron-associated gene cassettes in Halifax Harbour: assessment of a mobile
gene pool in marine sediments: Environmental Microbiology, v. 10, p. 1024-1038.
Kojima, A., Y. Ishii, K. Ishihara, H. Esaki, T. Asai, C. Oda, Y. Tamura, T. Takahashi, and K. Yamaguchi, 2005, Extendedspectrum-β-lactamase-producing
Escherichia Coli strains isolated from farm animals from 1999 to 2002:
Report from the Japanese Veterinary Antimicrobial Resistance Monitoring program: Antimicrobial Agents
and Chemotherapy, v. 49, p. 3533-3537.
Kola, A., B. Piening, U.-F. Pape, W. Veltzke-Schlieker, M. Kaase, C. Geffers, B. Wiedenmann, and P. Gastmeier, 2015,
An outbreak of carbapenem-resistant OXA-48 - producing Klebsiella pneumonia associated to
duodenoscopy: Antimicrobial Resistance and Infection Control, v. 4, p. 1-8.
Kolar, M., J. Bardon, M. Chroma, K. Hricova, T. Stosova, P. Sauer, and D. Koukalova, 2010, ESBL and AmpC betalactamase-producing
Enterobacteriaceae in poultry in the Czech Republic, Veterinarni Medicina, v. 55, p.
119-124.
Kolenda, R., M. Burdukiewicz, and P. Schierack, 2015, A systematic review and meta-analysis of the epidemiology
of pathogenic Escherichia coli of calves and the role of calves as reservoirs for human pathogenic E. coli:
Frontiers in Cellular and Infection Microbiology, v. 5, p. 1-12.
172
Komp Lindgren, P., A. Karlsson, and D. Hughes, 2003, Mutation rate and evolution of fluoroquinolone resistance in
Escherichia coli isolates from patients with urinary tract infections: Antimicrobial agents and
chemotherapy, v. 47, p. 3222-3232.
Kuemmerer, K., 2009a, Antibiotics in the aquatic environment - A review - Part I: Chemosphere, v. 75, p. 417-434.
Kuemmerer, K., 2009b, Antibiotics in the aquatic environment - A review - Part II: Chemosphere, v. 75, p. 435-441.
Kumar, A., and H. P. Schweizer, 2005, Bacterial resistance to antibiotics: Active efflux and reduced uptake: Advanced
Drug Delivery Reviews, v. 57, p. 1486-1513.
Kummerer, K., and A. Henninger, 2003, Promoting resistance by the emission of antibiotics from hospitals and
households into effluent: Clinical Microbiology and Infection, v. 9, p. 1203-1214.
Lartigue, M. F., L. Poirel, D. Aubert, and P. Nordmann, 2006, In vitro analysis of ISEcp1B-mediated mobilization of
naturally occurring β-Lactamase Gene blaCTX-M of Kluyvera ascorbata: Antimicrobial Agents and
Chemotherapy, v. 50, p. 1282-1286.
Lascols, C., I. Podglajen, C. Verdet, V. Gautier, L. Gutmann, C.-J. Soussy, E. Collatz, and E. Cambau, 2008, A plasmidborne
Shewanella algae gene, qnrA3, and its possible transfer in vivo between Kluyvera ascorbata and
Klebsiella pneumoniae: Journal of Bacteriology, v. 190, p. 5217-5223.
Laupland, K. B., D. L. Church, J. Vidakovich, M. Mucenski, and J. D. D. Pitout, 2008a, Community-onset extendedspectrum
β-lactamase (ESBL) producing Escherichia coli: Importance of international travel: Journal of
Infection, v. 57, p. 441-448.
Laupland, K. B., D. B. Gregson, D. L. Church, T. Ross, and J. D. D. Pitout, 2008b, Incidence, risk factors and outcomes
of Escherichia coli bloodstream infections in a large Canadian region: Clinical Microbiology and Infection,
v. 14, p. 1041-1047.
Lawrence, J. G., and H. Ochman, 1998, Molecular archaeology of the Escherichia coli genome: Proceedings of the
National Academy of Sciences of the United States of America, v. 95, p. 9413-9417.
Lederberg, J., and E. L. Tatum, 1953, Sex in bacteria - Genetic Studies, 1945-1952: Science, v. 118, p. 169-175.
Lee, K., J. H. Yum, D. G. Yong, H. M. Lee, H. D. Kim, J. D. Docquier, G. M. Rossolini, and Y. S. Chong, 2005, Novel
acquired metallo-β-lactamase gene, blaSIM-1, in a class 1 integron from Acinetobacter baumannii Clinical
isolates from Korea: Antimicrobial Agents and Chemotherapy, v. 49, p. 4485-4491.
Lesher, G. Y., M. D. Gruett, E. J. Froelich, R. P. Brundage, and J. H. Bailey, 1962, 1,8-Naphthyridine derivatives - a
new class of chemotherapeutic agents: Journal of Medicinal Chemistry, v. 5, p. 1063-1065.
Leverstein-van Hall, M. A., C. M. Dierikx, J. C. Stuart, G. M. Voets, M. P. van den Munckhof, A. van Essen-Zandbergen,
T. Platteel, A. C. Fluit, N. van de Sande-Bruinsma, J. Scharinga, M. J. M. Bonten, D. J. Mevius, and E. S. G.
Natl, 2011, Dutch patients, retail chicken meat and poultry share the same ESBL genes, plasmids and
strains: Clinical Microbiology and Infection, v. 17, p. 873-880.
Lewis, J. S., II, M. Herrera, B. Wickes, J. E. Patterson, and J. H. Jorgensen, 2007, First report of the emergence of CTXM-Type
Extended-Spectrum β-Lactamases (ESBLs) as the predominant ESBL isolated in a US Health Care
System: Antimicrobial Agents and Chemotherapy, v. 51, p. 4015-4021.
Li, L., B. Wang, S. Feng, J. Li, C. Wu, Y. Wang, X. Ruan, and M. Zeng, 2014, Prevalence and characteristics of extendedspectrum
β-lactamase and plasmid-mediated fluoroquinolone resistance genes in Escherichia coli isolated
from chickens in Anhui province, China: PLOS One, v. 9, p. 1-6.
Li, S., W. Song, Y. Zhou, Y. Tang, Y. Gao, and Z. Miao, 2015, Spread of extended-spectrum beta-lactamase-producing
Escherichia coli from a swine farm to the receiving river: Environmental Science and Pollution Research, v.
22, p. 13033-13037.
Liao, X.-P., J. Xia, L. Yang, L. Li, J. Sun, Y.-H. Liu, and H.-X. Jiang, 2015, Characterization of CTX-M-14-producing
Escherichia coli from food-producing animals: Frontiers in Microbiology, v. 6, p. 1-8.
Liebana, E., M. Batchelor, K. L. Hopkins, F. A. Clifton-Hadley, C. J. Teale, A. Foster, L. Barker, E. J. Threlfall, and R. H.
Davies, 2006, Longitudinal farm study of extended-spectrum β-lactamase-mediated resistance: Journal of
Clinical Microbiology, v. 44, p. 1630-1634.
Liebert, C. A., R. M. Hall, and A. O. Summers, 1999, Transposon Tn21, flagship of the Floating Genome: Microbiology
and Molecular Biology Reviews, v. 63, p. 507-522.
Lim, H. M., J. J. Pene, and R. W. Shaw, 1988, Cloning, nucleotide-sequence, and expression of the Bacillus-cereus
5/B/6 β-lactamase-II structural gene: Journal of Bacteriology, v. 170, p. 2873-2878.
Lin, Y.-T., Y.-J. Pan, T.-L. Lin, C.-P. Fung, and J.-T. Wang, 2015, Transfer of CMY-2 cephalosporinase from Escherichia
coli to virulent Klebsiella pneumoniae causing a recurrent liver abscess: Antimicrobial Agents and
Chemotherapy, v. 59, p. 5000-5002.
Linares, J. F., I. Gustafsson, F. Baquero, J. L. Martinez, 2006, Antibiotics as intermicrobial signaling agents instead of
weapons: Proceedings of the National Academy of Sciences of the United States of America, v.103, p.
19484–19489.
173
Lindberg, R. H., K. Bjorklund, P. Rendahl, M. I. Johansson, M. Tysklind, and B. A. V. Andersson, 2007, Environmental
risk assessment of antibiotics in the Swedish environment with emphasis on sewage treatment plants:
Water Research, v. 41, p. 613-619.
Literak, I., M. Dolejska, A. Cizek, C. A. T. Djigo, A. Konecny, and P. Koubek, 2009, Reservoirs of antibiotic-resistant
Enterobacteriaceae among animals sympatric to humans in Senegal: extended-spectrum beta-lactamases
in bacteria in a black rat (Rattus rattus): African Journal of Microbiology Research, v. 3, p. 751-754.
Literak, I., M. Dolejska, D. Janoszowska, J. Hrusakova, W. Meissner, H. Rzyska, S. Bzoma, and A. Cizek, 2010a,
Antibiotic-resistant Escherichia coli bacteria, including strains with genes encoding the extended-spectrum
beta-lactamase and QnrS, in waterbirds on the Baltic Sea coast of Poland: Applied and Environmental
Microbiology, v. 76, p. 8126-8134.
Literak, I., M. Dolejska, T. Radimersky, J. Klimes, M. Friedman, F. M. Aarestrup, H. Hasman, and A. Cizek, 2010b,
Antimicrobial-resistant faecal Escherichia coli in wild mammals in central Europe: multiresistant Escherichia
coli producing extended-spectrum beta-lactamases in wild boars: Journal of Applied Microbiology, v. 108,
p. 1702-1711.
Literak, I., M. Micudova, D. Tausova, A. Cizek, M. Dolejska, I. Papousek, J. Prochazka, J. Vojtech, F. Borleis, L.
Guardone, S. Guenther, J. Hordowski, C. Lejas, W. Meissner, B. Fuertes Marcos, and M. Tucakov, 2012,
Plasmid-mediated quinolone resistance genes in fecal bacteria from rooks commonly wintering
throughout Europe: Microbial Drug Resistance, v. 18, p. 567-573.
Literak, I., R. Petro, M. Dolejska, E. Gruberova, H. Dobiasova, J. Petr, and A. Cizek, 2011, Antimicrobial resistance in
fecal Escherichia coli Isolates from healthy urban children of two age groups in relation to their antibiotic
therapy: Antimicrobial Agents and Chemotherapy, v. 55, p. 3005-3007.
Literak, I., T. Reitschmied, D. Bujnakova, M. Dolejska, A. Cizek, J. Bardon, L. Pokludova, P. Alexa, D. Halova, and I.
Jamborova, 2013, Broilers as a source of quinolone-resistant and extraintestinal pathogenic Escherichia
coli in the Czech Republic: Microbial Drug Resistance, v. 19, p. 57-63.
Liu, L., D. He, L. Lv, W. Liu, X. Chen, Z. Zeng, S. R. Partridge, and J.-H. Liu, 2015, blaCTX-M-1/9/1 hybrid genes may have
been generated from blaCTX-M-15 on an IncI2 plasmid: Antimicrobial Agents and Chemotherapy, v. 59, p.
4464-70.
Livermore, D. M., 1995, β-lactamases in laboratory and clinical resistance: Clinical Microbiology Reviews, v. 8, p.
557-584.
Loncaric, I., G. L. Stalder, K. Mehinagic, R. Rosengarten, F. Hoelzl, F. Knauer, and C. Walzer, 2013, Comparison of
ESBL - and AmpC producing Enterobacteriaceae and methicillin-resistant Staphylococcus aureus (MRSA)
isolated from migratory and resident population of rooks (Corvus frugilegus) in Austria: PLOS One, v. 8, p.
1-8.
Lytsy, B., L. Sandegren, E. Tano, E. Torell, D. I. Andersson, and A. S. A. Melhus, 2008, The first major extendedspectrum
β-lactamase outbreak in Scandinavia was caused by clonal spread of a multiresistant Klebsiella
pneumoniae producing CTX-M-15: APMIS, v. 116, p. 302-308.
Ma, L., L. K. Siu, and P.-L. Lu, 2011, Effect of spacer sequences between blaCTX-M and ISEcp1 on blaCTX-M expression:
Journal of Medical Microbiology, v. 60, p. 1787-1792.
Maddox, T. W., P. D. Clegg, P. J. Diggle, A. L. Wedley, S. Dawson, G. L. Pinchbeck, and N. J. Williams, 2012a, Crosssectional
study of antimicrobial-resistant bacteria in horses. Part 1: Prevalence of antimicrobial-resistant
Escherichia coli and methicillin-resistant Staphylococcus aureus: Equine Veterinary Journal, v. 44, p. 289-
296.
Maddox, T. W., G. L. Pinchbeck, P. D. Clegg, A. L. Wedley, S. Dawson, and N. J. Williams, 2012b, Cross-sectional study
of antimicrobial-resistant bacteria in horses. Part 2: Risk factors for faecal carriage of antimicrobialresistant
Escherichia coli in horses: Equine Veterinary Journal, v. 44, p. 297-303.
Madec, J.-Y., L. Poirel, E. Saras, A. Gourguechon, D. Girlich, P. Nordmann, and M. Haenni, 2012, Non-ST131
Escherichia coli from cattle harbouring human-like blaCTX-M-15-carrying plasmids: Journal of Antimicrobial
Chemotherapy, v. 67, p. 578-581.
Magiorakos, A. P., A. Srinivasan, R. B. Carey, Y. Carmeli, M. E. Falagas, C. G. Giske, S. Harbarth, J. F. Hindler, G.
Kahlmeter, B. Olsson-Liljequist, D. L. Paterson, L. B. Rice, J. Stelling, M. J. Struelens, A. Vatopoulos, J. T.
Weber, and D. L. Monnet, 2012, Multidrug-resistant, extensively drug-resistant and pandrug-resistant
bacteria: an international expert proposal for interim standard definitions for acquired resistance: Clinical
Microbiology and Infection, v. 18, p. 268-281.
Mahillon, J., and M. Chandler, 1998, Insertion sequences: Microbiology and Molecular Biology Reviews, v. 62, p.
725-774.
Mahillon, J., C. Leonard, and M. Chandler, 1999, IS elements as constituents of bacterial genomes: Research in
Microbiology, v. 150, p. 675-687.
174
Mainil, J., 2013, Escherichia coli virulence factors: Veterinary Immunology and Immunopathology, v. 152, p. 2-12.
Manges, A. R., and J. R. Johnson, 2012, Food-borne origins of Escherichia coli causing extraintestinal infections:
Clinical Infectious Diseases, v. 55, p. 712-719.
Masarikova, M., I. Manga, A. Cizek, M. Dolejska, V. Oravcova, P. Myskova, R. Karpiskova, I. Literak, 2016, Salmonella
enterica resistant to antimicrobials in wastewater effluents and black-headed gulls in the Czech Republic:
Science of the Total Environment, v. 542, p. 102-107.
Marks, S. L., S. C. Rankin, B. A. Byrne, and J. S. Weese, 2011, Enteropathogenic bacteria in dogs and cats: diagnosis,
epidemiology, treatment, and control: Journal of Veterinary Internal Medicine, v. 25, p. 1195-1208.
Marshall, C. G., G. Broadhead, B. K. Leskiw, and G. D. Wright, 1997, D-Ala-D-Ala ligases from glycopeptide antibioticproducing
organisms are highly homologous to the enterococcal vancomycin-resistance ligases VanA and
VanB: Proceedings of the National Academy of Sciences of the United States of America, v. 94, p. 6480-
6483.
Marti, E., E. Variatza, and J. L. Balcazar, 2014, Bacteriophages as a reservoir of extended-spectrum β-lactamase and
fluoroquinolone resistance genes in the environment: Clinical Microbiology and Infection, v. 20, p. O456-
O459.
Martin, D., S. Fougnot, F. Grobost, S. Thibaut-Jovelin, F. Ballereau, T. Gueudet, D. de Mouy, J. Robert, and O. N.-v.
Network, 2016, Prevalence of extended-spectrum beta-lactamase producing Escherichia coli in
community-onset urinary tract infections in France in 2013: Journal of Infection, v. 72, p. 201-206.
Martinez-Martinez, L., 2008, Extended-spectrum β-lactamases and the permeability barrier: Clinical Microbiology
and Infection, v. 14, p. 82-89.
Martinez-Martinez, L., A. Pascual, and G. A. Jacoby, 1998, Quinolone resistance from a transferable plasmid: Lancet
, v. 351, p. 797-799.
Mascaretti, O. A., 2003, Bacteria versus antimicrobial agents: an Integrated approach : Washington, D.C., ASM
Press,
393 pp.
Maslanova, I., J. Doskar, M. Varga, L. Kuntova, J. Muzik, D. Maluskova, V. Ruzickova, and R. Pantucek, 2013,
Bacteriophages of Staphylococcus aureus efficiently package various bacterial genes and mobile genetic
elements including SCCmec with different frequencies: Environmental Microbiology Reports, v. 5, p. 66-
73.
Mataseje, L. F., P. J. Baudry, G. G. Zhanel, D. W. Morck, R. R. Read, M. Louie, and M. R. Mulvey, 2010, Comparison
of CMY-2 plasmids isolated from human, animal, and environmental Escherichia coli and Salmonella spp.
from Canada: Diagnostic Microbiology and Infectious Disease, v. 67, p. 387-391.
Matsumoto, Y., F. Ikeda, T. Kamimura, Y. Yokota, and Y. Mine, 1988, Novel plasmid-mediated β-lactamase from
Escherichia-Coli that inactivates oxyimino-cephalosporins: Antimicrobial Agents and Chemotherapy, v. 32,
p. 1243-1246.
Mazel, D., B. Dychinco, V. A. Webb, and J. Davies, 1998, A distinctive class of integron in the Vibrio cholerae genome:
Science, v. 280, p. 605-608.
McIntosh, D., M. Cunningham, B. Ji, F. A. Fekete, E. M. Parry, S. E. Clark, Z. B. Zalinger, I. C. Gilg, G. R. Danner, K. A.
Johnson, M. Beattie, and R. Ritchie, 2008, Transferable, multiple antibiotic and mercury resistance in
Atlantic Canadian isolates of Aeromonas salmonicida subsp. salmonicida is associated with carriage of an
IncA/C plasmid similar to the Salmonella enterica plasmid pSN254: Journal of Antimicrobial Chemotherapy,
v. 61, p. 1221-1228.
Melano, R., A. Petroni, A. Garutti, H. A. Saka, L. Mange, F. Pasteran, M. Rapoport, A. Rossi, and M. Galas, 2002, New
carbenicillin-hydrolyzing β-lactamase (CARB-7) from Vibrio cholerae Non-O1, Non-O139 strains encoded
by the VCR region of the V. cholerae genome: Antimicrobial Agents and Chemotherapy, v. 46, p. 2162-
2168.
Meunier, D., E. Jouy, C. Lazizzera, M. Kobisch, and J.-Y. Madec, 2006, CTX-M-1- and CTX-M-15-type β-lactamases in
clinical Escherichia coli isolates recovered from food-producing animals in France: International Journal of
Antimicrobial Agents, v. 28, p. 402-407.
Meyer, R., 2009, Replication and conjugative mobilization of Broad Host-range IncQ plasmids: Plasmid, v. 62, p. 57-
70.
Micenkova, L., P. Siskova, J. Bosak, I. Jamborova, L. Cernohorska, and D. Smajs, 2014, Characterization of human
uropathogenic ESBL-producing Escherichia coli in the Czech Republic: Spread of CTX-M-27-producing
strains in a University hospital: Microbial Drug Resistance, v. 20, p. 610-617.
Michael, C. A., M. R. Gillings, A. J. Holmes, L. Hughes, N. R. Andrew, M. P. Holley, and H. W. Stokes, 2004, Mobile
gene cassettes: A fundamental resource for bacterial evolution: American Naturalist, v. 164, p. 1-12.
175
Miller, C., L. E. Thomsen, C. Gaggero, R. Mosseri, H. Ingmer, and S. N. Cohen, 2004, SOS response induction by βlactams
and bacterial defense against antibiotic lethality: Science, v. 305, p. 1629-1631.
Minarini, L. A. R., and A. L. C. Darini, 2012, Mutations in the quinolone resistance-determining regions of gyrA and
parC in Enterobacteriaceae isolates from Brazil: Brazilian Journal of Microbiology, v. 43, p. 1309-1314.
Minh-Duy, P., and J. Wain, 2008, IncHI plasmids, a dynamic link between resistance and pathogenicity: Journal of
Infection in Developing Countries, v. 2, p. 272-278.
Minot, S., R. Sinha, J. Chen, H. Li, S. A. Keilbaugh, G. D. Wu, J. D. Lewis, and F. D. Bushman, 2011, The human gut
virome: Inter-individual variation and dynamic response to diet: Genome Research, v. 21, p. 1616-1625.
Mnif, B., S. Vimont, A. Boyd, E. Bourit, B. Picard, C. Branger, E. Denamur, and G. Arlet, 2010, Molecular
characterization of addiction systems of plasmids encoding extended-spectrum β-lactamases in
Escherichia coli: Journal of Antimicrobial Chemotherapy, v. 65, p. 1599-1603.
Modi, S. R., H. H. Lee, C. S. Spina, and J. J. Collins, 2013, Antibiotic treatment expands the resistance reservoir and
ecological network of the phage metagenome: Nature, v. 499, p. 219-222.
Monteiro, J., R. H. Widen, A. C. C. Pignatari, C. Kubasek, and S. Silbert, 2012, Rapid detection of carbapenemase
genes by multiplex real-time PCR: Journal of Antimicrobial Chemotherapy, v. 67, p. 906-909.
Moodley, A., and L. Guardabassi, 2009, Transmission of IncN Plasmids carrying blaCTX-M-1 between commensal
Escherichia coli in pigs and farm workers: Antimicrobial Agents and Chemotherapy, v. 53, p. 1709-1711.
Moore, P. R., A. Evenson, T. D. Luckey, E. McCoy, C. A. Elvehjem, and E. B. Hart, 1946, Use of sulfasuxidine,
streptothricin, and streptomycin in nutritional studies with the chick: Journal of Biological Chemistry, v.
165, p. 437-441.
Morikawa, K., A. J. Takemura, Y. Inose, M. Tsai, T. Le Thuy Nguyen, T. Ohta, and T. Msadek, 2012, Expression of a
cryptic secondary sigma factor gene unveils natural competence for DNA transformation in Staphylococcus
aureus: PLOS Pathogens, v. 8, p. 1-20.
Mourao, J., C. Novais, J. Machado, L. Peixe, and P. Antunes, 2015, Metal tolerance in emerging clinically relevant
multidrug-resistant Salmonella enterica serotype 4,[5],12: i:- clones circulating in Europe: International
Journal of Antimicrobial Agents, v. 45, p. 610-616.
Mulvey, M. R., E. Susky, M. McCracken, D. W. Morck, and R. R. Read, 2009, Similar cefoxitin-resistance plasmids
circulating in Escherichia coli from human and animal sources: Veterinary Microbiology, v. 134, p. 279-287.
Muniesa, M., M. Colomer-Lluch, and J. Jofre, 2013, Potential impact of environmental bacteriophages in spreading
antibiotic resistance genes: Future Microbiology, v. 8, p. 739-751.
Munshi, M. H., D. A. Sack, K. Haider, Z. U. Ahmed, M. M. Rahaman, and M. G. Morshed, 1987, Plasmid-mediated
resistance to nalidixic-acid in Shigella dysenteriae type-1: Lancet, v. 2, p. 419-421.
Naas, T., G. Cuzon, M.-V. Villegas, M.-F. Lartigue, J. P. Quinn, and P. Nordmann, 2008, Genetic structures at the
origin of acquisition of the β-lactamase blaKPC gene: Antimicrobial Agents and Chemotherapy, v. 52, p.
1257-1263.
Naas, T., Y. Mikami, T. Imai, L. Poirel, and P. Nordmann, 2001, Characterization of In53, a class 1 plasmid- and
Composite Transposon-Located Integron of Escherichia coli which carries an unusual array of gene
cassettes: Journal of Bacteriology, v. 183, p. 235-249.
Nagy, B., and P. Z. Fekete, 2005, Enterotoxigenic Escherichia coli in veterinary medicine: International Journal of
Medical Microbiology, v. 295, p. 443-454.
Nagy, Z., and M. Chandler, 2004, Regulation of transposition in bacteria: Research in Microbiology, v. 155, p. 387-
398.
Nakahara, H., T. Ishikawa, Y. Sarai, I. Kondo, H. Kozukue, and S. Silver, 1977, Linkage of mercury, cadmium, and
arsenate and drug resistance in clinical isolates of Pseudomonas aeruginosa: Applied and Environmental
Microbiology, v. 33, p. 975-976.
Nakazato, G., T. A. de Campos, E. G. Stehling, M. Brocchi, and W. D. da Silveira, 2009, Virulence factors of avian
pathogenic Escherichia coli (APEC): Pesquisa Veterinaria Brasileira, v. 29, p. 479-486.
Nelson, M., S. H. Jones, C. Edwards, and J. C. Ellis, 2008, Characterization of Escherichia coli populations from gulls,
landfill trash, and wastewater using ribotyping: Diseases of Aquatic Organisms, v. 81, p. 53-63.
Nesme, J., and P. Simonet, 2015, The soil resistome: a critical review on antibiotic resistance origins, ecology and
dissemination potential in telluric bacteria: Environmental Microbiology, v. 17, p. 913-930.
Nicolas-Chanoine, M.-H., X. Bertrand, and J.-Y. Madec, 2014, Escherichia coli ST131, an intriguing clonal group:
Clinical Microbiology Reviews, v. 27, p. 543-574.
Nield, B. S., A. J. Holmes, M. R. Gillings, G. D. Recchia, B. C. Mabbutt, K. M. H. Nevalainen, and H. W. Stokes, 2001,
Recovery of new integron classes from environmental DNA: FEMS Microbiology Letters, v. 195, p. 59-65.
Nikaido, H., 1996, Multidrug Efflux Pumps of Gram-negative bacteria: Journal of Bacteriology, v. 178, p. 5853-5859.
176
Nikaido, H., 2003, Molecular basis of bacterial outer membrane permeability revisited: Microbiology and Molecular
Biology Reviews, v. 67, p. 593-656.
Nikaido, H., and Y. Takatsuka, 2009, Mechanisms of RND multidrug efflux pumps: Biochimica Et Biophysica ActaProteins
and Proteomics, v. 1794, p. 769-781.
Nordmann, P., 2014, Carbapenemase-producing Enterobacteriaceae: Overview of a major public health challenge:
Medecine Et Maladies Infectieuses, v. 44, p. 51-56.
Nordmann, P., L. Dortet, and L. Poirel, 2012a, Carbapenem resistance in Enterobacteriaceae: here is the storm!:
Trends in Molecular Medicine, v. 18, p. 263-272.
Nordmann, P., M.-F. Lartigue, and L. Poirel, 2008, β-lactam induction of ISEcp1B-mediated mobilization of the
naturally occurring blaCTX-M β-lactamase gene of Kluyvera ascorbata: FEMS Microbiology Letters, v. 288, p.
247-249.
Nordmann, P., and L. Poirel, 2005, Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae:
Journal of Antimicrobial Chemotherapy, v. 56, p. 463-469.
Nordmann, P., and L. Poirel, 2014, The difficult-to-control spread of carbapenemase producers among
Enterobacteriaceae worldwide: Clinical Microbiology and Infection, v. 20, p. 821-830.
Nordmann, P., L. Poirel, and L. Dortet, 2012b, Rapid detection of carbapenemase-producing Enterobacteriaceae:
Emerging Infectious Diseases, v. 18, p. 1503-1507.
Norman, A., L. H. Hansen, Q. She, and S. J. Sorensen, 2008, Nucleotide sequence of pOLA52: A conjugative IncX1
plasmid from Escherichia coli which enables biofilm formation and multidrug efflux: Plasmid, v. 60, p. 59-
74.
Norman, A., L. H. Hansen, and S. J. Sorensen, 2009, Conjugative plasmids: vessels of the communal gene pool:
Philosophical Transactions of the Royal Society B-Biological Sciences, v. 364, p. 2275-2289.
Novais, A., I. Comas, F. Baquero, R. Canton, T. M. Coque, A. Moya, F. Gonzalez-Candelas, and J.-C. Galan, 2010,
Evolutionary trajectories of beta-lactamase CTX-M-1 cluster enzymes: Predicting Antibiotic Resistance:
PLOS Pathogens, v. 6, p. 1-16.
Novick, R. P., 1987, Plasmid incompatibility: Microbiological Reviews, v. 51, p. 381-395.
Novick, R. P., R. C. Clowes, S. N. Cohen, R. Curtiss, N. Datta, and S. Falkow, 1976, Uniform nomenclature for bacterial
plasmids: a proposal: Bacteriological Reviews, v. 40, p. 168-189.
Novick, R. P., and F. C. Hoppensteadt, 1978, On plasmid incompatibility: Plasmid, v. 1, p. 421-434.
Ochman, H., and A. C. Wilson, 1987, Evolution in bacteria - evidence for a universal substitution rate in cellular
genomes: Journal of Molecular Evolution, v. 26, p. 74-86.
Ogawa, A., and T. Takeda, 1993, The gene encoding the heat-stable enterotoxin of Vibrio-Cholerae is flanked by
123-base pair direct repeats: Microbiology and Immunology, v. 37, p. 607-616.
Ojer-Usoz, E., D. Gonzalez, I. Garcia-Jalon, and A. Isabel Vitas, 2014, High dissemination of extended-spectrum βlactamase-producing
Enterobacteriaceae in effluents from wastewater treatment plants: Water Research,
v. 56, p. 37-47.
Oliver, A., T. M. Coque, D. Alonso, A. Valverde, F. Baquero, and R. Canton, 2005, CTX-M-10 linked to a phage-related
element is widely disseminated among Enterobacteriaceae in a Spanish hospital: Antimicrobial Agents and
Chemotherapy, v. 49, p. 1567-1571.
Oliver, A., J. C. Perez-Diaz, T. M. Coque, F. Baquero, and R. Canton, 2001, Nucleotide sequence and characterization
of a novel cefotaxime-hydrolyzing βlactamase (CTX-M-10) isolated in Spain: Antimicrobial Agents and
Chemotherapy, v. 45, p. 616-620.
Olliver, A., M. Valle, E. Chaslus-Dancla, and A. Cloeckaert, 2005, Overexpression of the multidrug efflux peron acrEF
by insertional activation with IS1 or IS10 elements in Salmonella enterica serovar Typhimurium DT204 acrB
mutants selected with fluoroquinolones: Antimicrobial Agents and Chemotherapy, v. 49, p. 289-301.
Olson, A. B., M. Silverman, D. A. Boyd, A. McGeer, B. M. Willey, V. Pong-Porter, N. Daneman, and M. R. Mulvey,
2005, Identification of a progenitor of the CTX-M-9 group of extended-spectrum β-lactamases from
Kluyvera georgiana isolated in Guyana: Antimicrobial Agents and Chemotherapy, v. 49, p. 2112-2115.
Osano, E., Y. Arakawa, R. Wacharotayankun, M. Ohta, T. Horii, H. Ito, F. Yoshimura, and N. Kato, 1994, Molecular
characterization of an enterobacterial metallo β-lactamase found in a clinical isolate of SerratiaMarcescens
that shows imipenem resistance: Antimicrobial Agents and Chemotherapy, v. 38, p. 71-78.
Osborn, A. M., F. M. D. Tatley, L. M. Steyn, R. W. Pickup, and J. R. Saunders, 2000, Mosaic plasmids and mosaic
replicons: evolutionary lessons from the analysis of genetic diversity in IncFII-related replicons:
Microbiology, v. 146, p. 2267-2275.
Paciorek, J., 2002, Virulence properties of Escherichia coli faecal strains isolated in Poland from healthy children and
strains belonging to serogroups O18, O26, O44, O86, O126 and O127 isolated from children with
diarrhoea: Journal of Medical Microbiology, v. 51, p. 548-556.
177
Pal, C., J. Bengtsson-Palme, E. Kristiansson, and D. G. J. Larsson, 2015, Co-occurrence of resistance genes to
antibiotics, biocides and metals reveals novel insights into their co-selection potential: BMC Genomics, v.
16, p. 14.
Papagiannitsis, C. C., M. Dolejska, R. Izdebski, H. Dobiasova, V. Studentova, F. J. Esteves, L. P. G. Derde, Bonten, M.
J. M. Bonten, J. Hrabak. M. Gniadkowski, 2015c, Characterization of pKP-M1144, a Novel ColE1-Like
Plasmid Encoding IMP-8, GES-5, and BEL-1 beta-Lactamases, from a Klebsiella pneumoniae Sequence Type
252 Isolate: Antimicrobial Agents and Chemotherapy, v. 59, p. 5065-5068.
Papagiannitsis, C. C., M. Dolejska, R. Izdebski, P. Giakkoupi, A. Skalova, K. Chudejova, H. Dobiasova, A. C. Vatopoulos,
L. P. G. Derde, M. J. M. Bonten, M. Gniadkowski, and J. Hrabak, 2016, Characterisation of IncA/C2 plasmids
carrying an In416-like integron with the blaVIM-19 gene from Klebsiella pneumoniae ST383 of Greek origin:
International Journal of Antimicrobial Agents, v. 47, p. 158-162.
Papagiannitsis, C. C., R. Izdebski, A. Baraniak, J. Fiett, M. Herda, J. Hrabak, L. P. G. Derde, M. J. M. Bonten, Y. Carmeli,
H. Goossens, W. Hryniewicz, C. Brun-Buisson, M. Gniadkowski, and M. W. W. W. S. Grp, 2015a, Survey of
metallo-β-lactamase-producing Enterobacteriaceae colonizing patients in European ICUs and
rehabilitation units, 2008-11: Journal of Antimicrobial Chemotherapy, v. 70, p. 1981-1988.
Papagiannitsis, C. C., V. Studentova, V. Jakubu, P. Spanelova, P. Urbaskova, H. Zemlickova, J. Hrabak, and E. Czech
Participants, 2015b, High prevalence of ST131 among CTX-M-producing Escherichia coli from communityacquired
infections, in the Czech Republic: Microbial Drug Resistance, v. 21, p. 74-84.
Papp-Wallace, K. M., A. Endimiani, M. A. Taracila, and R. A. Bonomo, 2011, Carbapenems: Past, present, and future:
Antimicrobial Agents and Chemotherapy, v. 55, p. 4943-4960.
Parsley, L. C., E. J. Consuegra, K. S. Kakirde, A. M. Land, W. F. Harper, Jr., and M. R. Liles, 2010, Identification of
diverse antimicrobial resistance determinants carried on bacterial, plasmid, or viral metagenomes from an
activated sludge microbial assemblage: Applied and Environmental Microbiology, v. 76, p. 3753-3757.
Partridge, S. R., 2011, Analysis of antibiotic resistance regions in Gram-negative bacteria: FEMS Microbiology
Reviews, v. 35, p. 820-855.
Partridge, S. R., and R. M. Hall, 2005, Evolution of transposons containing blaTEM genes: Antimicrobial Agents and
Chemotherapy, v. 49, p. 1267-1268.
Partridge, S. R., G. Tsafnat, E. Coiera, and J. R. Iredell, 2009, Gene cassettes and cassette arrays in mobile resistance
integrons: FEMS Microbiology Reviews, v. 33, p. 757-784.
Partridge, S. R., Z. Zong, and J. R. Iredell, 2011, Recombination in IS26 and Tn2 in the evolution of multiresistance
regions carrying blaCTX-M-15 on conjugative IncF plasmids from Escherichia coli: Antimicrobial Agents and
Chemotherapy, v. 55, p. 4971-4978.
Pastrana-Carrasco, J., J. Ulises Garza-Ramos, H. Barrios, R. Morfin-Otero, E. Rodriguez-Noriega, J. Manuel Barajas,
S. Suarez, R. Diaz, G. Miranda, F. Solorzano, J. Contreras, and J. Silva-Sanchez, 2012, qacEΔ1 gene frequency
and biocide resistance in extended-spectrum β-lactamase producing Enterobacteriaceae clinical isolates:
Revista De Investigacion Clinica, v. 64, p. 535-540.
Paterson, D. L., 2006, Resistance in Gram-negative bacteria: Enterobacteriaceae: American Journal of Infection
Control, v. 34, p. S20-S28.
Paton, J. H., and D. S. Reeves, 1988, Fluoroquinolone antibiotics - microbiology, pharmacokinetics and clinical use:
Drugs, v. 36, p. 193-228.
Peirano, G., K. B. Laupland, D. B. Gregson, and J. D. D. Pitout, 2011, Colonization of returning travelers with CTX-Mproducing
Escherichia coli: Journal of Travel Medicine, v. 18, p. 299-303.
Pembroke, J. T., C. MacMahon, and B. McGrath, 2002, The role of conjugative transposons in the
Enterobacteriaceae: Cellular and Molecular Life Sciences, v. 59, p. 2055-2064.
Perez, A., M. Poza, A. Fernandez, M. del Carmen, F. Susana Mallo, M. Merino, S. Rumbo-Feal, M. P. Cabral, and G.
Bou, 2012, Involvement of the AcrAB-TolC efflux pump in the resistance, fitness, and virulence of
Enterobacter cloacae: Antimicrobial Agents and Chemotherapy, v. 56, p. 2084-2090.
Perez-Perez, F. J., and N. D. Hanson, 2002, Detection of plasmid-mediated AmpC β-lactamase genes in clinical
isolates by using multiplex PCR: Journal of Clinical Microbiology, v. 40, p. 2153-2162.
Perron, G. G., A. E. G. Lee, Y. Wang, W. E. Huang, and T. G. Barraclough, 2012, Bacterial recombination promotes
the evolution of multi-drug-resistance in functionally diverse populations: Proceedings of the Royal Society
B-Biological Sciences, v. 279, p. 1477-1484.
Phan, M.-D., C. Kidgell, S. Nair, K. E. Holt, A. K. Turner, J. Hinds, P. Butcher, F. J. Cooke, N. R. Thomson, R. Titball, Z.
A. Bhutta, R. Hasan, G. Dougan, and J. Wain, 2009, Variation in Salmonella enterica serovar Typhi IncHI1
plasmids during the global spread of resistant typhoid fever: Antimicrobial Agents and Chemotherapy, v.
53, p. 716-727.
178
Philippon, A., G. Arlet, and G. A. Jacoby, 2002, Plasmid-determined AmpC-type β-lactamases: Antimicrobial Agents
and Chemotherapy, v. 46, p. 1-11.
Phillips, I., 2007, Withdrawal of growth-promoting antibiotics in Europe and its effects in relation to human health:
International Journal of Antimicrobial Agents, v. 30, p. 101-107.
Piddock, L. J., 2002, Fluoroquinolone resistance in Salmonella serovars isolated from humans and food animals:
FEMS Microbiology Reviews, v. 26, p. 3-16.
Pilar Garcillan-Barcia, M., B. Ruiz del Castillo, A. Alvarado, F. de la Cruz, and L. Martinez-Martinez, 2015, Degenerate
primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones: Plasmid,
v. 77, p. 17-27.
Pinto, L., H. Radhouani, C. Coelho, P. M. da Costa, R. Simoes, R. M. L. Brandao, C. Torres, G. Igrejas, and P. Poeta,
2010, Genetic detection of extended-spectrum β-lactamase-containing Escherichia coli isolates from birds
of prey from Serra da Estrela Natural Reserve in Portugal: Applied and Environmental Microbiology, v. 76,
p. 4118-4120.
Pitout, J. D. D., 2012a, Extraintestinal pathogenic Escherichia coli: a combination of virulence with antibiotic
resistance: Frontiers in Microbiology, v. 3, p. 1-7.
Pitout, J. D. D., 2012b, Extraintestinal pathogenic Escherichia coli: an update on antimicrobial resistance, laboratory
diagnosis and treatment: Expert Review of Anti-Infective Therapy, v. 10, p. 1165-1176.
Pitout, J. D. D., P. Nordmann, K. B. Laupland, and L. Poirel, 2005, Emergence of Enterobacteriaceae producing
extended-spectrum β-lactamases (ESBLs) in the community: Journal of Antimicrobial Chemotherapy, v. 56,
p. 52-59.
Pobiega, M., J. Wojkowska-Mach, A. Chmielarczyk, D. Romaniszyn, P. Adamski, P. B. Heczko, B. Gryglewska, and T.
Grodzicki, 2013, Molecular characterization and drug resistance of Escherichia coli strains isolated from
urine from long-term care facility residents in Cracow, Poland: Medical Science Monitor, v. 19, p. 317-326.
Poirel, L., A. Barbosa-Vasconcelos, R. R. Simoes, P. M. Da Costa, W. Liu, and P. Nordmann, 2012a, Environmental
KPC-producing Escherichia coli isolates in Portugal: Antimicrobial Agents and Chemotherapy, v. 56, p. 1662-
1663.
Poirel, L., R. A. Bonnin, and P. Nordmann, 2012b, Genetic Features of the widespread plasmid coding for the
carbapenemase OXA-48: Antimicrobial Agents and Chemotherapy, v. 56, p. 559-562.
Poirel, L., V. Cattoir, and P. Nordmann, 2008a, Is plasmid-mediated quinolone resistance a clinically significant
problem?: Clinical Microbiology and Infection, v. 14, p. 295-297.
Poirel, L., V. Cattoir, and P. Nordmann, 2012c, Plasmid-mediated quinolone resistance; interactions between
human, animal, and environmental ecologies: Frontiers in Microbiology, v. 3, p. 1-7.
Poirel, L., M. Gniadkowski, and P. Nordmann, 2002a, Biochemical analysis of the ceftazidime-hydrolysing extendedspectrum
β-lactamase CTX-M-15 and of its structurally related β-lactamase CTX-M-3: Journal of
Antimicrobial Chemotherapy, v. 50, p. 1031-1034.
Poirel, L., P. Kampfer, and P. Nordmann, 2002b, Chromosome-encoded Ambler class A β-lactamase of Kluyvera
georgiana, a probable progenitor of a subgroup of CTX-M extended-spectrum β-lactamases: Antimicrobial
Agents and Chemotherapy, v. 46, p. 4038-4040.
Poirel, L., T. Naas, and P. Nordmann, 2008b, Genetic support of extended-spectrum β-lactamases: Clinical
Microbiology and Infection, v. 14, p. 75-81.
Poirel, L., J. D. D. Pitout, L. Calvo, J. M. Rodriguez-Martinez, D. Church, and P. Nordmann, 2006, In vivo selection of
fluoroquinolone-resistant Escherichia coli isolates expressing plasmid-mediated quinolone resistance and
expanded-spectrum β-lactamase: Antimicrobial Agents and Chemotherapy, v. 50, p. 1525-1527.
Poirel, L., A. Potron, C. De La Cuesta, T. Cleary, P. Nordmann, and L. S. Munoz-Priceb, 2012d, Wild coastline birds as
reservoirs of broad-spectrum-β -lactamase-producing Enterobacteriaceae in Miami Beach, Florida:
Antimicrobial Agents and Chemotherapy, v. 56, p. 2756-2758.
Poirel, L., A. Potron, and P. Nordmann, 2012e, OXA-48-like carbapenemases: the phantom menace: Journal of
Antimicrobial Chemotherapy, v. 67, p. 1597-1606.
Poirel, L., J.-M. Rodriguez-Martinez, H. Mammeri, A. Liard, and P. Nordmann, 2005, Origin of plasmid-mediated
quinolone resistance determinant QnrA: Antimicrobial agents and chemotherapy, v. 49, p. 3523-5.
Poirel, L., R. Stephan, V. Perreten, and P. Nordmann, 2014, The carbapenemase threat in the animal world: the
wrong culprit: Journal of Antimicrobial Chemotherapy, v. 69, p. 2007-2008.
Pomba, C., J. D. da Fonseca, B. C. Baptista, J. D. Correia, and L. Martinez-Martinez, 2009, Detection of the pandemic
O25-ST131 human virulent Escherichia coli CTX-M-15-producing clone harboring the qnrB2 and aac(6 ')Ib-cr
genes in a dog: Antimicrobial Agents and Chemotherapy, v. 53, p. 327-328.
Pons, M. J., C. Gomes, and J. Ruiz, 2013, QnrVC, a new transferable Qnr-like family: Enfermedades Infecciosas Y
Microbiologia Clinica, v. 31, p. 191-192.
179
Popowska, M., and A. Krawczyk-Balska, 2013, Broad-host-range IncP-1 plasmids and their resistance potential:
Frontiers in Microbiology, v. 4, p. 1-8.
Porres-Osante, N., Y. Saenz, S. Somalo, and C. Torres, 2015, Characterization of beta-lactamases in faecal
Enterobacteriaceae recovered from healthy humans in Spain: Focusing on AmpC Polymorphisms: Microbial
Ecology, v. 70, p. 132-140.
Potron, A., P. Nordmann, E. Lafeuille, Z. Al Maskari, F. Al Rashdi, and L. Poirel, 2011, Characterization of OXA-181, a
Carbapenem-hydrolyzing class D β-lactamase from Klebsiella pneumoniae: Antimicrobial Agents and
Chemotherapy, v. 55, p. 4896-4899.
Potron, A., P. Nordmann, and L. Poirel, 2013, Characterization of OXA-204, a carbapenem-hydrolyzing class D βlactamase
from Klebsiella pneumoniae: Antimicrobial Agents and Chemotherapy, v. 57, p. 633-636.
Pourcher, A. M., A. Jadas-Hécart, P. Cotinet, P. Dabert, C. Ziebal, S. Le Roux, R. Moraru, D. Heddadj, I. Kempf, 2014,
Effect of land application of manure from enrofloxacin-treated chickens on ciprofloxacin resistance of
Enterobacteriaceae in soil: Science of the Total Environment, v. 482-483, p. 269-275.
Price, L. B., J. R. Johnson, M. Aziz, C. Clabots, B. Johnston, V. Tchesnokova, L. Nordstrom, M. Billig, S. Chattopadhyay,
M. Stegger, P. S. Andersen, T. Pearson, K. Riddell, P. Rogers, D. Scholes, B. Kahl, P. Keim, and E. V.
Sokurenko, 2013, The epidemic of extended-spectrum-β -lactamase-producing Escherichia coli ST131 Is
Driven by a Single Highly Pathogenic Subclone, H30-Rx: mBio, v. 4, p. 1-10.
Pérez-Vázquez, M., Oteo, J., García-Cobos, S., Aracil, B., Harris, S.R., Ortega, A., Fontanals, D., Hernández, J.M., Solís,
S., Campos, J., Dougan, G., Kingsley, R.A., 2016, Phylogeny, resistome and mobile genetic elements of
emergent OXA-48 and OXA-245 Klebsiella pneumoniae clones circulating in Spain., Journal of Antimicrobial
Chemotherapy, v. 71, p. 887-896.
Queenan, A. M., and K. Bush, 2007, Carbapenemases: the versatile β-lactamases: Clinical Microbiology Reviews, v.
20, p. 440-458.
Quesada, S. P., J. A. Rizzato Paschoal, and F. G. Reyes Reyes, 2013, Considerations on the aquaculture development
and on the use of veterinary drugs: Special issue for fluoroquinolones-a review: Journal of Food Science, v.
78, p. R1321-R1333.
Quiros, P., M. Colomer-Lluch, A. Martinez-Castillo, E. Miro, M. Argente, J. Jofre, F. Navarro, and M. Muniesa, 2014,
Antibiotic resistance genes in the bacteriophage DNA fraction of human fecal samples: Antimicrobial
Agents and Chemotherapy, v. 58, p. 606-609.
Rahman, M., G. Mauff, J. Levy, M. Couturier, G. Pulverer, N. Glasdorff, and J. P. Butzler, 1994, Detection of 4quinolone
resistance mutation in gyrA gene of Shigella dysenteriae Type-1 by PCR: Antimicrobial Agents
and Chemotherapy, v. 38, p. 2488-2491.
Randall, L. P., C. Clouting, R. A. Horton, N. G. Coldham, G. Wu, F. A. Clifton-Hadley, R. H. Davies, and C. J. Teale, 2011,
Prevalence of Escherichia coli carrying extended-spectrum β-lactamases (CTX-M and TEM-52) from broiler
chickens and turkeys in Great Britain between 2006 and 2009: Journal of Antimicrobial Chemotherapy, v.
66, p. 86-95.
Rasko, D. A., M. J. Rosovitz, G. S. A. Myers, E. F. Mongodin, W. F. Fricke, P. Gajer, J. Crabtree, M. Sebaihia, N. R.
Thomson, R. Chaudhuri, I. R. Henderson, V. Sperandio, and J. Ravel, 2008, The pangenome structure of
Escherichia coli: Comparative genomic analysis of E. coli commensal and pathogenic isolates: Journal of
Bacteriology, v. 190, p. 6881-6893.
Rawlings, D. E., 1999, Proteic toxin-antitoxin: bacterial plasmid addiction systems and their evolution with special
reference to the pas system of pTF-FC2: FEMS Microbiology Letters, v. 176, p. 269-277.
Recchia, G. D., and R. M. Hall, 1995, Plasmid evolution by acquisition of mobile gene cassettes - plasmid pIE723
contains the aadb gene cassette precisely inserted at a secondary site in the IncQ plasmid RSF1010:
Molecular Microbiology, v. 15, p. 179-187.
Reinthaler, F. F., G. Feierl, H. Galler, D. Haas, E. Leitner, F. Mascher, A. Melkes, J. Posch, I. Winter, G. Zarfel, and E.
Marth, 2010, ESBL-producing E. coli in Austrian sewage sludge: Water Research, v. 44, p. 1981-1985.
Reuland, E. A., T. Halaby, J. P. Hays, D. M. C. de Jongh, H. D. R. Snetselaar, M. van Keulen, P. J. M. Elders, P. H. M.
Savelkoul, C. M. J. E. Vandenbroucke-Grauls, and N. al Naiemi, 2015, Plasmid-mediated AmpC: prevalence
in community-acquired isolates in Amsterdam, the Netherlands, and risk factors for carriage: PLOS One, v.
10, p. 1-9.
Richards, H., and N. Datta, 1979, Reclassification of incompatibility group L (IncL) plasmids: Plasmid, v. 2, p. 293-
295.
Riesenfeld, C. S., R. M. Goodman, and J. Handelsman, 2004, Uncultured soil bacteria are a reservoir of new antibiotic
resistance genes: Environmental Microbiology, v. 6, p. 981-989.
180
Rizzo, L., C. Manaia, C. Merlin, T. Schwartz, C. Dagot, M. C. Ploy, I. Michael, and D. Fatta-Kassinos, 2013, Urban
wastewater treatment plants as hotspots for antibiotic resistant bacteria and genes spread into the
environment: A review: Science of the Total Environment, v. 447, p. 345-360.
Roberts, A. P., M. Chandler, P. Courvalin, G. Guedon, P. Mullany, T. Pembroke, J. I. Rood, C. J. Smith, A. O. Summers,
M. Tsuda, and D. E. Berg, 2008, Revised nomenclature for transposable genetic elements: Plasmid, v. 60,
p. 167-173.
Robicsek, A., J. Strahilevitz, G. A. Jacoby, M. Macielag, D. Abbanat, C. H. Park, K. Bush, and D. C. Hooper, 2006,
Fluoroquinolone-modifying enzyme: a new adaptation of a common aminoglycoside acetyltransferase:
Nature Medicine, v. 12, p. 83-88.
Robinson, A. A., J. B. Belden, and M. J. Lydy, 2005, Toxicity of fluoroquinolone antibiotics to aquatic organisms:
Environmental Toxicology and Chemistry, v. 24, p. 423-430.
Rodriguez, M. M., P. Power, M. Radice, C. Vay, A. Famiglietti, M. Galleni, J. A. Ayala, and G. Gutkind, 2004,
Chromosome-encoded CTX-M-3 from Kluyvera ascorbata: a possible origin of plasmid-borne CTX-M-1derived
cefotaximases: Antimicrobial Agents and Chemotherapy, v. 48, p. 4895-4897.
Rodriguez, M. M., P. Power, H. Sader, M. Galleni, and G. Gutkind, 2010, Novel chromosome-encoded CTX-M-78 βlactamase
from a Kluyvera georgiana Clinical isolate as a putative origin of CTX-M-25 subgroup:
Antimicrobial Agents and Chemotherapy, v. 54, p. 3070-3071.
Rodriguez-Bano, J., L. Lopez-Cerero, M. D. Navarro, P. Diaz de Alba, and A. Pascual, 2008, Faecal carriage of
extended-spectrum β-lactamase-producing Escherichia coli: prevalence, risk factors and molecular
epidemiology: Journal of Antimicrobial Chemotherapy, v. 62, p. 1142-1149.
Rodriguez-Martinez, J. M., M. Eliecer Cano, C. Velasco, L. Martinez-Martinez, and A. Pascual, 2011, Plasmidmediated
quinolone resistance: an update: Journal of Infection and Chemotherapy, v. 17, p. 149-182.
Rogers, B. A., H. E. Sidjabat, and D. L. Paterson, 2011, Escherichia coli O25b-ST131: a pandemic, multiresistant,
community-associated strain: Journal of Antimicrobial Chemotherapy, v. 66, p. 1-14.
Rodicio, R. M., A. Herrero, I. Rodriguez, P. Garcia, I. Montero, J. Beutlich, R. Rodicio, B. Guerra, and M. C. Mendoza,
2011, Acquisition of antimicrobial resistance determinants by virulence plasmids specific for nontyphoid
serovars of Salmonella enterica: Reviews in Medical Microbiology, v. 22, p. 55-65.
Rossolini, G. M., M. M. D'Andrea, and C. Mugnaioli, 2008, The spread of CTX-M-type extended-spectrum βlactamases:
Clinical Microbiology and Infection, v. 14, p. 33-41.
Rowe-Magnus, D. A., A. M. Guerout, L. Biskri, P. Bouige, and D. Mazel, 2003, Comparative analysis of superintegrons:
Engineering extensive genetic diversity in the Vibrionaceae: Genome Research, v. 13, p. 428-442.
Rowe-Magnus, D. A., A. M. Guerout, and D. Mazel, 2002, Bacterial resistance evolution by recruitment of superintegron
gene cassettes: Molecular Microbiology, v. 43, p. 1657-1669.
Rowe-Magnus, D. A., and D. Mazel, 1999, Resistance gene capture: Current Opinion in Microbiology, v. 2, p. 483-
488.
Rubin, J. E., and J. D. D. Pitout, 2014, Extended-spectrum β-lactamase, carbapenemase and AmpC producing
Enterobacteriaceae in companion animals: Veterinary Microbiology, v. 170, p. 10-18.
Ruiz, J., 2003, Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase
protection: Journal of Antimicrobial Chemotherapy, v. 51, p. 1109-1117.
Ruuskanen, M., J. Muurinen, A. Meierjohan, K. Pärnänen, M. Tamminen, C. Lyra, L. Kronberg, M. Virta, 2016,
Fertilizing with Animal Manure Disseminates Antibiotic Resistance Genes to the Farm Environment:
Journal of Environmental Quality, v. 45, p. 488-493.
Saenz, Y., M. Zarazaga, L. Brinas, F. Ruiz-Larrea, and C. Torres, 2003, Mutations in gyrA and parC genes in nalidixic
acid-resistant Escherichia coli strains from food products, humans and animals: Journal of Antimicrobial
Chemotherapy, v. 51, p. 1001-1005.
Saga, T., M. Kaku, Y. Onodera, S. Yamachika, K. Sato, and H. Takase, 2005, Vibrio parahaemolyticus chromosomal
qnr homologue VPA0095: Demonstration by transformation with a mutated gene of its potential to reduce
quinolone susceptibility in Escherichia coli: Antimicrobial Agents and Chemotherapy, v. 49, p. 2144-2145.
Saino, Y., F. Kobayashi, M. Inoue, and S. Mitsuhashi, 1982, Purification and properties of inducible penicillin βlactamase
isolated from Pseudomonas maltophilia: Antimicrobial Agents and Chemotherapy, v. 22, p. 564-
570.
Samuels, A. L., E. Lanka, and J. E. Davies, 2000, Conjugative junctions in RP4-mediated mating of Escherichia coli:
Journal of Bacteriology, v. 182, p. 2709-2715.
Sanchez, M. B., A. Hernandez, J. M. Rodriguez-Martinez, L. Martinez-Martinez, and J. L. Martinez, 2008, Predictive
analysis of transmissible quinolone resistance indicates Stenotrophomonas maltophilia as a potential
source of a novel family of Qnr determinants: BMC Microbiology, v. 8, p. 1-14.
181
Sarmah, A. K., M. T. Meyer, A. B. A. Boxall, 2006, A global perspective on the use, sales, exposure pathways,
occurrence, fate and effects of veterinary antibiotics (VAs) in the environment: Chemosphere, v. 65, p.
725–759.
Sarria, J. C., A. M. Vidal, R. C. Kimbrough, 2001, Infections caused by Kluyvera species in humans: Clinical Infectious
Diseases, v. 33, p. E69-74.
Seshasayee, A. S., P. Bertone, G. M. Fraser, N. M. Luscombe, 2006, Transcriptional regulatory networks in bacteria:
from input signals to output responses. Current Opinion in Microbiology, v. 9, p. 511-519. Current Opinion
in Microbiology, v. 9, p. 511-519.
Schijyen, J. F., H. Blaak, F. M. Schets, and A. M. d. R. Husman, 2015, Fate of extended-spectrum β-lactamaseproducing
Escherichia coli from faecal sources in surface water and probability of human exposure through
swimming: Environmental Science & Technology, v. 49, p. 11825-11833.
Schink, A.-K., K. Kadlec, H. Kaspar, J. Mankertz, and S. Schwarz, 2013, Analysis of extended-spectrum-β-lactamaseproducing
Escherichia coli isolates collected in the GERM-Vet monitoring programme: Journal of
Antimicrobial Chemotherapy, v. 68, p. 1741-1749.
Schmidt, M., P. Zheng, and N. Delihas, 1995, Secondary structures of Escherichia. coli antisense micF RNA, the 5'end
of the target ompF mRNA, and the RNA/RNA duplex: Biochemistry, v. 34, p. 3621-3631.
Schmiedel, J., L. Falgenhauer, E. Domann, R. Bauerfeind, E. Prenger-Berninghoff, C. Imirzalioglu, and T. Chakraborty,
2014, Multiresistant extended-spectrum β-lactamase-producing Enterobacteriaceae from humans,
companion animals and horses in central Hesse, Germany: BMC Microbiology, v. 14, p. 1-13.
Schwarz, S., and E. Chaslus-Dancla, 2001, Use of antimicrobials in veterinary medicine and mechanisms of
resistance: Veterinary Research, v. 32, p. 201-225.
Schwarz, S., C. Kehrenberg, and T. R. Walsh, 2001, Use of antimicrobial agents in veterinary medicine and food
animal production: International Journal of Antimicrobial Agents, v. 17, p. 431-437.
Seiffert, S. N., M. Hilty, V. Perreten, and A. Endimiani, 2013, Extended-spectrum cephalosporin-resistant gramnegative
organisms in livestock: An emerging problem for human health?: Drug Resistance Updates, v. 16,
p. 22-45.
Seitz, P., and M. Blokesch, 2013, Cues and regulatory pathways involved in natural competence and transformation
in pathogenic and environmental Gram-negative bacteria: FEMS Microbiology Reviews, v. 37, p. 336-363.
Shaheen, B. W., R. Nayak, and D. M. Boothe, 2013, Emergence of a New Delhi metallo-β-lactamase (NDM-1)encoding
gene in clinical Escherichia coli isolates recovered from companion animals in the United States:
Antimicrobial Agents and Chemotherapy, v. 57, p. 2902-2903.
Sheng, W.-H., R. E. Badal, P.-R. Hsueh, and S. Program, 2013, Distribution of extended-spectrum β-lactamases,
AmpC β-lactamases, and carbapenemases among Enterobacteriaceae isolates causing intra-abdominal
infections in the Asia-Pacific region: results of the study for monitoring antimicrobial resistance trends
(SMART): Antimicrobial Agents and Chemotherapy, v. 57, p. 2981-2988.
Shiraki, Y., N. Shibata, Y. H. Doi, and Y. Arakawa, 2004, Escherichia coli producing CTX-M-2 β-lactamase in cattle,
Japan: Emerging Infectious Diseases, v. 10, p. 69-75.
Shore, A. C., and D. C. Coleman, 2013, Staphylococcal cassette chromosome mec: Recent advances and new insights:
International Journal of Medical Microbiology, v. 303, p. 350-359.
Shousha, A., N. Awaiwanont, D. Sofka, F. J. M. Smulders, P. Paulsen, M. P. Szostak, T. Humphrey, and F. Hilbert,
2015, Bacteriophages isolated from chicken meat and the horizontal transfer of antimicrobial resistance
genes: Applied and Environmental Microbiology, v. 81, p. 4600-4606.
Sidjabat, H. E., K. Y. Seah, L. Coleman, A. Sartor, P. Derrington, C. Heney, J. Faoagali, G. R. Nimmo, and D. L. Paterson,
2014, Expansive spread of IncI1 plasmids carrying blaCMY-2 amongst Escherichia coli: International Journal
of Antimicrobial Agents, v. 44, p. 203-208.
Sidjabat, H. E., N. Townell, G. R. Nimmo, N. M. George, J. Robson, R. Vohra, L. Davis, C. Heney, and D. L. Paterson,
2015, Dominance of IMP-4-producing Enterobacter cloacae among carbapenemase-producing
Enterobacteriaceae in Australia: Antimicrobial Agents and Chemotherapy, v. 59, p. 4059-4066.
Siguier, P., J. Filee, and M. Chandler, 2006a, Insertion sequences in prokaryotic genomes: Current Opinion in
Microbiology, v. 9, p. 526-531.
Siguier, P., L. Gagnevin, and M. Chandler, 2009, The new IS1595 family, its relation to IS1 and the frontier between
insertion sequences and transposons: Research in Microbiology, v. 160, p. 232-241.
Siguier, P., E. Gourbeyre, and M. Chandler, 2014, Bacterial insertion sequences: their genomic impact and diversity:
FEMS Microbiology Reviews, v. 38, p. 865-891.
Siguier, P., E. Gourbeyre, A. Varani, B. Ton-Hoang, and M. Chandler, 2015, Everyman's guide to bacterial insertion
sequences: Microbiology Spectrum, v. 3, p.1-35.
182
Siguier, P., J. Perochon, L. Lestrade, J. Mahillon, and M. Chandler, 2006b, ISfinder: the reference centre for bacterial
insertion sequences: Nucleic Acids Research, v. 34, p. D32-D36.
Silver, S., 2003, Bacterial silver resistance: molecular biology and uses and misuses of silver compounds: Fems
Microbiology Reviews, v. 27, p. 341-353.
Silver, S., and L. T. Phung, 2005, A bacterial view of the periodic table: genes and proteins for toxic inorganic ions:
Journal of Industrial Microbiology and Biotechnology, v. 32, p. 587-605.
Smet, A., A. Martel, D. Persoons, J. Dewulf, M. Heyndrickx, L. Herman, F. Haesebrouck, and P. Butaye, 2010a, Broadspectrum
β-lactamases among Enterobacteriaceae of animal origin: molecular aspects, mobility and
impact on public health: FEMS Microbiology Reviews, v. 34, p. 295-316.
Smet, A., F. Van Nieuwerburgh, T. T. M. Vandekerckhove, A. Martel, D. Deforce, P. Butaye, and F. Haesebrouck,
2010b, Complete nucleotide sequence of CTX-M-15-plasmids from clinical Escherichia coli isolates:
Insertional events of transposons and insertion sequences: PLOS One, v. 5, p. 1-8.
Smillie, C., M. P. Garcillan-Barcia, M. Vi. Francia, E. P. C. Rocha, and F. de la Cruz, 2010, Mobility of plasmids:
Microbiology and Molecular Biology Reviews, v. 74, p. 434-452.
Snyder, L., and W. Champness, 2007, Molecular genetics of bacteria, 3rd Edition, Washington, D.C., ASM Press, 735
pp.
Sorensen, A. H., L. H. Hansen, E. Johannesen, and S. J. Sorensen, 2003, Conjugative plasmid conferring resistance to
olaquindox: Antimicrobial Agents and Chemotherapy, v. 47, p. 798-799.
Sougakoff, W., S. Goussard, and P. Courvalin, 1988, The TEM-3 β-lactamase, which hydrolyzes broad-spectrum
cephalosporins, is derived from the TEM-2 penicillinase by 2 amino-acid substitutions: FEMS Microbiology
Letters, v. 56, p. 343-348.
Sousa, M., C. Torres, J. Barros, S. Somalo, G. Igrejas, and P. Poeta, 2011, Gilthead seabream (Sparus aurata) as
carriers of SHV-12 and TEM-52 extended-spectrum beta-lactamases-containing Escherichia coli isolates:
Foodborne Pathogens and Disease, v. 8, p. 1139-1141.
Spratt, B. G., L. D. Bowler, Q. Y. Zhang, J. J. Zhou, and J. M. Smith, 1992, Role of interspecies transfer of chromosomal
genes in the evolution of penicillin resistance in pathogenic and commensal Neisseria species: Journal of
Molecular Evolution, v. 34, p. 115-125.
Stalder, G. L., I. Loncaric, and C. Walzer, 2014, Diversity of enterobacteria including β-lactamase producing isolates
associated with the Spanish slug (Anion vulgaris): Science of the Total Environment, v. 479, p. 11-16.
Stedt, J., J. Bonnedahl, J. Hernandez, J. Waldenstrom, B. J. McMahon, C. Tolf, B. Olsen, and M. Drobni, 2015, Carriage
of CTX-M type extended spectrum β-lactamases (ESBLs) in gulls across Europe: Acta Veterinaria
Scandinavica, v. 57, p. 1-8.
Stokes, H. W., and M. R. Gillings, 2011, Gene flow, mobile genetic elements and the recruitment of antibiotic
resistance genes into Gram-negative pathogens: FEMS Microbiology Reviews, v. 35, p. 790-819.
Stokes, H. W., and R. M. Hall, 1989, A novel family of potentially mobile DNA elements encoding site-specific geneintegration
functions: integrons: Molecular Microbiology, v. 3, p. 1669-1683.
Stolle, I., E. Prenger-Berninghoff, I. Stamm, S. Scheufen, E. Hassdenteufel, S. Guenther, A. Bethe, Y. Pfeifer, and C.
Ewers, 2013, Emergence of OXA-48 carbapenemase-producing Escherichia coli and Klebsiella pneumoniae
in dogs: Journal of Antimicrobial Chemotherapy, v. 68, p. 2802-2808.
Strahilevitz, J., G. A. Jacoby, D. C. Hooper, and A. Robicsek, 2009, Plasmid-mediated quinolone resistance: a
multifaceted threat: Clinical Microbiology Reviews, v. 22, p. 664-689.
Sukul, P., and M. Spiteller, 2007, Fluoroquinolone antibiotics in the environment: Reviews of Environmental
Contamination and Toxicology, Vol 191, v. 191, p. 131-162.
Sutterlin, S., P. Edquist, L. Sandegren, M. Adler, T. Tangden, M. Drobni, B. Olsen, and A. Melhus, 2014, Silver
resistance genes are overrepresented among Escherichia coli isolates with CTX-M production: Applied and
Environmental Microbiology, v. 80, p. 6863-6869.
Suzuki, H., T. Lefebure, P. P. Bitar, and M. J. Stanhope, 2012, Comparative genomic analysis of the genus
Staphylococcus including Staphylococcus aureus and its newly described sister species Staphylococcus
simiae: BMC Genomics, v. 13, p. 1-8.
Szmolka, A., D. Fortini, L. Villa, A. Carattoli, M. F. Anjum, and B. Nagy, 2011, First report on IncN plasmid-mediated
quinolone resistance gene qnrS1 in porcine Escherichia coli in Europe: Microbial Drug Resistance, v. 17, p.
567-573.
Tacao, M., A. Moura, A. Correia, and I. Henriques, 2014, Co-resistance to different classes of antibiotics among ESBLproducers
from aquatic systems: Water Research, v. 48, p. 100-107.
Tagg, K. A., A. N. Ginn, X. Jiang, J. Ellem, S. R. Partridge, and J. R. Iredell, 2015, Distribution of acquired AmpC βlactamase
genes in Sydney, Australia: Diagnostic Microbiology and Infectious Disease, v. 83, p. 56-58.
183
Talukdar, P. K., M. Rahman, M. Rahman, A. Nabi, Z. Islam, M. M. Hoque, H. P. Endtz, and M. A. Islam, 2013,
Antimicrobial resistance, virulence factors and genetic diversity of Escherichia coli isolates from household
water supply in Dhaka, Bangladesh: PLOS One, v. 8, p. 1-8.
Tamang, M. D., H.-M. Nam, M. Gurung, G.-C. Jang, S.-R. Kim, S.-C. Jung, Y. H. Park, and S.-K. Lim, 2013, Molecular
characterization of CTX-M β-lactamase and associated addiction systems in Escherichia coli circulating
among cattle, farm workers, and the farm environment: Applied and Environmental Microbiology, v. 79,
p. 3898-3905.
Tamang, M. D., H.-M. Nam, G.-C. Jang, S.-R. Kim, M. H. Chae, S.-C. Jung, J.-W. Byun, Y. H. Park, and S.-K. Lim, 2012,
Molecular characterization of extended-spectrum-β-lactamase-producing and plasmid-mediated AmpC βlactamase-producing
Escherichia coli isolated from stray dogs in South Korea: Antimicrobial Agents and
Chemotherapy, v. 56, p. 2705-2712.
Tamtam, F., F. Mercier, B. Le Bot, J. Eurin, Q. T. Dinh, M. Clement, and M. Chevreuil, 2008, Occurrence and fate of
antibiotics in the Seine River in various hydrological conditions: Science of the Total Environment, v. 393,
p. 84-95.
Tangden, T., O. Cars, A. Melhus, and E. Lowdin, 2010, Foreign Travel is a major risk factor for colonization with
Escherichia coli producing CTX-M-Type extended-spectrum β-lactamases: a prospective study with
Swedish volunteers: Antimicrobial Agents and Chemotherapy, v. 54, p. 3564-3568.
Tausova, D., M. Dolejska, A. Cizek, L. Hanusova, J. Hrusakova, O. Svoboda, G. Camlik, and I. Literak, 2012, Escherichia
coli with extended-spectrum β-lactamase and plasmid-mediated quinolone resistance genes in great
cormorants and mallards in Central Europe: Journal of Antimicrobial Chemotherapy, v. 67, p. 1103-1107.
Tavakoli, N., A. Comanducci, H. M. Dodd, M. C. Lett, B. Albiger, and P. Bennett, 2000, IS1294, a DNA element that
transposes by RC transposition: Plasmid, v. 44, p. 66-84.
Taylor, D. E., 2009, Thermosensitive nature of IncHI1 plasmid transfer: Antimicrobial Agents and Chemotherapy, v.
53, p. 2703-2703.
Taylor, D. E., J. C. Chumpitaz, and F. Goldstein, 1985, Variability of IncHI1 plasmids from Salmonella typhi with special
reference to Peruvian plasmids encoding resistance to trimethoprim and other antibiotics: Antimicrobial
Agents and Chemotherapy, v. 28, p. 452-455.
Taylor, D. E., and J. G. Levine, 1980, Studies of temperature-sensitive transfer and maintenance of H Incompatibility
group plasmids: Journal of General Microbiology, v. 116, p. 475-484.
Temkin, E., A. Adler, A. Lerner, and Y. Carmeli, 2014, Carbapenem-resistant Enterobacteriaceae: biology,
epidemiology, and management: Antimicrobial Therapeutics Reviews: Infectious Diseases of Current and
Emerging Concern, v. 1323, p. 22-42.
Tennstedt, T., R. Szczepanowski, S. Braun, A. Puhler, and A. Schluter, 2003, Occurrence of integron-associated
resistance gene cassettes located on antibiotic resistance plasmids isolated from a wastewater treatment
plant: FEMS Microbiology Ecology, v. 45, p. 239-252.
Teshager, T., L. Dominguez, M. A. Moreno, Y. Saenz, C. Torres, and S. Cardenosa, 2000, Isolation of an SHV-12 βlactamase-producing
Escherichia coli strain from a dog with recurrent urinary tract infections:
Antimicrobial Agents and Chemotherapy, v. 44, p. 3483-3484.
Tham, J., I. Odenholt, M. Walder, A. Brolund, J. Ahl, and E. Melander, 2010, Extended-spectrum β-lactamaseproducing
Escherichia coli in patients with travellers' diarrhoea: Scandinavian Journal of Infectious
Diseases, v. 42, p. 275-280.
Thisted, T., and K. Gerdes, 1992, Mechanism of post-segregational killing by the hok/sok system of plasmid R1: Sok
antisense RNA regulates hok gene expression indirectly through the overlapping mok gene: Journal of
Molecular Biology, v. 223, p. 41-54.
Thomas, C. M., and K. M. Nielsen, 2005, Mechanisms of, and barriers to, horizontal gene transfer between bacteria:
Nature Reviews Microbiology, v. 3, p. 711-721.
Tock, M. R., and D. T. F. Dryden, 2005, The biology of restriction and anti-restriction: Current Opinion in
Microbiology, v. 8, p. 466-472.
Toleman, M. A., and T. R. Walsh, 2011, Combinatorial events of insertion sequences and ICE in Gram-negative
bacteria: FEMS Microbiology Reviews, v. 35, p. 912-935.
Trott, D., 2013, βlactam resistance in Gram-negative pathogens isolated from animals: Current Pharmaceutical
Design, v. 19, p. 239-249.
Turner, S. M., A. Scott-Tucker, L. M. Cooper, and I. R. Henderson, 2006, Weapons of mass destruction: virulence
factors of the global killer Enterotoxigenic Escherichia coli: FEMS Microbiology Letters, v. 263, p. 10-20.
Turnidge, J., L. R. McCarthy, R. N. Master, and D. E. Kepner, 2003, Low levels of fluoroquinolone resistance in
Escherichia coli. A five-year trend in Australia measured through the use of TSN Database Australia:
Communicable Diseases Intelligence Quarterly Report, v. 27, Suppl, p. S89-91.
184
Unicomb, L. E., J. Ferguson, R. J. Stafford, R. Ashbolt, M. D. Kirk, N. G. Becker, M. S. Patel, G. L. Gilbert, M. Valcanis,
L. Mickan, for the Australian Campylobacter Subtyping Study Group , 2006, Low-level fluoroquinolone
resistance among Campylobacter jejuni isolates in Australia: Clinical Infectious Diseases, v. 42, p. 1368-
1374.
Valverde, A., R. Canton, M. Pilar Garcillan-Barcia, A. Novais, J. Carlos Galan, A. Alvarado, F. de la Cruz, F. Baquero,
and T. M. Coque, 2009, Spread of blaCTX-M-14 is driven mainly by IncK plasmids disseminated among
Escherichia coli phylogroups A, B1, and D in Spain: Antimicrobial Agents and Chemotherapy, v. 53, p. 5204-
5212.
Valverde, A., F. Grill, T. M. Coque, V. Pintado, F. Baquero, R. Canton, and J. Cobo, 2008, High rate of intestinal
colonization with extended-spectrum-β-lactamase-producing organisms in household contacts of infected
community patients: Journal of Clinical Microbiology, v. 46, p. 2796-2799.
van Belkum, A., 2007, Tracing isolates of bacterial species by multilocus variable number of tandem repeat analysis
(MLVA): FEMS Immunology and Medical Microbiology, v. 49, p. 22-27.
Veldman, K., L. M. Cavaco, D. Mevius, A. Battisti, A. Franco, N. Botteldoorn, M. Bruneau, A. Perrin-Guyomard, T.
Cerny, C. De Frutos Escobar, B. Guerra, A. Schroeter, M. Gutierrez, K. Hopkins, A.-L. Myllyniemi, M. Sunde,
D. Wasyl, and F. M. Aarestrup, 2011, International collaborative study on the occurrence of plasmidmediated
quinolone resistance in Salmonella enterica and Escherichia coli isolated from animals, humans,
food and the environment in 13 European countries: Journal of Antimicrobial Chemotherapy, v. 66, p.
1278-1286.
Veldman, K., P. van Tulden, A. Kant, J. Testerink, and D. Mevius, 2013, Characteristics of cefotaxime-resistant
Escherichia coli from wild birds in the Netherlands: Applied and Environmental Microbiology, v. 79, p. 7556-
7561.
Venter, J. C., K. Remington, J. F. Heidelberg, A. L. Halpern, D. Rusch, J. A. Eisen, D. Y. Wu, I. Paulsen, K. E. Nelson, W.
Nelson, D. E. Fouts, S. Levy, A. H. Knap, M. W. Lomas, K. Nealson, O. White, J. Peterson, J. Hoffman, R.
Parsons, H. Baden-Tillson, C. Pfannkoch, Y. H. Rogers, and H. O. Smith, 2004, Environmental genome
shotgun sequencing of the Sargasso Sea: Science, v. 304, p. 66-74.
Verdet, C., Y. Benzerara, V. Gautier, O. Adam, Z. Ould-Hocine, and G. Arlet, 2006, Emergence of DHA-1-producing
Klebsiella spp. in the Parisian region: Genetic organization of the ampC and ampR genes originating from
Morganella morganii: Antimicrobial Agents and Chemotherapy, v. 50, p. 607-617.
Vetting, M. W., S. S. Hegde, J. E. Fajardo, A. Fiser, S. L. Roderick, H. E. Takiff, and J. S. Blanchard, 2006, Pentapeptide
repeat proteins: Biochemistry, v. 45, p. 1-10.
Vignaroli, C., G. M. Luna, S. Pasquaroli, A. Di Cesare, R. Petruzzella, P. Paroncini, and F. Biavasco, 2013, Epidemic
Escherichia coli ST131 and Enterococcus faecium ST17 in coastal marine sediments from an Italian beach:
Environmental Science & Technology, v. 47, p. 13772-13780.
Vila, J., J. Ruiz, F. Marco, A. Barcelo, P. Goni, E. Giralt, and T. J. Deanta, 1994, Association between double mutation
in gyrA gene of ciprofloxacin-resistant clinical isolates of Escherichia coli and MICs: Antimicrobial Agents
and Chemotherapy, v. 38, p. 2477-2479.
Villa, L., A. Capone, D. Fortini, M. Dolejska, I. Rodríguez, F. Taglietti, P. De Paolis, N. Petrosillo, A. Carattoli,
2013b,Reversion to susceptibility of a carbapenem-resistant clinical isolate of Klebsiella pneumoniae
producing KPC-3: Journal of Antimicrobial Chemotherapy, v. 68, p. 2482-2486.
Villa, L., A. Carattoli, P. Nordmann, C. Carta, and L. Poirel, 2013a, Complete sequence of the IncT-type plasmid pTOXA-181
carrying the blaOXA-181 carbapenemase gene from Citrobacter freundii: Antimicrobial Agents and
Chemotherapy, v. 57, p. 1965-1967.
Villa, L., A. Garcia-Fernandez, D. Fortini, and A. Carattoli, 2010, Replicon sequence typing of IncF plasmids carrying
virulence and resistance determinants: Journal of Antimicrobial Chemotherapy, v. 65, p. 2518-2529.
Vincent, C., P. Boerlin, D. Daignault, C. M. Dozois, L. Dutil, C. Galanakis, R. J. Reid-Smith, P.-P. Tellier, P. A. Tellis, K.
Ziebell, and A. R. Manges, 2010, Food Reservoir for Escherichia coli Causing Urinary Tract Infections:
Emerging Infectious Diseases, v. 16, p. 88-95.
Vo, A. T. T., E. van Duijkeren, A. C. Fluit, and W. Gaastra, 2007, Characteristics of extended-spectrum cephalosporinresistant
Escherichia coli and Klebsiella pneumoniae isolates from horses: Veterinary Microbiology, v. 124,
p. 248-255.
Voets, G. M., T. N. Platteel, A. C. Fluit, J. Scharringa, C. M. Schapendonk, J. C. Stuart, M. J. M. Bonten, M. A.
Leverstein-van Hal, and E. S. W. G. Natl, 2012, Population distribution of beta-lactamase conferring
resistance to third-generation cephalosporins in human clinical Enterobacteriaceae in the Netherlands:
PLOS One, v. 7, p. 1-6.
185
Voulgari, E., O. Zarkotou, K. Ranellou, D. E. Karageorgopoulos, G. Vrioni, V. Mamali, K. Themeli-Digalaki, and A.
Tsakris, 2013, Outbreak of OXA-48 carbapenemase-producing Klebsiella pneumoniae in Greece involving
an ST11 clone: Journal of Antimicrobial Chemotherapy, v. 68, p. 84-88.
Waldor, M. K., H. Tschape, and J. J. Mekalanos, 1996, A new type of conjugative transposon encodes resistance to
sulfamethoxazole, trimethoprim, and streptomycin in Vibrio cholerae O139: Journal of Bacteriology, v. 178,
p. 4157-4165.
Wales, A. D., M. J. Woodward, and G. R. Pearson, 2005, Attaching-effacing bacteria in animals: Journal of
Comparative Pathology, v. 132, p. 1-26.
Walker, R. I., D. Steele, T. Aguado, and E. T. E. C. Ad Hoc, 2007, Analysis of strategies to successfully vaccinate infants
in developing countries against enterotoxigenic E. coli (ETEC) disease: Vaccine, v. 25, p. 2545-2566.
Walsh, T. R., M. A. Toleman, L. Poirel, and P. Nordmann, 2005, Metallo-β-lactamases: the quiet before the storm?:
Clinical Microbiology Reviews, v. 18, p. 306-325.
Walsh, T. R., J. Weeks, D. M. Livermore, and M. A. Toleman, 2011, Dissemination of NDM-1 positive bacteria in the
New Delhi environment and its implications for human health: an environmental point prevalence study:
Lancet Infectious Diseases, v. 11, p. 355-362.
Walther-Rasmussen, J., and N. Hoiby, 2006, OXA-type carbapenemases: Journal of Antimicrobial Chemotherapy, v.
57, p. 373-383.
Wang, J., R. Stephan, K. Power, Q. Yan, H. Haechler, and S. Fanning, 2014, Nucleotide sequences of 16 transmissible
plasmids identified in nine multidrug-resistant Escherichia coli isolates expressing an ESBL phenotype
isolated from food-producing animals and healthy humans: Journal of Antimicrobial Chemotherapy, v. 69,
p. 2658-2668.
Wang, L., Y. Oda, S. Grewal, M. Morrison, F. C. Michel, Jr., and Z. Yu, 2012, Persistence of resistance to erythromycin
and tetracycline in swine manure during simulated composting and lagoon treatments: Microbial Ecology,
v. 63, p. 32-40.
Wang, M., Q. Guo, X. Xu, X. Wang, X. Ye, S. Wu, D. C. Hooper, and M. Wang, 2009a, New plasmid-mediated
quinolone resistance gene, qnrC, found in a clinical isolate of Proteus mirabilis: Antimicrobial Agents and
Chemotherapy, v. 53, p. 1892-1897.
Wang, M., G. A. Jacoby, D. M. Mills, and D. C. Hooper, 2009b, SOS regulation of qnrB expression: Antimicrobial
Agents and Chemotherapy, v. 53, p. 821-823.
Wasyl, D., A. Hoszowski, and M. Zajac, 2014, Prevalence and characterisation of quinolone resistance mechanisms
in Salmonella spp: Veterinary Microbiology, v. 171, p. 307-314.
Weese, J. S., J. M. Blondeau, D. Boothe, E. B. Breitschwerdt, L. Guardabassi, A. Hillier, D. H. Lloyd, M. G. Papich, S. C.
Rankin, J. D. Turnidge, and J. E. Sykes, 2011, Antimicrobial use guidelines for treatment of urinary tract
disease in dogs and cats: Antimicrobial guidelines working group of the international society for companion
animal infectious diseases: Veterinary Medicine International, v. 2011, p. 263768, 1-9.
Wegener, H. C., F. M. Aarestrup, L. B. Jensen, A. M. Hammerum, and F. Bager, 1999, Use of antimicrobial growth
promoters in food animals and Enterococcus faecium resistance to therapeutic antimicrobial drugs in
Europe: Emerging Infectious Diseases, v. 5, p. 329-335.
Whelan, K. F., E. Colleran, and D. E. Taylor, 1995, Phage inhibition, colicin resistance, and tellurite resistance are
encoded by a single cluster of genes on the IncHI2 plasmid R478: Journal of Bacteriology, v. 177, p. 5016-
5027.
Whiteley, M., and D. E. Taylor, 1983, Identification of DNA homologies among H-Incompatibility group plasmids by
restriction enzyme digestion and Southern transfer hybridization: Antimicrobial Agents and
Chemotherapy, v. 24, p. 194-200.
WHO, 2003, Impact of antimicrobial growth promoter termination in Denmark: WHO international panel's
evaluation of the termination of the use of antimicrobial growth promoters in Denmark., World Health
Organization, 57 pp.
WHO, 2012, Critically important antimicrobials for human medicine, Geneva, Switzerland, World Health
Organization, 32 pp.
Williams, P. A., and K. Murray, 1974, Metabolism of benzoate and methylbenzoates by Pseudomonas putida (arvilla)
mt-2: Evidence for existence of a TOL plasmid: Journal of Bacteriology, v. 120, p. 416-423.
Wirth, T., D. Falush, R. T. Lan, F. Colles, P. Mensa, L. H. Wieler, H. Karch, P. R. Reeves, M. C. J. Maiden, H. Ochman,
and M. Achtman, 2006, Sex and virulence in Escherichia coli: an evolutionary perspective: Molecular
Microbiology, v. 60, p. 1136-1151.
Woodford, N., A. Carattoli, E. Karisik, A. Underwood, M. J. Ellington, and D. M. Livermore, 2009, Complete nucleotide
sequences of plasmids pEK204, pEK499, and pEK516, encoding CTX-M enzymes in three major Escherichia
186
coli lineages from the United Kingdom, all belonging to the international O25:H4-ST131 clone:
Antimicrobial Agents and Chemotherapy, v. 53, p. 4472-4482.
Woodford, N., J. F. Turton, and D. M. Livermore, 2011, Multiresistant Gram-negative bacteria: the role of high-risk
clones in the dissemination of antibiotic resistance: FEMS Microbiology Reviews, v. 35, p. 736-755.
Wozniak, R. A. F., and M. K. Waldor, 2010, Integrative and conjugative elements: mosaic mobile genetic elements
enabling dynamic lateral gene flow: Nature Reviews Microbiology, v. 8, p. 552-563.
Wu, T.-L., J.-H. Chia, L.-H. Su, C.-H. Chiu, A.-J. Kuo, L. Ma, and L. K. Siu, 2007, CMY-2 β-lactamase-carrying communityacquired
urinary tract Escherichia coli: genetic correlation with Salmonella enterica serotypes Choleraesuis
and Typhimurium: International Journal of Antimicrobial Agents, v. 29, p. 410-416.
Xiao, W., S. Zhang, Q. Zhao, Y. Wang, Y. Lai, Z. Li, and X. Cui, 2013, Diversity and heavy-metal tolerance of bacteria
isolated from Gejiu tin mining area of Yunnan: Weishengwu Xuebao, v. 53, p. 1158-1165.
Yagi, T., J. Wachino, H. Kurokawa, S. Suzuki, K. Yamane, Y. Doi, N. Shibata, H. Kato, K. Shibayama, and Y. Arakawa,
2005, Practical methods using boronic acid compounds for identification of class C β-lactamase-producing
Klebsiella pneumoniae and Escherichia coli: Journal of Clinical Microbiology, v. 43, p. 2551-2558.
Yamane, K., J.-I. Wachino, S. Suzuki, K. Kimura, N. Shibata, H. Kato, K. Shibayama, T. Konda, and Y. Arakawa, 2007,
New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate:
Antimicrobial Agents and Chemotherapy, v. 51, p. 3354-3360.
Yang, Q.-E., J. Sun, L. Li, H. Deng, B.-T. Liu, L.-X. Fang, X.-P. Liao, and Y.-H. Lu, 2015, IncF plasmid diversity in multidrug
resistant Escherichia coli strains from animals in China: Frontiers in Microbiology, v. 6, p. 1-9.
Yong, D., M. A. Toleman, C. G. Giske, H. S. Cho, K. Sundman, K. Lee, and T. R. Walsh, 2009, Characterization of a new
metallo-β-lactamase gene, blaNDM-1, and a novel erythromycin esterase gene carried on a unique genetic
structure in Klebsiella pneumoniae sequence type 14 from India: Antimicrobial Agents and Chemotherapy,
v. 53, p. 5046-5054.
Zakharova, I. B., and D. V. Viktorov, 2015, Integrative conjugative elements (ICEs) of microorganisms: Molecular
Genetics Microbiology and Virology, v. 30, p. 114-123.
Zhang, H., Y. Zhou, S. Guo, and W. Chang, 2015, Multidrug resistance found in extended-spectrum beta-lactamaseproducing
Enterobacteriaceae from rural water reservoirs in Guantao, China: Frontiers in Microbiology, v.
6, p. 1-4.
Zhao, W.-H., and Z.-Q. Hu, 2011a, Epidemiology and genetics of VIM-type metallo-β-lactamases in Gram-negative
bacilli: Future Microbiology, v. 6, p. 317-333.
Zhao, W.-H., and Z.-Q. Hu, 2011b, IMP-type metallo-β-lactamases in Gram-negative bacilli: distribution, phylogeny,
and association with integrons: Critical Reviews in Microbiology, v. 37, p. 214-226.
Zhao, W.-H., and Z.-Q. Hu, 2013, Epidemiology and genetics of CTX-M extended-spectrum β-lactamases in Gramnegative
bacteria: Critical Reviews in Microbiology, v. 39, p. 79-101.
Zhao, X. L., C. Xu, J. Domagala, and K. Drlica, 1997, DNA topoisomerase targets of the fluoroquinolones: A strategy
for avoiding bacterial resistance: Proceedings of the National Academy of Sciences of the United States of
America, v. 94, p. 13991-13996.
Zinder, N. D., 1955, Bacterial transduction: Journal of Cellular and Comparative Physiology, v. 45, p. 23-49.
Zong, Z., A. N. Ginn, H. Dobiasova, J. R. Iredell, and S. R. Partridge, 2015, Different IncI1 plasmids from Escherichia
coli carry ISEcp1-blaCTX-M-15 associated with different Tn2-derived elements: Plasmid, v. 80, p. 118-126.
Zong, Z., and R. Yu, 2010, Escherichia coli carrying the blaCTX-M-15 gene of ST648: Journal of Medical Microbiology, v.
59, p. 1536-1537.
Zurfluh, K., M. T. Nuesch-Inderbinen, L. Poirel, P. Nordmann, H. Haechler, and R. Stephan, 2015, Emergence of
Escherichia coli producing OXA-48 β-lactamase in the community in Switzerland: Antimicrobial Resistance
and Infection Control, v. 4, p. 1-3.
Zurfluh, K., J. Wang, J. Klumpp, M. Nueesch-Inderbinen, S. Fanning, and R. Stephan, 2014, Vertical transmission of
highly similar blaCTX-M-1-harboring Incl1 plasmids in Escherichia coli with different MLST types in the poultry
production pyramid: Frontiers in Microbiology, v. 5, p. 1-7.
187
Internetové zdroje
AGAR, Australian Group on Antimicrobial Resistance. The evolution of carbapenemases in Enterobacteriaceae in
Australia.
URL: http://www.agargroup.org/files/AGAR _Carbapenemase_evolution%20Final.pdf
EARS-Net, Antimicrobial resistance interactive database
URL:http://ecdc.europa.eu/
ICEberg, ICEberg: a web-based resource for integrative and conjugative elements found in Bacteria
URL: http://db-mml.sjtu.edu.cn/ICEberg/
INTEGRALL, The integron database
URL: http://integrall.bio.ua.pt/
IS Finder
URL: https://www-is.biotoul.fr/
PlasmidFinder
URL: https://cge.cbs.dtu.dk/services/PlasmidFinder/
Plasmid MLST Dababase
URL: http://pubmlst.org/plasmid/
qnr numbering and sequence
URL: http://www.lahey.org/qnrstudies/
188
Přílohy
1. DOLEJSKÁ, M., BIEROŠOVÁ, B., KOHOUTOVÁ, L., LITERÁK, I., ČÍŽEK A., 2009, Antibiotic resistant
Salmonella and Escherichia coli isolates with integrons and extended-spectrum betalactamases
in surface water and sympatric black-headed gulls: Journal of Applied Microbiology, v. 106, p.
1941-1950.
2. LITERAK, I., DOLEJSKA, M., CIZEK, A., DJIGO, C. A. T., KONECNY, A., KOUBEK, P., 2009, Reservoirs
of antibiotic-resistant Enterobacteriaceae among animals sympatric to humans in Senegal:
extended-spectrum beta-lactamases in bacteria in a black rat (Rattus rattus): African Journal of
Microbiology Research, v. 11, p. 751-754.
3. LITERAK, I., DOLEJSKA, M., RADIMERSKY, T., KLIMES, J., FRIEDMAN, M., AARESTRUP, F. M.,
HASMAN, H., CIZEK, A., 2010, Antimicrobial-resistant faecal Escherichia coli in wild mammals in
central Europe: multiresistant Escherichia coli producing extended-spectrum beta-lactamases in
wild boars: Journal of Applied Microbiology, v. 108, p. 1702-1711.
4. LITERAK, I., DOLEJSKA, M., JANOSZOWSKA, D., HRUSAKOVA, J., WLODZIMIERZ, M., RZYSKA, H.,
BZOMA, S., CIZEK, A., 2010, Antibiotic-resistant Escherichia coli bacteria, including strains with
genes encoding the extended-spectrum beta-lactamase and QnrS, in waterbirds on the Baltic Sea
coast of Poland: Applied and Environmental Microbiology, v. 76, p. 8126-8134.
5. DOLEJSKA, M., DUSKOVA, E., RYBARIKOVA, J., JANOSZOWSKA, D., ROUBALOVA, E., DIBDAKOVA,
K., MASECKOVA, G., KOHOUTOVA, L., LITERAK, I., SMOLA, J., CIZEK, A., 2011, Plasmids carrying
blaCTX-M-1 and qnr genes in Escherichia coli isolates from equine clinic and horseback riding centre:
Journal of Antimicrobial Chemotherapy, v. 66, p. 757-764.
6. DOLEJSKA, M., JURCICKOVA, Z., LITERAK, I., POKLUDOVA, L., BURES, J., HERA, A., KOHOUTOVA, L.,
SMOLA, J., CIZEK, A., 2011, IncN plasmids carrying blaCTX-M-1 in Escherichia coli isolateson a dairy
farm: Veterinary Microbiology, v. 149, p. 513-516.
7. LITERAK, I., PETRO, R., DOLEJSKA, M., GRUBEROVA, E., DOBIASOVA, H., PETR, J., CIZEK, A., 2011,
Antimicrobial resistance in fecal Escherichia coli isolates from healthy urban children of two age
categories with a view to their antibiotic therapy: Antimicrobial Agents and Chemotherapy, v. 55,
p. 3005-3007.
8. DOLEJSKA , M., MATULOVA, M., KOHOUTOVA, L., LITERAK, I., BARDON, J., CIZEK, A. (2011)
Extended-spectrum beta-lactamase-producing Escherichia coli in turkey meat production flocks
in the Czech Republic: National survey reveals widespread isolates with blaSHV-12 genes on IncFII
plasmids: Letters in Applied Microbiology, v. 53, 271-277.
9. DOLEJSKA, M., FLOREK, M., FLORKOVA, P., JAMBOROVA, I., PURGERTOVA, M., KUTILOVA, I.,
CIZEK, A., GUENTHER, S., LITERAK, I., 2011, CTX-M-15-producing Escherichia coli clone B2-O25bST131
and Klebsiella spp. isolates in municipal wastewater treatment plant effluents: Journal of
Antimicrobial Chemotherapy, v. 66, p. 2784-2790.
10. TAUSOVA, D., DOLEJSKA, M., CIZEK, A., HANUSOVA, L., HRUSAKOVA, J., SVOBODA, O., CAMLIK,
G., LITERAK, I., 2012, Escherichia coli with extended-spectrum β-lactamase and plasmid mediated
quinolone resistance genes in great cormorants and mallards in Central Europe: Journal of
Antimicrobial Chemotherapy, v. 67, p. 1103-1107.
11. ALBRECHTOVA, K., DOLEJSKA, M., CIZEK, A., TAUSOVA, D., KLIMES, J., BEBORA, L., LITERAK, I.,
2012, Dogs of nomadic pastoralists in northern Kenya are reservoirs of plasmid-mediated
cephalosporin- and quinolone-resistant Escherichia coli, including pandemic clone B2-O25ST131:
Antimicrobial Agents and Chemotherapy, v. 56, p. 4013-4017.
12. DOLEJSKA, M., BRHELOVA, E., DOBIASOVA, H., KRIVDOVA, J., JURANKOVA J., SEVCIKOVA, A.,
DUBSKA, L., LITERAK, I., CIZEK, A., VAVRINA, M., KUTNIKOVA, L., STERBA, J. (2012) Dissemination
of IncFIIK-type plasmids in multiresistant CTX-M-15-producing Enterobacteriaceae isolates from
children in hospital paediatric oncology wards: International Journal of Antimicrobial Agents, v.
40, p. 510-515.
189
13. LITERAK, I., MICUDOVA, M., TAUSOVA, D., CIZEK, A., DOLEJSKA, M., PAPOUSEK, I., PROCHAZKA,
J., VOJTECH, J., BORLEIS, F., GUARDONE, L., GUENTHER, S., HORDOWSKI, J., LEJAS, C., MEISSNER,
W., MARCOS, BF., TUCAKOV, M., 2012, Plasmid-mediated quinolone resistance genes in fecal
bacteria from rooks commonly wintering throughout Europe: Microbial Drug Resistance, v. 18,
p. 567-573.
14. DOLEJSKA, M., VILLA, L., HASMAN, H., HANSEN, L., CARATTOLI, A., 2013, Characterization of IncN
plasmids carrying blaCTX-M-1 and qnr genes in Escherichia coli and Salmonella from animals,
environment and humans: Journal of Antimicrobial Chemotherapy, v. 68, p. 333-339.
15. DOLEJSKA, M., VILLA, L., POIREL, L., NORDMANN, P., CARATTOLI, A., 2013, Complete sequencing
of an IncHI1 plasmid encoding the carbapenemase NDM-1, the ArmA 16S RNA methylase and a
resistance-nodulation-cell division/multidrug efflux pump: Journal of Antimicrobial
Chemotherapy v. 68, p. 34-39.
16. LITERAK, I., REITSCHMIED, T., BUJNAKOVA, D., DOLEJSKA, M., CIZEK, A., BARDON, J., POKLUDOVA,
L., ALEXA, P., HALOVA, D., JAMBOROVA, I., 2013, Broilers as a source of quinolone-resistant and
extraintestinal pathogenic Escherichia coli in the Czech Republic: Microbial Drug Resistance, v.
19, p. 57-63.
17. DOLEJSKA, M., VILLA, L., DOBIASOVA, H., FORTINI, D., FEUDI, C., CARATTOLI, A., 2013, Plasmid
content of a clinically relevant Klebsiella pneumoniae clone from the Czech Republic, producing
CTX-M-15 and QnrB1: Antimicrobial Agents and Chemotherapy, v. 57, p. 1073-1076.
18. KLIMES, J., MACHALKOVA, M., DOLEJSKA, M., CIZEK, A., JANOSZOWSKA, D., ALEXA, P.,
ALBRECHTOVA, K., VOJTECH, J., LITERAK, I., 2013, Escherichia coli-producing extended-spectrum
beta-lactamases CTX-M-15 in a captive South American tapir (Tapirus terrestris): Journal of Zoo
and Wildlife Medicine, v. 44, p. 173-175.
19. ACCOGLI, M., FORTINI, D., GIUFRÈ, M., GRAZIANI, C., DOLEJSKA, M., CARATTOLI, A., CERQUETTI,
M., 2013, IncI1 plasmids associated with the spread of CMY-2, CTX-M-1 and SHV-12 in Escherichia
coli of animal and human origin: Clinical Microbiology and Infection, v. 19, p. E238-240.
20. DOBIASOVA, H., DOLEJSKA, M., JAMBOROVA, I., BRHELOVA, E., BLAZKOVA, L., PAPOUSEK, I.,
KOZLOVA, M., KLIMES, J., CIZEK, A., LITERAK, I., 2013, Extended spektrum beta-lactamase and
fluoroquinolone resistance genes and plasmids among Escherichia coli isolates from zoo animals,
Czech Republic: FEMS Microbiology Ecology, v. 85, p. 604-611.
21. VILLA, L., CAPONE, A., FORTINI, D., DOLEJSKA, M., RODRÍGUEZ, I., TAGLIETTI, F., DE PAOLIS, P.,
PETROSILLO, N., CARATTOLI, A., 2013, Reversion to susceptibility of a carbapenem resistant
clinical isolate of Klebsiella pneumoniae producing KPC-3: Journal of Antimicrobial
Chemotherapy, v. 68, p. 2482-2486.
22. ALBRECHTOVA, K., PAPOUSEK, I., DE NYS, H., PAULY, M., ANOH, E., MOSSOUN, A., DOLEJSKA, M.,
MASARIKOVA, M., METZGER, S., COUACY-HYMANN, E., AKOUA-KOFFI, C., WITTIG, R. M., KLIMES,
J., CIZEK, A., LEENDERTZ, F. H., LITERAK, I., 2014, Low rates of antimicrobial-resistant
Enterobacteriaceae in wildlife in Taï National Park, Côte d'Ivoire, surrounded by villages with high
prevalence of multiresistant ESBL-producing Escherichia coli in people and domestic animals:
PLOS One, v. 9, e113548.
23. JANATOVA, M., ALBRECHTOVA, K., PETRZELKOVA, K. J., DOLEJSKA, M., PAPOUSEK, I.,
MASARIKOVA, M., CIZEK, A., TODD, A., SHUTT, K., KALOUSOVA, B., PROFOUSOVA, I., MODRY, D.,
LITERAK, I., 2014, Antimicrobial-resistant Enterobacteriaceae from humans and wildlife in
Dzanga-Sangha Protected Area, Central African Republic: Veterinary Microbiology, v. 171, p. 422-
431.
24. DOLEJSKA, M., VILLA, L., MINOIA, M., GUARDABASSI, L., CARATTOLI, A., 2014, Complete
sequences of IncHI1 plasmids carrying blaCTX-M-1 and qnrS1 in equine Escherichia coli provide new
insights into plasmid evolution: Journal of Antimicrobial Chemotherapy, v. 69, p. 2388-2393.
25. ALBRECHTOVA, K., KUBELOVA, M., MAZANCOVA, J., DOLEJSKA, M., LITERAK, I., CIZEK, A., 2014,
High prevalence and variability of CTX-M-15-producing and fluoroquinolone resistant Escherichia
coli observed in stray dogs in rural Angola: Microbial Drug Resistance, v. 20, p. 372-375.
190
26. JAMBOROVA, I., DOLEJSKA, M., VOJTECH, J., GUENTHER, S., URICARIU, R., DROZDOWSKA, J.,
PAPOUSEK, I., PASEKOVA, K., MEISSNER, W., HORDOWSKI, J., CIZEK, A., LITERAK, I., 2015, Plasmidmediated
resistance to cephalosporins and fluoroquinolones in various Escherichia coli sequence
types isolated from rooks wintering in Europe: Applied and Environmental Microbiology, v. 81, p.
648-657.
27. STUDENTOVA, V., DOBIASOVA, H., HEDLOVA, D., DOLEJSKA, M., PAPAGIANNITSIS, C. C., HRABAK,
J., 2015, Complete nucleotide sequence of two NDM-1-encoding plasmids characterized from
the same Sequence type 11 Klebsiella pneumoniae: Antimicrobial Agents Chemotherapy, v. 59,
p. 1325-1358.
28. PAPAGIANNITSIS C. C., DOLEJSKA, M., IZDEBSKI, R., DOBIASOVA H., STUDENTOVA, V., ESTEVES, F.
J., DERDE, L. P. G., BONTEN, M.J.M., HRABAK, J., GNIADKOWSKI, M., 2015, Characterization of
pKP-M1144, a novel ColE1-like plasmid encoding IMP-8, GES-5, and BEL-1 ß-lactamases, from a
Klebsiella pneumoniae sequence type 252 isolate: Antimicrobial Agents and Chemotherapy, v.
59, p. 5065-5068.
29. DOBIASOVA, H., VIDENSKA, P., DOLEJSKA, M., 2015, Complete sequences of IncU plasmids
harboring quinolone resistance genes qnrS2 and aac(6')-Ib-cr in Aeromonas spp. from
ornamental fish: Antimicrobial Agents and Chemotherapy, v. 60, p. 653-657.
30. DOLEJSKA, M., MASARIKOVA, M., DOBIASOVA, H., JAMBOROVA, I., KARPISKOVA, R., HAVLICEK,
M., CARLILE, N., PRIDDEL, D., CIZEK, A., LITERAK, I., 2016, High prevalence of Salmonella and IMP-
4-producing Enterobacteriaceae in the silver gull on Five Islands, Australia: Journal of
Antimicrobial Chemotherapy, v. 71, p. 63-70.
31. MASARIKOVA, M., MANGA, I., CIZEK, A., DOLEJSKA, M., ORAVCOVA, V., MYSKOVA, P.,
KARPISKOVA, R., LITERAK, I., 2016, Salmonella enterica resistant to antimicrobials in wastewater
effluents and black-headed gulls in the Czech Republic: Science of the Total Environment, v. 542,
p. 102-107.
32. PAPAGIANNITSIS, C. C., DOLEJSKA, M., IZDEBSKI, R., GIAKKOUPI, P., SKÁLOVÁ, A., CHUDĚJOVÁ, K.,
DOBIASOVA, H., VATOPOULOS, A. C., DERDE, L.P., BONTEN, M.J., GNIADKOWSKI, M., HRABÁK, J.,
2016, Characterisation of IncA/C2 plasmids carrying an In416-like integron with the blaVIM-19 gene
from Klebsiella pneumoniae ST383 of Greek origin: International Journal of Antimicrobial Agents,
v. 47, p. 158-162.
33. DOBIASOVA, H., KUTILOVA, I., PIACKOVA, V., VESELY, T., CIZEK, A., DOLEJSKA, M., 2014,
Ornamental fish as a source of plasmid-mediated quinolone resistance genes and antibiotic
resistance plasmids: Veterinary Microbiology, v. 171, p. 413-421.
34. DOBIASOVA, H., DOLEJSKA, M., 2016, Prevalence and diversity of IncX plasmids carrying
fluoroquinolone and β-lactam resistance genes in Escherichia coli originating from diverse
sources and geographical areas: Journal of Antimicrobial Chemotherapy, v tisku.
Příloha 1
DOLEJSKÁ, M., BIEROŠOVÁ, B., KOHOUTOVÁ, L., LITERÁK, I., ČÍŽEK A., 2009, Antibiotic resistant
Salmonella and Escherichia coli isolates with integrons and extended-spectrum beta-lactamases
in surface water and sympatric black-headed gulls: Journal of Applied Microbiology, v. 106, p.
1941-1950.
Souhrn
V této studii byly vzorky kloakálních výtěrů mláďat racků chechtavých hnízdících na vodním díle Nové Mlýny a
vzorky vody vyšetřeny na přítomnost rezistentních izolátů E. coli a salmonel. Salmonely byly zjištěny v 16 %
vzorků vody a u 24 % racků. E. coli s produkcí ESBL (CTX-M-1, CTX-M-15, SHV-2, SHV-12) byly identifikovány
pouze ve vzorcích z racků. Studie dokumentuje významnou kontaminaci povrchové vody salmonelami a
rezistentními kmeny E. coli. Rackové představují rezervoáry rezistentních kmenů včetně producentů ESBL.
ORIGINAL ARTICLE
Antibiotic-resistant Salmonella and Escherichia coli isolates
with integrons and extended-spectrum beta-lactamases in
surface water and sympatric black-headed gulls
M. Dolejska´1
, B. Bierosˇova´1
, L. Kohoutova´2
, I. Litera´k1
and A. Cˇ ı´zˇek2
1 Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences,
Brno, Czech Republic
2 Department of Microbiology and Immunology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences, Brno,
Czech Republic
Introduction
Increased introduction of antimicrobial agents into the
environment via medical therapy, agriculture and
animal husbandry has resulted in selective pressures on
bacterial populations (Schwarz and Chaslus-Dancla
2001). The increase in the number of resistant and
multiresistant (resistant to two and more antimicrobials)
strains of bacteria is a major concern of health
officials worldwide. Recently, bacterial resistance arising
through the production of extended-spectrum betalactamases
(ESBL) has been recognized as a worldwide
therapeutic problem (Bush 2008; Canto´n et al. 2008;
Hawkey 2008).
Keywords
antibiotics, Escherichia coli, extendedspectrum
beta-lactamases, gulls, Larus,
resistance, Salmonella, surface water.
Correspondence
Monika Dolejska´, Department of Biology and
Wildlife Diseases, Faculty of Veterinary
Hygiene and Ecology, University of Veterinary
and Pharmaceutical Sciences, Palacke´ho 1–3,
612 42 Brno, Czech Republic.
E-mail: m.dolejska@centrum.cz
2008 ⁄ 1520: received 4 September 2008,
revised 27 October 2008 and accepted
3 November 2008
doi:10.1111/j.1365-2672.2009.04155.x
Abstract
Aim: To examine surface water from a pond in the northeastern part of the
Czech Republic and young black-headed gulls (Larus ridibundus) nesting on
the same pond for the presence of antibiotic-resistant Salmonella and Escherichia
coli.
Methods and Results: A total of 16% (n = 87) of water and 24% (n = 216) of
gull samples yielded Salmonella. Salmonella Enteritidis PT8 and PT4 were the
most prevalent. Antibiotic resistance was found in 12% (n = 14) of water and
28% (n = 51) of gull salmonellae. Escherichia coli were found in 83 (95%) and
213 (99%) of pond water and gull samples, respectively. Totals of 18%
(n = 83) of water and 28% (n = 213) of gull E. coli isolates were resistant to
antimicrobial agents tested. Class 1 integrons were found in 21% (n = 14) of
water and 15% (n = 60) of gull antibiotic-resistant E. coli isolates. Class 2
integrons and extended-spectrum beta-lactamase-producing E. coli isolates
(with blaCTX-M-1, blaCTX-M-15-like, blaSHV-2 and blaSHV-12) were found in 13%
(eight positive, n = 60 gull-resistant E. coli isolates) and 3% (seven positive,
n = 216 gull E. coli isolates) of gull isolates, respectively. Antibiotic-resistant
E. coli isolates with identical pulsed field gel electrophoresis (PFGE) patterns
were found in either gulls or water, but not both. Salmonellae of the same
serotype and PFGE profile were found in both gulls and water.
Conclusion: A high prevalence of antibiotic-resistant salmonellae and E. coli
were found in both pond water and in sympatric black-headed gulls.
Significance and Impact of the Study: Intensive contamination of pond surface
water by antibiotic-resistant E. coli and salmonellae was documented. Blackheaded
gulls were identified as important reservoirs of antibiotic-resistant
salmonellae and E. coli, including extended-spectrum beta-lactamase-producing
isolates.
Journal of Applied Microbiology ISSN 1364-5072
ª 2009 The Authors
Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009) 1941–1950 1941
Bacterial contamination of surface water, and particularly
contamination with faecally derived bacteria, has
long been a water quality issue owing to the potential for
disease transmission. Antibiotic-resistant bacteria have
been detected in various aquatic environments, including
drinking water (Shehabi et al. 2006), rivers (Cernat et al.
2002), sewage (Anderson and Sobrey 2006) and marine
water (Boehm et al. 2003). The transmission of resistance
genes from environmental bacteria to human pathogens
is considered an important risk for public health (Cernat
et al. 2002; Walia et al. 2004). The introduction of resistant
bacteria to surface waters through faecal contamination
plays a role in both the occurrence and
dissemination of resistance.
The black-headed gull (Larus ridibundus) is an abundant,
migrating species that nests in colonies on water
reservoirs in inland Eurasia (Hudec and Sˇtˇastny´ 2005).
Many studies have recorded the presence of both human
and animal pathogens, mainly Salmonella spp. (Litera´k
et al. 1992; Cˇ ı´zˇek et al. 1994; Nesse et al. 2005; Palmgren
et al. 2006; Pennycott et al. 2006), in gulls. Moreover,
gulls have been involved in several outbreaks of salmonellosis
in animals (Johnston et al. 1979) and humans
(Kruse et al. 2004).
Gulls have been identified as important reservoirs of
antibiotic-resistant commensal bacteria, particularly
Escherichia coli, including antibiotic resistance genes and
integrons (Tsubokura et al. 1995; Dolejska et al. 2007;
Gionechetti et al. 2008), probably reflecting the presence
of such strains in their sources of food and ⁄ or water.
The aim of this study was to examine both pond
surface water samples and samples from young, unfledged
black-headed gulls nesting on the same pond for the presence
of antibiotic-resistant Salmonella and E. coli. Any
antibiotic resistance genes, integrons and ESBL in bacteria
thus isolated were analysed and the identity of water and
gull isolates were compared. In addition, the dynamics of
occurrence of these bacteria in water was studied over the
course of a year.
Materials and Methods
Sample collection
A total of 87 water samples were taken from the Herˇmanicky´
Pond near Ostrava in the northeastern part of the
Czech Republic. Pond water was regularly sampled every
14 days over a 1-year period between November 2005 and
November 2006. The samples were taken using the Moore
swab method (Moore 1948). The swabs, sterilized at
121°C before use, were placed into the water for 24 h: at
two sites at the inflow and two at the outflow of the pond.
Next day, the swabs were taken out and placed into sterile
bags and transported to the laboratory in an isothermal
box. A total of 216 cloacal swabs from young black-headed
gulls nesting at this pond were taken in May 2006. Cloacal
smears of gulls were placed on Amies Transport Medium
(Oxoid, UK) and transported within several hours in an
isothermic box to the laboratory for processing.
Herˇmanicky´ Pond lies in a valley of the River Odra
and has a total area of about 120 ha. The source of the
water for the pond is the River Vrbicka´ Struzˇka. This
river receives surface water that includes water probably
contaminated by municipal waste from the the cities of
Petrˇvald, Orlova´ and Rychvald, with a total population of
about 100 000 inhabitants. Water from the pond then
flows back into the River Vrbicka´ Struzˇka and, thereafter,
into the River Odra. There is no evidence of contamination
of the pond by agricultural waste. The pond serves
as a nesting site for almost 250 species of birds (in particular
for around 2000 nesting pairs of black-headed gulls)
and as a traditional stop for migrating water birds. It is
also intensively used for sport angling (Manda´k 2004).
Salmonella and Escherichia coli isolation and antibiotic
susceptibility testing
On the same day as sampling, Moore swabs and cloacal
swabs from gulls were placed into buffered peptone water
(BPW; Oxoid) and examined for Salmonella and E. coli as
previously described by Cˇ ı´zˇek et al. (2007) and Litera´k
et al. (2007). Salmonella isolates were serotyped and characterized
by phage typing (Cˇ ı´zˇek et al. 2007).
The antibiotic susceptibility of Salmonella and E. coli
isolates was tested using the disc diffusion method on
Mueller-Hinton Agar (Oxoid), in accordance with Clinical
Laboratory Standards Institute guidelines (CLSI;
NCCLS 2002) and using 12 antibacterial substances as
previously described by Cˇ ı´zˇek et al. (2007).
Polymerase chain reaction (PCR) for detecting antibiotic
resistance determinants and integrons
In E. coli and Salmonella isolates found to be resistant to
one or more antibiotics, PCR was used for detecting specific
antibiotic resistance genes, the class 1 and 2 integrase
genes intI1 and intI2, respectively, and gene cassettes
within class 1 and 2 integrons (Dolejska et al. 2007). The
list of primers and control strains is shown in Table S1
(see Supporting Information). PCR products of the class
1 integron region amplified using the dhfr1 ⁄ F and
aadA5 ⁄ R primers were purified (DyeEx 2Æ0 Spin Kit;
Qiagen) and sequenced using an ABI 310 Genetic Analyser
(Applied Biosystems). The results were compared with
sequences previously published on the internet: http://
blast.ncbi.nlm.nih.gov/Blast.cgi.
Antibiotic-resistant Salmonella and E. coli M. Dolejska´ et al.
1942 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009) 1941–1950
ª 2009 The Authors
Pulsed field gel electrophoresis (PFGE)
The one-day standardized laboratory protocol for molecular
subtyping of E. coli and Salmonella by PFGE, as recommended
by PulseNet (Molecular Subtyping Network
for Foodborne Bacterial Disease Surveillance, US – http://
www.cdc.gov/pulsenet), was used on selected water and
gull E. coli strains exhibiting the same antibiotic resistance
phenotype and antibiotic resistance genes in order to
compare their macrorestriction profiles and determine
epidemiological relatedness, as well as for all antibioticresistant
Salmonella isolates from water and gulls. The
relatedness of the samples was analysed according the criteria
by Tenover et al. (1995). The samples with indistinguishable
PFGE patterns (clones) were inscribed with the
same letters. The samples with more than seven differences
in PFGE patterns were designed as not related and
inscribed with different letters.
Extended-spectrum beta-lactamases
The samples were enriched in MacConkey broth and subcultivated
onto MacConkey agar containing cefotaxime
(2 mg l)1
; Wu et al. 2008). The colonies were examined
using the double-disc synergy test for the production of
ESBL (Thomson and Sanders 1992; NCCLS 2002) and
identified by the API 10S test kit (bioMerieux, France).
The genes responsible for the ESBL phenotype (blaTEM,
blaSHV, blaOXA-1-like, blaOXA-2-like and blaCTX-M) were
identified by PCR and the PCR products were further analysed
using sequencing (ABI 310 Genetic Analyser; Applied
Biosystems). The list of primers used is shown in Table S1.
Results
Salmonella
A total of 14 (16%) of 87 pond water samples yielded
Salmonella isolates. Using Fischer’s exact test (P = 0Æ022),
the prevalence of salmonellae was found to be significantly
higher in samples from the water inflow (14 samples)
as compared with those collected from the water
outflow (3 samples). The highest number of isolates was
found in water in November compared with the other
months (Fig. 1). Salmonella Enteritidis was the most
prevalent serotype, being found in 50% (n = 7) of Salmonella-positive
samples (Fig. 1).
Cloacal swabs were taken from 216 young black-headed
gulls, of which 51 (24%) yielded Salmonella. Seven different
serotypes were found in gulls (Fig. 2). Salmonella
Enteritidis was the most prevalent serotype and S. Enteritidis
PT4 followed by PT8 were predominant.
Resistance to one or more antibiotics was found in
14% (n = 2) and 29% (n = 15) of water and gull Salmonella
isolates, respectively (Table 1). Four isolates of
Salmonella Hadar with the same antibiotic-resistance profile
(NaST – resistance to nalidixic acid, streptomycin and
tetracycline) were detected in water and gulls. Resistance
to nalidixic acid was the most prevalent, being found in
25% (n = 16) of the isolates, and in particular in five of
the six S. Hadar and 10 of 36 S. Enteritidis isolates. The
following genes were identified in Salmonella isolates:
blaTEM (resistance to ampicillin), strA (streptomycin) and
tetA (tetracycline).
5
4
3
PT8
No.ofisolates
PT34b
PT8
PT19a
PT13a
PT8
PT8
DT1
DT67
2
1
0
1 2 3 4 5 6
Month
7 8 9 10 11 12
Figure 1 Numbers of Salmonella isolates
obtained from water samples during a 1-year
period (from January to December) including
serotype and phagotype characterization. ( ,
S. Enteritidis; , S. Typhimurium; , S. Derby;
, S. Indiana; , S. Infantis; , S. Hadar).
14
12
PT4
No.ofisolates
PT8
PT6
PT22
PT31
PT1
PT21
PT21c
DT141
DT104
10
8
6
4
2
0
Figure 2 Salmonelae isolated from black-headed gulls including
serotypes and phagotypes. ( , S. Enteritidis; , S. Typhimurium; ,
S. Derby; , S. Ohio; , S. Kentucky; , S. Infantis; , S. Hadar).
M. Dolejska´ et al. Antibiotic-resistant Salmonella and E. coli
ª 2009 The Authors
Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009) 1941–1950 1943
All antibiotic-resistant salmonellae were tested by
PFGE. Salmonella isolates of the same serotype, independent
of the antibiotic resistance phenotype, exhibited the
same macrorestriction profile (Table 1).
Escherichia coli
Escherichia coli isolates were found in 83 (95%) of 87
pond water samples. Resistance to one or more antibiotics
was detected in 14 (17%) of 83 E. coli isolates. In
total, 6 (7%) of the 83 isolates were resistant to only one
antimicrobial agent and the remaining 8 isolates were
resistant to more than one agent. Tetracycline resistance
was predominant, detected in nine isolates, followed by
resistance to sulphonamides, ampicillin and trimethoprim-sulfamethoxazole.
The most common antibiotic
resistance phenotypes were monoresistance to tetracycline
and monoresistance to ampicillin. The results of the
antimicrobial susceptibility of E. coli isolates from pond
water are summarized in Table 2.
A total of 213 (99%) E. coli isolates were obtained from
216 gull cloacal swab samples. Sixty (28%) of the isolates
displayed resistance to antibiotics. Twelve (6%) of the
213 isolates were resistant to only one antimicrobial agent
and the remaining 48 isolates were resistant to more than
one agent. Resistance to the three antibiotics was most
prevalent. Resistance to tetracycline was predominant,
found in 46 of the isolates, followed by resistance to
ampicillin, streptomycin, sulphonamides and trimethoprim-sulfamethoxazole
(Table 2). The most common
antibiotic resistance phenotypes were resistance to ampicillin,
streptomycin and sulphametoxazole (phenotype
AST), found in nine isolates.
The following genes were identified in E. coli isolates:
blaTEM, blaOXA-1-like (resistance to ampicillin), tetA, tetB
(tetracycline), strA, aadA1, aadA2, aadA5 (streptomycin),
Table 1 Antimicrobial-resistant Salmonella
isolates from pond water and black-headed
gullsSource Serotype (phagotype)
Antibiotic
resistance profile*
No. of
isolates
Antibiotic
resistance genes Pulsotype
Water Salmonella Hadar NaST 2 strA, tetA L
Gulls Salmonella Enteritidis (PT 1) Na 1 K
S. Enteritidis (PT 4) Na 8 K
S. Enteritidis (PT 31) Na 1 K
S. Hadar Na 1 L
S. Hadar NaST 2 strA, tetA L
Salmonella Derby A 1 blaTEM M
S. Derby Na 1 M
*A, ampicillin; Na, nalidixic acid; S, streptomycin; T, tetracycline.
Table 2 Prevalence of antibiotic resistance
of Escherichia coli isolates from pond
water and black-headed gulls
Antibiotics
No. of resistant isolates
(prevalence %)
Statistical
significance of
differences*
Pond water
(n = 83)
Gulls
(n = 213)
Tetracycline 9 (11) 46 (22) P = 0Æ021
Sulphonamides 8 (10) 28 (13) NS
Ampicillin 7 (8) 41 (19) P = 0Æ016
Trimethoprim-sulfamethoxazole 7 (8) 19 (9) NS
Streptomycin 3 (4) 32 (15) P = 0Æ003
Chloramphenicol 2 (2) 6 (3) NS
Nalidixic acid 1 (1) 13 (6) NS
Ciprofloxacin 0 (0) 7 (3) NS
Cephalotin 0 (0) 3 (1) NS
Gentamicin 0 (0) 1 (<1) NS
Amoxicillin-clavulanic acid 0 (0) 0 (0) NT
Ceftazidime 0 (0) 0 (0) NT
Differences in prevalence were compared using Fisher’s exact test. Statistical significance is
indicated at P £ 0Æ05.
*NS, not significant; NT, not tested.
Antibiotic-resistant Salmonella and E. coli M. Dolejska´ et al.
1944 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009) 1941–1950
ª 2009 The Authors
sul1, sul2, sul3 (sulphonamides) and cat, cmlA, floR (chloramphenicol).
The majority of water and gull ampicillinresistant
isolates yielded the blaTEM gene while two
isolates were negative for all bla genes tested. As regards
tetracycline resistance determinants, the gene tetA was
predominant in tetracycline-resistant isolates from gulls
while the gene tetB was found in the majority of isolates
from water. Isolates with both genes (tetA and tetB) were
frequent in gulls. One tetracycline-resistant isolate from a
gull was negative for all tet determinants tested. The sul2
gene was the predominant sulphonamide resistance determinant
in both groups of isolates and a combination of
two sul genes (sul1 and sul2) was frequently found in
both water and gull samples. A list of all antibiotic-resistant
E. coli isolates from pond water and black-headed
gulls, including antibiotic resistance profiles and antibiotic
resistance genes, is shown in Table 3.
Integrons and gene cassettes in Escherichia coli isolates
Three of 14 antibiotic-resistant E. coli isolates from water
yielded the intI1 gene and class 1 integron. A class 1
integron of 1Æ6 kb with the gene cassette dhfr12-aadA2
was present in two E. coli isolates, and one isolate contained
a 1Æ5 kb integron with the dhfr1-aadA1 cassette.
One sul1-positive isolate with the aadA5 gene cassette but
without the intI1 gene was detected, suggesting a mutation
in the 5¢ conservative region of the integron.
Nine of the 60 antibiotic-resistant E. coli isolates from
gulls possessed the intI1 gene and gene cassettes in variable
regions of the class 1 integron. The spectrum of
integrons in gull isolates was heterogeneous and varied
from those found in water samples; seven different types
of integrons were found in total: integrons of 1 kb with
aadA1 or aadA2 cassette, 1Æ5 kb integron with dhfr1aadA1,
1Æ7 kb integron with dhfr17-aadA5, 1Æ9 kb integron
with blaOXA-1-like-aadA1. Two intI1-positive samples
were negative for variable region of class 1 integron; one
of them with dhfr1 cassette and the other contained
aadA1 gene. One 2 kb integron with an unusual combination
of gene cassettes, dhfr1-catB3-aadA4, was found in
a gull isolate. The sequence analysed was identical to
sequences stored in the GenBank under accession no.
AM939644 (E. coli isolate 980, class 1 integron) and
AY214164 (E. coli plasmid pAPEC-02-R). Two isolates
were negative for a variable region of the class 1 integron,
probably as a result of a mutation inside the integron
structure (data not shown). One sul1-positive isolate
proved negative for intI1 as well as for all gene cassettes
tested.
Class 2 integrons were found only in gull isolates. Eight
of all antibiotic-resistant isolates were positive for the
intI2 gene; however, the PCR reaction for the variable
region of the class 2 integron was negative in one of
these. Three types of class 2 integrons were found. A class
2 integron with a variable region of 2Æ5 kb in size and the
estX-sat-aadA1 gene cassette was found in three E. coli
isolates; an integron 2 kb in size with the dhfr1-sat-aadA1
cassette was found in three isolates and a 1Æ5 kb integron
with the sat-aadA1 cassette was seen in one isolate.
Macrorestriction profile analysis
Sixteen E. coli isolates (five from water, eleven from gulls)
that exhibited the same antibiotic-resistance profile and
genes were analysed by PFGE. Identical isolates (clones)
were found among gull isolates or among water isolates,
but no relatedness was found between gull and water
isolates (Table 4). PFGE patterns of the isolates can be
seen in Fig. S1 (see Supporting Information).
ESBL-producing Escherichia coli
No ESBL-producing isolates were found in water samples.
Escherichia coli isolates producing ESBL were found in
seven (3%, n = 216) samples from gulls. The genes
blaCTX-M-1 (one isolate), blaCTX-M-15-like (two), blaSHV-2
(one) and blaSHV-12 (two) were found. One ESBL-producing
isolate was negative for all bla genes tested. All
blaSHV-positive isolates exhibited the same antibiotic
resistance profile, ACf (resistance to ampicillin and cephalothin).
All blaCTX-M-positive isolates were resistant to
four to seven antimicrobials. Two of these carried a class
1 integron of 1Æ7 kb with the dhfr17-aadA5 gene cassette,
and the remaining one contained a 1Æ5 kb class 1 integron
with dhfr1-aadA1.
Discussion
Contamination of surface water with untreated manure
and sewage continues to be a serious environmental problem.
The pond that we examined is situated within a
large industrial area densely inhabited with humans. The
area is not important from an agricultural point of view
and there are no large livestock farms that introduce an
influential amount of wastes of animal origin into surface
waters. In our study, we demonstrate a high level of contamination
of pond surface water by salmonellae. The
spectrum of serotypes and phagotypes of Salmonella
enterica isolated from pond water indicates their human
and ⁄ or animal origin. Salmonella Enteritidis PT8 was the
most prevalent serotype found in water in 2006 and, at
the same time, this phagotype was also predominant in
both humans and animals in the Czech Republic (Renata
Karpı´sˇkova´, National Institute of Public Health in Prague,
personal communication). Salmonella Hadar isolates with
M. Dolejska´ et al. Antibiotic-resistant Salmonella and E. coli
ª 2009 The Authors
Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009) 1941–1950 1945
Table 3 List of antibiotic-resistant Escherichia coli from pond water and gulls
Source Antibiotic resistance phenotype* Antibiotic resistance genes  No. of strains
Water A blaTEM 1
ND 1
T tetA 2
tetA, tetB 1
Su sul1, aadA5 1
CT cmlA, tetA 1
SuSxt sul2 1
SSuT strA, sul2, tetB 1
ASuSxt blaTEM, sul2 1
ASuSxtT blaTEM, sul1, sul2, tetA, intI1, I1 1Æ5 kb: dhfr1-aadA1 1
ANaSuSxtT blaTEM, sul1, sul2, intI1, I1 1Æ6 kb: dhfr12-aadA2 1
ASSuSxtT blaTEM, strA, sul2, tetA 1
ACSSuSxtT blaTEM, cat, strA, sul1, sul2, tetB, intI1, I1 1Æ6 kb: dhfr12-aadA2 1
Gulls A blaTEM 3
Na NT 1
S aadA1, intI2 1
T tetA 1
T tetB 3
T tetA, intI2, I2 2Æ5 kb: estX-sat-aadA1 1
T tetB, intI2, I2 2Æ5 kb: estX-sat-aadA1 1
AS blaTEM, aadA1, intI2 1
ASxt blaTEM 1
CipNa NT 1
NaT tetB 2
SSu strA, sul2 1
ST strA, tetB 1
SuT sul3, tetA 1
ACT blaTEM, cat, tetA 1
ACipNa blaTEM 1
ANaT blaTEM, tetB 1
AST blaTEM, strA, tetA 4
blaTEM, strA, tetB 2
strA, tetB 1
blaTEM, strA, tetA, tetB 1
ASuT blaTEM, sul3, tetB 1
SSuT sul1, tetB, intI1, I1 1 kb: aadA1, I1 1 kb: aadA2 1
SuCipNa sul1 1
SuSxtT sul1, tetA, intI1, I1 2 kb: dhfr1-catB3-aadA4, intI2 1
ACipNaT blaTEM, tetB 1
ACSSu blaTEM, cat, strA, sul2 1
ACSuT cat, sul1, tetB, intI1, I1 1Æ8 kb: blaOXA-1-like-aadA1 1
ASSuSxt blaTEM, strA, sul1, sul2, intI1, I1 1Æ5 kb: dhfr17-aadA5 1
ASSuT blaTEM, strA, sul2, tetA 1
ASuSxtT blaTEM, sul1, tetA, intI1, I1 1Æ5 kb: dhfr1-aadA1 1
blaTEM, sul3, tetB 1
CSuSxtT cat, sul2, tetA 1
ACfSSuT blaTEM, strA, sul2, tetB 1
ASSuSxtT blaTEM, strA, sul2, tetA 3
blaTEM, strA, sul2, tetA, intI2, I2 2 kb: dhfr1-sat-aadA1 1
blaTEM, strA, sul2, tetA, intI2, I2 2Æ5 kb: estX-sat-aadA1 1
blaTEM, strA, sul2, tetB 1
blaTEM, strA, sul1, sul2, tetA, tetB, intI1, I1 1Æ5 kb: dhfr17-aadA5 1
ACfSSuSxtT blaTEM, strA, sul2, tet A 1
blaTEM, strA, sul2, tetB 1
ACSSuSxtT blaTEM, strA, sul2, tetA 1
blaTEM, cat, strA, sul2, tetB, intI2, I2 2 kb: dhfr1-sat-aadA1 1
Antibiotic-resistant Salmonella and E. coli M. Dolejska´ et al.
1946 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009) 1941–1950
ª 2009 The Authors
resistance to nalidixic acid, streptomycin and tetracycline
are exclusively isolated from human samples in the Czech
Republic (Renata Karpı´sˇkova´, personal communication),
indicating contamination of the water in the pond by
human sewage. On the other hand, Salmonella Derby,
isolated from pond water, is exclusively found in pigs in
the Czech Republic (Renata Karpı´sˇkova´, personal
communication).
A high prevalence of Salmonella was recorded among
young black-headed gulls. A total of 24% (n = 216) of
gull samples yielded Salmonella isolates as compared with
27% (n = 132) of isolates found from the same colony in
2005 (Cˇ ı´zˇek et al. 2007). The spectrum of serotypes and
phagotypes in gulls varied between 2006 and 2005, probably
reflecting different contamination sources for gull
colonization. The most prevalent phagotype in 2005,
S. Enteritidis PT6, was replaced by PT4 and PT8 in 2006.
The PT4 phagotype is predominant to the west of the
Czech Republic, suggesting an additional source of this
phagotype in black-headed gulls outside their nesting
area. Salmonella Enteritidis PT8, S. Derby and antibioticresistant
S. Hadar were frequently found in gulls as well
as in pond water.
Escherichia coli was isolated in pond surface water from
both the inflow and outflow throughout the year. Various
studies provide evidence that E. coli can persist in secondary,
nonhost habitats such as freshwater and water sediments
(Hendricks and Morrison 1967; Flint 1987;
Anderson et al. 2005). An increase in faecal E. coli contamination
of natural waters in the summer months and
higher survival and growth at warmer temperatures was
reported by Ksoll et al. (2007), although a negative rate
of growth and decreased survival in secondary habitats
was also observed. There is probably, therefore, a continuous
bulk transfer from human and animal sources to
maintain a stable population outside the animal hosts
(Savageau 1983). Our results demonstrate an intensive
and permanent faecal contamination of the pond.
Black-headed gulls have been identified as reservoirs of
antibiotic-resistant salmonellae and E. coli, including
integron-carrying isolates (Cˇ ı´zˇek et al. 2007; Dolejska
et al. 2007). Edge and Hill (2005) demonstrated that bird
faeces might be a more prominent contributor of E. coli
to surface waters than municipal wastewater sources.
Omnivorous adult black-headed gulls from colonies in
the Czech Republic gather food for their young over an
area of about 10 km around the nesting colonies (Hudec
and Sˇtˇastny´ 2005) and, as such, have sufficient opportunities
to become infected through by-products of animal
and human origin. We consider the sources of E. coli
infections in young black-headed gulls to be from outside
the pond water and local environment owing to the differing
spectrum of E. coli isolates found in gulls in 2006
and in the water of the Herˇmanicky´ Pond in November
2005 ⁄ November 2006, as well as the differing spectrum of
E. coli isolates found in gulls in 2006 and gulls examined
Table 3 (Continued)
Source Antibiotic resistance phenotype* Antibiotic resistance genes  No. of strains
ANaSSuSxtT blaTEM, strA, sul1, sul2, tetB, intI1, dhfr1 1
ACipNaSSuSxtT strA, sul1, sul2, tetA, tetB, intI1, I1 1Æ5 kb: dhfr1-aadA1 1
ACCfCipGnNaSSuSxtT blaTEM, floR, strA, sul1, sul2, tetB, intI1, aadA1 1
*A, ampicillin; C, chloramphenicol; Cf, cephalotin; Cip, ciprofloxacin; Gn, gentamicin; Na, nalidixic acid; S, streptomycin; Su, sulfonamides cp.;
Sxt, trimethoprim-sulfamethoxazole; T, tetracycline.
 ND, not determined; NT, not tested; I1, class 1 integron; I2, class 2 integron.
Table 4 Escherichia coli isolates analysed by
pulsed field gel electrophoresis
Group
Antibiotic resistance
phenotype* Antibiotic resistance genes
Pulsotype
Designation Source
1 A blaTEM A Water (1)
B Gulls (3)
2 T tetA C Water (2)
D Gulls (2)
3 ASuSxtT blaTEM, sul1, sul2, tetA, intI1,
1Æ5 kb integron: dhfr1-aadA1
E Water (1)
F Gulls (1)
4 ASSuSxtT blaTEM, strA, sul2, tetA G Water (1)
H Gulls (5)
*A, ampicillin; S, streptomycin; Su, sulfonamides cp.; Sxt, trimethoprim-sulfamethoxazole;
T, tetracycline.
M. Dolejska´ et al. Antibiotic-resistant Salmonella and E. coli
ª 2009 The Authors
Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009) 1941–1950 1947
at the same location in 2005. However, further investigations
must be performed to confirm this statement. We
did not find any isolate with the same antibioticresistance
profile, antibiotic resistance genes and macrorestriction
profile in isolates from water and gulls in
2006. A few studies have reported little genetic similarity
between E. coli populations in hosts and those in the
environment where faeces from those hosts accumulate
(Gordon 2001; Gordon et al. 2002; McLellan 2004). As
with our study, McLellan (2004) found that some E. coli
strains isolated from river water were more closely related
to isolates taken from different river sites or collected on
other days than they were related to E. coli strains from
known sources of faecal contamination (e.g. gulls) at
these sites.
We found integrons in both water and black-headed
gull isolates. The prevalence of integron-positive E. coli
was higher in gulls as compared with water and the
spectrum of integrons was more variable in gulls. We
believe that this is because of additional sources of
strains with integrons in the food of gulls outside the
pond water. A class 1 integron, 2 kb in size, with a
unique combination of gene cassettes (dhfr1-catB3aadA4)
was detected in a black-headed gull isolate. A
similar type of integron was recently found in poultry
E. coli in Hungary (2Æ4 kb, dhfr1-catB3-aadA5; No´gra´dy
et al. 2006). The sequence of the integron we detected
was identical with the integron described by Kadlec and
Schwarz (in press) in an animal E. coli isolate in Germany
between 2004 and 2006 (GenBank accession no.
AM939644). This type of integron was also identified
as part of the pAPEC-O2-R plasmid in an avian pathogenic
E. coli strain isolated from an chicken with obvious
disease manifestation in the United States in 2005
(Johnson et al. 2005).
Class 2 integrons were demonstrated only in gull isolates,
with integrons 2Æ5 kb in size with estX-sat-aadA1
and 2 kb with dhfr1-sat-aadA1 being the most prevalent.
The same types of integrons have been sporadically found
in E. coli from pigs in Norway and Switzerland (Sunde
2005; Cocchi et al. 2007). According to our knowledge,
this is the first report of class 2 integrons in wildlife.
Some isolates with class 1 and class 2 integrons were
positive for streptomycin-resistant gene aadA but did not
exhibit corresponding antibiotic resistance phenotype. It
was demonstrated that streptomycin resistance genes associated
with integrons mostly provide reduced susceptibility
to these agents rather than full resistance, probably
owing to low-level gene expression (Collins and Hall
1995; Martinez-Freijo et al. 1998).
We detected ESBL-producing E. coli in 3% of the
black-headed gull samples. The ESBL genes blaTEM,
blaSHV and blaCTX-M that we found in these isolates are
the most prevalent ones world-wide. The blaCTX-M and
especially blaCTX-M-1 genes have now become increasingly
dominant in Europe (Canto´n et al. 2008). All the blaCTX-Mpositive
E. coli from gulls in our study contained class 1
integrons with genes cassettes; blaCTX-M-1-positive E. coli
contained dhfr1-aadA1 and blaCTX-M-15-like positive
E. coli isolates were positive for dhfr17-aadA5. The
blaCTX-M gene has recently been identified as frequently
found on the same genetic elements as class 1 integrons
(Canto´n et al. 2008). The ESBL SHV-12 and SHV-2 that
we found in gull E. coli isolates are the most prevalent
enzymes within the SHV family (Canto´n et al. 2008).
They have been reported all over the world in Klebsiella
pneumoniae and, more recently, in E. coli from humans
and food-producing animals (Valverde et al. 2004;
Herna´ndez et al. 2005; Miro´ et al. 2005; Blanc et al. 2006;
Machado et al. 2008). Little information is available on
the spreading of ESBL-producing E. coli isolates into the
environment and wildlife. ESBL-producing E. coli with
blaCTX-M-1 and blaSHV-12 has been found in birds of prey
in Portugal (Costa et al. 2006). We therefore consider our
observation of the occurrence of ESBL-producing E. coli
in black-headed gulls that commonly occupy water reservoirs
in inland Europe somewhat alarming. It provides
evidence that the ESBL-producing E. coli selected for in
humans and food-producing animals are colonizing wild
gulls and that, via these birds, the emerging ESBLproducing
E. coli isolates can be spread into the environment
in the same way as E. coli isolates resistant to older
generations of antimicrobials, as we recently documented
(Dolejska et al. 2007).
Acknowledgements
This study was funded by grant no. MSM6215712402
from the Ministry of Education, Youth and Sports of the
Czech Republic and grant IGA VFU 162 ⁄2008 FVL. The
authors thank Renata Karpı´sˇkova´ from the Centre for
Food Chain Hygiene, Brno, National Institute of Public
Health in Prague, Czech Republic, for recent data on the
occurence of human and animal salmonellosis in the
Czech Republic.
References
Anderson, M.E. and Sobrey, M.D. (2006) Detection and occurence
of antimicrobially resistant Escherichia coli in
groundwater on or near swine farms in eastern North
Carolina. Water Sci Technol 54, 211–218.
Anderson, K.L., Whitlock, J.E. and Harwood, V.J. (2005)
Persistence and differential survival of fecal indicator
bacteria in subtropical waters and sediments. Appl Environ
Microbiol 71, 3041–3048.
Antibiotic-resistant Salmonella and E. coli M. Dolejska´ et al.
1948 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009) 1941–1950
ª 2009 The Authors
Blanc, V., Mesa, R., Saco, M., Lavilla, S., Prats, S., Miro´, E.,
Navarro, F., Corte´s, P. et al. (2006) ESBL- and plasmidic
class C beta-lactamase-producing E. coli strains isolated
from poultry, pig and rabbit farms. Vet Microbiol 118,
299–304.
Boehm, A.B., Fuhrman, J.A., Mrse, R.D. and Grant, S.B.
(2003) Tiered approach for identification of a human fecal
pollution source at a recreational beach: case study at
Avalon Bay, Catalina Island, California. Environ Sci Technol
37, 673–680.
Bush, K. (2008) Extended-spectrum b-lactamases in North
America, 1987–2006. Clin Microbiol Infect 14, 134–143.
Canto´n, R., Novais, A., Valverde, A., Machado, E., Peixe, L.,
Baquero, F. and Coque, T.M. (2008) Prevalence and
spread of extended-spectrum b-lactamase-producing
Enterobacteriaceae in Europe. Clin Microbiol Infect 14,
144–153.
Cernat, R., Laza˘r, V., Balotescu, C., Cotar, A., Coipan, E. and
Cojocaru, C. (2002) Distribution and diversity of conjugative
plasmids among some multiple antibiotic-resistant
Escherichia coli strains isolated from river waters. Bacteriol
Virusol Parazitol Epidemiol 47, 147–153.
Cˇ ı´zˇek, A., Litera´k, I., Hejlı´cˇek, K., Treml, F. and Smola, J.
(1994) Salmonella contamination of the environment and
its incidence in wild birds. J Vet Med B 41, 320–327.
Cˇ ı´zˇek, A., Dolejska´, M., Karpı´sˇkova´, R., Deˇdicˇova´, D. and
Litera´k, I. (2007) Wild black-headed gulls (Larus
ridibundus) as an environmental reservoir of Salmonella
strains resistant to antimicrobial drugs. Eur J Wildl Res 53,
55–60.
Cocchi, S., Grasselli, E., Gutacker, M., Benagli, C., Convert, M.
and Piffaretti, J.C. (2007) Distribution and characterization
of integrons in Escherichia coli strains of animal and
human origin. FEMS Immunol Med Microbiol 50, 126–132.
Collins, C.M. and Hall, R.M. (1995) Expression of antibiotic
resistance genes in the integrated cassettes of integrons.
Antimicrob Agents Chemother 39, 155–162.
Costa, D., Poeta, P., Sa´enz, Y., Vinue´, L., Rojo-Bezares, B.,
Jouini, A., Zarazaga, M., Rodrigues, J. et al. (2006) Detection
of Escherichia coli harbouring extended-spectrum
b-lactamases of the CTX-M, TEM and SHV classes in
faecal samples of wild animals in Portugal. J Antimicrob
Chemother 58, 1311–1312.
Dolejska, M., Cizek, A. and Literak, I. (2007) High prevalence
of antimicrobial-resistant genes and integrons in Escherichia
coli isolates from black-headed gulls in the Czech
Republic. J Appl Microbiol 103, 11–19.
Edge, T.A. and Hill, S. (2005) Occurrence of antibiotic resistance
in Escherichia coli from surface waters and faecal
pollution sources near Hamilton, Ontario. Can J Microbiol
51, 501–505.
Flint, K.P. (1987) The long-term survival of Escherichia coli in
river water. J Appl Bacteriol 63, 261–270.
Gionechetti, F., Zucca, P., Gombac, F., Monti-Bragadin, C.,
Lagatolla, C., Tonin, E., Edalucci, E., Vitali, L.A. et al.
(2008) Characterization of antimicrobial resistance and
class 1 integrons in Enterobacteriaceae isolated from Mediterranean
herring gulls (Larus cachinnans). Microb Drug
Resist 14, 93–99.
Gordon, D.M. (2001) Geographical structure and host
specificity in bacteria and the implications for tracing
the source of coliform contamination. Microbiology 147,
1079–1085.
Gordon, D.M., Bauer, S. and Johnson, J.R. (2002) The genetic
structure of Escherichia coli populations in primary and
secondary habitats. Microbiology 148, 1513–1522.
Hawkey, P.M. (2008) Prevalence and clonality of extendedspectrum
b-lactamases in Asia. Clin Microbiol Infect 14,
159–165.
Hendricks, C.W. and Morrison, S.M. (1967) Multiplication
and growth of selected enteric bacteria in clear mountain
stream water. Water Res 1, 567–576.
Herna´ndez, J.R., Martı´nez-Martı´nez, L., Canto´n, R., Coque,
M.T. and Pascual, A. and Spanish Group for Nosocomial
Infections (GEIH) (2005) Nationwide study of Escherichia
coli and Klebsiella pneumoniae producing extendedspectrum
b-lactamase in Spain. Antimicrob Agents
Chemother 49, 2122–2125.
Hudec, K. and Sˇtˇastny´, K. (2005) Larus ridibundus Linnaeus.
In Pta´ci – Aves, Fauna CˇR II ⁄ 2 (Birds of the Czech Republic,
in Czech), pp. 759–769. Prague: Academia.
Johnson, T.J., Siek, K.E., Johnson, S.J. and Nolan, L.K. (2005)
DNA sequence and comparative genomics if pAPECO2-R,
an avian pathogenic Escherichia coli transmissible
R plasmid. Antimicrob Agents Chemother 49, 4681–
4688.
Johnston, W.S., Maclachlan, G.K. and Hopka´na, G.F. (1979)
The possible involvement of seagulls (Larus spp.) in the
transmission of Salmonella in dairy cattle. Vet Rec 105,
526–527.
Kadlec, K. and Schwarz, S. (2008) Analysis and distribution of
class 1 and class 2 integrons and associated gene cassettes
among Escherichia coli isolates from swine, horses, cats and
dogs collected in the BfT-GermVet monitoring study. J Antimicrob
Chemother, doi: 10.1093 ⁄ jac ⁄ dkn233.
Kruse, H., Kirmeno, A.M. and Handeland, K. (2004) Wildlife
as a source of zootic infections. Emerg Infect Dis 10, 2067–
2072.
Ksoll, W.B., Ishii, S., Sadowsky, M.J. and Hicks, R.E. (2007)
Presence and sources of fecal coliform bacteria in epilithic
periphyton communities of Lake Superior. Appl Environ
Microbiol 73, 3771–3778.
Litera´k, I., Cˇ ı´zˇek, A. and Honza, M. (1992) Using examinations
of young black-headed gulls (Larus ridibundus) for
the detection of Salmonella in the environment. Acta Vet
Brno 61, 141–146.
Litera´k, I., Vanko, R., Dolejska´, M., Cˇ ı´zˇek, A. and Karpı´sˇkova´,
R. (2007) Antibiotic resistant Escherichia coli in Russian
rooks (Corvus frugilegus) wintering in the Czech Republic.
Lett Appl Microbiol 45, 616–621.
M. Dolejska´ et al. Antibiotic-resistant Salmonella and E. coli
ª 2009 The Authors
Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009) 1941–1950 1949
Machado, E., Coque, T.M., Canto´n, R., Sousa, J.C. and Peixe,
L. (2008) Antibiotic resistance integrons and extendedspectrum
beta-lactamases among Enterobacteriaceae
isolates recovered from chickens and swine in Portugal.
J Antimicrob Chemother 62, 296–302.
Manda´k, M. (2004) Herˇmanicky´ rybnı´k – vy´zmana´ ornitologicka´
lokalita (Herˇmanicky´ Pond – important ornithological
locality, in Czech). Acrocephalus (Ostrava) 20, 2–53.
Martinez-Freijo, P., Fluit, A.C., Schmitz, F.J., Grek, V.S.C.,
Verhoef, J. and Jones, M.E. (1998) Class I integrons in
gram-negative isolates from different European hospitals
and association with decreased susceptibility to multiple
antibiotic compounds. J Antimicrob Chemother 42, 689–
696.
McLellan, S.L. (2004) Genetic diversity of Escherichia coli
isolated from urban rivers and beach water. Appl Environ
Microbiol 70, 4658–4665.
Miro´, E., Mirelis, B., Navarro, F., Rivera, A., Mesa, R.J., Roig,
M.C., Go´mez, L. and Coll, P. (2005) Surveillance of
extended spectrum b-lactamases from clinical samples and
faecal carriers in Barcelona, Spain. J Antimicrob Chemother
56, 1152–1155.
Moore, B. (1948) The detection of paratyphoid carriers in
towns by means of sewage examination. Mon Bull Minist
Health Public Health Lab Serv 9, 72–78.
National Committee for Clinical Laboratory Standards (2002)
Performance standards for antimicrobial disk and dilution
susceptibility tests for bacteria isolated from animals.
Approved standard M31-A2. Wayne, PA: National
Committee for Clinical Laboratory Standards.
Nesse, L.L., Refsum, T., Heir, E., Nordby, K., Vardund, T. and
Holstad, G. (2005) Molecular epidemiology of Salmonella
spp. isolates from gulls, fish-meal factories, feed factories,
animals and humans in Norway based on pulsed-field gel
electrophoresis. Epidemiol Infect 133, 53–58.
Palmgren, H., Aspa´n, A., Broman, T., Bengtsson, K., Blomquist,
L., Bergstro¨m, S., Sellin, M., Wollin, R. et al. (2006)
Salmonella in black-headed gulls (Larus ridibundus); prevalence,
genotypes and influence on Salmonella epidemiology.
Epidemiol Infect 134, 635–644.
Pennycott, T.W., Park, A. and Mather, H.A. (2006) Isolation
of different serovars of Salmonella enterica from wild birds
in Great Britain between 1995 and 2003. Vet Rec 158, 817–
820.
Savageau, M.A. (1983) Escherichia coli habitats, cell types, and
molecular mechanism of gene control. Am Nat 122, 732–
744.
Schwarz, S. and Chaslus-Dancla, E. (2001) Use of antimicrobials
in veterinary medicine and mechanisms of resistance.
Vet Res 32, 201–225.
Shehabi, A.A., Odeh, J.F. and Fayyad, M. (2006) Characterization
of antimicrobial resistance and class 1 integrons found
in Escherichia coli isolates from human stools and drinking
water sources in Jordan. J Chemother 18, 468–472.
Sunde, M. (2005) Prevalence and characterization of class 1
and class 2 integrons in Escherichia coli isolated from meat
and meat products of Norwegian origin. J Antimicrob
Chemother 56, 1019–1024.
Tenover, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A.,
Murray, B.E., Pensing, D.H., Swaminathan, B. (1995)
Interpreting chromosomal DNA restriction patterns produced
by pulsed-field gel electrophoresis: criteria for bacterial
strain typing. J Clin Microbiol 33, 2233–2239.
Thomson, K.S. and Sanders, C.C. (1992) Detection of
extended-spectrum beta-lactamases in members of the
family Enterobacteriaceae: comparison of the double-disk
and three-dimensional tests. Antimicrob Agents Chemother
36, 1877–1882.
Tsubokura, M., Matsumoto, A., Otsuki, K., Animas, S.B. and
Sanekata, T. (1995) Drug resistance and conjugative R
plasmids in Escherichia coli strains isolated from migratory
waterfowl. J Wild Dis 31, 352–357.
Valverde, A., Coque, T.M., Sa´nchez-Moreno, M.P., Rolla´n, A.,
Baquero, F. and Canto´n, R. (2004) Dramatic increase in
prevalence of fecal carriage of extended-spectrum betalactamase-producing
Enterobacteriaceae during nonoutbreak
situations in Spain. J Clin Microbiol 42, 4769–4775.
Walia, S.K., Kaiser, A., Parkash, M. and Chaudhry, G.R.
(2004) Self-transmissible antibiotic resistance to ampicillin,
streptomycin, and tetracycline found in Escherichia coli
isolates from contaminated drinking water. J Environ Sci
Health A Tox Hazard Subst Environ Eng 39, 651–662.
Wu, S., Chouliara, E., Hasman, H., Dalsgaard, A., Vieira, A.
and Jensen, L.B. (2008) Detection of a single isolate of
CTX-M-1-producing Escherichia coli from healthy pigs in
Denmark. J Antimicrob Chemother 61, 747–749.
Supporting Information
Additional Supporting Information may be found in the
online version of this article:
Figure S1 Pulsed field gel electrophoresis (PFGE) patterns
of Escherichia coli isolates from water and gulls with the
same antibiotic resistance phenotype and antibitoic resistance
genes. The same PFGE patterns are indicated by the
same letter. Lines 10 and 16, control strain Salmonella
Braenderup H9812; lanes 1 and 2, E. coli type C (water);
lines 3, 4 and 6, E. coli type B (gull); line 5, E. coli type A
(water); line 7, E. coli type E (water); line 8, E. coli type F
(gull); line 9, E. coli type G (water); lines 11–15, E. coli
type H (gull); line 17, E. coli type D (gull).
Table S1 List of primers used in this study.
Please note: Wiley-Blackwell are not responsible for the
content or functionality of any supporting materials supplied
by the authors. Any queries (other than missing
material) should be directed to the corresponding author
for the article.
Antibiotic-resistant Salmonella and E. coli M. Dolejska´ et al.
1950 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 106 (2009) 1941–1950
ª 2009 The Authors
Příloha 2
LITERAK, I., DOLEJSKA, M., CIZEK, A., DJIGO, C. A. T., KONECNY, A., KOUBEK, P. ,2009, Reservoirs
of antibiotic-resistant Enterobacteriaceae among animals sympatric to humans in Senegal:
extended-spectrum beta-lactamases in bacteria in a black rat (Rattus rattus): African Journal of
Microbiology Research, v. 11, p. 751-754.
Souhrn
Vyšetřením vzorků rektálních výtěrů vybraných skupin savců ze Senegalu byly identifikovány dva kmeny
s produkcí ESBL, které pocházely z krysy obecné. Jednalo se o izoláty E. coli s CTX-M-15 a Enterobacter cloacae
s TEM-52. Studie poukazuje na možný význam sympatrických druhů hlodavců v šíření rezistentních bakterií.
African Journal of Microbiology Research Vol. 3(11) pp. 751-754, November, 2009
Available online http://www.academicjournals.org/ajmr
ISSN 1996-0808 ©2009 Academic Journals
Full Length Research Paper
Reservoirs of antibiotic-resistant Enterobacteriaceae
among animals sympatric to humans in Senegal:
extended-spectrum beta-lactamases in bacteria in a
black rat (Rattus rattus)
Ivan Literak1*
, Monika Dolejska1
, Alois Cizek2
, Chiekh Ahmed Tidiane Djigo3
, Adam
Konecny4,5
and Petr Koubek4
1
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and
Pharmaceutical Sciences, Brno, Czech Republic.
2
Department of Microbiology and Immunology, Faculty of Veterinary Medicine, University of Veterinary and
Pharmaceutical Sciences, Brno, Czech Republic.
3
Administration of the Niokolo Koba National Park, Tambacounda, Senegal.
4
Institute of Vertebrate Biology, Academy of Sciences of the Czech Republic, Brno, Czech Republic.
5
Centre de Biologie et de Gestion des Populations, INRA-IRD, Montferrier sur Lez, France.
Accepted 2 October, 2009
In Senegal, rectal swabs from cattle, wild rodents and chiropterans were cultured for Enterobacteriaceae.
Isolates were tested for susceptibility to antimicrobial agents. Two cefotaxime-resistant
isolates were found in a black rat (Rattus rattus): a multiresistant Escherichia coli with blaCTX-M-15 gene
and Enterobacter cloacae resistant to ampicillin and cephalotin with blaTEM-52b gene. Sympatric rats in
Senegal may represent an important reservoir for antibiotic-resistant. Enterobacteriaceae including
extended-spectrum beta-lactamases producing isolates.
Key words: Antibiotics, resistance, Escherichia, Enterobacter, rat, Senegal.
INTRODUCTION
Recently, bacteria isolated from feces and rectal swabs
of wild and domestic animals in Europe and North
America were examined for antimicrobial susceptibility.
Close associations were found between occurrences of
resistant bacteria in humans, domestic and sympatric
wild animals (Skurnik et al., 2006). This may have been
influenced by the use of antimicrobial agents. Data
regarding occurrence of antibiotic-resistant bacteria in
African domestic and wild mammals are limited. We
examined cattle, wild rodents and chiropterans sympatric
to humans in southeastern Senegal for the presence of
antibiotic-resistant Enterobacteriaceae. Our results are
presented and discussed in this paper.
*Corresponding author. E-mail: literaki@vfu.cz. Tel: +420541
562 630. Fax: +420 541 652 631.
MATERIAL AND METHODS
In September 2007, we examined domestic cattle (n = 48; 31 cows,
4 haifers, and 13 calves) , wild rodents (n = 45; Rattus rattus 33,
Arvicola ansorgei 4, Myomys daltoni 3, Mastomys erythroleucos 2,
Tatera guinea 2, Mus musculus 1) and chiropterans (n = 24;
Epomorphorus gambianus 19, Micropteropus pusilus 3,
Hiposideros gigas 2) sympatric to humans, from two locations in
southeastern Senegal for the presence of antibiotic-resistant
Enterobacteriaceae. Wild rodents and chiropterans were caught
using live traps and mist nets, respectively, in places inhabited by
humans. Rectal swabs obtained from all the sampled animals were
stored in Amies transport medium before laboratory testing.
Individual rectal swabs were placed overnight in Buffered
Peptone Water (BPW) (Oxoid, UK) at 37°C, and then cultured for E.
coli on Chromogenic medium for E. coli and coliform bacteria
(Oxoid). One suspect colony of each plate was identified using
API10S test kit (bioMérieux, France) and tested for susceptibility to
antimicrobial agents in accordance with CLSI (The Clinical and
Laboratory Standards Institute). Antibiotic susceptibility was tested
by disk diffusion method on Mueller-Hinton agar (Oxoid) using the
752 Afr. J. Microbiol. Res.
following antimicrobials and concentrations: amoxicillin-clavulanic
acid (30 µg), ampicillin (10 µg), cephalothin (30 µg), ceftazidime (30
µg), chloramphenicol (30 µg), ciprofloxacin (5 µg), gentamicin (10
µg), nalidixic acid (30 µg), streptomycin (10 µg), sulphamethoxazole-trimethoprim
(25 µg), sulphonamides (300 µg), and
tetracycline (30 µg) (Oxoid).In E. coli isolates found to be resistant
to one or more of the antibiotics listed above, polymerase chain
reaction (PCR) was used to detect specific antibiotic-resistance
genes, integrase genes int1 and int2, and gene cassettes within
class 1 and 2 integrons (Dolejska et al. 2007, for the list of primers
see Literak et al., in press).
For isolation of extended-spectrum beta-lactamase-producing
and quinolone-resistant Enterobacteriaceae, the samples were
enriched overnight at 37°C in MacConkey broth (Oxoid) and after
that subcultured on MacConkey agar containing cefotaxime (2 mg
L-1
) and MacConkey agar containing nalidixic acid (20 mg L-1
) to
detect Enterobacteriaceae resistant to cefotaxime and nalidixic
acid, respectively. The cefotaxime-resistant colonies were
examined using the double-disk synergy test for the production of
extended-spectrum beta-lactamase (ESBL) (CLSI 2002) and
identified by the API 10S test kit (bioMérieux). The genes responsible
for the ESBL phenotype (blaTEM, blaSHV and blaCTX-M) were
identified by PCR and the products were further analysed using
sequencing (ABI 310 Genetic Analyser, Applied Biosystems). The
primers 1537 and 1580 were used for sequencing of blaCTX-M-1 group
and the primers 686 and 757 were used for sequence analysis of
blaTEM (Literak et al., in press). Transferability of bla genes was
tested by conjugation (Literak et al., in press). Plate-mating experiments
were done using plasmid-free, rifampicin and nalidixic acid
resistant E. coli MT102RN and Salmonella Typhimurium SL5325 as
recipients (Caroff et al., 1999; Olesen et al., 2004).
RESULTS AND DISCUSSION
A total of 48 isolates of E. coli were obtained from 48
samples (one sample - one isolate) of cattle in Dar Salam
(13°15´ N, 13°12´ W). Three isolates were resistant to
tetracycline encoded by the tetA gene. Using a selective
cultivation, one more E. coli isolate resistant to nalidixic
acid but susceptible to ciprofloxacin was obtained. We do
not consider the cattle in that area of Senegal to
comprise an important reservoir of resistant E. coli nor as
a risk factor for transmitting resistant E. coli to people
living in close contact with their cattle. It should be noted
that an E. coli isolate resistant to tetracycline originating
from cattle has been documented in Kenya, which is also
in tropical Africa (Kikuvi et al., 2007).
A total of 37 and 24 E. coli isolates from 37 wild
rodents and 24 chiropterans respectively, in Dar Salam
were obtained by cultivation on Chromogenic medium.
Two (5%) isolates from wild rodents, both from black rats
(Rattus rattus), were resistant: one resistant to tetracycline
carrying the tetA gene and one multiresistant to
sulphonamides, sulphametoxazole-trimethoprim and
tetracycline with the sul2 and tetA genes. Only one (4%)
isolate from chiropterans (Micropteropus pusillus) was
resistant to tetracycline due to presence of the tetA gene.
No antibiotic-resistant isolates were obtained using
selective cultivation on media with cefotaxime or nalidixic
acid. The prevalence of resistant isolates in both wild
rodents and chiropterans in Dar Salam was low, and, as
in cattle, the most frequent resistance was to tetracycline.
The information on antimicrobial usage in people as well
as in domestic animals in Dar Salam is limited, and there
was probably only small pressure for selection of
resistant E. coli in their populations and consequently for
the spreading of resistant isolates or genetic determinants
of resistance to sympatric populations of wild
animals. A study in Indonesia showed that the use of
antimicrobials in people and domestic animals and fecal
contamination of the environment was associated with
the isolation of resistant Enterobacteriaceae in sympatric
wild rodents including black rats and chiropterans
(Graves et al., 1988).
Additionally, eight wild rodents sympatric to human
buildings were examined in Tambacounda (13°45´ N,
13°40´ W). Using cultivation on Chromogenic medium 8
E. coli isolates were obtained, however, resistance to
antimicrobials tested was not found in any isolate. Using
the selective method of cultivation on medium with
cefotaxime or nalidixic acid, two E. coli isolates resistant
to nalidixic acid and sensitive to ciprofloxacin were found
in two black rats. Moreover two isolates of cefotaximeresistant
Enterobacteriaceae were found in another black
rat. Found were an E. coli isolate resistant to ampicillin,
streptomycin, sulphonamides, sulphametoxazoletrimethoprim
and tetracycline with genes blaCTX-M-15, strA,
sul2, and tetA, as well as an Enterobacter cloacae isolate
with the blaTEM-52b gene. The bla genes failed to transfer
by conjugation into E. coli and Salmonella. Tambacounda
is a town with poor hygienic conditions where wild
rodents commonly inhabit buildings with humans and can
be easily colonized with fecal bacterial strains excreted
by humans or resistance determinants can be spread by
horizontal gene transfer.
The dissemination of ESBLs is a problem of global
magnitude, with rates of production being particularly
high in some enterobacterial species, especially
Klebsiella pneumoniae and E. coli (Rossolini et al., 2008).
Various types of ESBLs (TEM, SHV, CTX-M) has been
documented recently in human clinical isolates of
Enterobacteriacea in different regions of Africa (Kariuki et
al., 2001, Usha et al., 2008, Ehlers et al., 2009). The
CTX-M-15 beta-lactamase has been detected in hospital
isolates of Salmonella enterica in Senegal (Weill et al.,
2004), Klebsiella pneumoniae isolates connected with
community-acquired urinary tract infections in Nigeria
(Soge et al., 2006). CTX-M-15 is also wide spread in
hospital isolates of Klebsiella pneumoniae, E. coli and
Enterobacter cloacae in Algeria (Touati et al., 2006,
2007, Iabadene et al., 2008, Massai et al., 2008) and
Tunisia (Ktari et al., 2006, Abbassi et al., 2008). Global
dissemination of CTX-M-15 and importance of clonal
spreading has recently been documented by Clermont et
al. (2008). These authors reported a clone of CTX-M-15producing
E. coli spreading through Europe, Tunisia and
Central African Republic.
Recently, two children with no known antibiotic exposure
living in a remote Senegalese village, were found to be
fecal carriers of a multiresistant E. coli clone that pro-
duced CTX-M-15 beta-lactamase (Ruppe et al., 2009).
These isolates were able to transfer resistance to
cephalosporins since the presence of blaCTX-M-15 was
confirmed by PCR in the transconjugants. This highlights
the current massive spread of extended-spectrum betalactamases,
especially CTX-M-15, even in isolated
communities.
TEM-52 has been seen in non-typhoid Salmonella of
human origin and Salmonella seems to be the preferred
reservoir for this ESBL type (Yates et al., 2004; Hasman
et al., 2005). Only few TEM-52 producers are reported in
animals. The gene blaTEM-52 has been documented in E.
coli from pets (Costa et al. 2004) and food-producing
animals (Brinas et al. 2005), In the wild, the gene blaTEM-
52 has been detected in E. coli from wild birds and game
in Portugal (Costa et al., 2008, Poeta et al., 2008) and
wild boars in the Czech Republic (Literak et al., in press).
To define the extent of the spread of ESBLs, the
characterization of antibiotic-resistant bacteria needs to
be done in each geographical area and different
environments including wildlife, especially in areas where
resources are limited and antibiotics are unregulated
(Okeke et al., 1999).
We conclude that rats sympatric to humans in Senegal,
similarly as rats in Kenya (Gakyua et al., 2001), represent
a possibly important reservoir for antibiotic-resistant
Enterobacteriaceae including ESBL producing strains.
ACKNOWLEDGEMENTS
This study was funded by grants nos. MSM6215712402
(Ministry of Education, Youth and Sports of the Czech
Republic) and IAA 6093403 (Grant Agency of the
Academy of Sciences of the Czech Republic).
REFERENCES
Abbassi MS, Torres C, Achour W, Vinue L, Saenz Y, Costa D,
Bouchami O, BenHassen A (2008). Genetic characterisation of CTXM-15-producing
Klebsiella pneumoniae and Escherichia coli strains
isolated from stem cell transplant patients in Tunisia. Int. J.
Antimicrob. Agents. 32: 308–314.
Brinas L, Moreno MA, Teshager T (2005). Monitoring and
characterization of extended spectrum beta-lactamases in
Escherichia coli strains from healthy and sick animals in Spain.
Antimicrob. Agents Chemother. 49: 1262–1264.
Caroff N, Espaze E, Berard I, Richet H, Reynaud A (1999). Mutations in
the ampC promoter of Escherichia coli isolates resistant to
oxyiminocephalosporins without extended spectrum beta-lactamase
production. FEMS Microbiol. Let. 173: 459–465.
Clermont O, Lavollay M, Vimont S, Deschamps C, Forestier C, Branger
C, Denamur E, Arlet G (2008). The CTX-M-15-producing Escherichia
coli diffusing clone belongs to a highly virulent B2 phylogenetic
subgroup. J. Antimicrob. Chemother. 61: 1024–1028.
CLSI. Clinical and Laboratory Standards Institute Guidelines (2002)
Performance standards for antimicrobial disk and dilution
susceptibility tests for bacteria isolated from animals. Approved
standard M31-A2. National Committee for Clinical Laboratory
Standards, Wayne, Pa.
Costa D, Poeta P, Brinas L, Saenz Y, Rodrigues J, Torres C (2004).
Literak et al. 753
Detection of CTX M-1 and TEM-52 beta-lactamases in Escherichia coli
strains from healthy pets in Portugal. J. Antimicrob. Chemother. 54:
960–961.
Costa D, Poeta P, Saenz Y, Vinue L, Coelho AC, Matos M, RojoBezares
B, Rodrigues J, Torres C (2008). Mechanisms of antibiotic
resistance in Escherichia coli isolates recovered from wild animals.
Microb. Drug Resist. 14: 71–77.
Dolejska M, Cizek A, Literak I (2007). High prevalence of antimicrobialresistant
genes and integrons in Escherichia coli isolates from blackheaded
gulls in the Czech Republic. J. Appl. Microbiol. 103: 11–19.
Dolejska M, Bierosova B, Kohoutova L, Literak I, Cizek A (2009).
Antibiotic-resistant Salmonella and Escherichia coli isolates with
integrons and extended-spectrum beta- lactamases in surface water
and sympatric black-headed gulls. J. Appl. Microbiol. 106: 1941–
1950.
Ehlers MM, Veldsman C, Makgotlho EP, Dove MG, Hoosen AA, Kock
MM (2009). Detection of blaSHV, blaTEM and blaCTX-M antibiotic
resistance genes in randomly selected bacterial pathogens from the
Steve Biko Academic Hospital. FEMS Immunol. Med. Microbiol. 56:
191–196.
Gakuya FM, Kyule MN, Gathura PB, Kariuki S (2001). Antimicrobial
susceptibility and plasmids from Escherichia coli isolated from rats.
East Afr. Med. J. 78: 518–522.
Graves SR, Kennelly-Merrit SA, Tidemann CR, Rawlinson PA, Harvey
KJ, Thornton IWB (1988). Antibiotic-resistance patterns of enteric
bacteria of wild mammals on the Krakatau Island and West Java,
Indonesia. Phil. Trans. R. Soc. Lond. B. 322: 339–353.
Hasman H, Mevius D, Veldman K, Olesen I, Aarestrup FM (2005). Betalactamases
among extended-spectrum beta-lactamase (ESBL)resistant
Salmonella from poultry, poultry products and human
patients in The Netherlands. J. Antimicrob. Chemother. 56:115–121.
Iabadene H, Messai Y, Ammari H, Ramdani-Bouguessa N, Lounes S,
Bakour R, Arlet G (2008). Dissemination of ESBL and Qnr
determinants in Enterobacter cloacae in Algeria. J. Antimicrob.
Chemother. 62: 133–136.
Kariuki S, Corkill JE, Revathi G, Musoke R, Hart CA (2001). Molecular
characterization of a novel plasmid-encoded cefotaximase (CTX-M-
12) found in clinical Klebsiella pneumoniae isolates from Kenya.
Antimicrob. Agents Chemother. 45: 2141–2143.
Kikuvi GM, Schwarz S, Ombui NJ, Mitema ES, Kehrenberg C (2007).
Streptomycin and chloramphenicol resistance genes in Escherichia
coli isolates from cattle, pigs, and chicken in Kenya. Microb. Drug
Resist. 13: 62–68.
Ktari S, Arlet G, Mnif B, Gautier V, Mahjoubi F, Ben Jmeaa M, Bouaziz
M, Hammami A (2006). Emergence of multidrug-resistant Klebsiella
pneumoniae isolates producing VIM-4 metallo-beta-lactamase, CTXM-15
extended-spectrum beta-lactamase, and CMY-4 AmpC betalactamase
in a Tunisian university hospital. Antimicrob. Agents
Chemother. 50: 4198–4201.
Literak I, Dolejska M, Radimersky T, Klimes J, Friedman M, Aarestrup
FM, Hasman H, Cizek A. Antimicrobial-resistant faecal Escherichia
coli in wild mammals in central Europe: multiresistant E. coli
producing extended-spectrum beta-lactamases in wild boars. J. Appl.
Microbiol. In press.
Messai Y, Iabadene H, Benhassine T, Alouache S, Tazir M, Gautier V,
Arlet G, Bakour R (2008). Prevalence and characterization of
extended-spectrum beta-lactamases in Klebsiella pneumoniae in
Algiers hospitals (Algeria). Pathol. Biol. 56: 319–325.
Okeke IN, Lamikanra A, Edelman R (1999). Socioeconomic and
behavioral factors leading to acquired bacterial resistance to
antibiotics in developing countries. Emerg. Infect. Dis. 5: 18–27.
Olesen I, Hasman H, Aarestrup FM (2004). Prevalence of betalactamases
among ampicillin-resistant Escherichia coli and
Salmonella isolated from food animals in Denmark. Microb. Drug
Res. 10: 334–340.
Poeta P, Radhouani H, Igrejas G, Goncalves A, Carvalho C, Rodrigues
J, Vinue, Somalo S, Torres C (2008). Seagulls of the Berlengas
natural reserve of Portugal as carriers of fecal Escherichia coli
harboring CTX-M and TEM extended-spectrum beta lactamases.
Appl. Environ. Microbiol. 74: 7439–7441.
Rossolini GM, D’Andrea MM and Mugnaioli C (2008). The spread of
CTX-M-typeextended-spectrum beta-lactamases. Clin. Microbiol.
754 Afr. J. Microbiol. Res.
Infect. 14(1): 33–41.
Ruppe E, Woerther PL, Diop A, Sene AM, Da Costa A, Arlet G,
Andremont A, Rouveix B (2009). Carriage of CTX-M-15 – producing
Escherichia coli among remote-living children in Senegal.
Antimicrobial Agents Chemother. 53: 3135-3137.
Skurnik D, Ruimy R, Andremont A, Amorin C, Rouquet P, Picard B,
Denamur E (2006). Effect of human vicinity on antimicrobial
resistance and integrons in animal faecal Escherichia coli. J.
Antimicrob. Chemother. 57: 1215–1219.
Soge O, Queenan AM, Ojo KK, Adeniyi BA, Roberts MC (2006). CTXM-15
extended-spectrum beta-lactamase from Nigerian Klebsiella
pneumoniae. J. Antimicrob. Chemother. 57: 24–30.
Touati A, Benallaoua S, Djoudi F, Madoux J, Brasme L, De Champs C
(2006). Characterization of CTX-M-15-producing Klebsiella
pneumoniae and Escherichia coli strains isolated from hospital
environments in Algeria. Microb. Drug Res. 13: 85–89.
Touati A, Benallaoua S, Djoudi F, Madoux J, Brasme L, De Champs C
(2007). Characterization of CTX-M-15-producing Klebsiella
pneumoniae and Escherichia coli strains isolated from hospital
environments in Algeria. Microb. Drug Res. 13: 85–89.
Usha G, Chunderika M, Prashini M, Willem SA, Yusuf ES (2008).
Characterization of extended-spectrum beta-lactamases in
Salmonella spp. at a tertiary hospital in Durban, South Africa. Diagn.
Microbiol. Infect. Dis. 62: 86–91.
Weill FX, Perrier-Gros-Claude JD, Demartin M, Coignard S, Grimont PA
(2004). Characterization of extended-spectrum-beta-lactamase
(CTX-M-15)-producing strains of Salmonella enterica isolated in
France and Senegal. FEMS Microbiol. Lett. 238: 353–358.
Yates CM, Brown DJ, Edwards GF, Amye SG (2004). Detection of
TEM-52 in Salmonella enterica serovar Enteritidis isolated in
Scotland. J. Antimicrob. Chemother. 53: 407–408.
Příloha 3
LITERAK, I., DOLEJSKA, M., RADIMERSKY, T., KLIMES, J., FRIEDMAN, M., AARESTRUP, F. M.,
HASMAN, H., CIZEK, A., 2010, Antimicrobial-resistant faecal Escherichia coli in wild mammals in
central Europe: multiresistant E. coli producing extended-spectrum beta-lactamases in wild
boars: Journal of Applied Microbiology, v. 108, p. 1702-1711.
Souhrn
Vybrané druhy volně žijících savců z České a Slovenské republiky byly vyšetřeny na přítomnost rezistentních
koliformních bakterií. Z prasat divokých bylo získáno pět (6 %) izolátů E. coli s produkcí ESBL, u kterých byl gen
blaCTX-M-1 nesen na IncI1 plazmidu. Studie dokumentuje šíření klinicky významné antimikrobiální rezistence
k volně žijícím savcům.
ORIGINAL ARTICLE
Antimicrobial-resistant faecal Escherichia coli in wild
mammals in central Europe: multiresistant Escherichia coli
producing extended-spectrum beta-lactamases in
wild boars
I. Literak1
, M. Dolejska1
, T Radimersky1
, J. Klimes1
, M. Friedman1
, F.M. Aarestrup2
, H. Hasman2
and A. Cizek3
1 Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences,
Brno, Czech Republic
2 National Food Institute, Technical University of Denmark, Copenhagen, Denmark
3 Department of Microbiology and Immunology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences, Brno,
Czech Republic
Introduction
The increasing antimicrobial resistance in bacteria is a
current problem in medicine. In the veterinary area, the
alarming state of bacterial antibiotic resistance is seen in
examining the Escherichia coli isolates, where attention
has been given especially to food-producing animals such
as pigs, cattle and domestic fowl (White 2006). A phenomenon
studied rather more recently is the spreading
of resistant E. coli strains into the environment beyond
Keywords
antibiotic resistance, Czech Republic, intestinal
bacteria, Slovakia, Sus scrofa.
Correspondence
Ivan Literak, Department of Biology and
Wildlife Diseases, Faculty of Veterinary
Hygiene and Ecology, University of Veterinary
and Pharmaceutical Sciences, Palackeho 1–3,
612 42 Brno, Czech Republic.
E-mail: literaki@vfu.cz
2009 ⁄ 0712: received 23 April 2009, revised 3
September 2009 and accepted 15 September
2009
doi:10.1111/j.1365-2672.2009.04572.x
Abstract
Aims: To determine the presence of antibiotic-resistant faecal Escherichia coli in
populations of wild mammals in the Czech Republic and Slovakia.
Methods and Results: Rectal swabs or faeces collected during 2006–2008 from
wild mammals were spread on MacConkey agar and MacConkey agar containing
2 mg l)1
of cefotaxime. From plates with positive growth, one isolate was
recovered and identified as E. coli. Susceptibility to 12 antibiotics was tested
using the disk diffusion method. Resistance genes, class 1 and 2 integrons and
gene cassettes were detected in resistant isolates by polymerase chain reaction
(PCR). Extended-spectrum beta-lactamases (ESBL) were further characterized
by DNA sequencing, macrorestriction profiling and determination of plasmid
sizes. Plasmid DNA was subjected to EcoRV digestion, transferability by conjugation
and incompatibility grouping by multiplex PCR. The prevalence of resistant
isolates was 2% in small terrestrial mammals (rodents and insectivores,
nE. coli = 242), 12% in wild ruminants and foxes (nE. coli = 42), while no resistant
isolates were detected in brown bears (nE. coli = 16). In wild boars (Sus scrofa)
(nE. coli = 290), the prevalence of resistant isolates was 6%. Class 1 and 2 integrons
with various gene cassettes were recorded in resistant isolates. From wild
boars, five (2%, nrectal smears = 293) multiresistant isolates producing ESBL were
recovered: one isolate with blaCTX-M-1 + blaTEM-1, three with blaCTX-M-1 and one
with blaTEM-52b. The blaCTX-M-1 genes were carried on approx. 90 kb IncI1
conjugative plasmids.
Conclusions: Antibiotic-resistant E. coli occured in populations of wild
mammals in various prevalences.
Significance and Impact of the Study: Wild mammals are reservoirs of antibiotic-resistant
E. coli including ESBL-producing strains which were found in
wild boars.
Journal of Applied Microbiology ISSN 1364-5072
ª 2009 The Authors
Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 1
the populations directly influenced by the antibiotic
practice and the subsequent colonization of wild animal
populations.
We have studied the occurrence of resistant commensal
E. coli in the populations of various wild bird
species in the Czech Republic (Dolejska et al. 2007,
2008, 2009; Literak et al. 2007). The prevalence of resistant
E. coli was found to be high in omnivorous synanthropic
birds like black-headed gulls (Larus ridibundus)
and rooks (Corvus frugilegus), while in house sparrows
(Passer domesticus) from cattle stables the prevalence
was substantially lower. Wild birds colonized by
resistant E. coli, and particularly the synanthropic bird
species with high prevalence of resistant E. coli, can
thus become important reservoirs and vectors of these
strains that are potentially concerning because of the
presence of conjugatively transferable determinants of
resistance.
Attention has been given to some species of wild
mammals regarding the occurrence of commensal resistant
E. coli in various parts of the world (Rolland et al.
1985; Routman et al. 1985; Graves et al. 1988; Kinjo et al.
1992; Gilliver et al. 1999; Livermore et al. 2001; Swiecicka
et al. 2003; Costa et al. 2006; Kozak et al. 2009; Schierack
et al. 2009). An extensive study analysing antibiotic resistance
in 449 E. coli isolates from 77 wild mammal species
of 14 families was carried out in Australia (Sherley et al.
2000). The results from Australia demonstrated a low but
widespread prevalence of antimicrobial resistance in wild
isolates. Geographical location and host group significantly
influenced the antibiotic resistance profile of
isolates.
The goal of the present study is to characterize the
central European (Czech and Slovak) populations of wild
mammals regarding the occurrence of commensal antimicrobial-resistant
E. coli.
Material and methods
Animals
Small terrestrial mammals (Rodentia, Insectivora) were
captured in a suburban and forest environment. They
were snap trapped and dissected. During dissection,
samples of the large intestines’ contents were collected for
the subsequent E. coli isolation. In the suburban environment
of the village of Kunin (north-eastern Czech Republic),
small terrestrial mammals were captured near fields
and family houses with gardens in May 2007 and 2008.
In a forest environment frequented by people but not by
farm animals near the village of Vracov (south-eastern
Czech Republic), small terrestrial mammals were captured
in September 2008.
Large wild mammals (Cervidae, Canidae) were examined
in Poloniny National Park (NP) in north-eastern
Slovakia. Faecal samples of these mammals were collected
in winter of 2006 ⁄ 2007 and 2007 ⁄ 2008. The brown bear
(Ursus arctos) is a carnivore living in the mountains of
Slovakia. Its present population density is maintained by
regulated culling. Rectal swabs were collected from
brown bears that were shot in the Low Tatras NP in
central Slovakia during 2005–2007. The wild boar (Sus
scrofa) is common in central Europe and is a frequently
hunted game species. Rectal swabs were collected from
wild boars that were shot near Litomysl and Opava (central
and north-eastern Czech Republic) in 2006 and 2007
(Fig. 1).
Sample collection and processing
Individual rectal swabs from wild pigs, samples of intestinal
content from small terrestrial mammals or samples of
faeces were placed overnight in buffered peptone water
HUNGARY
100 km
SLOVAKIA
CZECH
REPUBLIC
POLAND
GERMANY
Wild
boars
AUSTRIA
Small
rodents
Deer, Foxes
Bears
Figure 1 Sampling sites in the Czech Republic
and Slovakia.
Antimicrobial-resistant E. coli in wild mammals I. Literak et al.
2 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology
ª 2009 The Authors
(BPW) at 37°C, then cultivated for E. coli and tested for
susceptibility to 12 antimicrobial agents as previously
described (Literak et al. 2007). Briefly, one colony of each
plate was tested for susceptibility to antimicrobial agents
in accordance with CLSI (The Clinical and Laboratory
Standards Institute, Wayne, PA, USA). Antibiotic susceptibility
was tested by disk diffusion method on Mueller–
Hinton agar (CM337; Oxoid, UK) using antibacterial
substances: amoxicillin–clavulanic acid (30 lg), ampicillin
(10 lg), cephalothin (30 lg), ceftazidime (30 lg),
chloramphenicol (30 lg), ciprofloxacin (5 lg), gentamicin
(10 lg), nalidixic acid (30 lg), streptomycin (10 lg),
trimethoprim–sulfamethoxazole (25 lg), sulfonamides
compounds (300 lg) and tetracycline (30 lg) (Oxoid). In
E. coli isolates found to be resistant to one or more of the
antibiotics listed above, polymerase chain reaction (PCR)
was used to detect specific antibiotic-resistant genes,
integrase genes int1 and int2, and gene cassettes within
class 1 and 2 integrons (Dolejska et al. 2007; Literak et al.
2007). The presence of genes tetA, tetB, tetC, tetD, tetE,
tetG, blaTEM, blaSHV, blaOXA-2-like, blaOXA-1 ⁄ -30, cat, cmlA,
floR, sul1, sul2, sul3, strA, int1, int2, variable region of
class 1 integron, variable region of class 2 integron, dhfr1,
dhfr12, dhfr17, aadA1, aadA2, aadA5, estX and sat1 ⁄2 was
tested with primers and under the conditions listed in
Table 1. The control strains E. coli F134, H195, HR17,
M2, M44, M66, M148, OP1, R128, Aeromonas sp. A233,
Salmonella enterica serovar Typhimurium DT104S1 and
Klebsiella pneumoniae ATTC700603 were used. All E. coli
strains were identified by the API 10S test (BioMerieux,
France).
The samples from BPW were enriched with
MacConkey broth and subcultivated onto MacConkey
agar containing cefotaxime (2 mg l)1
) to detect E. coli
strains with extended-spectrum beta-lactamases (ESBLs)
(Wu et al. 2008). The colonies were examined using the
double-disc synergy test for the production of ESBL
(Thomson and Sanders 1992; CLSI 2008a) and identified
by the API 10S test. The genes responsible for the
ESBL phenotype (blaTEM, blaSHV and blaCTX-M) were
identified by PCR, and the products were further analysed
using sequencing (ABI 310 Genetic Analyser;
Applied Biosystems). The primers 1537 and 1580 were
used for sequencing of blaCTX-M-1 group, and the primers
686 and 757 were used for sequence analysis of blaTEM
(Table 1).
Antimicrobial susceptibility of all the ESBL-positive
isolates was tested quantitatively by broth microdilution
with cation-adjusted Mueller–Hinton broth, according to
CLSI guidelines (CLSI 2008b). Microtitre trays were used
with dehydrated dilution ranges of custom-made panels
of antibiotics (Trek Diagnostic System, East Grinstead,
UK). The following antimicrobial agents were included in
the panel: amoxicillin–clavulanic acid, ampicillin, apramycin,
cefpodoxime, ceftiofur, cephalotin, chloramphenicol,
ciprofloxacin, colistin, florfenicol, gentamicin, nalidixic
acid, neomycin, spectinomycin, streptomycin, sulfamethoxazole,
tetracycline and trimethoprim with the test
ranges and Subcommittee on Veterinary Antimicrobial
Susceptibility Testing (CLSI⁄ VAST) breakpoints as
described previously (CLSI 2008b). Identification of
E. coli phylogenetic groups was performed using a multiplex
PCR assay (Clermont et al. 2000) in all the ESBL
isolates. By this method, E. coli isolates can be devided
into four main phylogenetic groups (A, B1, B2 and D)
according to the presence of chuA and yjaA genes and
DNA fragment TSPE4.C2. The isolates were typed by
XbaI-pulsed field gel electrophoresis (PFGE) (CDCP
2004). The samples with no band differences were
designed as indistinguishable and possibly epidemiologically
linked, and the samples with the different PFGE
patterns (more than three band changes) were epidemiologically
unrelated (Tenover et al. 1995).
Transferability of bla genes was tested by conjugation.
Plate mating experiments were performed using plasmidfree,
rifampicin-resistant and nalidixic acid-resistant
E. coli MT102RN and Salm. Typhimurium SL5325 as
recipients (Caroff et al. 1999; Olesen et al. 2004). The
strains were grown to exponential phase, mixed (1 : 1),
and 500 ll of the donor and recipient mixture was
incubated using a bacteriological filter on the surface of
blood agar at 37°C overnight. Transconjugants were
selected on brain heart infusion (BHI) medium supplemented
with 25 mg l)1
rifampicin, 32 mg l)1
nalidixic
acid and 2 mg l)1
cefotaxime.
Plasmids of ESBL strains were characterized by replicon
typing and EcoRV digestion. Primarily plasmid DNA was
extracted using the Qiagen plasmid midi kit (Qiagen,
Germany). Plasmid DNA was introduced to competent
E. coli GenehogsÒ
(Invitrogen, USA) by electroporation
followed by the selection of transformants on BHI agar
supplemented with cefotaxime (2 mg l)1
). The presence
of relevant bla gene in transformants was confirmed by
PCR. The size of the plasmid with ESBL gene from transformants
was designated by S1-PFGE. Plasmid DNA from
transformants was digested with EcoRV and subjected to
gel electrophoresis in 0Æ8% agarose gel for 4 h at
4Æ0 V cm)1
. Plasmids were replicon typed as previously
described (Carattoli et al. 2005).
The following abbreviations are used for resistance
phenotype in this study: ampicillin (A), amoxicillin–
clavulanic acid (Ac), chloramphenicol (C), cephalotin
(Cf), ceftazidime (Cfz), ciprofloxacin (Cip), gentamicin
(Gn), nalidixic acid (Na), streptomycin (S), sulfonamides
cp. (Su), trimethoprim–sulfamethoxazole (Sxt) and
tetracycline (T).
I. Literak et al. Antimicrobial-resistant E. coli in wild mammals
ª 2009 The Authors
Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 3
Table 1 List of primers for antibiotic resistance genes used in the study
Primer Primer sequence (5¢–3¢) Amplified gene
Anneling
temp. (°C)
Amplicon
size (bp) Reference
tetA ⁄ F GCT ACA TCC TGC TTG CCT TC tetA 55 210 Ng et al. (1999)
tetA ⁄ R CAT AGA TCG CCG TGA AGA GG
tetB ⁄ F TTG GTT AGG GGC AAG TTT TG tetB 55 659 Ng et al. (1999)
tetB ⁄ R GTA ATG GGC CAA TAA CAC CG
tetC ⁄ F CTT GAG AGC CTT CAA CCC AG tetC 55 418 Ng et al. (1999)
tetC ⁄ R ATG GTC GTC ATC TAC CTG CC
tetD ⁄ F AAA CCA TTA CGG CAT TCT GC tetD 55 787 Ng et al. (1999)
tetD ⁄ R GAC CGG ATA CAC CAT CCA TC
tetE ⁄ F AAA CCA CAT CCT CCA TAC GC tetE 55 278 Ng et al. (1999)
tetE ⁄ R AAA TAG GCC ACA ACC GTC AG
tetG ⁄ F CAG CTT TCG GAT TCT TAC GG tetG 55 468 Ng et al. (1999)
tetG ⁄ R GAT TGG TGA GGC TCG TTA GC
686 ACC AAT GCT TAA TCA GTG AG blaTEM 55 964 Bergenholtz et al. (2009)
757 GCG GAA CCC CTA TTT G
1354 ATG TGC AGY ACC AGT AAR GTK ATG GC blaCTX-M all 60 554 Hasman et al. (2005)
1580 TGG GTR AAR TAR GTS ACC AGA AYS AGC GG
1537 CCA TGG TTA AAA AAT CAC TGC G blaCTX-M-1 group 60 593 Bergenholtz et al. (2009)
1580 TGG GTR AAR TAR GTS ACC AGA AYS AGC GG
blaSHV ⁄ F CAC TCA AGG ATG TAT TGT G blaSHV 55 702 Brinas et al. (2002)
blaSHV ⁄ R TTA GCG TTG CCA GTG CTC G
blaOXA2 ⁄ F TTC AAG CCA AAG GCA CGA TAG blaOXA-2 like 55 885 Brinas et al. (2002)
blaOXA2 ⁄ R TCC GAG TTG ACT GCC GGG TTG
blaOXA-1F CCA AAG ACG TGG ATG blaOXA-1 ⁄ -30 55 831 EU339234
blaOXA-1R GTT AAA TTC GAC CCC AAG TT
cat ⁄ F CCT GCC ACT CAT CGC AGT cat 55 623 Guerra et al. (2001)
cat ⁄ R CCA CCG TTG ATA TAT CCC
cmlA ⁄ F TGT CAT TTA CGG CAT ACT CG cmlA 55 455 Saenz et al. (2004)
cmlA ⁄ R ATC AGG CAT CCC ATT CCC AT
floF ⁄ F GCG ATA TTC ATT ACT TTG GC floR 50 425 Faldynova et al. (2003)
floF ⁄ R TAG GAT GAA GGT GAG GAA TG
sul1 ⁄ F CTT CGA TGA GAG CCG GCG GC sul1 68 417 Zhao et al. (2001)
sul1 ⁄ R GCA AGG CGG AAA CCC GCG CC
sul2 ⁄ F AGG GGG CAG ATG TGA TCG AC sul2 58 249 Faldynova et al. (2003)
sul2 ⁄ R GCA GAT GAT TTC GCC AAT TG
sul3 ⁄ F GAG CAA GAT TTT TGG AAT CG sul3 55 789 Perreten and Boerlin (2003)
sul3 ⁄ R CAT CTG CAG CTA ACC TAG GGC TTT GGA
strA ⁄ F CCT ATC GGT TGA TCA ATG TC strA 58 250 Faldynova et al. (2003)
strA ⁄ R GAA GAG TTT TAG GGT CCA CC
intI1 ⁄ F CCT CCC GCA CGA TGA TC intI1 55 280 Zhao et al. (2001)
intI1 ⁄ R TCC ACG CAT CGT CAG GC
intI2 ⁄ F CAC GGA TAT GCG ACA AAA AGG T intI2 55 788 Saenz et al. (2004)
intI2 ⁄ R GTA GCA AAC GAG TGA CGA AAT G
5¢CS GGC ATC CAA GCA GCA AG Class 1 integron 55 Variable Levesque et al. (1995)
3¢CS AAG CAG ACT TGA CCT GA
Hep74 CGGGATCCCGGACGGCATGCACGATTTGTA Class 2 integron 55 Variable White et al. (2001)
Hep51 GATGCCATCGCAAGTACGAG
dhfr1 ⁄ F ACG GAT CCT GGC TGT TGG TTG GAC GC dhfr1 55 254 Gibreel and Skold (1998)
dhfr1 ⁄ R CGG AAT TCA CCT TCC GGC TCG ATG TC
dhfr12 ⁄ F ACT CGG AAT CAG TAC GCA dhfr12 51 462 Guerra et al. (2001)
dhfr12 ⁄ R GTG TAC GGA ATT ACA GCT
dhfr17 ⁄ F GAT TTC TGC AGT GTC AGA dhfr17 50 384 Guerra et al. (2004)
dhfr17 ⁄ R CTC AGG CAT TAT AGG GAA
aadA1 ⁄ F CGA CTC AAC TAT CAG AGG TA aadA1 51 384 AY534545
aadA1 ⁄ R CTT TTG TCA GCA AGA TAG CC
aadA2 ⁄ F CGG TGA CCA TCG AAA TTT CG aadA2 55 249 Frana et al. (2001)
Antimicrobial-resistant E. coli in wild mammals I. Literak et al.
4 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology
ª 2009 The Authors
Results
Rodentia, Insectivora
In the suburban environment of the village of Kunin, 75
small terrestrial mammals were examined (Mus musculus –
4 specimens, Apodemus agrarius – 24, Apodemus flavicollis
– 20, Apodemus sylvaticus – 2, Microtus arvalis – 6, Microtus
subterraneus – 13, Arvicola terrestris – 1, Sorex araneus – 1,
Crocidura suaveolens – 4). Escherichia coli was recovered
from 43 animals. Resistance to antibiotics was recorded in
only one isolate (1⁄ 43, 2%) from striped field mouse
(A. agrarius). It was a multiresistant isolate with the phenotype
ACSSuSxtT and with resistance genes blaTEM, cat, strA,
sul1, sul2 and tetB. Also detected was the class 1 integron
(2Æ0 kb) with gene cassette dhfr12-orf-aadA2. No isolates
with ESBL production were found.
In the forest environment near the village of Vracov,
235 small terrestrial mammals were examined (A. flavicollis
– 30 specimens, A. sylvaticus – 51, A. microps – 22,
Microtus arvalis – 3, Microtus subterraneus – 11, Clethrionomys
glareolus – 103, Sorex araneus – 12, Sorex minutus –
2, Crocidura suaveolens – 1). Escherichia coli was recovered
from 199 animals. There were four resistant isolates
(4 ⁄199, 2%). Three resistant isolates originated from bank
voles (Clethrionomys glareolus): E. coli of the phenotype A
(with the gene blaTEM), phenotype T (with the gene tetA)
and phenotype Na. One resistant isolate was from
A. sylvaticus: phenotype AT (with genes blaTEM and tetB).
No isolates with ESBL production were found.
Cervidae, Canidae, Ursus arctos
Sixty samples of faeces from Poloniny NP were
examined (Cervus elaphus – 53, Capreolus capreolus – 2,
Vulpes vulpes – 5). Escherichia coli was isolated from 42
samples. Five isolates were resistant (5⁄ 42, 12%). Four
resistant E. coli isolates originated from Cervus elaphus
with phenotype T (with tetA gene) and one isolate originated
from Vulpes vulpes with phenotype T (with tetB
gene). A total of 21 rectal swabs were collected from
U. arctos, and 16 E. coli isolates were recovered. In no
U. arctos isolate was there recorded a resistance to the
antimicrobials tested. No ESBL-producing isolates were
found.
Sus scrofa
A total of 293 rectal swabs were collected from S. scrofa,
and 290 E. coli were recovered. Antibiotic resistance was
recorded in 17 isolates (17⁄ 290, 6%) (Table 2).
Of the 293 rectal swabs, five E. coli strains (5⁄ 293, 2%)
were isolated on the medium with cefotaxime. All five
strains produced ESBL (they were positive in the double
disk synergy test). In all cases, the strains were multiresistant
(with resistance to 3–8 antibiotics), and in two
strains, class 2 integrons were found (Table 3). The genes
Table 1 (Continued)
Primer Primer sequence (5¢–3¢) Amplified gene
Anneling
temp. (°C)
Amplicon
size (bp) Reference
aadA2 ⁄ R CTA TAG CGC GGA GCG TCT CGC
aadA5 ⁄ F CAC TGG ACA CAA TCC ACC TG aadA5 55 217 EF571855
aadA5 ⁄ R CCA AGG CAC TAC TTC GCT TC
estX ⁄ F CCCATGAACCCATTATCCTG estX 55 227 DQ286459
estX ⁄ R ATGAGCAGCTTCCAGACCAT
sat ⁄ F CCGACCAAGGCTTTGAACTA sat1 ⁄ 2 55 234 DQ286459
sat ⁄ R TCGCAAATTCGATGAGACTG
Table 2 Overview of antibiotic-resistant Escherichia coli isolates from
wild boars
Number
of isolates
Phenotype
of resistance*
Resistance genes,
integrons : gene cassettes
1 A blaTEM
1 Na
1 S strA
1 S int2, estX-sat-aadA1
1 S int2, I2: 1Æ5 kb: sat-aadA1
2 T tetA
3 T tetB
1 AST blaTEM, strA, tetB
1 NaSuSxt sul1, int1, I1: 1Æ7 kb: dhfr17-aadA5
1 SSuT strA, sul2, tetA
2 SSuT strA, sul2, tetB
1 ASSuSxtT blaTEM, tetA, strA, sul1, sul2, int1,
I1: 1Æ5 kb: dhfr1-aadA1
1 AAcSSxtT blaTEM, strA, tetA, int2,
I2: 2Æ0 kb: dhfr1-sat-aadA1
*A, ampicillin; Ac, amoxicillin–clavulanic acid; Na, nalidixic acid;
S, streptomycin; Su, sulfonamides cp.; Sxt, trimethoprim–sulfamethoxazole;
T, tetracycline.
 I1, class 1 integron; I2, class 2 integron.
I. Literak et al. Antimicrobial-resistant E. coli in wild mammals
ª 2009 The Authors
Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 5
blaCTX-M-1 (three strains), blaTEM-52b (one strain) and the
combination of blaCTX-M-1 and blaTEM-1 (one strain) were
found by PCR and sequencing. PFGE analysis of all five
wild type isolates showed that each isolate produced a distinct
pulse-type. All the isolates belonged to phylogenetic
group A. The plasmids with blaCTX-M-1 were transferred by
conjugation to the E. coli MT102RN and Salm. Typhimurium
SL5325, while the plasmid with blaTEM-52b was transferred
only to E. coli. The sul2 gene transferred together
with blaCTX-M-1 genes by conjugation as well as transformation
in all the strains, thus showing the presence of
this gene on the same plasmid encoding blaCTX-M-1. All
four plasmids encoding blaCTX-M-1 had identical EcoRV
RFLP profile designated A. They belonged to the IncI
group and had a size of approx. 90 kb. The blaTEM-52bharbouring
plasmid had a distinct RFLP profile (B), and
the size of the plasmid was approx. 45 kb. In this plasmid,
however, it was not possible to specify the Inc group
by the method used.
Discussion
The low prevalence (2%) of resistant E. coli isolates in the
populations of small terrestrial mammals at two sites in
Czech Republic was probably caused by an exceptional
contact between the hosts and resistant E. coli strains
produced by either humans or domestic animals that
were capable of colonizing new hosts or at least of
enabling the horizontal transfer of genetic determinants
of antibiotic resistance to the E. coli strains that colonize
small terrestrial mammals.
By examination of small terrestrial mammals originated
from two pig farms in the Czech Republic, we found
much higher prevalences of resistant E. coli in these mammals
(11% and 54%, respectively) depending probably on
the high prevalences of resistant E. coli isolates in pigs
reared and treated with antibiotics in those farms (Literak
et al. 2009). Recently, it was also suggested that E. coli
isolates from wild small terrestrial mammals living on
swine farms in Canada have higher rates of resistance and
are more frequently multiresistant than E. coli isolates
from environments, such as natural areas, that are less
impacted by human and agricultural activities (Kozak
et al. 2009).
Exceptional, yet still most frequent, was the resistance
to tetracycline in E. coli from Czech small terrestrial
mammals. Resistance to tetracycline had been frequent
(unlike other antibiotics tested) also in E. coli isolates
from bank voles examined in Poland (Swiecicka et al.
2003). A study of antibiotic resistance in E. coli from rats
in Indonesia has suggested that tetracycline-resistant
E. coli has become established in rats in West Java,
whereas rats on the nearby uninhabited Krakatau Islands
do not contain these bacteria (Graves et al. 1988). It was
concluded that excessive or uncontrolled use of antibiotics
by human population in areas where faecal contamination
of the environment is inevitable leads to changes
in the enteric flora of wild mammals living in these areas.
We concur with that conclusion. Role of environmental
bacteria as natural resistance reservoirs and possible
source of genetic elements (Chopra and Roberts, 2001)
could be another explanation for the frequent occurrence
of tetracycline resistance in E. coli from wild mammals.
One E. coli strain isolated from the striped field mouse
showed a multiresistant pattern. It is an exceptional finding
in our study of small terrestrial mammals. However,
Table 3 Phenotypic and genotypic characteristics of ESBL-positive Escherichia coli strains from wild boars
Isolate
Nonbeta-lactam
antibiotic
resistance
phenotype* bla genes
Other antibiotic
resistance genes
and integrons 
Phylo-
genetic
groupà
Plasmid
type
(EcoRV)
bla gene
on plasmid
Incompat-
ibility
group
Plasmid
size
(approximate
kb)
Conjugation to
E. coli
Salmonella
enterica serovar
Typhimurium
85DI ⁄ B SSuT blaCTX-M-1,
blaTEM-1
strA, sul2, tetA A A blaCTX-M-1 IncI1 90 + +
137DI ⁄ B SSu blaCTX-M-1 strA, sul2 A A blaCTX-M-1 IncI1 90 + +
67DI ⁄ B SSpeSuT blaCTX-M-1 tetB, sul2, int2,
I2: 1Æ5 kb sat-aadA1
A A blaCTX-M-1 IncI1 90 + +
118DI ⁄ B SSpeSuT blaCTX-M-1 tetA, sul2, int2,
I2: 1Æ5 kb sat-aadA1
A A blaCTX-M-1 IncI1 90 + +
172DI ⁄ B T blaTEM-52b tetA A B blaTEM-52b NT§ 45 + )
ESBL, extended-spectrum beta-lactamase.
*S, streptomycin; Spe, spectinomycin; Su, sulfonamides cp.; T, tetracycline.
 I2, class 2 integron.
àThe phylogenetic groups were determinated by PCR for chuA and yjaA genes and DNA fragment TSPE4.C2 according to Clermont et al. (2000).
§NT, incompatibility group not specified by the primers used in the study.
Antimicrobial-resistant E. coli in wild mammals I. Literak et al.
6 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology
ª 2009 The Authors
the colonization of other small terrestrial mammals –
13-lined ground squirrels (Spermophilus tridecemlineatus)
– by multiresistant isolates of other Gram-negative members
of the c-proteobacteria group was recorded in the
USA (Cloud-Hansen et al. 2007).
In free-living ruminants, e.g. the Japanese serow
(Capricornis crispus), the prevalence of resistant E. coli
isolates was markedly lower compared to individuals of
the same species in captivity (Kinjo et al. 1992). At
Poloniny NP in Slovakia, the prevalence of resistant
E. coli isolates from wild mammals, particularly ruminants
but also the red fox, was 12%. This finding suggests
the existence of important sources of colonization by
resistant E. coli isolates in Poloniny NP. Meadows that
are a food source for wild ruminants in the NP are also
used for grazing of cattle. Cattle, especially calves, could
be the source of resistant isolates (Dolejska et al. 2008).
Foxes searching for food in the immediate vicinity of
human habitations, and particularly in winter, can easily
become infected with food contaminated by resistant isolates
of human origin, or domestic animals could be the
source. At villages within Poloniny NP, resistant E. coli
isolates were found also in domestic dogs (data not
shown). Both in wild ruminants and foxes from Poloniny
NP, only monoresistant isolates with resistance to tetracycline
were recorded, and we have not found the presence
of ESBL in E. coli isolates. The occurrence of ESBLproducing
E. coli from two deer (blaTEM-52) and one fox
(blaCTX-M-14 + blaTEM-1) has recently been recorded in
Portuguese NPs (Costa et al. 2006) suggesting the spreading
of such strains also into the wildlife of NPs.
Antibiotic-resistant E. coli isolates were found among
wild ruminants in the Stelvio NP, Italy (Caprioli et al.
1991). In Norway, antibiotic resistance was also found in
E. coli isolates from wild cervids, and most of the resistant
isolates were resistant to one type of antibiotics only
(Lillehaug et al. 2005). Our results from Poloniny NP
were similar. On the other hand, E. coli isolates from wild
cervids and bank voles from remote areas of Finland were
almost free of antimicrobial resistance (Osterblad et al.
2001), and thus it was suggested that the widespread
resistance found in E. coli populations must be caused by
human activities.
Class 1 and 2 integrons are genetic elements that play
an important role in the development of antibiotic resistance.
They have a worldwide distribution and are
described from Gram-negative bacteria colonizing both
humans and animals (Sunde 2005). Integrons so far characterized
have originated mostly from bacteria isolated
from environments where antibiotics are heavily used
(Sunde 2005). Recently, a class 1 integron was found in
E. coli isolated from wild reindeer (Rangifer tarandus) in
a remote mountain area in Norway (Sunde 2005). In the
present study, we have recorded class 1 and 2 integrons
in striped field mouse and wild boars. In our other studies,
we have recorded the occurrence of E. coli isolates
with class 1 and 2 integrons in both domestic and wild
animals as well as in surface waters in the Czech Republic
(Dolejska et al. 2007, 2008, 2009; Literak et al. 2007).
Class 1 integrons with the same gene cassettes as in wild
boars were found in cattle, in black-headed gulls and in
water from the pond where these gulls lived. Class 2
integrons with the same gene cassettes as in wild boars
were also recorded in black-headed gulls. It seems that
E. coli isolates possessing integrons with various gene
cassettes are emerging more and more frequently in
synanthropic wild animal populations, although these
animals are not directly influenced by antibiotics.
The occurrence of multiresistant E. coli isolates from
wild boars with ESBL-producing genes is a novelty in
Europe. In central Europe, the wild boar is a common
and widespread large mammal that lives in forest, field
and suburban habitats and is intensively hunted in many
countries (Herre 1986). Wild boars are omnivores and
can visit communal refuse sites as well as the proximity
of animal farms and consume animal waste containing
resistant E. coli strains. We assume that the presence of
multiresistant E. coli isolates with ESBL in wild boars is
caused by these sources. Bacterial resistance to multiple
antibiotics was recently documented in bacteria, including
E. coli, colonizing the avian scavengers Egyptian vultures
(Neophron percnopterus) in Spain (Blanco et al. 2007).
The prevalence of antibiotic-resistant vulture bacteria was
higher in areas where vultures consumed the highest
proportion of carrion from stabled livestock, especially
fattening pigs and poultry.
Most of the ESBL isolates from wild boars contained
the blaCTX-M-1 gene. CTX-M-1 is one of most prevalent
ESBLs in Europe. It has been frequently detected in
humans (Novais et al. 2007) as well as in food-producing
animals (Meunier et al. 2006). ESBL-producing E. coli
with blaCTX-M-1 has also been recently detected in
wild birds (Poeta et al. 2008; Dolejska et al. 2009). The
blaCTX-M-1 in all the isolates was carried on large 90 -kb
plasmids. This plasmid also carried the sulfonamideresistance
gene sul2. This plasmid seems to be of relatively
broad host range because of conjugation to the
Salmonella recipient. All the plasmids had the same RFLP
profile and belonged to the incompatibility group IncI1.
This type of plasmid has recently been associated with
blaCTX-M-1 in poultry in France (Girlich et al. 2007) and
Denmark (data not published). It provides evidence that
the ESBL-producing E. coli selected for in humans and
food-producing animals are colonizing wild animals,
which can thus become reservoirs and possible vectors of
these strains into the environment.
I. Literak et al. Antimicrobial-resistant E. coli in wild mammals
ª 2009 The Authors
Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 7
The gene blaTEM-52b was found in one E. coli isolate
from a wild boar. TEM-52 has been seen in nontyphoid
Salmonella of human origin, and Salmonella seems to be
the preferred reservoir for this ESBL type (Yates et al.
2004; Hasman et al. 2005). The gene blaTEM-52 has also
been documented in E. coli from pets (Costa et al. 2004),
food-producing animals (Brinas et al. 2005) and recently
also in wild birds and game in Portugal (Costa et al.
2008; Poeta et al. 2008).
In central Europe, we can observe a widespread occurrence
of antimicrobial resistance in E. coli isolates from
wildlife. We suppose similarly as do Skurnik et al. (2006)
that antimicrobial resistance found in E. coli from wild
mammals is anthropogenic. Among wild mammals, the
wild boar plays an important role in the circulation of
resistant E. coli isolates including isolates with integrons
and ESBL production. The wild boar can be considered
an important reservoir and vector of these strains in the
environment.
Acknowledgements
We are grateful to K. Dibdakova, L. Hanusova, N. Horakova,
L. Chudobova, F. Kupka, T. Najer, J. Mikulska,
S. Ondrus, P. Slamova, M. Slavikova and E. Suchanova
for their assistance in the field and ⁄or in the laboratory.
This study was funded by Grant No. MSM6215712402 of
the Ministry of Education, Youth and Sports of the Czech
Republic. Capture, euthanasia and examination of small
terrestrial mammals were approved by the Ethical Commission
of the Ministry of Education, Youth and Sports
of the Czech Republic.
References
Bergenholtz, R.D., Jorgensen, M.S., Hansen, L.H., Jensen, L.B.
and Hasman, H. (2009) Characterization of genetic determinants
of extended-spectrum cephalosporinases (ESCs) in
Escherichia isolates from Danish and imported poultry
meat. J Antimicrob Chemother 64, 207–209.
Blanco, G., Lemus, J.A., Grande, J., Gangoso, L., Grande, J.M.,
Donazar, J.A., Arroyo, B., Frias, O. et al. (2007) Geographical
variation in cloacal microflora and bacterial antibiotic
resistance in a threatened avian scavenger in relation to
diet and livestock farming practices. Environ Microbiol 9,
1738–1749.
Brinas, L., Zarazaga, M., Saenz, Y., Ruiz-Larrea, F. and Torres,
C. (2002) b-lactamases in ampicillin-resistant Escherichia
coli isolates from foods, humans, and healthy animals.
Antimicrob Agents Chemother 46, 3156–3160.
Brinas, L., Moreno, M.A. and Teshager, T. (2005) Monitoring
and characterization of extended-spectrum beta-lactamases
in Escherichia coli strains from healthy and sick animals
in Spain in 2003. Antimicrob Agents Chemother 49,
1262–1264.
Caprioli, A., Donelli, G., Falbo, V., Passi, C., Pagano, A. and
Mantovani, A. (1991) Antimicrobial resistance and production
of toxins in Escherichia coli strains from wild ruminants
and the alpine marmot. J Wildl Dis 27, 324–327.
Carattoli, A., Bertini, A., Villa, L., Falbo, V., Hopkins, K.L.
and Threlfall, E.J. (2005) Identification of plasmids by
PCR-based replicon typing. J Microbiol Methods 63,
219–228.
Caroff, N., Espaze, E., Berard, I., Richet, H. and Reynaud, A.
(1999) Mutations in the ampC promoter of Escherichia coli
isolates resistant to oxyiminocephalosporins without
extended spectrum beta-lactamase production. FEMS
Microbiol Lett 173, 459–465.
Center for Disease Control and Prevention (2004) Standardized
Molecular Subtyping of Foodborne Bacterial Pathogens by
Pulsed-Field Gel Electrophoresis. Atlanta, GA: The National
Molecular Network for Foodborne Disease Surveillance
CDCP.
Chopra, I. and Roberts, M. (2001) Tetracyclin antibiotics:
Mode of action, applications, molecular biology, and
epidemiology of bacterial resisdance. Microbiol Mol Biol
Rev 65, 232–260.
Clermont, O., Bonacorsi, S. and Bingen, E. (2000) Rapid and
simple determination of Escherichia coli phylogenetic
group. Appl Environ Microbiol 66, 4555–4558.
Clinical and Laboratory Standards Institute (2008a) Performance
Standards for Antimicrobial Susceptibility Testing;
8th Informational Supplement. Wayne, PA: CLSI.
Clinical and Laboratory Standards Institute (2008b) Performance
Standards for Antimicrobial Disc and Dilution Susceptibility
Tests for Bacteria Isolated From Animals; Approved Standard
3rd Edition. Wayne, PA: CLSI.
Cloud-Hansen, K.A., Villiard, K.M., Handelsman, J. and Carey,
H.V. (2007) Thirteen-lined ground squirrels (Spermophilus
tridecemlineatus) harbor multiantibiotic-resistant bacteria.
J Am Assoc Lab Anim Sci 46, 17–20.
Costa, D., Poeta, P., Brinas, L., Saenz, Y., Rodrigues, J. and
Torres, C. (2004) Detection of CTX-M-1 and TEM-52
beta-lactamases in Escherichia coli strains from healthy pets
in Portugal. J Antimicrob Chemother 54, 960–961.
Costa, D., Poeta, P., Saenz, Y., Vinue, L., Rojo-Bezares, B.,
Jouini, A., Zarazaga, M., Rodrigues, J. et al. (2006)
Detection of Escherichia coli harbouring extended-spectrum
b-lactamases of the CTX-M, TEM and SHV classes in
faecal samples of wild animals in Portugal. J Antimicrob
Chemother 58, 1311–1312.
Costa, D., Poeta, P., Saenz, Y., Vinue, L., Coelho, A.C., Matos,
M., Rojo-Bezares, B., Rodrigues, J. et al. (2008) Mechanisms
of antibiotic resistance in Escherichia coli recovered
from wild animals. Microb Drug Resist 14, 71–77.
Dolejska, M., Cizek, A. and Literak, I. (2007) High prevalence
of antimicrobial-resistant genes and integrons in
Antimicrobial-resistant E. coli in wild mammals I. Literak et al.
8 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology
ª 2009 The Authors
Escherichia coli isolates from black-headed gulls in the
Czech Republic. J Appl Microbiol 103, 11–19.
Dolejska, M., Senk, D., Cizek, A., Rybarikova, J., Sychra, O.
and Literak, I. (2008) Antimicrobial resistant Escherichia
coli isolates in cattle and house sparrows on two Czech
dairy farms. Res Vet Sci 85, 491–494.
Dolejska, M., Bierosova, B., Kohoutova, L., Literak, I. and
Cizek, A. (2009) Antibiotic-resistant Salmonella and
Escherichia coli isolates with integrons and extendedspectrum
beta-lactamases in surface water and sympatric
black-headed gulls. J Appl Microbiol, 106, 1941–1950.
Faldynova, M., Pravcova, M., Sisak, F., Havlickova, H., Kolackova,
I., Cizek, A., Karpiskova, R. and Rychlik, I. (2003)
Evolution of antibiotic resistance in Salmonella enterica
serovar Typhimurium strains isolated in Czech Republic
between 1984 and 2002. Antimicrob Agents Chemother 47,
2002–2005.
Frana, T.S., Carlson, S.A. and Griffith, R.W. (2001) Relative
and conservation of genes encoding aminoglycosidemodifying
enzymes in Salmonella enterica serotype
Typhimurium phage type DT104. Appl Environ Microbiol
67, 445–448.
Gibreel, A. and Skold, O. (1998) High-level resistance to trimethoprim
in clinical isolates of Campylobacter jejuni by
acquisition of foreign genes (dfr1 and dfr9) expressing
drug-intensive dihydrofolate reductases. Antimicrob Agents
Chemother 42, 3059–3064.
Gilliver, M.A., Bennett, M., Begon, M., Hazel, S.M. and Hart,
C.A. (1999) Antibiotic resistance found in wild rodents.
Nature 401, 233–234.
Girlich, D., Poirel, L., Carattoli, A., Kempf, I., Lartigue, M.F.,
Bertini, A. and Nordmann, P. (2007) Extended-spectrum
beta-lactamase CTX-M-1 in Escherichia coli isolates from
healthy poultry in France. Appl Environ Microbiol 73,
4681–4685.
Graves, S.R., Kennely-Merrit, S.A., Tidemann, C.R., Rawlinson,
P.A., Harvey, K.J. and Thorton, I.W.B. (1988) Antibiotic
resistance patterns of enteric bacteria of wild mammals on
the Krakatau Islands and West Java, Indonesia. Philos
Trans R Soc Lond B Biol Sci 322, 339–353.
Guerra, B., Soto, S.M., Arguelles, J.M. and Mendoza, M.C.
(2001) Multidrug resistance is mediated by large plasmids
carrying a class 1 integron in the emergent Salmonella
enterica serotype [4,5,12:i–]. Antimicrob Agents Chemother
45, 1305–1308.
Guerra, B., Junker, E., Miko, A., Helmuth, R. and Mendoza,
M.C. (2004) Characterization and localization of drug
resistance determinants in multidrug-resistant, integroncarrying
Salmonella enterica serotype Typhimurium strains.
Microb Drug Resist 10, 83–91.
Hasman, H., Mevius, D., Veldman, K., Olesen, I. and
Aarestrup, F.M. (2005) Beta-lactamases among extendedspectrum
beta-lactamase (ESBL)-resistant Salmonella from
poultry, poultry products and human patients in The
Netherlands. J Antimicrob Chemother 56, 115–121.
Herre, W. (1986) Sus scrofa – Wildschwein. In Handbuch der
Saugetiere Europas. Band2 ⁄ II Paarhufer – Artiodactyla
(Suidae, Cervidae, Bovidae) ed. Niethammer, J. and Krapp,
F. pp. 36–66. Wiesbaden, Germany: AULA-Verlag.
Kinjo, T., Minamoto, N., Sugiyama, M. and Sugiyama, Y.
(1992) Comparison of antimicrobial resistant Escherichia
coli in wild and captive Japanese serows. J Vet Med Sci 54,
821–827.
Kozak, G.K., Boerlin, P., Janecko, N., Reid-Smith, R.J. and
Jardine, C. (2009) Antimicrobial resistance in Escherichia
coli isolates from swine and wild small mammals in the
proximity of swine farms and in natural environments
in Ontario, Canada. Appl Environ Microbiol 75, 559–
566.
Levesque, C., Piche, L., Larose, C.L. and Roy, P.H. (1995) PCR
mapping of integrons reveals several novel combinations
of resistance genes. Antimicrob Agents Chemother 29, 185–
191.
Lillehaug, A., Bergsjo, B., Schau, J., Bruheim, T., Vikoren, T.
and Handeland, K. (2005) Campylobacter spp., Salmonella
spp., verocytogenic Escherichia coli, and antibiotic
resistance in indicator organisms in wild cervids.
Acta Vet Scand 46, 23–32.
Literak, I., Vanko, R., Dolejska, M., Cizek, A. and Karpiskova,
R. (2007) Antibiotic resistant Escherichia coli and Salmonella
in Russian rooks (Corvus frugilegus) wintering in the
Czech Republic. Lett Appl Microbiol 45, 616–625.
Literak, I., Dolejska, M., Rybarikova, J., Cizek, A., Strejckova,
P., Vyskocilova, M., Friedman, M. and Klimes, J. (2009)
Highly variable patterns of antimicrobial resistance in
commensal Escherichia coli isolates from pigs, rodents and
flies. Microb Drug Resist 15, 229–234.
Livermore, D.M., Warner, M., Hall, L.M.C., Enne, V.I., Projan,
S.J., Dunman, P.M., Wooster, S.L. and Harrison, G. (2001)
Antibiotic resistance in bacteria from magpies (Pica pica)
and rabbits (Oryctolagus cuniculus) from west Wales.
Environ Microbiol 3, 658–661.
Meunier, D., Jouy, E., Lazizzera, C., Kobisch, M. and Madec,
J.Y. (2006) CTX-M-1 and CTX-M-15-type beta-lactamases
in clinical Escherichia coli isolates recovered from foodproducing
animals in France. Int J Antimicrob Agents 28,
402–407.
Ng, L.K., Mulvey, M.R., Martin, I., Peters, G.A. and Johnson,
W. (1999) Genetic characterization of antimicrobial
resistance in Canadian isolates of Salmonella serovar
typhimurium DT104. Antimicrob Agents Chemother 43,
3018–3021.
Novais, A., Canton, R., Moreira, R., Peixe, L., Baquero, F. and
Coque, T.M. (2007) Emergence and dissemination of
Enterobacteriaceae isolates producing CTX-M-1-like
enzymes in Spain are associated with IncFII (CTX-M-15)
and broad-host-range (CTX-M-1, -3, and -32) plasmids.
Antimicrob Agents Chemother 51, 796–799.
Olesen, I., Hasman, H. and Aarestrup, F.M. (2004) Prevalence
of beta-lactamases among ampicillin-resistant Escherichia
I. Literak et al. Antimicrobial-resistant E. coli in wild mammals
ª 2009 The Authors
Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 9
coli and Salmonella isolated from food animals in
Denmark. Microb Drug Resist 10, 334–340.
Osterblad, M., Norrdahl, K., Korpimaki, E. and Huovinen, P.
(2001) Antibiotic resistance. How wild are wild mammals?
Nature 409, 37–38.
Perreten, V. and Boerlin, P. (2003) A new sulfonamide resistance
gene (sul3) in Escherichia coli is widespread in pig
population of Switzerland. Antimicrob Agents Chemother
47, 1169–1172.
Poeta, P., Radhouani, H., Igrejas, G., Goncalves, A., Carvalho,
C., Rodrigues, J., Vinue, L., Somalo, S. et al. (2008)
Seagulls of the Berlengas natural reserve of Portugal as
carriers of fecal Escherichia coli harboring CTX-M and
TEM extended-spectrum beta-lactamases. Appl Environ
Microbiol 74, 7439–7441.
Rolland, R.M., Hausfater, G., Marshall, B. and Levy, S.B.
(1985) Antibiotic resistant bacteria in wild primates:
increased prevalence in baboons feeding on human refuse.
Appl Environ Microbiol 49, 791–794.
Routman, E., Miller, R.D., Phillips-Conroy, J. and Hartl, D.L.
(1985) Antibiotic resistance and population structure in
Escherichia coli from free-ranging African yellow baboons.
Appl Environ Microbiol 50, 749–754.
Saenz, Y., Brinas, L., Dominguez, E., Ruiz, J., Zarazaga, M.,
Vila, J. and Torres, C. (2004) Mechanisms of resistance in
multiple-antibiotic-resistant Escherichia coli strains of
human, animal, and food origin. Antimicrob Agents
Chemother 48, 3996–4001.
Schierack, P., Romer, A., Jores, J., Kaspar, H., Guenther, S.,
Filter, M., Eichberg, J. and Wieler, L.H. (2009) Isolation
and characterization of intestinal Escherichia coli clones
from wild boars in Germany. Appl Environ Microbiol 75,
695–702.
Sherley, M., Gordon, D.M. and Collignon, P.J. (2000) Variations
in antibiotic resistance profile in Enterobacteriaceae
isolated from wild Australian mammals. Environ Microbiol
2, 620–631.
Skurnik, D., Ruimy, R., Andremont, A., Amorin, C., Rouquet,
P., Picard, B. and Denamur, E. (2006) Effect of human
vicinity on antimicrobial resistance and integrons in
animal faecal Escherichia coli. J Antimicrob Chemother 57,
1215–1219.
Sunde, M. (2005) Class I integron with a group II intron
detected in an Escherichia coli strain from a free-range
reindeer. Antimicrob Agents Chemother 49, 2512–2514.
Swiecicka, I., Buczek, J. and Iwaniuk, A. (2003) Analysis of
genetic relationships and antimicrobial susceptibility of
Escherichia coli isolated from Clethrionomys glareolus. J Gen
Appl Microbiol 49, 315–320.
Tenover, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A.,
Murray, B.E., Persing, D.H. and Swaminathan, B. (1995)
Interpreting chromosomal DNA restriction patterns
produced by pulsed-field gel electrophoresis: criteria
for bacterial strain typing. J Clin Microbiol 3, 2233–
2239.
Thomson, K.S. and Sanders, C.C. (1992) Detection of
extended-spectrum beta-lactamases in members of the
family Enterobacteriaceae: comparison of the double-disk
and three-dimensional tests. Antimicrob Agents Chemother
36, 1877–1882.
White, D.G. (2006) Antimicrobial resistance in pathogenic
Escherichia coli from animals. In Antimicrobial Resistance
in Bacteria of Animal Origin ed. Aarestrup, F.M. pp. 145–
166. Washington, DC: ASM Press.
White, P.A., McIver, C.J. and Rawlinson, W.D. (2001)
Integrons and gene cassettes in the Enterobacteriaceae.
Antimicrob Agents Chemother 45, 2658–2661.
Wu, S., Chouliara, E., Hasman, H., Dalsgaard, A., Vieira, A.
and Jensen, L.B. (2008) Detection of a single isolate of
CTX-M-1-producing Escherichia coli from healthy pigs in
Denmark. J Antimicrob Chemother 61, 747–749.
Yates, C.M., Brown, D.J., Edwards, G.F. and Amyes, S.G.
(2004) Detection of TEM-52 in Salmonella enterica serovar
Enteritidis isolated in Scotland. J Antimicrob Chemother
53, 407–408.
Zhao, S., White, D.G., Ge, B., Ayers, S., Friedman, S., English,
L., Wagner, D., Gainers, S. et al. (2001) Identification and
characterization of integron-mediated antibiotic resistance
among shiga toxin-producing Escherichia coli isolates. Appl
Environ Microbiol 67, 1558–1564.
Antimicrobial-resistant E. coli in wild mammals I. Literak et al.
10 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology
ª 2009 The Authors
Příloha 4
LITERAK, I., DOLEJSKA, M., JANOSZOWSKA, D., HRUSAKOVA, J., WLODZIMIERZ, M., RZYSKA, H.,
BZOMA, S., CIZEK, A. (2010) Antibiotic-resistant Escherichia coli bacteria, including strains with
genes encoding the extended-spectrum beta-lactamase and QnrS, in waterbirds on the Baltic
Sea coast of Poland: Applied and Environmental Microbiology, v. 76, p. 8126-8134.
Souhrn
V této studii byly různé druhy vodních ptáků z pobřeží Baltského moře v Polsku vyšetřeny na přítomnost E. coli
s produkcí ESBL a plazmidově determinovanou rezistencí k fluorochinolonům. Byly izolovány E. coli s geny
blaCTX-M-1, blaCTX-M-9, blaCTX-M-15 nebo blaSHV-12, které byly neseny epidemickými IncI1 nebo IncN plazmidy.
Snížená citlivost k fluorochinolonům byla spojena s genem qnrS1 vázaným na IncX1, IncX2 nebo IncN plazmidy.
Studie poukazuje na šíření bakterií s klinicky významnými mechanismy plazmidově kódované rezistence k volně
žijícím vodním ptákům.
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2010, p. 8126–8134 Vol. 76, No. 24
0099-2240/10/$12.00 doi:10.1128/AEM.01446-10
Copyright © 2010, American Society for Microbiology. All Rights Reserved.
Antibiotic-Resistant Escherichia coli Bacteria, Including Strains with
Genes Encoding the Extended-Spectrum Beta-Lactamase
and QnrS, in Waterbirds on the Baltic
Sea Coast of Polandᰔ
Ivan Literak,1
* Monika Dolejska,1
Dagmar Janoszowska,1
Jolana Hrusakova,1
Wlodzimierz Meissner,2
Hanna Rzyska,2
Szymon Bzoma,3
and Alois Cizek4
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and
Pharmaceutical Sciences, Palackeho 1-3, 612 42 Brno, Czech Republic1
; Avian Ecophysiology Unit, Department of
Vertebrate Ecology and Zoology, Gdansk University, Al. Legionow 9, 80 441 Gdansk, Poland2
; Department of
Fishery Resources, Sea Fisheries Institute, Kollataja 1, 81 332 Gdynia, Poland3
; and Department of Microbiology and
Immunology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences,
Palackeho 1-3, 612 42 Brno, Czech Republic4
Received 17 June 2010/Accepted 11 October 2010
Individual cloacal swabs of mallards (Anas platyrhynchos) and of herring gulls (Larus argentatus), as well as
samples of waterbird feces obtained in 2008 and 2009, were cultivated for Escherichia coli. Isolates of E. coli were
tested for susceptibilities to 12 antimicrobial agents by the disk diffusion method. Moreover, the samples were
subcultivated on MacConkey agar (MCA) containing cefotaxime (2 mg liter؊1
) to detect E. coli with extendedspectrum
beta-lactamase (ESBL) and subsequently on MCA supplemented with ciprofloxacin (0.05 mg liter؊1
) and
MCA with nalidixic acid (20 mg liter؊1
) to isolate fluoroquinolone-resistant E. coli. PCR was used to detect specific
antibiotic resistance genes. We found 9 E. coli isolates producing ESBL with bla genes: blaCTX-M-1 (6 isolates),
blaCTX-M-9 plus blaTEM-1b (1 isolate), blaCTX-M-15 plus blaOXA-1 (1 isolate), and blaSHV-12 (1 isolate). In the isolate
with blaCTX-M-15, the gene aac(6)-Ib-cr was also detected. The bla genes were harbored by transferable plasmids of
the IncN and IncI1 groups. Nine quinolone-resistant E. coli isolates with qnrS genes were found and characterized.
The gene qnrS was associated with a Tn3-like transposon on the IncX1 plasmid together with blaTEM-1 in two
isolates. The gene qnrS was also harbored by conjugative plasmids of the IncN and IncX2 groups. Even if
populations of wild birds are not directly influenced by antibiotic practice, we have demonstrated that antibioticresistant
E. coli strains, including strains with various ESBL and qnrS genes, are found in the feces of wild birds on
the coast of the Baltic Sea in Poland.
There is considerable concern about antibiotic resistance in
bacteria from humans and farm animals, but the spread of
resistance into wider ecosystems has received much less attention
(48). Usually, isolates of the common intestinal bacterium
Escherichia coli are examined to detect antibiotic resistance in
populations of wild animals. Wild birds are colonized with
various strains of E. coli, including strains such as E. coli O157
that are pathogenic for humans (83). Fecal strains of E. coli
resistant to antibiotics have been found at various prevalences
in wild bird populations. In particular, bird populations sympatric
to areas inhabited by people and areas with a high
density of livestock were colonized with antibiotic-resistant E.
coli strains possibly selected by the antibiotic practice in humans
and domestic animals. Antibiotic-resistant E. coli isolates
have been found in corvids (Corvus corone, C. frugilegus, C.
macrorhynchos, Pica pica, and Pyrrhocorax pyrrhocorax) (3, 46,
48, 53, 74), house sparrows (Passer domesticus) (22, 61), house
martins (Delichon urbica) (73), feral pigeons (Columba livia
forma domestica) (68), ducks, geese, and swans (Anas platyrhynchos,
Anas acuta, Branta canadensis, and Cygnus columbianus)
(17, 26, 51, 82), cormorants (Phalacrocorax auritus and P.
cristatus) (20, 71), Egyptian vultures (Neophron percnopterus)
(2), and, most frequently, in various gull species throughout
the world (Larus argentatus, L. atricilla, L. audouinii, L. cachinans,
L. crassirostris, L. glaucoides, L. hyperboreus, L. marinus,
L. ridibundus, and L. vagae) (4, 7, 21, 23, 29, 66, 71, 76, 82).
Corvids and gulls feeding on garbage dumps and in urbanized
areas are frequently colonized with resistant strains of E. coli,
and they are considered to be important reservoirs and vectors
of these isolates in the environment (23, 46).
The occurrence of antibiotic resistance in E. coli from surface
water and fecal pollution sources (wastewater treatment
plants and bird feces) was studied in the inland Hamilton
Harbor on Lake Ontario, Canada (24). Authors of the study
suggested that at times, feces of wild geese, ducks, and gulls
may be a more prominent contributor of resistant E. coli to a
beach near Hamilton than are municipal wastewater sources.
Thousands of great cormorants (Phalacrocorax carbo), gulls
(Larus argentatus, L. ridibundus, L. canus, and L. marinus) and
mallards (Anas platyrhynchos) winter in Puck Bay on the Polish
coast of the Baltic Sea (50). Many of them stay near the two
biggest cities of this region, Gdynia and Gdansk, in harbors,
* Corresponding author. Mailing address: Department of Biology
and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology,
University of Veterinary and Pharmaceutical Sciences, Palackeho 1-3,
612 42 Brno, Czech Republic. Phone: 420 541 562 630. Fax: 420 541
562 631. E-mail: literaki@vfu.cz.
ᰔ
Published ahead of print on 15 October 2010.
8126
municipal beaches, build-up areas, and city parks situated near
the seacoast. We were concerned about antimicrobial-resistant
E. coli, including strains producing extended-spectrum betalactamase
(ESBL) and carrying class 1 and 2 integrons with
resistant gene cassettes in these birds. Resistant E. coli isolates
producing ESBL have been found in black-headed gulls (L.
ridibundus) in the Czech Republic, yellow-legged gulls (Larus
michahellis) in France, and seagulls of diverse species (not
determined) in Portugal (4, 23, 66). Resistant isolates carrying
class 1 and 2 integrons have been found in Canada geese
(Branta canadensis) in the United States, black-headed gulls
and rooks (Corvus frugilegus) in the Czech Republic, Mediterranean
herring gulls (Larus cachinans) in Italy, and seagulls in
Portugal (4, 17, 21, 23, 29, 46, 66). We also were concerned
about strains resistant to fluoroquinolones, since such strains
have emerged recently in gulls (L. audouinii, L. cachinans, L.
glaucoides/L. hyperboreus, and L. ridibundus) in Italy, Portugal,
Greenland, and the Czech Republic (7, 23, 29, 76).
MATERIALS AND METHODS
Locations, birds, and feces samples. The samples were collected on the Polish
coast of the Baltic Sea within or near Gdynia and Gdansk (Fig. 1). Mallards
(Anas platyrhynchos) were caught in the city parks of Gdansk (n ϭ 46) and also
in Bolszewo (n ϭ 32), Kwidzyn (n ϭ 5), Zduny (n ϭ 2), and Kartuzy (n ϭ 1)
during winter 2008/2009 and in November and December 2009. The latter four
places are located in a region of lakes around Gdansk within a distance of up to
50 km from that city. Cloacal smears were obtained from 86 mallards in total.
Herring gulls (Larus argentatus) were caught in Gdynia during winter 2008/2009
(adults) and during the nesting period (pulli) in 2009. Cloacal smears were
obtained from 27 herring gulls. There is a large wave breaker within Gdynia’s
harbor that has no connection with the coast. On the shore at a distance of about
6 km from the harbor, there is also an old and abandoned army building standing
on water near (300 m) a coast, near one of the Gdynia districts called Babie Doly.
Especially inasmuch as public entry is prohibited to both of these, they are
frequently used by waterbirds (gulls, cormorants, and sometimes also ducks) for
resting, and many of their feces occur there. We collected samples of bird feces
from both of these structures in January 2009. We obtained in total 244 samples
(119 and 125 from the wave breaker and army building, respectively). A large
roosting place for wintering great cormorants lies along the coast in Swarzewo,
about 30 km from Gdynia. Here we collected 125 samples of cormorant feces in
January 2009. Cormorants were daily moving from this roosting place to various
places near the seacoast, including the sea close to Gdynia and Gdansk.
Nonselective antibiotic-resistant E. coli isolation and characterization. Individual
cloacal swabs and samples of feces were transported to the laboratory and
placed overnight in buffered peptone water (BPW) at 37°C and then cultivated
for E. coli on selective chromogenic medium for E. coli and coliform bacteria
(CM0956; Oxoid, United Kingdom). One colony of each plate was tested for
susceptibilities to antimicrobial agents by the disk diffusion method in accordance
with the Clinical and Laboratory Standards Institute (16). Susceptibilities
to the following antibacterial substances were tested: amoxicillin-clavulanic acid
(30 ␮g), ampicillin (10 ␮g), cephalothin (30 ␮g), ceftazidime (30 ␮g), chloramphenicol
(30 ␮g), ciprofloxacin (5 ␮g), gentamicin (10 ␮g), nalidixic acid (30 ␮g),
streptomycin (10 ␮g), sulfamethoxazole-trimethoprim (25 ␮g), sulfonamide
compounds (300 ␮g), and tetracycline (30 ␮g) (Oxoid). In E. coli isolates found
to be resistant to one or more of the antibiotics listed above, PCR was used to
detect specific antibiotic resistance genes, integrase genes int1 and int2, and gene
cassettes within class 1 and 2 integrons (47). The presence of the genes tetA, tetB,
tetC, tetD, tetE, tetG, blaTEM, blaSHV, blaOXA-1 like, cat, cmlA, floR, sul1, sul2, sul3,
strA, int1, int2, variable regions of class 1 and class 2 integrons, dhfr1, dhfr12,
dhfr17, aadA1, aadA2, aadA5, estX, and sat1 and sat2 were tested with primers
and under conditions as described elsewhere (47). All resistant E. coli strains
were identified by the API 10S test (bioMerieux, France).
Selective isolation of ESBL and quinolone-resistant isolates. All samples from
BPW were subsequently enriched in MacConkey broth and subcultivated on
MacConkey agar (MCA) containing cefotaxime (2 mg literϪ1
) to detect E. coli
strains with ESBL (84) and subsequently on MCA supplemented with ciprofloxacin
(0.05 mg literϪ1
) to isolate fluoroquinolone-resistant E. coli. Samples of
waterbird feces from BPW were enriched in MacConkey broth and also subcultivated
on MCA containing nalidixic acid (20 mg literϪ1
) to detect E. coli strains
resistant to nalidixic acid and possibly other quinolones.
PCR for ESBL/quinolone resistance genes. The colonies grown on MCA with
cefotaxime were examined using the double-disk synergy test (DDST) for the
production of ESBL (16, 80). The genes responsible for the ESBL phenotype
(blaTEM, blaSHV, and blaCTX-M) were identified by PCR as described elsewhere
(5, 45, 64). All the PCR products were further analyzed using sequencing (ABI
310 genetic analyzer; Applied Biosystems). The colonies grown on MCA with
ciprofloxacin or nalidixic acid were tested for the plasmid-encoded quinolone
resistance genes qnrA, qnrB, qnrC, qnrD, qnrS, qepA, and aac(6Ј)-Ib by PCR as
described elsewhere (9, 11, 25, 41, 57, 63, 70, 78, 85), and MICs for nalidixic acid
and ciprofloxacin were determined by the agar dilution method in accordance
with Clinical and Laboratory Standards Institute standards (16). In all the isolates
positive for plasmid-harbored quinolone resistance genes with high MIC
levels for nalidixic acid and ciprofloxacin, the gyrA and parC genes were detected
by PCR and analyzed by sequencing. All isolates resistant to ampicillin and/or
amoxicillin-clavulanic acid, as determined during nonselective isolations, were
tested also by DDST for the production of ESBL. All isolates resistant to
nalidixic acid and/or ciprofloxacin, as determined during nonselective isolation,
were also tested for the presence of the qnrA, qnrB, qnrC, qnrD, qnrS, qepA, and
aac(6Ј)-Ib genes.
Molecular characterization of ESBL/quinolone-resistant isolates. Antimicrobial
susceptibilities of the ESBL-positive and quinolone-resistant E. coli isolates
were examined by the disk diffusion method, and the isolates were tested for
additional antibiotic resistance genes (see above). Identification of E. coli
phylogenetic groups and determination of the presence of the cib gene for
FIG. 1. Map of the Polish coast of the Baltic Sea, where the samples were collected. Mallards (Anas platyrhynchos) originated at Gdansk,
Bolszewo, Kwidzin, Zduny, and Kartuzy, herring gulls (Larus argentatus) from Gdynia, and samples of waterbird feces from Gdynia, Babie Doly,
and Swarzewo.
VOL. 76, 2010 ANTIBIOTIC-RESISTANT E. COLI IN WATERBIRDS IN POLAND 8127
colicin production were performed using PCR (15). The isolates were typed
by XbaI pulsed-field gel electrophoresis (PFGE) (12). Those samples with no
band differences were designated indistinguishable and possibly epidemiologically
linked.
Transferability of antibiotic resistance genes. Transferability of ESBL and
plasmid-encoded quinolone resistance genes was tested by conjugation. Platemating
experiments were done using plasmid-free, rifampin and nalidixic acidresistant
E. coli MT102RN and Salmonella enterica serovar Typhimurium SL5325
as recipients (in the case of a donor strain having resistance to quinolone,
recipients resistant to rifampin and sodium azide were used) (1).
Plasmid analysis. For plasmid analysis, transformants with a single plasmid
carrying ESBL or quinolone resistance genes were prepared. Primarily plasmid
DNA was extracted using the Qiagen Plasmid Midi kit (Qiagen, Germany).
Plasmid DNA was introduced into competent E. coli Top10 (Invitrogen) by
chemical transformation, followed by selection of transformants on LB agar
supplemented with cefotaxime (2 mg literϪ1
) or ciprofloxacin (0.05 mg literϪ1
).
The presence of relevant bla and quinolone resistance genes in transformants
was confirmed by PCR. The size of plasmids with ESBL or quinolone resistance
genes from transformants was designated by S1-PFGE. Plasmids were characterized
by replicon typing and restriction fragment length polymorphism (RFLP)
analysis. Plasmid DNA from transformants was digested with EcoRV and HincII
and then subjected to gel electrophoresis in a 1% agarose gel for 5 h at 100 V/cm.
Plasmids were replicon typed as previously described (8). The presence of Tn3like
transposons in qnrS transformants was tested by PCR (1).
RESULTS
Antimicrobial-resistant E. coli in mallards, herring gulls,
and waterbird feces. In total, 65 suspected E. coli isolates were
obtained from 86 samples from mallards. Antibiotic resistance
was detected in 23 E. coli isolates. The prevalence of mallards
with antimicrobial-resistant E. coli was 27% (23 resistant E.
coli isolates/86 mallards tested). Three of the resistant isolates
showed resistance to ciprofloxacin (but plasmid-encoded
quinolone resistance genes were not detected). Isolates resistant
to ampicillin and amoxicillin-clavulanic acid were
tested for ESBL production by DDST, and three of them were
found to produce ESBL. Phenotypes and resistance genes,
including integrons and gene cassettes, are summarized in Table
1. With selective cultivation on MCA with cefotaxime, one
ESBL-producing E. coli isolate was detected (upon further
analysis, however, this isolate was found to be identical to an
isolate obtained by nonselective cultivation from the identical
cloacal swab sample) (Table 2). Resistance to ciprofloxacin was
found in 25 isolates by selective cultivation, and the qnrS gene
was detected in four of these (Table 3).
In total, 18 suspected E. coli isolates were detected in 27 samples
from herring gulls. Three E. coli isolates were antibiotic
resistant (Table 1). The prevalence of herring gulls with antimicrobial-resistant
E. coli was 11% (3/27). While one isolate was
resistant to ciprofloxacin, plasmid-encoded quinolone resistance
genes were not detected. Three ESBL-producing E. coli isolates
were found by selective isolation with cefotaxime (Table 2). Using
selective isolation with ciprofloxacin, 20 E. coli isolates was detected;
the qnrS gene was detected in three of these (Table 3).
From 365 waterbird feces, 58 suspected E. coli isolates were
obtained by nonselective cultivation. Antibiotic resistance was
detected in five E. coli isolates (Table 1). The prevalence of
waterbird feces with antimicrobial-resistant E. coli was 1.4%
(5/365). By selective cultivation with cefotaxime, three ESBLproducing
E. coli isolates were detected (Table 2). Using selective
cultivation with ciprofloxacin, 23 E. coli isolates were
found, and 2 of these were positive for qnrS. Another 5 isolates
were obtained by selective cultivation on MCA with nalidixic
acid; 1 of these isolates was positive for a mutant variant
aac(6Ј)-Ib-cr, and moreover, ESBL production was detected in
this isolate (Table 2).
TABLE 1. Antibiotic-resistant Escherichia coli obtained by nonselective isolation and numbers of strains with some resistance
patterns from mallards, herring gulls, and waterbird feces
Antibiotic resistance
phenotypea Antibiotic resistance gene(s)b
No. of isolates from:
Mallards
Herring
gulls
Waterbird
feces
A blaTEM 3
Gn NT 1
Na ND 1 1
S aadA1 1
S ND 6 1
ANa blaTEM 1
GnS aadA1 1
GnS ND 1
SSu strA, sul2 1 1
ANaS blaTEM, strA 1
ANaT blaTEM, tetA 1
AST blaTEM, strA, tetB 1
ANaST blaTEM, strA, tetB 2
AAcCfCipNa blaCTX-M-1 1
ACipNaSxtT blaTEM, tetA, tetB, int1; I1, 1.5 kb: dhfr1-aadA1 1
NaSSuSxtT sul1, tetA, int1; I1, 2.2 kb: aadA1 1
AAcCfCipNaS blaTEM, aadA1 2
ACfSSuSxtT blaCTX-M-1, strA, sul2, aadA1, tetB 1
ACCfSSuSxtT blaCTX-M-1, cat, strA, sul1, sul2, tetB, int1; I1, 2.5 kb: dhfr1-aadA1 1
Total 23 3 5
a
A, ampicillin; Ac, amoxicillin-clavulanic acid; C, chloramphenicol; Cf, cephalothin; Cip, ciprofloxacin; Gn, gentamicin; Na, nalidixic acid; S, streptomycin; Su,
sulfonamides; Sxt, sulfamethoxazole-trimethoprim; T, tetracycline.
b
ND, not determined; NT, not tested; I1, class 1 integron.
8128 LITERAK ET AL. APPL. ENVIRON. MICROBIOL.
Characterization of ESBL-producing E. coli isolates. Nine
ESBL-producing E. coli isolates were used for further characterization
(see Table 2). The most prevalent gene in these
ESBL-producing isolates was blaCTX-M-1 (6 isolates). The gene
blaCTX-M-9, blaCTX-M-15, or blaSHV-12 was detected in the remaining
3 isolates. In the isolate with blaCTX-M-15, the gene
aac(6Ј)-Ib-cr, responsible for resistance to aminoglycosides
and fluoroquinolones, was detected. Most of the isolates were
multiresistant, and four isolates contained a class 1 integron
with gene cassettes. All the isolates showed unique XbaIPFGE
profiles. Most of the plasmids containing the bla genes
for ESBL production were transferable by conjugation to E.
coli and/or Salmonella. Transformants or transconjugants with
single plasmids carrying the blaCTX-M-1 gene were obtained
from 5 isolates. Plasmid DNA purified from these transformants
was used for replicon typing and RFLP performed by
EcoRV (Fig. 2) and HincII digestions. The strain 5PL, from
mallards, harbored the 35-kb conjugative plasmid (RFLP type I)
of the IncN group. The gene blaCTX-M-1, in another 3 isolates
from a herring gull (isolate 17 LA CEF) and waterbird feces
(isolates 88 and 96), was located on the 90- to 100-kb conjugative
plasmids of the IncI1 group. RFLP profiles of the IncI1 plasmids
showed many band similarities. A plasmid 80 kb in size from the
E. coli 11 LA CEF transformant was negative for the incompatibility
group by the method used and showed the unique
RFLP profile.
Characterization of quinolone-resistant E. coli isolates.
Nine quinolone-resistant isolates with the qnrS genes were
characterized (Table 3). Four isolates with high MIC levels of
quinolones were examined for chromosomal mutations in the
genes gyrA and parC. Mutation of Ser83 to Leu in GyrA and
80Ile to Ser in ParC were the most prevalent. A class 1 integron
1 kb in size was identified in one multiresistant isolate
from a herring gull. All the isolates showed unique XbaI PFGE
profiles and belonged to the A (6 isolates) or B1 (3 isolates)
phylogenetic group as determined by multiplex PCR. Most of
the qnrS plasmids were transferable by conjugation to E. coli
and/or Salmonella. Transformants or transconjugants with a
single qnrS plasmid were obtained only from 4 isolates and
were used for further testing of the Inc groups and EcoRV
(Fig. 2) and HincII plasmid DNA profiling. The isolates 18 PL
CIP from a mallard and 6 LA CIP from a herring gull harbored
the same 45-kb conjugative plasmid (RFLP type VI) of the X1
incompatibility group. The gene qnrS was associated with the
Tn3-like transposon on this IncX1 plasmid together with
blaTEM-1 in both the isolates. A plasmid 30 kb in size from a
transformant of E. coli strain 11 belonged to the IncX2 group
and showed the unique RFLP profile. The qnrS gene in the
isolate 58 PL CIP from a mallard was located on a 45-kb
conjugative IncN plasmid. The RFLP profile of this plasmid
differed from the profiles of other IncN plasmids harboring
blaCTX-M-1 genes detected in this study.
DISCUSSION
Even if populations of wild birds are not directly influenced
by antibiotic practice, the acquired resistance in bacteria isolated
from wild waterbirds occurs in various prevalences. Studies
of resistant E. coli isolates have been mostly based on
phenotype characterization of these isolates (20, 24, 26, 51, 58,
TABLE2.CharacterizationofESBL-producingEscherichiacoliisolatesfromwildbirdsontheBalticSeacoastofPoland
Isolateno.Origin
Antibiotic
resistance
phenotypec
ESBLbla
genes
Antibioticresistance
genes
XbaI
PFGEe
Presenceof
colicin(the
genecib)
Phylogenetic
group
Conjugation
toE.coli
Conjugationto
Salmonella
Plasmid
incompatibility
groupe
RFLP
pattern
(EcoRV)
Plasmid
size(kb)
Additionalgenes
onESBL-
carryingplasmid
1PLMallardAAcCfCipNablaCTX-M-1aϪAϩϩ
5PLMallardACfSSuSxtTblaCTX-M-1strA,aadA1,sul2,tetBbϪB1ϩϩIncNI35
78PLa
MallardACCfSSuSxtTblaCTX-M-1cat,strA,sul1,sul2,tetB,
int1,I1,d
2.5kb,dhfr1-
aadA1
cϪB2ϪϪ
17LACEFHerringgullACfSublaCTX-M-1sul2eϩAϩϩIncI1II90cib,sul2
11LACEFHerringgullACfGnSuSxtblaCTX-M-1sul1,int1,I1,2.0kb,
dhfr12-aadA2
dϪB2ϩϩNDIII80int1,I1,2.0kb,
dhfr12-aadA2
6LACEFHerringgullACfSSuSxtTblaCTX-M-9blaTEM-1b,strA,aadA1,
sul2,tetD
NDϪDϪϪ
88Waterbird
feces
ACfblaSHV-12int1,I1,2.1kb,aadA2gϪAϩϩIncI1IV95
96Waterbird
feces
ACfNaSuSxtTblaCTX-M-1blaTEM-1b,dhfr17,aadA5,
sul2,tetA,int1
hϪB1ϩϩIncI1V100sul2,int1,dhfr17,
aadA5
8Nb
Waterbird
feces
ACfCipNaSSuSxtTblaCTX-M-15blaOXA-1,aac(6Ј)-Ib-cr,
sul1,tetA,int1,I1,1.7
kb,dhfr17-aadA5
MϪB2ϩϪ
a
Twoidenticalisolates(designedbyPFGE)obtainedfromonebirdusingnonselectiveisolationandselectiveisolationonMacConkeyagarwithcefotaxime(2mg/liter),
b
ThestrainwasisolatedbyselectivecultivationonMCAwithnalidixicacid(20mg/liter).
c
A,ampicillin;Ac,amoxicillin-clavulanicacid;C,chloramphenicol;Cf,cephalothin;Cip,ciprofloxacin;Gn,gentamicin;Na,nalidixicacid;S,streptomycin;Su,sulfonamides;Sxt,sulfamethoxazole-trimethoprim;T,
tetracycline.
d
Class1integron.
e
ND,notdetected.VOL. 76, 2010 ANTIBIOTIC-RESISTANT E. COLI IN WATERBIRDS IN POLAND 8129
TABLE3.CharacterizationofEscherichiacoliwithqnrgenesfromwildbirdsontheBalticSeacoastofPoland
Isolateno.Origin
Antibiotic
resistance
phenotypea
Antibioticresistance
gene(s)b
qnr
gene
MIC(g/liter)
of:
MutationingyrA
andparC
XbaIPFGE
Presenceofcolicin(cibgene)
Phylogeneticgroup
ConjugationtoE.coli
ConjugationtoSalmonella
Plasmidincompatibilitygroup
RFLPpattern
Plasmidsize(kb)
Additionalantibioticresistance
gene(s)onqnrplasmid
NALCIP
71PLCIPMallardAGnblaTEMqnrS80.25DϩAϪϩ
67PLCIPMallardAAcCfblaTEMqnrS80.25CϪAϩϩ
18PLCIPMallardACipNaTblaTEM,tetA,int1qnrSϾ2568gyrA:83Ser3LeuAϪAϩϩIncX1VI45blaTEM-1
58PLCIPMallardACipNaSSuSxtTblaTEM,strA,
aadA1,sul2,
tetA,int1
qnrSϾ256Ͼ8gyrA:83Ser3Leu,
87Asp3Asn
BϪB1ϩϩIncNVIII45blaTEM-1,
sul2,tetA
19LACIPHerringgullAblaTEMqnrS80.25GϩAϩϩ
6LACIPHerringgullANaTblaTEM,tetBqnrS2561gyrA:83Ser3Leu,
parC:80Ile3Ser
FϩB1ϩϩIncX1VI45blaTEM-1
1LACIPHerringgullANaSSuTblaTEM,sul1,sul2,
tetA,int1,I1,
1.0kb,aadA1
qnrS2561gyrA:83Ser3Leu,
parC:80Ile3Ser
EϩAϪϪ
11Waterbird
feces
TtetAqnrS160.25IϪB1ϩϩIncX2VII30tetA
1Waterbird
feces
ASTblaTEM,strA,tetAqnrS160.25HϪAϪϩ
a
A,ampicillin;Ac,amoxicillin-clavulanicacid;Cf,cephalothin;Cip,ciprofloxacin;Gn,gentamicin;Na,nalidixicacid;S,streptomycin;Su,sulfonamides;Sxt,sulfamethoxazole-trimethoprim;T,tetracycline.Determined
bythediskdiffusionmethod.
b
I1,class1integron.
8130 LITERAK ET AL. APPL. ENVIRON. MICROBIOL.
71, 75, 76, 82), and the genes determining resistance to oldgeneration
antibiotics were sporadically detected (17, 21, 22,
29). Isolates of E. coli from birds on the Polish coast of the
Baltic Sea were commonly resistant to old-generation antibiotics,
and they were highly variable in phenotype and genotype
characteristics. Resistances to streptomycin, ampicillin, and
tetracycline were recently found in waterbirds elsewhere in
Europe (4, 21, 23, 29). In the United States, resistance to
streptomycin and ampicillin has been frequently seen in E. coli
isolates from Canada geese (17, 51).
Isolates of E. coli with class 1 integrons and gene cassettes
were found in waterbirds on the Polish coasts of the Baltic Sea.
The gene cassettes contained the genes aadA1, aadA2, dhfr1aadA1,
dhfr12-aadA2, and dhfr17-aadA5. In Portugal, E. coli
strains with class 1 and 2 integrons have been isolated from
gulls (66). In Italy, E. coli isolates with class 1 integrons have
been found in Mediterranean herring gulls (29). In the Czech
Republic, E. coli isolates with class 1 and 2 integrons have been
found in black-headed gulls (21, 23). We may summarize that
the integrons are commonly found in E. coli isolates from
waterbirds living in European areas inhabited by people and
that the gene cassettes detected within these integrons are
highly variable even though the genes aadA1 and dhfr1 are
found regularly.
The emergence and wide dissemination in recent years of E.
coli resistant to broad-spectrum cephalosporins due to production
of ESBL and/or E. coli resistant to fluoroquinolones due
to a presence of plasmid-encoded quinolone resistance genes
are of great concern and represent a serious problem for the
treatment of infectious diseases (59, 79). These strains are also
spread into the environment and can colonize wild mammals
as well as wild birds, especially omnivorous gulls (4, 18, 23, 29,
47, 66, 67). We have proven the occurrence of E. coli isolates
producing ESBL, as well as isolates with plasmid-encoded
fluoroquinolone resistance, in mallards, herring gulls, and
waterbird feces on the Polish coast of the Baltic Sea. Moreover,
most isolates showed resistance to multiple antibiotics
and contained class 1 integrons. Coresistance to non-betalactam
antibiotics in the ESBL-producing Enterobacteriaceae is
commonly described (60). Such multiresistant ESBL-producing
strains are a serious problem since they severely limit
therapeutic options against human and animal infections (69).
Isolates of E. coli producing ESBL found in mallards, in
herring gulls, and in waterbird feces had the genes blaCTX-M-1
(most isolates), blaCTX-M-9, blaCTX-M-15, and blaSHV-12. The
extended-spectrum beta-lactamase CTX-M-1 seems to be the
most prevalent ESBL in animal E. coli strains throughout Europe
(6, 30, 77). The various ESBLs have been found in E. coli
from wild waterbirds on the Atlantic coast of Europe (66), on
the coast of the Mediterranean Sea (4), and in the European
inland (23). The spectrum of genes associated with the production
of ESBL in Polish isolates was closer to the spectrum
of genes in isolates from birds originating from the Mediterranean
Sea and the European inland than to the spectrum of
genes found in E. coli isolates from birds originating on the
European Atlantic coast. Both gulls and mallards occurring in
European areas inhabited by people are commonly colonized
with E. coli strains resistant to broad-spectrum cephalosporins
and having various bla genes responsible for the ESBL phe-
notype.
In the present study, blaCTX-M-1 was found harbored on
conjugative plasmids of the incompatibility groups IncN and
IncI1. The association between blaCTX-M-1 and IncN plasmids
was recently described (49, 52, 55). IncN plasmids are broadhost-range
plasmids that might contribute to the further spread
of isolates producing CTX-M-1-like enzymes among other
members of the Enterobacteriaceae. The blaSHV-12 gene in the
E. coli isolate from a waterbird was harbored on an IncN
conjugative plasmid. The association of SHV-12 and plasmids
of this incompatibility group has been previously described (28,
49). In addition to CTX-M-1 and SHV-12, other types of ESBL
have been found to be connected with IncN plasmids (28, 33).
This indicates their role in disseminating ESBL genes. The
IncI1 plasmids have been found to be more frequent in pathogenic
than in commensal avian and human E. coli strains (35).
These plasmids are also characterized by association with virulence
and antibiotic resistance genes that can be involved in
positive selection of these plasmids (35). Plasmids belonging to
IncI1 carrying blaCTX-M-1 have recently been found in E. coli
and Salmonella isolates throughout Europe (19, 28, 30, 47, 49).
The beta-lactamase CTX-M-15 is one of the most important
ESBLs in human medicine. E. coli isolates producing this enzyme
have emerged worldwide as an important cause of community-onset
urinary tract and bloodstream infections (65).
CTX-M-15 is often associated with OXA-1, TEM-1 beta-lactamases,
and Aac(6Ј)-Ib-cr, a variant of an aminoglycosidemodifying
enzyme that is responsible for reduced susceptibility
to both aminoglycosides and fluoroquinolones (70). Similar
FIG. 2. RFLP analysis of plasmid DNA harboring genes for ESBL
or quinolone resistance designed by EcoRV. Lane 1, E. coli 18 PL CIP
(qnrS); lane 2, E. coli 6 LA CIP (qnrS); lane 3, E. coli 11 (qnrS); lane
4, E. coli 58 PL CIP (qnrS); lanes 5 and 12, ␭ DNA-HindIII Digest
(Biolabs, New England); lanes 6 and 13, 2-log DNA marker (Biolabs);
lane 7, E. coli 5 PL (blaCTX-M-1); lane 8, E. coli 11 LA CEF
(blaCTX-M-1); lane 9, E. coli 17 LA CEF (blaCTX-M-1); lane 10, E. coli 88
(blaSHV-12); lane 11, E. coli 96 (blaCTX-M-1).
VOL. 76, 2010 ANTIBIOTIC-RESISTANT E. COLI IN WATERBIRDS IN POLAND 8131
findings were seen in the waterbird isolate from our study. This
ESBL has been recently identified in the clone ST131, which is
responsible in large measure for an international epidemic
caused by CTX-M-15-producing E. coli (72). The pandemic
dissemination of the clone ST131 producing CTX-M-15 was
linked to the epidemic’s narrow host range of IncFII plasmids
(49, 62).
We found E. coli isolates with plasmid-encoded quinolone
resistance associated with the qnrS gene in mallards, herring
gulls, and waterbird feces on the Polish coast of the Baltic Sea.
Moreover, one E. coli isolate from waterbird feces producing
ESBL harbored the gene aac(6)-Ib-cr. All these findings of E.
coli with genes responsible for fluoroquinolone resistance in
wild birds are described here for the first time. Only recently,
E. coli strains determined to be resistant to ciprofloxacin based
on their resistance phenotype have been noted in waterbirds
(23, 29, 76). The qnrS gene was first found in Shigella flexneri
during 2003 in Japan (32), and together with the qnrB gene it
has been identified as the most prevalent plasmid-mediated
fluoroquinolone resistance gene (42). This gene has been detected
in quinolone-resistant human, poultry, and swine E. coli
and Salmonella isolates (10, 31, 34, 86).
In our study, qnrS genes were carried by plasmids of the N,
X1, and X2 incompatibility groups. The association of IncN
conjugative plasmids with qnrS genes was recently described
(28, 37). IncX plasmids have been implicated in the acquisition
and dissemination of transferable resistance in pathogenic bacteria
(81).
IncX1 plasmids have recently been found to be associated
with ESBL genes, such as blaTEM-52 (1, 47), and with increased
production of biofilm (54, 56), which could impart to the
strains carrying them a greater potential for spreading and
surviving in the environment. In our study, two E. coli isolates
with identical conjugative IncX1 plasmids harboring the qnrS
and blaTEM-1 genes inside the Tn3-like transposon, from a
mallard and a herring gull sampled in different areas of the
Polish coast (the distance between the areas is about 20 km),
were found. Both isolates showed high levels of resistance to
quinolones and contained chromosomal mutations in the gyrA
and/or parC gene. However, the isolates showed different macrorestriction
profiles by PFGE and belonged to different phylogenetic
groups, A and B1. This suggests a possible role for
horizontal spreading of the IncX1 plasmid in the E. coli population
of wild birds on the Polish coast. The association of
plasmid-mediated qnrS genes with plasmids of this incompatibility
group was recently described (13). The qnrS1 gene has
been found to be located on a 45-kb nonconjugative IncX1
plasmid in one poultry E. coli isolate from Italy. The qnrS1
gene of this isolate was associated with a Tn3-like transposon
containing the blaTEM-1 gene, as previously described for an
animal isolate of Salmonella enterica serovar Infantis (39, 40).
Analysis of the IncX1 plasmid carrying this element showed it
to resemble that of a plasmid identified in Salmonella Dublin
(14). Those authors have suggested that genetic exchange
among Salmonella and E. coli has occurred, thus indicating the
existence of a potential animal reservoir for the qnr genes.
Further investigation of our IncX1 plasmids harboring qnrS
and blaTEM-1 in E. coli from wild birds needs to be undertaken
to find a possible association with the results presented by the
studies mentioned above.
In one waterbird E. coli isolate, the qnrS gene was found to
be located on a 30-kb conjugative plasmid of the IncX2 group.
To our knowledge, this is the first report of qnrS genes on
plasmids of the X2 incompatibility group. We think that our
IncX2 plasmid harboring the qnrS gene could be related to the
pR6K plasmid (36). Plasmids of this group are not very common,
and the pR6K plasmid is the only IncX2 member described
to date (36).
Mallards and gulls are identified as important bioindicators,
as reservoirs and vectors of E. coli strains resistant to
old-generation antibiotics, broad-spectrum cephalosporins,
and fluoroquinolones, and as a potential melting pot for the
development of new resistance types. We regard the common
occurrence of these isolates as alarming. It provides evidence
that these E. coli isolates, selected for in humans and domestic
animals, are colonizing wild waterbirds and that via these birds,
E. coli isolates important from a public health viewpoint can be
spread into the environment. Although waterbirds do not naturally
come into contact with antimicrobials, they are omnivorous
and often search for food in agricultural, rural, and
urban areas and in communal garbage dumps and sewage
water treatment plants. Thus, they can easily be infected with
resistant bacteria from domestic animal and human sources.
Urban waters, too, can possibly be a source of antibiotic-resistant
isolates inasmuch as these waters harbor higher percentages
of resistant E. coli strains than do rural waters (38).
Waterbirds excrete large quantities of fecal coliforms, and
they are theoretically capable, through their feces, of affecting
drinking and recreational water quality (27, 43, 44). It is important
to keep these birds away from swimming areas by
limiting food supplies. Further, it is important to educate owners
of beaches and restaurants, as well as the general public.
Keeping beaches clean and prohibiting the feeding of birds are
simple ways of limiting potential problems. The occurrence of
resistant bacteria in populations of wild waterbirds where there
is no selective pressure can imply that such resistance will be
difficult to displace.
ACKNOWLEDGMENTS
We thank George Jacoby (Lahey Clinic Inc., Burlington, MA), Lina
Cavaco and Henrik Hasman (National Food Institute, Copenhagen,
Denmark), Ming-Gui Wang (Institute of Antibiotics, Huashan Hospital,
Shanghai, China), and Surbhi Malhotra-Kumar (University of Antwerp,
Antwerp, Belgium) for positive-control strains. Our thanks also
go to Katerina Dibdakova, Eva Suchanova, Marketa Machalkova, and
Katerina Albrechtova for their excellent laboratory work. We thank
the Veterinary Research Institute (Brno, Czech Republic) for providing
equipment for pulsed-field gel electrophoresis.
This study was funded by grant no. MSM6215712402 from the Ministry
of Education, Youth and Sports of the Czech Republic and grant
no. P502/10/P083 from the Czech Science Foundation.
Wild birds were caught according to the permission given to Wlodzimierz
Meissner by the Polish General Director for Environmental
Protection, no. 187/2009.
REFERENCES
1. Bergenholtz, R. D., M. S. Jorgensen, L. H. Hansen, L. B. Jensen, and H.
Hasman. 2009. Characterization of genetic determinants of extended-spectrum
cephalosporinases (ESCs) in Escherichia isolates from Danish and
imported poultry meat. J. Antimicrob. Chemother. 64:207–209.
2. Blanco, G., J. A. Lemus, J. Grande, L. Gangoso, J. M. Grande, J. A. Donazar,
B. Arroyo, O. Frias, and F. Hiraldo. 2007. Geographical variation in cloacal
microflora and bacterial antibiotic resistance in a threatened avian scavenger
in relation to diet and livestock farming practices. Environ. Microbiol.
9:1738–1749.
8132 LITERAK ET AL. APPL. ENVIRON. MICROBIOL.
3. Blanco, G., J. A. Lemus, and J. Grande. 2009. Microbial pollution in wildlife:
linking agricultural manuring and bacterial antibiotic resistance in red-billed
choughs. Environ. Res. 109:405–412.
4. Bonnedahl, J., M. Drobni, M. Gauthier-Clerc, J. Hernandez, S. Granholm,
Y. Kayserr, A. Melhus, G. Kahlmeter, J. Waldenstrom, A. Johansson, and B.
Olsen. 2009. Dissemination of Escherichia coli with CTX-M type ESBL
between humans and yellow-legged gulls in the south of France. Plos ONE
4:e5958.
5. Brinas, L., M. Zaraga, Y. Saenz, F. Ruiz-Larrea, and C. Torres. 2002.
␤-Lactamases in ampicillin-resistant Escherichia coli isolates from foods,
humans, and healthy animals. Antimicrob. Agents Chemother. 46:3156–
3160.
6. Brinas, L., M. A. Moreno, T. Teshager, Y. Saenz, M. C. Porrero, L.
Dominguez, and C. Torres. 2005. Monitoring and characterization of extended-spectrum
beta-lactamases in Escherichia coli strains from healthy and sick
animals in Spain in 2003. Antimicrob. Agents Chemother. 49:1262–1264.
7. Camarda, A., E. Circella, D. Pennelli, A. Madio, G. Bruni, V. Lagrasta, G.
Marzano, E. Mallia, and E. Campagnari. 2006. Wild birds as biological
indicators of environmental pollution: biotyping and antimicrobial resistance
patterns of Escherichia coli isolated from Audouin’s gulls (Larus audouinii)
living in the Bay of Gallipoli (Italy). Ital. J. Anim. Sci. 5:287–290.
8. Carattoli, A., A. Bertini, L. Villa, V. Falbo, K. L. Hopkins, and E. J. Threlfall.
2005. Identification of plasmids by PCR-based replicon typing. J. Microbiol.
Methods 63:219–228.
9. Cattoir, V., L. Poirel, V. Rotimi, C. J. Soussy, and P. Nordmann. 2007.
Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr
genes in ESBL-producing enterobacterial isolates. J. Antimicrob. Chemother.
60:394–397.
10. Cavaco, L. M., N. Frimodt-Moller, H. Hasman, L. Guardabassi, L. Nielsen,
and F. M. Aarestrup. 2008. Prevalence of quinolone resistance mechanisms
and associations to minimum inhibitory concentrations in quinolone-resistant
Escherichia coli isolated from humans and swine in Denmark. Microb.
Drug Resist. 14:163–169.
11. Cavaco, L. M., H. Hasman, S. Xia, and F. M. Aarestrup. 2009. qnrD, a novel
gene conferring transferable quinolone resistance in Salmonella enterica serovars
Kentucky and Bovismorbificans of human origin. Antimicrob. Agents
Chemother. 53:603–608.
12. CDC. 2004. Standardized molecular subtyping of foodborne bacterial pathogens
by pulsed-field gel electrophoresis. National Molecular Network for
Foodborne Disease Surveillance, CDC, Atlanta, GA.
13. Cerquetti, M., A. Garcia-Fernandez, M. Giufre, D. Fortini, M. Accogli, C.
Graziani, I. Luzzi, A. Caprioli, and A. Carattoli. 2009. First report of plasmid-mediated
quinolone resistance determinant qnrS1 in an Escherichia coli
strain of animal origin in Italy. Antimicrob. Agents Chemother. 53:3112–
3114.
14. Chu, C., Y. Feng, A. C. Chien, S. Hu, C. H. Chu, and C. H. Chiu. 2008.
Evolution of genes on the Salmonella virulence plasmid phylogeny revealed
from sequencing of the virulence plasmids of S. enterica serotype Dublin and
comparative analysis. Genomics 92:339–343.
15. Clermont, O., S. Bonacorsi, and E. Bingen. 2000. Rapid and simple determination
of Escherichia coli phylogenetic group. Appl. Environ. Microbiol.
66:4555–4558.
16. CLSI. 2008. Performance standards for antimicrobial susceptibility testing,
8th informational supplement. CLSI, Wayne, PA.
17. Cole, D., D. J. V. Drum, D. E. Stallknecht, D. G. White, M. D. Lee, S. Ayers,
M. Sobsey, and J. J. Maurer. 2005. Free-living Canada geese and antimicrobial
resistance. Emerg. Infect. Dis. 11:935–938.
18. Costa, D., P. Poeta, Y. Saenz, L. Vinue, B. Rojo-Bezares, A. Jouini, M.
Zarazaga, J. Rodriguez, and C. Torres. 2006. Detection of Escherichia coli
harbouring extended-spectrum ␤-lactamases of the CTX-M, TEM and SHV
classes in faecal samples of wild animals in Portugal. J. Antimicrob. Chemother.
58:1311–1312.
19. Dierikx, C., A. van Essen-Zandbergen, K. Veldman, H. Smith, and D. Mevius.
2010. Increased detection of extended spectrum beta-lactamase producing
Salmonella enterica and Escherichia coli isolates from poultry. Vet.
Microbiol. 145:273.
20. Dobbin, G., H. Hariharan, P.-Y. Daoust, S. Hariharan, S. Heaney, M. Coles,
L. Price, and C. A. Muckle. 2005. Bacterial flora of free-living double-crested
cormorant (Phalacrocorax auritus) chicks on Prince Edward Island, Canada,
with reference to enteritic bacteria and antibiotic resistance. Comp. Immunol.
Microbiol. Infect. Dis. 28:71–82.
21. Dolejska, M., A. Cizek, and I. Literak. 2007. High prevalence of antimicrobial-resistant
genes and integrons in Escherichia coli isolates from blackheaded
gulls in the Czech Republic. J. Appl. Microbiol. 103:11–19.
22. Dolejska, M., D. Senk, A. Cizek, J. Rybarikova, O. Sychra, and I. Literak.
2008. Antimicrobial resistant Escherichia coli isolates in cattle and house
sparrows on two Czech dairy farms. Res. Vet. Sci. 85:491–494.
23. Dolejska, M., B. Bierosova, L. Kohoutova, I. Literak, and A. Cizek. 2009.
Antibiotic-resistant Salmonella and Escherichia coli isolates with integrons
and extended-spectrum beta-lactamases in surface water and sympatric
black-headed gulls. J. Appl. Microbiol. 106:1941–1950.
24. Edge, T. A., and S. Hill. 2005. Occurrence of antibiotic resistance in Escherichia
coli from surface waters and fecal pollution sources near Hamilton,
Ontario. Can. J. Microbiol. 51:501–505.
25. Everett, M. J., Y. F. Jin, V. Ricci, and L. J. Piddock. 1996. Contributions of
individual mechanisms to fluoroquinolone resistance in 36 Escherichia coli
strains isolated from humans and animals. Antimicrob. Agents Chemother.
40:2380–2386.
26. Fallacara, D. M., C. M. Monahan, T. Y. Morishita, and R. W. Wack. 2001.
Fecal shedding and antimicrobial susceptibility of selected bacterial pathogens
and a survey of intestinal parasites in free-living waterfowl. Avian Dis.
45:128–135.
27. Fogarty, L. R., S. K. Haack, M. J. Wolcott, and R. I. Whitman. 2003.
Abundance and characteristics of the recreational water quality indicator
bacteria Escherichia coli and enterococci in gull faeces. J. Appl. Microbiol.
94:865–878.
28. Garcia-Fernandez, A., G. Chiaretto, A. Bertini, L. Villa, D. Fortini, A. Ricci,
and A. J. Carattoli. 2008. Multilocus sequence typing of IncI1 plasmids
carrying extended-spectrum beta-lactamases in Escherichia coli and Salmonella
of human and animal origin. J. Antimicrob. Chemother. 61:1229–1233.
29. Gionechetti, F., P. Zucca, F. Gombac, C. Monti-Bragadin, C. Lagatolla, E.
Tonin, E. Edalucci, L. A. Vitali, and L. Dolzani. 2008. Characterization of
antimicrobial resistance and class 1 integrons in Enterobacteriaceae isolated
from Mediterranean herring gulls (Larus cachinans). Microb. Drug Resist.
14:93–99.
30. Girlich, D., L. Poirel, A. Carattoli, I. Kempf, M. F. Lartigue, A. Bertini, and
P. Nordmann. 2007. Extended-spectrum beta-lactamase CTX-M-1 in Escherichia
coli isolates from healthy poultry in France. Appl. Environ. Microbiol.
73:4681–4685.
31. Gunell, M., M. A. Webber, P. Kotilainen, A. J. Lilly, J. M. Caddick, J. Jalava,
P. Huovinen, A. Siitonen, A. J. Hakanen, and L. J. Piddock. 2009. Mechanisms
of resistance in nontyphoidal Salmonella enterica strains exhibiting a
nonclassical quinolone resistance phenotype. Antimicrob. Agents Chemother.
53:3832–3836.
32. Hata, M., M. Suzuki, M. Matsumoto, M. Takahashi, K. Sato, S. Ibe, and K.
Sakae. 2005. Cloning of a novel gene for quinolone resistance from a transferable
plasmid in Shigella flexneri 2b. Antimicrob. Agents Chemother. 49:
801–803.
33. Hopkins, K. L., E. Liebana, L. Villa, M. Batchelor, E. J. Threlfall, and A.
Carattoli. 2006. Replicon typing of plasmids carrying CTX-M or CMY betalactamases
circulating among Salmonella and Escherichia coli isolates. Antimicrob.
Agents Chemother. 50:3203–3206.
34. Hopkins, K. L., L. Wootton, M. R. Day, and E. J. Threlfall. 2007. Plasmidmediated
quinolone resistance determinant qnrS1 found in Salmonella enterica
strains isolated in the UK. J. Antimicrob. Chemother. 59:1071–1075.
35. Johnson, T. J., Y. M. Wannemuehler, S. J. Johnson, C. M. Logue, D. G.
White, C. Doetkott, and L. K. Nolan. 2007. Plasmid replicon typing of
commensal and pathogenic Escherichia coli isolates. Appl. Environ. Microbiol.
73:1976–1983.
36. Jones, C. S., D. J. Osborne, and J. Stanley. 1993. Molecular comparison of
the IncX plasmids allows division into IncX1 and IncX2 subgroups. J. Gen.
Microbiol. 139:735–741.
37. Karah, N., L. Poirel, S. Bengtsson, M. Sundqvist, G. Kahlmeter, P. Nordmann,
A. Sundsfjord, O. Samuelsen, and Norwegian Study Group on
PMQR. 2010. Plasmid-mediated quinolone resistance determinants qnr and
aac(6Ј)-Ib-cr in Escherichia coli and Klebsiella spp. from Norway and Sweden.
Diagn. Microbiol. Infect. Dis. 66:425–431.
38. Kaspar, C. W., J. L. Burgess, I. T. Knight, and R. R. Colwell. 1990. Antibiotic
resistance indexing of Escherichia coli to identify sources of fecal contamination
in water. Can. J. Microbiol. 36:891–894.
39. Kehrenberg, C., S. Friederichs, A. de Jong, G. B. Michael, and S. Schwarz.
2006. Identification of the plasmid-borne quinolone resistance gene qnrS in
Salmonella enterica serovar Infantis. J. Antimicrob. Chemother. 58:18–22.
40. Kehrenberg, C., A. de Jong, S. Friederichs, A. Cloeckaert, and S. Schwarz.
2007. Molecular mechanisms of decreased susceptibility to fluoroquinolones
in avian Salmonella serovars and their mutants selected during the determination
of mutant prevention concentrations. J. Antimicrob. Chemother. 59:
886–892.
41. Kim, H. B., C. H. Park, C. J. Kim, E. C. Kim, G. A. Jacoby, and D. C. Hooper.
2009. Prevalence of plasmid-mediated quinolone resistance determinants
over a 9-year period. Antimicrob. Agents Chemother. 53:639–645.
42. Lavilla, S., J. J. Gonzalez-Lopez, M. Sabate, A. Garcia-Fernandez, M. N.
Larrosa, R. M. Bartolome, A. Carattoli, and G. Prats. 2008. Prevalence of
qnr genes among extended-spectrum beta-lactamase-producing enterobacterial
isolates in Barcelona, Spain. J. Antimicrob. Chemother. 61:291–295.
43. Levesque, B., P. Brousseau, P. Simard, E. Dewailly, M. Meisels, D. Ramsay,
and J. Joly. 1993. Impact of the ring-billed gull (Larus delawarensis) on the
microbiological quality of recreational water. Appl. Environ. Microbiol. 59:
1228–1230.
44. Levesque, B., P. Brousseau, F. Bernier, E. Dewailly, and J. Joly. 2000. Study
of the bacterial content of ring-billed gull droppings in relation to recreational
water quality. Water Res. 34:1089–1096.
45. Lewis, J. S., II, M. Herrera, B. Wickes, and J. E. Petterson. 2007. First report
of the emergence of CTX-M-type extended spectrum ␤-lactamases (ESBLs)
VOL. 76, 2010 ANTIBIOTIC-RESISTANT E. COLI IN WATERBIRDS IN POLAND 8133
as the predominant ESBL isolated in a U.S. health care system. Antimicrob.
Agents Chemother. 51:4015–4021.
46. Literak, I., R. Vanko, M. Dolejska, A. Cizek, and R. Karpiskova. 2007.
Antibiotic resistant Escherichia coli and Salmonella in Russian rooks (Corvus
frugilegus) wintering in the Czech Republic. Lett. Appl. Microbiol. 45:616–
621.
47. Literak, I., M. Dolejska, T. Radimersky, J. Klimes, M. Friedman, F. M.
Aarestrup, H. Hasman, and A. Cizek. 2010. Antimicrobial resistant faecal
Escherichia coli in wild mammals in central Europe: multiresistant Escherichia
coli producing extended-spectrum beta-lactamases in wild boars.
J. Appl. Microbiol. 108:1702–1711.
48. Livermore, D. M., M. Warner, L. M. C. Hall, V. I. Enne, S. J. Projan, P. M.
Dunman, S. L. Wooster, and G. Harrison. 2001. Antibiotic resistance in
bacteria from magpies (Pica pica) and rabbits (Oryctolagus cuniculus) from
west Wales. Environ. Microbiol. 3:658–661.
49. Marcade, G., C. Deschamps, A. Boyd, V. Gautier, B. Picard, C. Branger, E.
Denamur, and G. Arlet. 2009. Replicon typing of plasmids in Escherichia coli
producing extended-spectrum beta-lactamases. J. Antimicrob. Chemother.
63:67–71.
50. Meissner, W., J. Typiak, A. Kosmicki, and S. Bzoma. 2009. Numbers of
waterbirds on the Bay of Gdansk in the span May 2007–April 2008. Notatki
Ornitol. 50:65–72. (In Polish.)
51. Middleton, J. H., and A. Ambrose. 2005. Enumeration and antibiotic resistance
patterns of fecal indicator organisms isolated from migratory Canada
geese (Branta canadensis). J. Wildl. Dis. 41:334–341.
52. Moodley, A., and L. Guardabassi. 2009. Transmission of IncN plasmids
carrying blaCTX-M-1 between commensal Escherichia coli in pigs and farm
workers. Antimicrob. Agents Chemother. 53:1709–1711.
53. Nakamura, M., H. Yoshimura, and T. Koeda. 1982. Drug resistance and R
plasmids of Escherichia coli strains isolated from six species of wild birds.
Jpn. J. Vet. Sci. 44:465–471.
54. Norman, A., L. H. Hansen, Q. She, and S. J. Sorensen. 2008. Nucleotide
sequence of pOLA52: a conjugative IncX1 plasmid from Escherichia coli
which enables biofilm formation and multidrug efflux. Plasmid 60:59–74.
55. Novais, A., R. Canton, R. Moreira, L. Peixe, F. Baquero, and T. M. Coque.
2007. Emergence and dissemination of Enterobacteriaceae isolates producing
CTX-M-1-like enzymes in Spain are associated with IncFII (CTX-M-15)
and broad-host-range (CTX-M-1, -3, and -32) plasmids. Antimicrob. Agents
Chemother. 51:796–799.
56. Ong, C. L., S. A. Beatson, A. G. McEwan, and M. Schembri. 2009. Conjugative
plasmid transfer and adhesion dynamics in an Escherichia coli biofilm.
Appl. Environ. Microbiol. 75:6783–6791.
57. Park, C. H., A. Robicsek, G. A. Jacoby, D. Sahm, and D. C. Hooper. 2006.
Prevalence in the United States of aac(6Ј)Ib-cr encoding a ciprofloxacinmodifying
enzyme. Antimicrob. Agents Chemother. 50:3953–3955.
58. Parveen, S., R. L. Murphree, L. Edmiston, C. W. Kaspar, K. M. Portier, and
M. L. Tamplin. 1997. Association of multiple-antibiotic-resistance profiles
with point and nonpoint sources of Escherichia coli in Apalachicola Bay.
Appl. Environ. Microbiol. 63:2607–2612.
59. Paterson, D. L., and R. A. Bonomo. 2005. Extended-spectrum beta lactamases:
a clinical update. Clin. Microbiol. Rev. 18:657–686.
60. Paterson, D. L. 2006. Resistance in Gram-negative bacteria: Enterobacteriaceae.
Am. J. Infect. Control. 119:S20–S28.
61. Pawiak, R., M. Mazurkiewicz, J. Molenda, J. Pinowski, and A. Wieliczko.
1989. The occurrence of Escherichia coli strains pathogenic to humans and
animals in the eggs and nestlings of Passer spp., p. 139–151. In J. Pinowski,
B. P. Kavanagh, and W. Go´rski (ed.), Nestling mortality of granivorous birds
due to microorganisms and toxic substances. Proceedings of the International
Symposium of the Working Group on Granivorous Birds, INTECOL.
Polish Scientific Publishers, Warsaw, Poland.
62. Peirano, G., M. Costello, J. D. Pitout. 2010. Molecular characteristics of
extended-spectrum beta-lactamase-producing Escherichia coli from the Chicago
area: high prevalence of ST131 producing CTX-M-15 in community
hospitals. Int. J. Antimicrob. Agents 36:19–23.
63. Perichon, B., P. Courvalin, and M. Galimand. 2007. Transferable resistance
to aminoglycosides by methylation of G1405 in 16S rRNA and to hydrophilic
fluoroquinolones by qepA-mediated efflux in Escherichia coli. Antimicrob.
Agents Chemother. 51:2464–2469.
64. Pitout, J. D., A. Hossain, and N. D. Hanson. 2004. Phenotypic and molecular
detection of CTX-M-beta-lactamases produced by Escherichia coli and Klebsiella
spp. J. Clin. Microbiol. 42:5715–5721.
65. Pitout, J. D. 2010. Infections with extended-spectrum beta-lactamase-producing
enterobacteriaceae: changing epidemiology and drug treatment
choices. Drugs 70:313–333.
66. Poeta, P., H. Radhouani, G. Igrejas, A. Goncalves, C. Carvalho, J. Rodrigues,
L. Vinue, S. Somalo, and C. Torres. 2008. Seagulls of the Berlengas
natural reserve of Portugal as carriers of fecal Escherichia coli harboring
CTX-M and TEM extended-spectrum beta-lactamases. Appl. Environ. Microbiol.
74:7439–7441.
67. Poeta, P., H. Radhouani, L. Pinto, A. Martinho, V. Rego, R. Rodrigues, A.
Goncalves, J. Rodrigues, V. Estepa, C. Torres, and G. Igrejas. 2009. Wild
boars as reservoirs of extended-spectrum beta-lactamase (ESBL) producing
Escherichia coli of different phylogenetic groups. J. Basic Microbiol. 49:584–
588.
68. Radimersky, T., P. Frolkova, D. Janoszowska, M. Dolejska, P. Svec, E.
Roubalova, P. Cikova, A. Cizek, and I. Literak. 2010. Antibiotic resistance in
faecal bacteria (Escherichia coli, Enterococcus spp.) in feral pigeons. J. Appl.
Microbiol. 109:1687–1695.
69. Rice, L. B. 2009. The clinical consequences of antimicrobial resistance. Curr.
Opin. Microbiol. 12:476–481.
70. Robicsek, A., J. Strahilevitz, G. A. Jacoby, M. Macielag, D. Abbanat, C. H.
Park, K. Bush, and D. C. Hooper. 2006. Fluoroquinolone-modifying enzyme:
a new adaptation of a common aminoglycoside acetyltransferase. Nat. Med.
12:83–88.
71. Rose, J. M., R. J. Gast, A. Bogomolni, J. C. Ellis, B. J. Lentell, K. Touhey,
and M. Moore. 2009. Occurrence and patterns of antibiotic resistance in
vertebrates off the Northeastern United States coast. FEMS Microbiol. Ecol.
67:421–431.
72. Rossolini, G. M., M. M. D’Andrea, C. Mugnaioli. 2008. The spread of
CTX-M-type extended-spectrum beta-lactamases. Clin. Microbiol. Infect.
14:33–41.
73. Rybarikova, J., M. Dolejska, D. Materna, I. Literak, and A. Cizek. 2010.
Phenotypic and genotypic characteristics of antimicrobial resistant Escherichia
coli isolated from symbovine flies, cattle and sympatric insectivorous
house martins from a farm in the Czech Republic (2006–2007). Res. Vet. Sci.
89:179–183.
74. Sato, G., C. Oka, M. Asagi, and N. Ishiguro. 1978. Detection of conjugative
R plasmids conferring chloramphenicol resistance in Escherichia coli isolated
from domestic and feral pigeons and crows. Zentralbl. Bakteriol. Orig. A
241:407–417.
75. Sayah, R. S., J. B. Kaneene, Y. Johnson, and R. A. Miller. 2005. Patterns of
antimicrobial resistance observed in Escherichia coli isolates obtained from
domestic- and wild-animal fecal samples, human septage, and surface water.
Appl. Environ. Microbiol. 71:1394–1404.
76. Sjolund, M., J. Bonnedahl, J. Hernandez, S. Bengtsson, G. Cederbrant, J.
Pinhassi, G. Kahlmeter, and B. Olsen. 2008. Dissemination of multidrugresistant
bacteria into the Arctic. Emerg. Infect. Dis. 14:70–72.
77. Smet, A., A. Martel, D. Persoons, J. Dewulf, M. Heyndrickx, B. Catry, L.
Herman, F. Haesebrouck, and P. Butaye. 2008. Diversity of extended-spectrum
beta-lactamases and class C beta-lactamases among cloacal Escherichia
coli isolates in Belgian broiler farms. Antimicrob. Agents Chemother. 52:
1238–1243.
78. Sreedharan, S., M. Oram, B. Jensen, L. R. Peterson, and L. M. Fisher. 1990.
DNA gyrase gyrA mutations in ciprofloxacin-resistant strains of Staphylococcus
aureus: close similarity with quinolone resistance mutations in Escherichia
coli. J. Bacteriol. 172:7260–7262.
79. Strahilevitz, J., G. A. Jacoby, D. C. Hooper, and A. Robicsek. 2009. Plasmidmediated
quinolone resistance: a multifaceted threat. Clin. Microbiol. Rev.
22:664–689.
80. Thomson, K. S., and C. C. Sanders. 1992. Detection of extended-spectrum
beta-lactamases in members of the family Enterobacteriaceae: comparison
of the double-disk and three-dimensional tests. Antimicrob. Agents Chemother.
36:1877–1882.
81. Threlfall, E. J., L. R. Ward, and B. Rowe. 1986. R plasmids in Salmonella
typhimurium in the United Kingdom. J. Antimicrob. Chemother. 18(Suppl.
C):175–177.
82. Tsubokura, M., A. Matsumoto, K. Otsuki, S. B. Animas, and T. Sanekata.
1995. Drug resistance and conjugative R plasmids in Escherichia coli strains
isolated from migratory waterfowl. J. Wildl. Dis. 31:352–357.
83. Wallace, J. S., T. Cheasty, and K. Jones. 1997. Isolation of Vero cytotoxinproducing
Escherichia coli O157 from wild birds. J. Appl. Microbiol. 82:399–
404.
84. Wu, S., E. Chouliara, H. Hasman, A. Dalsgaard, A. Vieira, L. B. Jensen.
2008. Detection of a single isolate of CTX-M-1-producing Escherichia coli
from healthy pigs in Denmark. J. Antimicrob. Chemother. 61:747–749.
85. Yamane, K., J. Wachino, S. Suzuki, and Y. Arakawa. 2008. Plasmid-mediated
qepA gene among Escherichia coli clinical isolates from Japan. Antimicrob.
Agents Chemother. 52:1564–1566.
86. Yue, L., H. X. Jiang, X. P. Liao, J. H. Liu, S. J. Li, X. Y. Chen, C. X. Chen,
D. H. Lu, and Y. H. Liu. 2008. Prevalence of plasmid-mediated quinolone
resistance qnr genes in poultry and swine clinical isolates of Escherichia coli.
Vet. Microbiol. 132:414–420.
8134 LITERAK ET AL. APPL. ENVIRON. MICROBIOL.
Příloha 5
DOLEJSKA, M., DUSKOVA, E., RYBARIKOVA, J., JANOSZOWSKA, D., ROUBALOVA, E., DIBDAKOVA,
K., MASECKOVA, G., KOHOUTOVA, L., LITERAK, I., SMOLA, J., CIZEK, A., 2011, Plasmids carrying
blaCTX-M-1 and qnr genes in Escherichia coli isolates from equine clinic and horseback riding
centre: Journal of Antimicrobial Chemotherapy, v. 66, p. 757-764.
Souhrn
Tato studie byla zaměřena na sledování výskytu izolátů E. coli u koní a v prostředí na Klinice chorob koní VFU
Brno a v hipocentru Koryčany. Byly vyšetřeny vzorky trusu koní, stěry ze stájových boxů, hmyz a rektální výtěry
ošetřovatelů koní. Na Klinice chorob koní byl zjišten vysoký výskyt E. coli s produkcí širokospektré betalaktamázy
CTX-M, především v trusu koní a v prostředí kliniky (18-34 %). Kmeny s identickým pulzním profilem
byly zjištěny ve všech typech vzorků, což ukazuje na jejich šíření v rámci kliniky. Gen blaCTX-M byl u všech kmenů
nesen na velkém konjugativním multirezistentním plazmidu IncHI1. Tento výsledek podtrhuje význam
horizontálního přenosu plazmidů v šíření ESBL mezi různými bakteriálními izoláty na klinice.
Plasmids carrying blaCTX-M-1 and qnr genes in Escherichia coli isolates
from an equine clinic and a horseback riding centre
Monika Dolejska1*, Eva Duskova2, Jana Rybarikova1, Dagmar Janoszowska1, Eva Roubalova1, Katerina Dibdakova1,
Gabriela Maceckova3, Ludmila Kohoutova2, Ivan Literak1, Jiri Smola2 and Alois Cizek2
1
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical
Sciences Brno, Palackeho 1-3, 612 42 Brno, Czech Republic; 2
Institute of Microbiology and Immunology, Faculty of Veterinary Medicine,
University of Veterinary and Pharmaceutical Sciences Brno, Palackeho 1-3, 612 42 Brno, Czech Republic; 3
Equine Clinic, Faculty of
Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno, Palackeho 1-3, 612 42 Brno, Czech Republic
*Corresponding author. Tel: +420-541-562-643; Fax: +420-541-562-631; E-mail: m.dolejska@centrum.cz
Received 20 July 2010; returned 25 August 2010; revised 1 December 2010; accepted 1 December 2010
Objectives: The aim of this study was to determine the occurrence of extended-spectrum b-lactamase (ESBL)producing
Escherichia coli at an equine clinic and a horseback riding centre, and to discuss the impact of antimicrobial
treatment on resistance selection.
Methods: Faeces from horses, environmental smears and flies were sampled at both the clinic and riding
centre. Staff at the equine clinic were also examined. The samples were cultivated on MacConkey agar with
cefotaxime (2 mg/L) to isolate ESBL-producing E. coli. The presence of bla and qnr genes was tested by PCR,
and transferability was determined by conjugation. Replicon typing and restriction analysis of plasmids harbouring
ESBL and qnr genes were performed.
Results: E. coli with the blaCTX-M-1 gene were isolated from horses, staff, environmental smears and flies at the
two sites. E. coli isolates from the equine clinic harboured an IncHI1 conjugative 235–285 kb plasmid containing
blaCTX-M-1, catA1, strA, sul2 and tet(B) genes. Some of these were positive for qnrS1 and/or qnrB19, and were
located on 40 or 45 kb IncN or IncX1 conjugative plasmids. The gene blaCTX-M-1 in isolates from the riding centre
was carried by IncN (30 kb) and IncI1 (85 kb) conjugative plasmids. Horizontal gene transfer seems to be
involved in disseminating E. coli with ESBL and qnr genes at the clinic and riding centre.
Conclusions: The study illustrates that ESBL-producing E. coli, as well as plasmids carrying ESBL genes of clinical
interest, can be easily transferred among horses, humans and flies living in close contact.
Keywords: antibiotics, horses, ESBLs
Introduction
Escherichia coli is a common commensal bacterial species that
colonizes the gastrointestinal tracts of both humans and
animals. Antibiotic-resistant commensal E. coli occur with
different frequencies in human and animal populations, and in
the environment. Human patients in hospitals and long-term
care facilities frequently develop nosocomial infections, often
caused by antibiotic–resistant E. coli clones.1
Similarly, an
increased frequency of antibiotic-resistant E. coli occurrence
has been detected in horse faeces in connection with hospitalization
and antimicrobial treatment of horses.2
Medication of both humans and animals with b-lactam antibiotics,
particularly third- and fourth-generation cephalosporins,
underlies the selection of extended-spectrum b-lactamase
(ESBL)-producing Enterobacteriaceae, which are among
common causative agents of nosocomial infections.3
Among
these, the proportion of CTX-M b-lactamase producers has
increased within the last few years.4
Genes encoding for ESBLs
are often parts of integrons, transposons and/or plasmids, and,
in the case of multiresistant strains of enterobacteria, these
transposable elements often harbour structurally unrelated
resistance genes. This enables their co-selection, e.g. by
sulphonamides, tetracyclines or aminoglycosides.5
Another
antibiotic resistance mechanism that is recently on the increase
in enterobacteria is resistance to fluoroquinolones determined by
plasmid-mediated qnr genes.6
Increased selection of ESBL producers among family
members of the Enterobacteriaceae can be expected when
using cephalosporins or, by co-selection, even when using
# The Author 2011. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: journals.permissions@oup.com
J Antimicrob Chemother 2011; 66: 757–764
doi:10.1093/jac/dkq500 Advance Access publication 25 January 2011
757
byguestonMarch20,2011jac.oxfordjournals.orgDownloadedfrom
other groups of antimicrobial substances for therapy in horses.
As evidenced by recently published findings of ESBL-producing
E. coli and Klebsiella pneumoniae in horses in the Netherlands,3
it will be necessary to consider ESBL-positive enterobacteria as
potential aetiological agents of nosocomial infections in equine
clinics.
The aim of this study was to detect the occurrence of antibiotic–resistant
E. coli in faeces of hospitalized horses and hospital
staff, flies and environmental samples from the university
equine clinic and from a horseback riding centre, with an emphasis
on E. coli strains producing ESBLs. The equine clinic and
horseback riding centre were selected for the study because of
two serious cases of E. coli infection and their differing antibiotic
policies. A case of metritis in one mare caused by multiresistant
E. coli was diagnosed at the equine clinic, and a case of sepsis in
newborn twin foals was demonstrated at the riding centre.
Further goals of this work were to discuss the impact of antimicrobial
treatment on the selection of ESBL–producing and
fluoroquinolone–resistant E. coli, and to evaluate the likelihood
of transmission and survival of ESBL–producing E. coli isolates
in the conditions of the clinic and riding centre.
Materials and methods
Equine clinic
The equine clinic is located on the campus of the University of Veterinary
and Pharmaceutical Sciences Brno, Czech Republic. It has been in service
since 2000 and has 50 boxes available for the hospitalization of horses.
This establishment administers treatment services for .1000 horses
per year. The annual usage of antimicrobial substances in 2009 was as
follows: procaine benzylpenicillin+streptomycin, 1898 defined daily
doses per adult horse (DDDs); enrofloxacin, 594 DDDs; metronidazole,
495 DDDs; gentamicin, 502 DDDs; trimethoprim+sulfadiazine, 384
DDDs; cefquinome, 93 DDDs; marbofloxacin, 69 DDDs; oxytetracycline,
48 DDDs; rifampicin, 17 DDDs; clarithromycin, 9 DDDs; cefazolin,
2 DDDs; and penicillin G, 2 DDDs. Data for 2009 are representative for
the year 2007–08, when the samples were taken. A case of metritis in
one mare caused by multiresistant E. coli (ESBL negative) was diagnosed
at the equine clinic on 6 June 2007. In subsequent screening tests, faecal
samples from hospitalized horses, rectal swab samples from clinic staff,
environmental samples from the stables (biofilm smears from the
waterers) and samples of flies (Musca domestica) were taken (Table 1).
An ESBL-positive E. coli strain isolated from a wound of a horse
hospitalized in this clinic was included in the examination.
Horseback riding centre
The monitored horseback riding centre is located in the south-east of
the Czech Republic, in the municipal territory of the town of Korycany,
60 km from Brno. The riding centre has no relation to the equine
clinic. At the time of sampling, 35 horses were kept at the centre.
Horses were stabled in boxes in two stables. The antibiotic therapy
of the horses was evaluated over 2007 and 2008. According to the
data provided by a veterinarian, antibiotics were administered only in
the course of castrations and respiratory infections, and to treat
flesh wounds. Benzylpenicillin+streptomycin (76 DDDs), trimethoprim+
sulfadiazine (7 DDDs), oxytetracycline (5 DDDs) and first-generation
cephalosporins (1/2 DDDs) were used. A case of sepsis in newborn
twin foals was demonstrated here in April 2008. These twin foals
were treated with the fourth-generation cephalosporin cefquinome.
One of the foals had to be euthanized due to progressive general
infection on 14 April 2008. The necropsy and subsequent cultivation
examination proved E. coli sepsis caused by ESBL-producing E. coli
(sample no. 62510). Within this context, three subsequent samplings
were taken, including faecal samples from horses (including the
mother of the antibiotic-treated twins), environmental smears from
boxes (waterers), samples of flies (M. domestica) and a rectal swab
of a cat (Table 1).
Table 1. ESBL-producing E. coli in the equine clinic and the horseback riding centre
Sampling place Date of visit Sample type (no.)
No. of
blaCTX-M-1-positive
isolates Pulsotype (no.)a
Equine clinic July 2007 horses (14) 3 B (1), C (1), E (1)
February 2008 horses (12) 2 A (1), U (1)
surface swabs (32) 8 A (7), Q (1)
humans (10) 1 A (1)
June 2008 wound infection (1) 1 S (1)
September 2008 horses (11) 7 D (1), F (2), I (1), J (1), N (1), P (1)
surface swabs (18) 9 H (1), L (2), N (3), O (2), R (1)
flies (179) 33 G (22), M (1), N (1), O (1), R (1), S (4), T (3)
humans (2) —
Horseback riding centre April 2008 foal—necropsy (1) 1 f (1)
horses (10) 4 a (1), b (1), c (1), d (1)
surface swabs (18) 2 d (1), e (1)
May 2008, June 2008 horses (33) —
surface swabs (2) —
flies (187) —
cat (1) —
a
Identical pulsotypes from different sample types (horses, humans, surface swabs and flies) are underlined.
Dolejska et al.
758
byguestonMarch20,2011jac.oxfordjournals.orgDownloadedfrom
Isolation of ESBL-producing E. coli and antibiotic
susceptibility testing
Samples were enriched in MacConkey broth and cultivated on MacConkey
agar with cefotaxime (2 mg/L). Selected isolates (1 isolate per 1 sample)
were examined for the production of ESBL using the double-disc synergy
test7,8
and identified by the API 10S test kit (bioMe´rieux, France). The disc
diffusion method9
was used to test for susceptibility to 12 selected
antimicrobial substances: ampicillin (10 mg); streptomycin (30 mg);
sulphonamides compound (300 mg); tetracycline (30 mg); sulfamethoxazole/trimethoprim
(23.75/1.25 mg); chloramphenicol (30 mg); cefalotin
(30 mg); nalidixic acid (30 mg); ceftazidime (30 mg); gentamicin (10 mg);
amoxicillin/clavulanic acid (30 mg); and ciprofloxacin (5 mg). In horses
with proven excretion of ESBL-producing E. coli, the concentration of
cefotaxime-resistant E. coli per gram of faeces was determined.
For this purpose, the faecal samples were weighed, homogenized in
phosphate-buffered saline, 10 times diluted and then cultivated on
MacConkey agar with cefotaxime (2 mg/L). ESBL production was proven
in cefotaxime-resistant colonies using a double-disc synergy test.
PCR and testing of antibiotic resistance genes
The genes responsible for the ESBL phenotype (blaTEM, blaSHV and
blaCTX-M) were identified by PCR (Table S1, available as Supplementary
data at JAC Online), and the products were sequenced on both strands
using primers CTX-M-1seq-F and CTX-M-1seq-R (ABI 310 Genetic Analyzer;
Applied Biosystems, Belgium). All the ESBL isolates were examined
for additional resistance and antibiotic resistance genes and integrons
by PCR with specific primers (Table S2, available as Supplementary data
at JAC Online), as described previously.9,10
All the isolates were also
tested for plasmid-mediated quinolone resistance (PMQR) genes, and
the products were sequenced on both strands using the following
primers: qnrS1.seq1F, qnrS1.seq1R, qnrS1.seq2F and qnrS1.seq2R for
the qnrS1 gene; and qnrB19.seq1F, qnrB19.seq1R, qnrB19.seq2F and
qnrB19.seq2R for the qnrB19 gene. The list of primers for PMQR is
shown in Table S1. The nucleotide sequences of the complete blaCTX-M-1
(876 bp), qnrS1 (657 bp) and qnrB19 (645 bp) genes have been submitted
to GenBank (accession numbers HQ456393, HQ640661 and HQ640660,
respectively). Identification of E. coli phylogenetic groups was performed
using a multiplex PCR assay.11
PFGE and transferability of ESBL/quinolone resistance
genes by conjugation
The isolates were typed by XbaI-PFGE following CDC guidelines.12
The
transferability of bla genes and quinolone resistance genes was tested
by conjugation. Plate-mating experiments were performed using
plasmid–free, rifampicin- and nalidixic acid-resistant or, in the case of
quinolone resistance, rifampicin- and sodium azide-resistant E. coli
MT102RN and Salmonella enterica subsp. enterica serovar Typhimurium
SL5325 as recipients.13
Plasmid characterization
Plasmid DNA from E. coli was isolated by the alkaline extraction pro-
cedure.14
Plasmid DNA was introduced to competent E. coli DH5a or
E. coli Top10 (both Invitrogen, USA) by chemical transformation, followed
by selection of transformants on brain heart infusion agar supplemented
with cefotaxime (2 mg/L) or ciprofloxacin (0.05 mg/L), respectively. The
presence of a relevant bla gene/quinolone resistance gene in the transformants
was confirmed by PCR. All transformants, transconjugants
and their corresponding donors were examined for MICs of ciprofloxacin
and nalidixic acid using an agar dilution method following CLSI guide-
lines.7
The presence of a Tn3-like transposon in qnrS1-positive
transformants was tested by PCR.15
The size of the plasmid with the
ESBL gene from transformants or transconjugants was designated by
S1 nuclease PFGE.16
Plasmid DNA from transformants/transconjugants
was digested with EcoRV and HincII before gel electrophoresis in 1%
agarose gel for 16 h at 67 V/cm. Plasmids were replicon typed as
described previously.17
Statistical analysis
All data were used to calculate the prevalence of antimicrobial resistance
and analysed by the x2
test. Differences with P≤0.05 were considered
significant.
Results
Equine clinic
Isolation of ESBL-producing E. coli
From the total of 37 horse faecal samples, 12 (32%) ESBLproducing
E. coli isolates were found (Table 1). Seventeen
(34%) out of 50 isolates from the stables environment, 33
(18%) of samples from 179 flies and 1 (8%) of 12 rectal swabs
from clinic staff were positive for ESBL–producing E. coli. Isolates
belonged to phylogenetic groups A (20), B1 (40) and B2 (3).
Distribution of ESBL isolate pulsotypes
The total 64 ESBL-producing E. coli isolates thus obtained were
compared using PFGE. These were isolates from horse faeces
(12 isolates), the stables environment (17), clinic staff (1), the
wound infection (1) and flies (33). The isolates were divided
into 20 different pulsotypes designated with letters A–U
(Tables 1 and 2). All except for two E. coli isolates acquired
from horses during the sampling period showed unique PFGE
profiles. Isolates with the same PFGE profile (designated A)
were found in one horse, a staff member and several surface
swabs, suggesting clonal dissemination of this isolate in the
equine clinic during the period investigated. Most E. coli isolates
from flies showed pulsotype G, which was not detected in
horse and stables environment samples. However, several isolates
from flies did show identical pulsotypes, as did a horse
isolate (pulsotype N) and three stables environment isolates
(pulsotypes N, O and R). The wound infection E. coli isolate
63743 showed the same pulsotype (S) as four fly isolates.
Antibiotic resistance genes and integrons in ESBL isolates
All the ESBL isolates were multiresistant, with resistance to 7–12
of the antimicrobial agents tested, and their ESBL phenotype was
caused by the presence of the gene blaCTX-M-1. No blaTEM and
blaSHV ESBL genes were detected. Additional resistance to chloramphenicol,
gentamicin, streptomycin, sulphonamides and
tetracycline was detected in all isolates, and all the isolates
were positive for the catA1, strA, sul2 and tet(B) genes. Most
isolates also contained class 1 integrons with variable gene
cassettes. A 1.7 kb integron with dfrA17-aadA5 was most prevalent,
followed by a 1.6 kb integron with dfrA12-aadA2 and a
1.5 kb integron with dfrA1-aadA1. Class 2 integrons (2.5 kb in
size) with the dfrA1-sat-aadA1 cassette were also found. All
the ESBL-positive isolates were examined for plasmid-mediated
Antibiotic-resistant E. coli in horses
759
JAC
byguestonMarch20,2011jac.oxfordjournals.orgDownloadedfrom
Table 2. Characterization of blaCTX-M-1-positive E. coli isolates from the equine clinic and the horseback riding centre
PFGE Source Strain no.
Additional AR genes and
integronsa
Plasmid with blaCTX-M-1
Inc
size
(kb) RFLPb
AR genes on
plasmida
Equine clinic
A personnel (1), horse
(1), surface (7)
L4, T4, N6, N13,
N17, N29, N30
X HI1 235 V(L4) X
N23 X, I1a
N31 X, qnrB19, I1a
B horse (1) 3K X, blaTEM-1, I1c HI1 235 X
C horse (1) 9K X, I1c HI1 235 X
D horse (1) T20 X, qnrB19 HI1 235 V X
E horse (1) 6K X, blaTEM-1 HI1 235 X
F horse (2) T21 X HI1 235 X
T22 X, blaTEM-1, qnrS1, I2
G fly (22) MVc
X, blaTEM-1, I1c HI1 235 X
H surface (1) N35 X HI1 235 X
I horse (1) T14 X HI1 235 V X
J horse (1) T15 X, qnrB19 HI1 235 X
L surface (2) N33, N34 X HI1 235 X
M fly (1) MV173 X HI1 235 X
N horse (1), surface (3),
fly (1)
MV111, N36 X, blaTEM-1, qnrS1, I1c, I2 HI1 235 V(N36) X
N42 X, blaTEM-1, qnrB19, qnrS1,
I1c, I2
N50 X, blaTEM-1, qnrS1, I2
T19 X, qnrS1
O surface (2), fly (1) N39, N41, MV34 X, blaTEM-1, I1c HI1 265 V(N39, MV34) X
P horse (1) T23 X, blaTEM-1, I1d HI1 235 V X
Q surface (1) N10 X HI1 235 V X
R surface (1), fly (1) N44, MV105 cmlA, tet(A), sul3, aadA1,
I1a1
HI1 235 X
S fly (4), wound (1) MV38, MV117,
MV153
X, blaTEM-1, I1b HI1 235 X
MV128 X, blaTEM-1, qnrS1, I1b
63743 X, blaTEM-1, qnrS1, I1b HI1/X1 285 X, qnrS1,
blaTEM-1
T fly (3) MV48, MV113,
MV130
X HI1 235 V(MV48) X
U horse (1) T10 X, blaTEM-1, I1c HI1 235 V1
X
Horseback
riding centre
a horse (1) KK4 blaTEM-1, I2 N 30 III aadA1
b horse (1) KK5 blaTEM-1, I2 I1 85 IV aadA1
c horse (1) KK6 blaTEM-1, I2 N 30 III aadA1
d horse (1) KK8 blaTEM-1, sul2, strA, tet(B), I2 N 30 III aadA1
e surface (1) NK6 blaTEM-1, I2 N 30 III aadA1
d surface (1) NK7 blaTEM-1, sul2, tet(B), I2 N 30 III aadA1
f foal—necropsy (1) 62510 blaTEM-1, sul2, strA, tet(B), I2 N 30 III aadA1, tet(B)
Inc, incompatibility group; AR, antibiotic resistance.
a
X, catA1, strA, sul2, tet(B), I1a, sul1, int1, class 1 integron 1.6 kb: dfrA12-aadA2; I1a1
, int1, dfrA12-aadA2 (PCR for variable region of integron using
5CS-3CS primers was negative); I1b, sul1, int1, class 1 integron 1.5 kb: dfrA1-aadA1; I1c, sul1, int1, class 1 integron 1.7 kb: dfr1A17-aadA5; I1d, sul1,
int1, dfrA1-orf-aadA5 (PCR for variable region of integron using 5CS-3CS primers was negative); I2, int2, class 2 integron 2 kb: dfrA1-sat-aadA1.
b
RFLP profile determined by EcoRV and HincII digestion.
c
MV1,MV3, MV16, MV17, MV18, MV20, MV26, MV37, MV39, MV46,MV47,MV49,MV50,MV70,MV95,MV96,MV125, MV131,MV155,MV171, MV174 andMV179.
Dolejska et al.
760
byguestonMarch20,2011jac.oxfordjournals.orgDownloadedfrom
quinolone resistance genes. In 11 isolates from the stables
environment (n¼4), horse faeces (n¼4), flies (n¼2) and
wound infection (n¼1), the genes qnrS1 and/or qnrB19 were
detected (Table 2).
Analysis of ESBL plasmids
The gene blaCTX-M-1 was transferred to E. coli by conjugation, but
it was not transferred to Salmonella. Most of the transconjugants
contained a large plasmid of 235 kb in size. In the isolates of
pulsotype O and pulsotype S (strain 63743 from the wound
infection), respectively, larger plasmids of 265 and 285 kb in
size were detected. Plasmids of all sizes belonged to the
IncHI1 group, and additional antibiotic resistance genes catA1,
strA, sul2 and tet(B) were found to be co-located on this
plasmid along with blaCTX-M-1 using PCR. Restriction fragment
length polymorphism (RFLP) analysis of IncHI1 plasmids was
performed only in 10 transconjugants, because of unsuccessful
isolation of large plasmid DNA. Using EcoRV digestion, most plasmids
showed an identical pattern (n¼9, profile V) or a several
band difference was found (n¼1, profile V1
).
Characterization of plasmids harbouring qnr genes
The transferability of the qnr genes was tested and the plasmids
carrying the qnr genes were analysed in all 11 qnr-positive isolates
(Table 3). In most of the isolates, the qnr genes were transferred
to E. coli and Salmonella by conjugation. Chemical
transformation of a qnr-carrying plasmid was successful in
most of the isolates. The MICs of nalidixic acid and ciprofloxacin
for donor strains, transconjugants and transformants are shown
in Table S3 (available as Supplementary data at JAC Online). The
qnr genes were located on plasmids of 40 or 45 kb in size. All the
plasmids with qnrB19 belonged to incompatibility group IncN
and had the same RFLP profiles. Plasmids with the qnrS1 gene
also showed the same indistinguishable RFLP profiles (in one
isolate a two band difference was found of type Ia) and belonged
to the IncX1 group. The gene blaTEM-1 and a Tn3-like transposon
were found to be located on this IncX1 plasmid. In the isolate
from the wound infection, the qnrS1 gene was located on a
large IncHI1/X1 plasmid of 285 kb in size, together with the
blaCTX-M-1, blaTEM-1, catA1, strA, sul2 and tet(B) genes, although
the PCR for Tn3-like transposon was negative.
Excretion of ESBL-producing E. coli in the horse faeces
Concentrations of ESBL-producing E. coli isolates ranged from
8.18×103
to 7.73×106
cfu per gram of horse faeces.
Horseback riding centre
Isolation of ESBL-producing E. coli
From the samples taken during the first sampling, we isolated
ESBL-positive E. coli from faeces of four (9%) of the horses examined.
These samples originated from the mother of the
antibiotic-treated foals (sample no. KK6) and from the horses
stabled in the neighbouring boxes (KK4, KK5 and KK8). Of 20
samples examined from the waterers, ESBL-positive E. coli were
detected in two (10%) boxes (NK6 and NK7), one of which
belonged to the mother of the antibiotic-treated foals (NK6).
The following two samplings resulted in no ESBL-positive E. coli
detection (Table 1).
Characterization of ESBL-producing E. coli isolates
All the ESBL-positive isolates were multiresistant, with resistance
to five to nine of the antibiotics tested, and were positive for the
blaTEM-1 and blaCTX-M-1 genes. The isolates belonged to phylogenetic
group B1. Class 2 integrons of 2.5 kb in size with
dfrA1-sat-aadA1 gene cassettes were found in all of the isolates
Table 3. Characterization of qnr-positive E. coli isolates from the equine clinic
Source of the strain E. coli strain PFGE profile qnr gene
Conjugation qnr plasmid
E. coli Salmonella Inc group size (kb) RFLP AR genes on plasmid
Horses T15/B J qnrB19 + + N 40 II
T19/B N qnrS1 2 2 X1 45 Ia blaTEM-1
T20/B D qnrB19 + + N 40 II
T22/B F qnrS1 + 2 X1 45 I blaTEM-1
Surface swabs N31/B A qnrB19 2 2 NT NT NT
N36/B N qnrS1 + + X1 45 I blaTEM-1
N42/B N qnrB19 + + N 40 II
qnrS1 2 2 X1 45 I blaTEM-1
N50/B N qnrS1 + + X1 45 I blaTEM-1
Flies MV128 S qnrS1 2 2 X1 45 I blaTEM-1
MV111 N qnrS1 2 2 X1 45 I blaTEM-1
Wound infection 63743 S qnrS1 + 2 HI1/X1 285 NT blaCTX-M-1, blaTEM-1, X
NT, not tested; AR, antibiotic resistance; X, catA1, strA, sul2, tet(B).
All of the qnr-positive isolates carried blaCTX-M-1 on a 235 kb plasmid (apart from 63743).
RFLP profile determined by EcoRV and HincII digestion.
Antibiotic-resistant E. coli in horses
761
JAC
byguestonMarch20,2011jac.oxfordjournals.orgDownloadedfrom
(Table 2). Most of the ESBL-positive E. coli isolates showed unique
PFGE profiles. The gene blaCTX-M-1 was transferred to E. coli by
conjugation, but it was not transferred to Salmonella. The
blaCTX-M-1 gene was localized on a small (30 kb) IncN plasmid
(n¼6) or on an 85 kb IncI1 plasmid along with the streptomycin
resistance gene aadA1. All the plasmids of the IncN group
showed the same restriction profile. No qnr genes were found
in these ESBL-producing E. coli isolates.
Statistical analysis
The prevalence of ESBL-producing E. coli in horses and environmental
smears at the equine clinic was significantly higher
(P,0.001) than in horses and environmental smears at the
horseback riding centre.
Discussion
We consider the common finding of ESBL-positive and
fluoroquinolone-resistant isolates with plasmid–mediated qnr
genes among E. coli isolates in horses at two horse facilities
alarming. Cephalosporins are important antibiotics in both
human and veterinary medicine. In horses, third- and fourthgeneration
cephalosporins are advised, with specific cautions,
only for the treatment of foal septicaemia.18
Our results
showed that this therapeutic intervention in the riding centre
implicated the excretion of ESBL-producing E. coli by the
mother of the antibiotic-treated foals and by the horses from
the neighbouring boxes, as well as the contamination of the
stables environment. No ESBL-producing E. coli strains were
detected during the following two samplings in May and June,
which indicates a temporary colonization of these horses by
ESBL-producing strains, probably as a result of cephalosporin
selective pressure. High prevalence of antimicrobial-resistant isolates
from hospital-treated horses compared with untreated and
a non-hospitalized community group of horses has been docu-
mented.2
High risk for faecal carriage of resistant E. coli in
horses during hospitalization has been recently identified.19
This includes a high prevalence of ESBL-producing E. coli in
faecal samples of hospitalized horses, with a significantly
increased prevalence during hospitalization compared with at
time of admission. We assume that the effect of hospitalization
on colonization by antibiotic-resistant bacteria in horses has also
played an important role in our study. At the equine clinic,
various antibiotics, including small portions of extendedspectrum
cephalosporins, were used for therapy of horses.
Metronidazole, sulphonamides, aminoglycosides and fluoroquinolones
were the antibiotics with the highest consumption. It
appears that co-selection promoted by the usage of these
non–b-lactam antibiotics is the reason for the high prevalence
of multidrug-resistant ESBL isolates in horses.
The horse colon can provide an environment suitable for the
survival and propagation of the causative agents for nosocomial
infections.20
The high concentrations of E. coli isolates in horse
faeces detected in our study markedly increase environmental
contamination and enable subsequent colonization of other
species, such as flies, occurring in the contaminated environment.
Our results indicate a high level of contamination of the
stables environment, which affected colonization of flies by
ESBL-producing E. coli. Such colonized flies can further serve as
vectors of resistant bacterial strains. A high prevalence of
antibiotic-resistant E. coli strains has been observed in flies captured
on cattle and pig farms.21,22
In our study, the same PFGE profiles were occasionally
observed in E. coli from horses, environmental samples and
flies, indicating a role for clonal spreading of some strains.
However, the high genetic diversity observed among blaCTX-M-1positive
E. coli isolated from horses, the stables environment
and flies indicated that the spread of isolates harbouring the
gene blaCTX-M-1 within the equine clinic resulted not only from
clonal dissemination, but that horizontal gene transfer is also
involved in the dissemination of ESBL-positive E. coli at the
equine clinic. This was confirmed by the plasmid analysis.
Clonal spread of blaCTX-M-1-positive E. coli, as well as horizontal
gene transfer of blaCTX-M-1, was also demonstrated at the riding
centre. The same observation has been made in hospitalized
horses in the UK.19
Various associations among the plasmids and b-lactamase
genes have been observed. In the present study, blaCTX-M-1 was
harboured on conjugative plasmids of three different incompatibility
groups—IncN, IncI1 and IncHI1.23,24
Our study provides
the first demonstration of an association between
ESBL-encoding genes and large IncHI1 multiresistance plasmids.
Large plasmids (usually .160 kb) of incompatibility group HI1
are important vectors of antibiotic resistance in both major
causal agents of enteric fever (Salmonella Typhi and Salmonella
Paratyphi A).25
It has been demonstrated that these IncHI1 plasmids
allow major human pathogens to acquire genes available in
the environment and in the human gut, and that they are maintained
by enhancing the competitive advantage of the bacterial
host.26
Association of IncHI1 plasmids with antibiotic resistance
to chloramphenicol, tetracycline, aminoglycosides and sulphonamides,
and relevant genes [catA1, tet(B), strA and sul2] has been
demonstrated.27
High prevalence of qnr genes has been described in E. coli
isolates carrying other resistance determinants, such as ESBLproducing
strains, probably due to co–transfer in the same
genetic elements.28
In our study, qnrS1 and qnrB19 genes
carried by plasmids of the IncN and IncX1 incompatibility groups
were detected in multiresistant ESBL-producing E. coli from
horses, surface environmental samples and flies at the equine
clinic. The qnrS1 gene has been recently detected also on a
45 kb non-conjugative IncX1 plasmid in one poultry E. coli isolate
in Italy and, similar to in our study, the qnrS1 gene in this poultry
isolate was associated with a Tn3-like transposon containing the
blaTEM-1 gene.29
IncX1 plasmids have recently also been found to
be associated with ESBL genes, such as blaTEM-52.
15
This study illustrates that ESBL-producing E. coli, as well as
plasmids carrying ESBL genes of clinical interest, can be easily
transferred among horses, humans and flies living in close
contact. The presence of ESBL-producing and fluoroquinoloneresistant
bacteria in the horse hospital environment increases
the health risk and raises essential questions about the control
of nosocomial infections. The results of the presented study indicate
the essential importance of infection control strategies,
such as frequent hand hygiene, barrier nursing, and proper cleaning
and disinfection. Such practices should minimize the spread
of antibiotic-resistant bacteria as well as of mobile genetic determinants
harbouring antibiotic resistance genes in a hospital
environment.30
Dolejska et al.
762
byguestonMarch20,2011jac.oxfordjournals.orgDownloadedfrom
Acknowledgements
We would like to thank George Jacoby (Lahey Clinic Inc., Burlington, MA,
USA), Lina Cavaco and Henrik Hasman (National Food Institute,
Copenhagen, Denmark), Ming-Gui Wang (Institute of Antibiotics,
Huashan Hospital, Shanghai, People’s Republic of China), and Surbhi
Malhotra-Kumar (University of Antwerp, Belgium) for positive control
strains. Our thanks also go to Iveta Zadrazilova for excellent laboratory
work, to Milan Dolinek and Miloslav Slesinger from the horseback riding
centre, and to employees of the equine clinic for their cooperation. We
would like to thank the Veterinary Research Institute in Brno (Czech
Republic), which provided equipment for PFGE analysis (Bio-Rad CHEF-DR).
Funding
This work was supported by the Czech Science Foundation (grant number
P502/10/P083), the Ministry of Education, Youth and Sports of the Czech
Republic (MSM6215712402) and the Internal Grant Agency of the University
of Veterinary and Pharmaceutical Sciences Brno (162/2008 FVL).
Transparency declarations
None to declare.
Supplementary data
Tables S1, S2 and S3 are available as Supplementary data at JAC Online
(http://jac.oxfordjournals.org/).
References
1 March A, Aschbacher R, Dhanji H et al. Colonization of residents and
staff of a long-term-care facility and adjacent acute-care hospital
geriatric unit by multiresistant bacteria. Clin Microbiol Infect 2009; 16:
934–44.
2 Dunowska M, Morley PS, Traub-Dargatz JL et al. Impact of
hospitalization and antimicrobial drug administration on antimicrobial
susceptibility patterns of commensal Escherichia coli isolated from the
feces of horses. J Am Vet Med Assoc 2006; 228: 1909–17.
3 Vo AT, van Duijkeren E, Fluit AC et al. Characteristics of extendedspectrum
cephalosporin-resistant Escherichia coli and Klebsiella
pneumoniae isolates from horses. Vet Microbiol 2007; 124: 248–55.
4 Livermore DM, Canton R, Gniadkowski M et al. CTX-M: changing the face
of ESBLs in Europe. J Antimicrob Chemother 2007; 59: 165–74.
5 Deschamps C, Clermont O, Hipeaux MC et al. Multiple acquisitions of
CTX-M plasmids in the rare D2 genotype of Escherichia coli provide
evidence for convergent evolution. Microbiology 2009; 155: 1656–68.
6 Strahilevitz J, Jacoby GA, Hooper DC et al. Plasmid-mediated quinolone
resistance: a multifaceted threat. Clin Microbiol Rev 2009; 22: 664–89.
7 Clinical and Laboratory Standards Institute. Performance Standards for
Antimicrobial Susceptibility Testing: Eighteenth Informational Supplement
M100-S18. CLSI, Wayne, PA, USA, 2008.
8 Thomson KS, Sanders CC. Detection of extended-spectrum
b-lactamases in members of the family Enterobacteriaceae:
comparison of the double-disk and three-dimensional tests. Antimicrob
Agents Chemother 1992; 36: 1877–82.
9 Dolejska M, Cizek A, Literak I. High prevalence of antimicrobial-resistant
genes and integrons in Escherichia coli isolates from black-headed gulls in
the Czech Republic. J Appl Microbiol 2007; 103: 11–9.
10 Dolejska M, Bierosova B, Kohoutova L et al. Antibiotic-resistant
Salmonella and Escherichia coli isolates with integrons and
extended-spectrum b-lactamases in surface water and sympatric black
headed gulls. J Appl Microbiol 2009; 106: 1941–50.
11 Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of
Escherichia coli phylogenetic group. Appl Environ Microbiol 2000; 66:
4555–8.
12 Center for Disease Control and Prevention. One-Day (24–28 h)
Standardized Laboratory Protocol for Molecular Subtyping of Escherichia
coli O157:H7, non-typhoidal Salmonella serotypes, and Shigella sonnei
by Pulsed Field Gel Electrophoresis (PFGE). http://www.cdc.gov/pulsenet/
protocols/ecoli_salmonella_shigella_protocols.pdf (1 May 2008, date last
accessed).
13 Olesen I, Hasman H, Aarestrup FM. Prevalence of b-lactamases
among ampicillin-resistant Escherichia coli and Salmonella isolated
from food animals in Denmark. Microb Drug Resist 2004; 10: 334–40.
14 Birnboim HL, Doily J. A rapid alkaline extraction procedure for
screening of recombinant plasmid DNA. Nucleic Acids Res 1979; 7:
1513–23.
15 Bergenholtz RD, Jørgensen MS, Hansen LH et al. Characterization of
genetic determinants of extended-spectrum cephalosporinases (ESCs)
in Escherichia coli isolates from Danish and imported poultry meat.
J Antimicrob Chemother 2009; 64: 207–9.
16 Barton BM, Harding GP, Zuccarelli AJ. A general method for detecting
and sizing large plasmids. Anal Biochem 1995; 226: 235–40.
17 Carattoli A, Bertini A, Villa L et al. Identification of plasmids by
PCR-based replicon typing. J Microbiol Methods 2005; 63: 219–28.
18 European Medicines Agency. Revised Reflection Paper on the Use of
3rd and 4th Generation Cephalosporins in Food Producing Animals in the
European Union: Development of Resistance and Impact on Human and
Animal Health. London: EMEA, 2009.
19 Maddox TW, Clegg PD, Pinchbeck GL et al. Prevalence and risk factors
for faecal carriage of extended-spectrum b-lactamase-producing
Escherichia coli in hospitalised horses. In: Abstracts of the Second ASM
Conference on Antimicrobial Resistance in Zoonotic Bacteria and
Foodborne Pathogens in Animals, Humans and the Environment,
Toronto, Canada, 2010. Abstract A183, p. 114. American Society for
Microbiology, Washington, DC, USA.
20 House JK, Mainer-Jaime RC, Smith BP et al. Risk factors for nosocomial
Salmonella infection among hospitalized horses. J Am Vet Med Assoc
1999; 214: 1511–6.
21 Literak I, Dolejska M, Rybarikova J et al. Highly variable patterns of
antimicrobial resistance in commensal Escherichia coli isolates from
pigs, sympatric rodents, and flies. Microb Drug Resist 2009; 15: 229–37.
22 Rybarikova J, Dolejska M, Materna D et al. Phenotypic and genotypic
characteristics of antimicrobial resistant Escherichia coli isolated from
symbovine flies, cattle and sympatric insectivorous house martins from
a farm in the Czech Republic (2006–2007). Res Vet Sci 2010; 89: 179–83.
23 Moodley A, Guardabassi L. Transmission of IncN plasmids carrying
blaCTX-M-1 between commensal Escherichia coli in pigs and farm
workers. Antimicrob Agents Chemother 2009; 53: 1709–11.
24 Marcade´ G, Deschamps C, Boyd A et al. Replicon typing of plasmids
in Escherichia coli producing extended-spectrum b-lactamases.
J Antimicrob Chemother 2009; 63: 67–71.
25 Hampton MD, Ward LR, Rowe B et al. Molecular fingerprinting of
multidrug-resistant Salmonella enterica serotype Typhi. Emerg Infect Dis
1998; 4: 317–20.
26 Dionisio F, Conceic¸a˜o IC, Marques AC et al. The evolution of a
conjugative plasmid and its ability to increase bacterial fitness. Biol Lett
2005; 1: 250–2.
Antibiotic-resistant E. coli in horses
763
JAC
byguestonMarch20,2011jac.oxfordjournals.orgDownloadedfrom
27 Phan MD, Kidgell C, Nair S et al. Variation in Salmonella enterica
serovar Typhi IncHI1 plasmids during the global spread of resistant
typhoid fever. Antimicrob Agents Chemother 2009; 53: 716–27.
28 Cavaco LM, Hansen DS, Friis-Møller A et al. First detection of
plasmid-mediated quinolone resistance (qnrA and qnrS1) in Escherichia
coli strains isolated from humans in Scandinavia. J Antimicrob
Chemother 2007; 59: 804–5.
29 Cerquetti M, Garcı´a-Ferna´ndez A, Giufre` M et al. First report of
plasmid-mediated quinolone resistance determinant qnrS1 in an
Escherichia coli strain of animal origin in Italy. Antimicrob Agents
Chemother 2009; 53: 3112–4.
30 Bartley JM, Olmsted RN, Haas J. Current views of health care design
and construction: practical implications for safer, cleaner environments.
Am J Infect Control 2010; 38 Suppl 1: S1–12.
Dolejska et al.
764
byguestonMarch20,2011jac.oxfordjournals.orgDownloadedfrom
Příloha 6
DOLEJSKA, M., JURCICKOVA, Z., LITERAK, I., POKLUDOVA, L., BURES, J., KOHOUTOVA, L., SMOLA,
J., CIZEK, A., 2011, IncN plasmids carrying blaCTX-M-1 in Escherichia coli isolateson a dairy farm:
Veterinary Microbiology, v. 149, p. 513-516.
Souhrn
V této studii byla zjištěna vyšší prevalence E. coli s ESBL v rektálních výtěrech dojnic na konvenční farmě
s vysokou spotřebou cefalosporinů (39 %) v porovnání s organickou farmou bez použití této skupiny antibiotik
(<1 %). U všech izolátů byla zjištěna beta-laktamáza CTX-M. Genotypizace ESBL kmenů prokázala šíření jedné
dominantní linie mezi zvířaty na farmě a rovněž význam IncN plazmidů v přenosu genu blaCTX-M mezi
nepříbuznými kmeny E. coli. Studie dokumentuje negativní dopady použití cefalosporinů pro terapii a prevenci
mastitid na šíření producentů ESBL na úrovni farmy.
Short communication
IncN plasmids carrying blaCTX-M-1 in Escherichia coli isolates on a dairy
farm
Monika Dolejska a,
*, Zuzana Jurcickova b,c
, Ivan Literak a
, Lucie Pokludova c
, Jiri Bures c
,
Alfred Hera c
, Ludmila Kohoutova b
, Jiri Smola b
, Alois Cizek b
a
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences,
Brno, Palackeho 1–3, 612 42 Brno, Czech Republic
b
Department of Microbiology and Immunology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences, Brno, Palackeho 1–3,
612 42 Brno, Czech Republic
c
Institute for State Control of Veterinary Biologicals and Medicaments, Hudcova 56a, Brno 621 00, Czech Republic
1. Introduction
Therapeutic use of cephalosporins in veterinary medicine
may select for extended-spectrum beta-lactamase
(ESBL)-producing Enterobacteriaceae in animals, ultimately
resulting in an increased risk for zoonotic
transmission of ESBL-carrying bacteria and plasmids
(Moodley and Guardabassi, 2009). Third generation
parenteral cephalosporins are used extensively in cattle
for treating acute undifferentiated bovine pneumonia and
coliform mastitis (EMA, 2009). Several compounds belonging
to the third and fourth generation cephalosporins are
contained in veterinary medicinal products used in the
Czech Republic. Injectable products containing ceftiofur
are currently authorized for the following indications in
cattle: respiratory disease, interdigital necrobacillosis, and
puerperal metritis. Cefoperazone is available as an
intramammary suspension for mastitis indication only.
Cefquinome is used for respiratory disease, interdigital
necrobacillosis, severe mastitis, sepsis and other generalVeterinary
Microbiology 149 (2011) 513–516
A R T I C L E I N F O
Article history:
Received 9 August 2010
Received in revised form 23 November 2010
Accepted 25 November 2010
Keywords:
Cephalosporins
Dairy farm
ESBL
Escherichia coli
Plasmids
IncN
A B S T R A C T
The aim of the study was to compare the prevalence of extended-spectrum beta-lactamase
(ESBL)-producing Escherichia coli bovine isolates on a conventional dairy cattle farm with
high consumption of parenteral and intramammary cephalosporins (farm A) and on an
organic dairy farm with no cephalosporin use (farm B). ESBL-producing E. coli were isolated
from rectal swabs and milk filters by selective cultivation on MacConkey agar with
cefotaxime (2 mg/l). ESBL genes were identified by polymerase chain reaction (PCR) and
sequencing, and the genetic diversity of the isolates was determined by XbaI pulsed field gel
electrophoresis (PFGE). Conjugative transfer, incompatibility group, and restriction
fragment length polymorphism (RFLP) profiles of the ESBL-carrying plasmids were studied.
Higher prevalence (39%, nrectal samples in cows = 309) of CTX-M-1-producing E. coli isolates was
found on farm A compared to farm B (<1%, nrectal samples in cows = 154; 0%, nrectal samples in
calves = 46). Using PFGE, the isolates from farm A were divided into nine pulsotypes. In all
ESBL-positive isolates, the blaCTX-M-1 gene was carried on 40 kb IncN conjugative plasmids of
three related HincII restriction profiles. Horizontal gene transfer through transmission of
IncN plasmids harboring blaCTX-M-1 as well as clonal dissemination of a particular clone
seems to be involved in dissemination of CTX-M-1-producing E. coli isolates in cows on the
farm usingcephalosporinsin treating bacterial infections. The studydemonstratesa possible
role of cephalosporin use in the widespread occurrence of CTX-M-1-producing E. coli on the
conventional dairy cattle farm compared to the organic farm.
ß 2010 Elsevier B.V. All rights reserved.
* Corresponding author. Tel.: +420 541 562 643; fax: +420 541 562 631.
E-mail address: m.dolejska@centrum.cz (M. Dolejska).
Contents lists available at ScienceDirect
Veterinary Microbiology
journal homepage: www.elsevier.com/locate/vetmic
0378-1135/$ – see front matter ß 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.vetmic.2010.11.032
ized infections, as well as urogenitary tract infections
(EMA, 2009; USKVBL, 2010).
In this study, we investigated the occurrence of ESBLproducing
Escherichia coli on two Czech dairy farms with
different livestock management practices and antibiotic
policies. Clonal spread and horizontal transfer of ESBL
determinants were investigated by molecular characterization
of ESBL-producing E. coli isolates from rectal swabs
and milk filters obtained at the two farms.
2. Materials and methods
2.1. Sampling
Two dairy farms in the Czech Republic with different
antibiotic policies were chosen for the study. Farm A
housed 360 dairy cows and 80 calves in 2008. This was a
conventional intensive farm characterized by high consumption
of cephalosporin antibiotics. Ceftiofur (third
generation cephalosporin) was the antibiotic with the
highest frequency of use for treatment in several indications,
followed by amoxicillin–clavulanic acid, cefoperazone,
and a penicillin plus neomycin combination during
recent years (2005–2008). For dry cow therapy, cloxacillin
and cefquinome were frequently used. During 2008, a total
of 69 treatment courses using ceftiofur, cefoperazone or
cefquinome were recorded from a total of 132 antibiotic
administrations in 43 cows. Individual treatment courses
varied between 1 and 5 administrations.
Farm B housed 180 dairy cows, 80 beef cows and 50
calves in 2008. This farm was certified as an organic farm
and had low antibiotic consumption. Tetracycline was the
most frequently used antibiotic and was administered
using an injectable product. The farm had limited
individual medications. It used an oxytetracycline-containing
veterinary medicinal product for administration to
calves. Also administered on the farm were oxytetracycline
and neomycin in combination, a streptomycin and
sulphonamide combination, a penicillin and dihydrostreptomycin
combination, and a cloxacillin and neomycin
combination. No third and fourth generation cephalosporins
were used on the farm. On both farms, the cattle
turnover involved only animals born on the respective
farm, as no animals were purchased from outside. Rectal
swabs were collected from 309 dairy cows on farm A and
154 dairy cows and 46 calves on farm B in December 2008.
Two milk filters were sampled on each farm.
2.2. Selective isolation and genotyping of ESBL-producing E.
coli
Rectal swabs and milk filters were enriched in
MacConkey broth and subcultivated onto MacConkey agar
(MCA) containing cefotaxime (2 mg/l) for detection of
presumptive ESBL-producing E. coli. A single colony
growing on MCA with cefotaxime was subcultured and
examined using the double-disk synergy test for the
production of ESBL according to Clinical and Laboratory
Standards Institute specifications (CLSI, 2008) and identified
by API10S test kit (bioMerieux, France). Genes
responsible for the ESBL phenotype (blaTEM, blaSHV and
blaCTX-M) were identified by polymerase chain reaction
(PCR) as previously described (Literak et al., 2010) and
further analyzed using sequencing (ABI 310 Genetic
Analyzer, Applied Biosystems, USA). The isolates were
typed by XbaI pulsed field gel electrophoresis (PFGE) (CDC,
2002) and their relatedness was analyzed using Bionumerics
(Applied Maths, Belgium).
2.3. Transferability of genes encoding ESBL, plasmid analysis
Transferability of ESBL genes was tested by conjugation
(Literak et al., 2010). Plate-mating experiments were
conducted using plasmid-free, rifampicin- and nalidixic
acid-resistant E. coli MT102RN and Salmonella enterica
serovar Typhimurium SL5325 as recipients. Plasmid DNA
from E. coli was isolated by alkaline extraction procedure
(Birnboim and Doly, 1979) and introduced into competent
E. coli DH5a (Invitrogen, USA). The size of the plasmid with
the ESBL gene from transformants was determined by S1PFGE.
Plasmid DNA from transformants was digested with
HincII and replicon typed (Carattoli et al., 2005).
2.4. Statistical analysis
All data were used to calculate the prevalence of ESBLproducing
E. coli in cows and analyzed using chi-square
test. Differences with p  0.05 were considered significant.
3. Results and discussion
Among the 309 rectal swabs from farm A, 119 (39%)
were found to be positive for ESBL-producing E. coli. One of
the two milk filters collected from this farm was also
positive. In contrast, only one (<1%) of the 154 rectal swab
samples from dairy cows and none of the milk filters from
farm B yielded growth of ESBL-producing E. coli. Additional
resistance to other antibiotic groups including antibiotic
resistance genes were detected only in two E. coli isolates
from cows and one isolate from a milk filter on farm A. The
isolates were resistant to streptomycin, sulfonamides and
tetracycline and carried the genes strA, sul2 and tetB.
Statistically higher prevalence of ESBL-producing E. coli
isolates was detected on farm A, where third and fourth
generation cephalosporins were frequently administered,
in comparison to farm B, where no cephalosporins were
used (p  0.05). This suggests a possible influence of
cephalosporin use in the widespread occurrence of ESBLproducing
E. coli on farm A. In vivo effects of veterinary
cephalosporins (ceftiofur and cefquinome) on selection of
CTX-M-1-producing E. coli have been demonstrated in pigs
under experimental conditions (Cavaco et al., 2008). The
results of our study of cephalosporins’ effect in the natural
conditions of a dairy farm are consistent with the recent
study by Lanzas and Grohn (2010) evaluating the effect of
intramuscular administration of ceftiofur while following
the label recommendation (2.2 mg/kg/day for 5 d) on the
gastrointestinal E. coli population in cattle. They had found
that the presence of residual levels of ceftiofur in the
gastrointestinal tract favored the selection and clonal
dissemination of ceftiofur-resistant bacteria during treatment.
As only a single conventional and a single organic
M. Dolejska et al. / Veterinary Microbiology 149 (2011) 513–516514
farm were examined in our study, further study is needed
in order to draw conclusions as to a possible role of
selective pressure from cephalosporins on spreading of
ESBL-producing isolates in these farms. Recently, an
occurrence of ESBL-producing isolates in organic chicken
egg production but not in conventional farms has been
documented (Bortolaia et al., 2010). Thus, it also seems
that factors other than antibiotics usage, perhaps including
management practices, are involved in the spreading of
ESBL isolates in food production.
The blaCTX-M-1 gene was detected in the cases of all the
cattle testing positive for ESBL-producing E. coli. The betalactamase
CTX-M-1 has become one of the most widespread
CTX-M types in animal E. coli isolates worldwide.
This ESBL has also been isolated from diseased and healthy
cattle elsewhere in Europe (Brinas et al., 2005; Meunier
et al., 2006). In the Czech Republic, CTX-M-1-producing E.
coli have been reported in poultry (Kolar et al., 2010;
Dolejska et al, in press), wild birds, and mammals (Dolejska
et al., 2009; Literak et al., 2010).
Using XbaI PFGE, CTX-M-1-producing E. coli isolates
from farm A were divided into nine pulsotypes labeled A–G
(Fig. 1). Most of the CTX-M-1-producing E. coli isolates
from cows (87%, 103 positive/119 examined) belonged to
the dominant pulsotype A. One isolate from a cow
untypable by PFGE was excluded from further characterization.
The isolate from a milk filter belonged to pulsotype
E. The CTX-M-1-producing E. coli isolate from farm B
showed a unique pulsotype (labeled H). We suppose that
the dissemination of a particular clone (pulsotype A) was
involved in the spread of CTX-M-1-producing E. coli among
cows on farm A.
One randomly selected CTX-M-1-positive isolate from
each of the nine pulsotype groups from farm A and the one
isolate from farm B were used for conjugative transfer and
CTX-M-1-carrying plasmid characterization. The blaCTX-M-1
gene was transferred by conjugation to E. coli and Salmonella
in all the isolates from farm A, but the blaCTX-M-1 gene of the
isolate from farm B was located on a nonconjugative
plasmid (Fig. 1). Because of the unsuccessful transfer (using
conjugation and transformation) of the plasmid harboring
the blaCTX-M-1 gene, the isolate from farm B had to be
excluded from further plasmid characterizations. In all the
transformants from farm A, single 40 kb conjugative
plasmids of the IncN group were detected (Fig. 1). An
association between blaCTX-M-1 and IncN plasmids has also
been observed in Europe among porcine (Moodley and
Guardabassi, 2009), canine (Schink et al., 2010) and human
E. coli isolates (Novais et al., 2007). IncN plasmids are broadhost-range
plasmids that might contribute to the further
spread of the blaCTX-M-1 gene among other members of
Enterobacteriaceae (Novais et al., 2007).
Fig. 1. PFGE analysis and molecular characterization of CTX-M-1-producing E. coli isolates from cows on two Czech dairy farms. Dice (Tol. 0.625%) (H > 0.0%
S > 0.0%). a
Isolates with pulsotypes A, A1, D, D1, C, G, B, E, and F originated from farm A. The isolate with pulsotype H originated from farm B. b
EC, E. coli
MT102RN; ST, Salmonella enterica ser. Typhimurium SL5325. c
NT, not tested.
Fig. 2. RFLP analysis of plasmid DNA harboring the blaCTX-M-1 gene
designed by HincII. Lanes 1 and 8, Lambda DNA digested with HindIII;
lanes 2 and 9, DNA marker (2-log marker, New England Biolabs, UK);
lane 3, RFLP type I; lanes 4–7, 12–13, RFLP type II; lanes 10 and 11, RFLP
type III.
M. Dolejska et al. / Veterinary Microbiology 149 (2011) 513–516 515
By restriction analysis of plasmid DNA using HincII, the
IncN plasmids were divided into three groups (I–III) with
small band differences (Figs. 1 and 2). As previously
described (Liebana et al., 2006), plasmid analysis has
indicated that horizontal transfer of these elements is a
very efficient mechanism involved in the spread of CTX-Mmediated
resistance at the farm. These authors had found
that dissemination of CTX-M genes through IncK plasmids
of undistinguishable restriction fragment length polymorphism
(RFLP) profiles was involved in spreading ESBLproducing
E. coli on a dairy farm in the United Kingdom. A
role of horizontal gene transfer of blaCTX-M-1 mediated by
IncN plasmids among E. coli isolates associated with
prophylactic use of ceftiofur in pigs has been recently
described on Danish farms (Moodley and Guardabassi,
2009). We must consider a possible risk that IncN plasmids
carrying blaCTX-M-1, and which are typically conjugative
and broad-host-range plasmids, can be transferred from
commensal E. coli to cattle pathogens, and thus result in
veterinary therapeutic problems. In addition, the findings
of this study could have potential occupational health
implications for cattle farmers since direct transfer of IncN
plasmids carrying blaCTX-M-1 has previously been described
between pigs and pig farmers (Moodley and Guardabassi,
2009).
Modern, industrialized food production should accept
low use of antibiotics in order to reduce selection and
spreading of antibiotic-resistant bacteria. Principles of
prudent use should be followed and prophylactic and offlabel
use (especially in terms of non-approved indications,
shorter or longer duration of treatment, or inaccurate
dosing) of cephalosporins should be discouraged in dairy
cattle farming.
Acknowledgements
We would like to thank to Lina Cavaco and Henrik
Hasman (National Food Institute, Copenhagen, Denmark).
Our thanks also go to Petra Slamova, Jana Soukupova and
Marie Slavikova for excellent laboratory work, to Pavel
Svec for PFGE data analysis, and to employees of both the
studied cattle farms for their cooperation. Our thanks also
go to the Veterinary Research Institute in Brno (Czech
Republic), which provided equipment for PF6E analysis
(Bio-Rad CHEF-DR). This study was funded by grant no.
P502/10/P083 of the Czech Science Foundation, grant no.
MSM6215712402 of the Ministry of Education, Youth and
Sports of the Czech Republic, and grant IGA VFU 162/2008
FVL of the Internal Grant Agency of the university of
Veterinary and Pharmaceutical Sciences Brno, Czech
Republic. This study was also supported by project ESBL
01 of the Institute for State Control of Veterinary
Biologicals and Medicaments of the Czech Republic.
References
Birnboim, H.C., Doly, J., 1979. A rapid alkaline extraction procedure
for screening of recombinant plasmid DNA. Nucleic Acids Res. 7,
1513–1523.
Bortolaia, V., Guardabassi, L., Bisgaard, M., Larsen, J., Bojesen, A.M., 2010.
Escherichia coli producing CTX-M-1, -2, and -9 group beta-lactamases
in organic chicken egg production. Antimicrob. Agents Chemother.
54, 3527–3528.
Brinas, L., Moreno, M.A., Teshager, T., Saenz, Y., Porrero, M.C., Dominguez,
L., Torres, C., 2005. Monitoring and characterization of extendedspectrum
beta-lactamases in Escherichia coli strains from healthy and
sick animals in Spain in 2003. Antimicrob. Agents Chemother. 49,
1262–1264.
Carattoli, A., Bertini, A., Villa, L., Falbo, V., Hopkins, K.L., Threlfall, E.J., 2005.
Identification of plasmids by PCR-based replicon typing. J. Microbiol.
Methods 63, 219–228.
Cavaco, L.M., Abatih, E., Aarestrup, F.M., Guardabassi, L., 2008. Selection
and persistence of CTX-M-producing Escherichia coli in the intestinal
flora of pigs treated with amoxicillin, ceftiofur, or cefquinome. Antimicrob.
Agents Chemother. 52, 3612–3616.
CDC, 2002. One-day (24–28 h) standardized laboratory protocol for molecular
subtyping of Escherichia coli O157:H7, non-typhoidal Salmonella
serotypes, and Shigella sonnei by pulsed field gel electrophoresis
(PFGE). In: The National Molecular Network for Foodborne Disease
Surveillance CDCP, Center for Disease Control and Prevention,
Atlanta, GA, 15 pp.
CLSI, 2008. Performance Standards for Antimicrobial Susceptibility Testing:
8th Informational Supplement. Clinical and Laboratory Standards
Institute, Wayne, PA.
Dolejska, M., Bierosova, B., Kohoutova, L., Literak, I., Cizek, A., 2009.
Antibiotic-resistant Salmonella and Escherichia coli isolates with integrons
and extended-spectrum beta-lactamases in surface water and
sympatric black headed gulls. J. Appl. Microbiol. 106, 1941–1950.
Dolejska, M., Duskova, E., Rybarikova, J., Janoszowska, D., Roubalova, E.,
Dibdakova, K., Maceckova, G., Kohoutova, L., Literak, I., Smola, J., Cizek,
A., 2011. Plasmids carrying blaCTX-M-1 and qnr genes in Escherichia coli
isolates from equine clinic and horseback riding centre. J. Antimicrob.
Chemother., doi:10.1093/jac/DKQ500.
EMA, 2009. Revised Reflection Paper on the Use of 3rd and 4th Generation
Cephalosporins in Food Producing Animals in the European Union:
Development of Resistance and Impact on Human and Animal Health.
European Medicines Agency, London, 37 pp.
Kolar, M., Bardon, J., Chroma, M., Hricova, K., Stosova, T., Sauer, P., Koukalova,
D., 2010. ESBL and AmpC beta-lactamase-producing Enterobacteriaceae
in poultry in the Czech Republic. Vet. Med. 55, 119–124.
Lanzas, C., Grohn, Y.T., 2010. The effect of antimicrobial exposure on the
dissemination of antimicrobial resistance among enteric commensal
bacteria. In: 2nd ASM Conference. Antimicrobial Resistance in Zoonotic
Bacteria and Foodborne Pathogens in Animals, Humans and the
Environment, Toronto, Canada, p. 18.
Liebana, E., Batchelor, M., Hopkins, K.L., Clifton-Hadley, F.A., Teale, C.J.,
Foster, A., Barker, L., Threlfall, E.J., Davies, R.H., 2006. Longitudinal
farm study of extended-spectrum beta-lactamase-mediated resistance.
J. Clin. Microbiol. 44, 1630–1634.
Literak, I., Dolejska, M., Radimersky, T., Klimes, J., Friedman, M., Aarestrup,
F.M., Hasman, H., Cizek, A., 2010. Antimicrobial-resistant faecal
Escherichia coli in wild mammals in central Europe: multiresistant
Escherichia coli producing extended-spectrum beta-lactamases in
wild boars. J. Appl. Microbiol. 108, 1702–1711.
Meunier, D., Jouy, E., Lazizzera, C., Kobisch, M., Madec, J.Y., 2006. CTX-M-
1- and CTX-M-15-type beta-lactamases in clinical Escherichia coli
isolates recovered from food-producing animals in France. Int. J.
Antimicrob. Agents 28, 402–427.
Moodley, A., Guardabassi, L., 2009. Transmission of IncN plasmids carrying
blaCTX-M-1 between commensal Escherichia coli in pigs and farm
workers. Antimicrob. Agents Chemother. 53, 1709–1711.
Novais, A., Canton, R., Moreira, R., Peixe, L., Baquero, F., Coque, T.M., 2007.
Emergence and dissemination of Enterobacteriaceae isolates producing
CTX-M-1-like enzymes in Spain are associated with IncFII (CTXM-15)
and broad-host-range (CTX-M-1, -3, and -32) plasmids. Antimicrob.
Agents Chemother. 51, 796–799.
Schink, A., Kadlec, K., Schwarz, S., 2010. Analysis of blaCTX-M-1-carrying
plasmids from Escherichia coli isolates collected in the BfT-GermVet
study in Germany. In: 2nd ASM Conference. Antimicrobial Resistance
in Zoonotic Bacteria and Foodborne Pathogens in Animals, Humans
and the Environment, Toronto, Canada, p. 19.
USKVBL, 2010. Registrovane veterinarni lecive pripravky 2010 (in Czech,
Authorised Veterinary Medicinal Products 2010), Ustav pro statni
kontrolu veterinarnich biopreparatu a leciv. Institute for State Control
of Veterinary Biologicals and Medicaments, Prion, Hradec, Hralove,
Czech Republic.
M. Dolejska et al. / Veterinary Microbiology 149 (2011) 513–516516
Příloha 7
LITERAK, I., PETRO, R., DOLEJSKA, M., GRUBEROVA, E., DOBIASOVA, H., PETR, J., CIZEK, A., 2011,
Antimicrobial resistance in fecal Escherichia coli isolates from healthy urban children of two age
categories with a view to their antibiotic therapy: Antimicrobial Agents and Chemotherapy, v.
55, p. 3005-3007.
Souhrn
V této studii byl sledován výskyt E. coli s rezistencí k antibiotikům ve střevě zdravých dětí různých věkových
kategorií v ČR. U 36 % dětí ve věku šesti týdnů byly izolovány bakterie s rezistencí k jednomu až sedmi
antibiotikům, naopak u dětí věkové kategorie 6-17 let byla prevalence 24 %. Byly prokázány kmeny E. coli
s beta-laktamázou CTX-M-1 a genem plazmidově determinované rezistence k fluorochinolonům qnrS1.
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, June 2011, p. 3005–3007 Vol. 55, No. 6
0066-4804/11/$12.00 doi:10.1128/AAC.01724-10
Copyright © 2011, American Society for Microbiology. All Rights Reserved.
Antimicrobial Resistance in Fecal Escherichia coli Isolates from
Healthy Urban Children of Two Age Groups in Relation
to Their Antibiotic Therapyᰔ
Ivan Literak,1
* Radim Petro,2
Monika Dolejska,1
Erika Gruberova,1
Hana Dobiasova,1
Jan Petr,1
and Alois Cizek3
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and
Pharmaceutical Sciences, Brno, Czech Republic1
; Pediatric Working Group, Karvina, Czech Republic2
; and
Department of Microbiology and Immunology, Faculty of Veterinary Medicine, University of
Veterinary and Pharmaceutical Sciences, Brno, Czech Republic3
Received 13 December 2010/Returned for modification 11 February 2011/Accepted 28 March 2011
The study was performed in the Czech Republic during 2007 to 2009. Of Escherichia coli isolates from 275
children aged 6 weeks, 36% (n ‫؍‬ 177) were resistant to 1 to 7 antibiotics. Of isolates from 253 children aged
6 to 17 years, 24% (n ‫؍‬ 205) were resistant to 1 to 5 antibiotics. There was no significant difference in the
prevalences of antibiotic-resistant E. coli isolates between these groups of children, even though the consumptions
of antibiotics were quite different.
Since the introduction of antibiotics, the resistance of human
intestinal flora has become a common finding. In 1967,
nonpathogenic strains of Escherichia coli with multiple transferable
antibiotic resistances were isolated from the feces of a
small number of infants in Dublin, Ireland, who had not been
in hospital and had not been treated with antibiotics (7). From
that time, the presence of antibiotic-resistant E. coli isolates
among children has been studied in various countries, and it
was found that E. coli strains colonizing healthy children in
communities may be resistant far more often in some regions
than in others. The aim of our work was to characterize and
analyze antibiotic resistance in fecal E. coli strains isolated
from two groups of urban children differing in age while also
comparing the antibiotic practices applied for these children.
The two groups of healthy children examined were from the
town of Karvina in the Czech Republic. Karvina has about
60,000 inhabitants living in an urban habitat. One group consisted
of 275 children aged 6 weeks, and the other group
consisted of 253 children aged 6 to 17 years. The children were
examined during 2007 to 2009. Samples were taken by individual
rectal swabs, which were transported to the laboratory and
placed overnight in buffered peptone water at 37°C. The samples
were then cultivated for E. coli on a chromogenic medium
selective for E. coli and coliform bacteria (CM0956; Oxoid,
United Kingdom). One colony of each plate was tested for
susceptibility to 12 antimicrobial agents by the disk diffusion
method as described elsewhere previously (5). For E. coli isolates
found to be resistant to one or more of the antibiotics,
PCR was used to detect specific antibiotic resistance genes, the
integrase genes int1 and int2, variable regions of class 1 and
class 2 integrons, and gene cassettes within class 1 and 2 integrons,
as described elsewhere previously (5). The samples from
buffered peptone water were enriched in MacConkey broth
and subcultivated onto MacConkey agar (MCA) containing
cefotaxime (2 mg literϪ1
) to detect E. coli strains with extended-spectrum
beta-lactamase (ESBL) and subsequently
onto MCA supplemented with ciprofloxacin (0.06 mg literϪ1
)
to isolate fluoroquinolone-resistant E. coli isolates. These E.
coli isolates were further characterized; specifically, the transferabilities
of their ESBL and plasmid-encoded quinolone
resistance genes was tested by conjugation as described elsewhere
previously (1, 2). Plasmids of ESBL and quinoloneresistant
strains were characterized by replicon typing and
EcoRV digestion (1, 2). All E. coli strains were identified by
using the API 10S test (bioMe´rieux, France).
The antibiotics given to the children throughout their lives
until the time of examination were searched for by using the
archives of the proper pediatricians. The pediatricians in the
Czech Republic are obligated to record and archive all therapies
used for children. The term “antibiotic application” was
defined as one administration of a usual dosage of some antibiotic
prescribed for a therapeutic or prophylactic purpose to
one child. The impact of antibiotics was expressed as the total
number of antibiotic applications for those children examined.
A total of 177 E. coli isolates were obtained from 275 children
aged 6 weeks. Sixty-three (36%) isolates were resistant to
1 to 7 antibiotics (Table 1). From 253 children aged 6 to 17
years, a total of 205 E. coli isolates were obtained. Forty-nine
(24%) isolates were resistant to 1 to 5 antibiotics. There was no
significant difference in the total prevalences of antibioticresistant
E. coli isolates between children aged 6 weeks and
children aged 6 to 17 years. The prevalences of antibioticresistant
E. coli for individual antibiotics were significantly
higher for children aged 6 weeks than for children aged 6 to 17
years (applicable for ampicillin, trimethoprim-sulfamethoxazole,
cephalothin, and nalidixic acid), or the differences were
not significant.
* Corresponding author. Mailing address: Department of Biology
and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology,
University of Veterinary and Pharmaceutical Sciences, Palackeho 1–3,
612 42 Brno, Czech Republic. Phone: 420 541 562 630. Fax: 420 541
562 631. E-mail: literaki@vfu.cz.
ᰔ
Published ahead of print on 4 April 2011.
3005
The antibiotic-resistant E. coli isolates from both groups of
children were highly variable in their resistance patterns. The
blaTEM, blaSHV, and blaCTX-M-1 genes were detected in isolates
with ampicillin resistance. The only proven tetracycline resistance
determinants among E. coli isolates resistant to tetracycline
were the tetA and tetB genes. The sul1, sul2, and sul3
genes were found among the isolates resistant to sulfonamides.
Resistance to streptomycin was linked to the strA gene and the
aadA1, aadA2, and aadA5 gene cassettes. Resistance to chloramphenicol
was linked to the cat and cmlA genes. Various
types of class 1 integrons (with the gene cassettes aadA1,
aadA2, dfr17, dfr1-aadA1, dfr17-aadA5, and dfr12-orf-aadA2)
and class 2 integrons (with sat-aadA1, dhfr1-sat-aadA1, and
estX-sat-aadA1) were identified among the antibiotic-resistant
E. coli isolates.
Two ESBL-producing E. coli isolates were obtained from
one 6-week-old child and one 11-year-old child. Both isolates
contained the blaCTX-M-1 gene. The blaCTX-M-1 genes were
localized on a 30-kb conjugative plasmid of the IncN group
along with the tetracycline resistance gene tetA and on a 95-kb
conjugative plasmid of the IncI1 group along with the class 1
integron containing the dfr1-aadA1 gene cassettes and the cib
gene for colicin production, respectively. Another E. coli isolate,
from a 10-year-old child, selected using MCA with ciprofloxacin
had the plasmid-mediated quinolone resistance gene
qnrS1. The qnrS1 gene was transferred by conjugation and was
located on a 45-kb plasmid of the IncX1 group.
Only five antibiotic applications were recorded for children
at the age of 6 weeks (Table 2). A total of 1,965 antibiotic
applications were recorded for children aged 6 to 17 years.
Beta-lactam antibiotics were used most frequently, followed by
macrolides and sulfonamides with trimethoprim. The use of
other antibiotics was exceptional.
Commensal E. coli strains in children represent an important
reservoir of antibiotic resistance determinants. Relatively
low prevalences of antibiotic-resistant E. coli were observed for
the Czech children compared to the findings from a large
number of other studies on this topic, and they were in good
agreement with results of one recent study from Germany (4).
At 36%, we consider the high prevalence of antibiotic-resistant
E. coli strains in Czech children aged 6 weeks to be
disturbing. These children had scarcely been exposed directly
to antibiotics, and yet they were frequently colonized by antibiotic-resistant
E. coli. The range of sources for antibioticresistant
E. coli is very limited for this age group of children.
The fetal intestine is sterile and bathed in swallowed amniotic
fluid. Following delivery, multiple bacteria challenge the intestine
of the newborn (3). Microbes from the vaginal canal and
perineum enter the mouth and stomach of vaginally delivered
infants, and within few minutes after birth, the gastric content
of the newborn is influenced by and reflects the cervical flora
of the mother. All children in our study were born in maternity
hospitals with high hygienic standards. Such deliveries proceed
with a physician in attendance, and during the time important
for bacterial colonization of the newborns’ gastrointestinal
tracts, the children are in nearly exclusive contact with their
mothers. Mothers and their children usually leave the maternity
hospitals in the Czech Republic when the child is 4 days
old, and the child must be colonized primarily at that time. We
strongly believe that the sources for the colonization of
6-week-old children with antibiotic-resistant E. coli isolates
were their mothers.
Among the children aged 6 to17 years surveyed, there was a
24% prevalence of antibiotic-resistant E. coli, even though the
children had been treated with antibiotics during their lifeTABLE
1. Prevalences of antibiotic-resistant Escherichia coli
isolates from urban children of two age groups
Antibiotic
No. of resistant isolates
(prevalence ͓%͔) in
children aged: P valuea
6 wk
(n ϭ 177)
6–17 yr
(n ϭ 205)
Ampicillin 50 (28) 34 (17) 0.0061
Tetracycline 32 (18) 25 (12) NS
Sulfonamides 29 (16) 21 (10) NS
Streptomycin 24 (14) 20 (10) NS
Sulfamethoxazole-trimethoprim 13 (7) 6 (3) 0.0476
Cephalothin 10 (6) 2 (1) 0.0090
Nalidixic acid 9 (5) 3 (1) 0.0430
Chloramphenicol 7 (4) 4 (2) NS
Amoxicillin-clavulanic acid 4 (2) 2 (1) NS
Ciprofloxacin 1 (1) 0 (0) NS
Gentamicin 1 (1) 0 (0) NS
Ceftazidime 1 (1) 0 (0) NS
a
Differences in prevalences were compared by using the chi-square test and
Fisher’s exact test. Statistical significance is indicated at a P value of Յ0.05. NS,
not significant.
TABLE 2. Antibiotics given to the children examined during their
lives up to the time of examination
Antibiotic
No. of antibiotic
applications for
children aged:
6 wka
6–17 yr
Beta-lactams
Penicillins (penicillin, penamecillin,
phenoxymethylpenicillin, oxacillin)
491
Aminopenicillins (ampicillin, amoxicillin) 311
Aminopenicillins with beta-lactamase
inhibitors (ampicillin ϩ sulbactam,
amoxicillin ϩ clavulanic acid)
3 376
Narrow-spectrum cephalosporins
(cephalexin, cefadroxil)
59
Expanded-spectrum cephalosporins
(cefaclor, cefprozil, cefuroxime,
including axetilcefuroxime)
200
Broad-spectrum cephalosporins
(cefotaxime, ceftazidime, ceftriaxone)
5
Macrolides (erythromycin, spiramycin,
roxithromycin, clarithromycin,
azithromycin)
1 387
Sulfonamides, trimethoprim
(sulfamethoxazole ϩ trimethoprim,
trimethoprim)
122
Aminoglycosides (neomycin, gentamicin,
netilmycin)
1 5
Others (clindamycin, nitrofurantoin,
vancomycin, bacitracin)
9
Total 5 1,965
a
One antibiotic application means an application of a usual therapeutic dose
of some antibiotic prescribed during a child’s single therapeutic situation.
3006 LITERAK ET AL. ANTIMICROB. AGENTS CHEMOTHER.
times a total of 1,965 times. The prevalences of E. coli isolates
resistant to tetracycline, streptomycin, and chloramphenicol
were 12%, 10%, and 2%, respectively, even if no such antibiotics
had been administered to these children. In the United
Kingdom as well, healthy children 8 to 9 years old were shown
to carry bacteria resistant to antibiotics to which children were
not usually exposed (6). The authors of that study considered
that bacteria resistant to ceftazidime, chloramphenicol, and
tetracycline may be coselected by exposure to other antibiotics
used for children or may be acquired from family members,
pets, other children, or food.
The E. coli isolates harboring the blaCTX-M-1 gene, responsible
for the production of ESBL, and the qnrS1 gene have
been documented for the first time in children anywhere in the
world. Various associations among the plasmids and beta-lactamase
genes have been observed. The associations between
blaCTX-M-1 and IncN plasmids, blaCTX-M-1 and IncI1 plasmids,
and qnrS1 and IncX1 plasmids have been observed recently in the
Czech Republic among human and animal E. coli isolates (1, 2).
This study was funded by grants MSM6215712402 from the Ministry
of Education, Youth, and Sports of the Czech Republic; IGA69/2007/
FVHE from the University of Veterinary and Pharmaceutical Sciences
Brno; and P502/10/P083 from the Czech Science Foundation.
REFERENCES
1. Dolejska, M., et al. 2011. Plasmids carrying blaCTX-M-1 and qnr genes in
Escherichia coli isolates from an equine clinic and a horseback riding centre.
J. Antimicrob. Chemother. 66:757–764.
2. Dolejska, M., et al. 2011. IncN plasmids carrying blaCTX-M-1 in Escherichia coli
isolates on a dairy farm. Vet. Microbiol. 149:513–516.
3. Fanaro, S., R. Chierici, P. Guerrini, and V. Vigi. 2003. Intestinal microflora in
early infancy: composition and development. Acta Paediatr. Suppl. 441:48–55.
4. Lietzau, S., E. Raum, H. von Baum, R. Marre, and H. Brenner. 2007. Household
contacts were key factor for children’s colonization with resistant Escherichia
coli in community setting. J. Clin. Epidemiol. 60:1149–1155.
5. Literak, I., et al. 2010. Antimicrobial resistant faecal Escherichia coli in
wild mammals in central Europe: multiresistant Escherichia coli producing
extended-spectrum beta-lactamases in wild boars. J. Appl. Microbiol. 108:
1702–1711.
6. Millar, M. R., et al. 2001. Carriage of antibiotic-resistant bacteria by healthy
children. J. Antimicrob. Chemother. 47:605–610.
7. Moorhouse, E. C., and L. McKay. 1968. Hospital study of transferable drug
resistance. Br. Med. J. 2:741–742.
VOL. 55, 2011 ANTIMICROBIAL-RESISTANT E. COLI IN CHILDREN 3007
Příloha 8
DOLEJSKA , M., MATULOVA, M., KOHOUTOVA, L., LITERAK, I., BARDON, J., CIZEK, A., 2011,
Extended-spectrum beta-lactamase-producing Escherichia coli in turkey meat production flocks
in the Czech Republic: National survey reveals widespread isolates with blaSHV-12 genes on IncFII
plasmids: Letters in Applied Microbiology, v. 53, p. 271-277.
Souhrn
Cílem studie bylo zjistit výskyt E. coli s produkcí ESBL na krůtích farmách v ČR. Ze čtyřiceti vyšetřených farem
byly tyto kmeny izolovány v prostředí osmi farem (20 %). Fenotyp rezistence byl u většiny izolátů spojen
s genem blaSHV neseným na konjugativních IncFII plazmidech. Nález izolátů s identickým genotypem a
plazmidovým profilem na různých farmách ukazuje na jejich pravděpodobný společný zdroj v líhních.
Cefalosporiny nejsou v ČR pro použití u drůbeže autorizovány, frekventovaný výskyt rezistence k této skupině
antibiotik může ukazovat na jejich off-label použití.
ORIGINAL ARTICLE
Extended-spectrum beta-lactamase-producing Escherichia
coli in turkey meat production farms in the Czech Republic:
National survey reveals widespread isolates with blaSHV-12
genes on IncFII plasmids
M. Dolejska1,2
, M. Matulova3
, L. Kohoutova3
, I. Literak1,2
, J. Bardon4
and A. Cizek3
1 Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences
Brno, Palackecho, Czech Republic
2 CEITEC, University of Veterinary and Pharmaceutical Sciences Brno
3 Institute of Microbiology and Infectious Diseases, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno,
Palackeho, Brno, Czech Republic
4 State Veterinary Institute, Jakoubka ze Stribra, Olomouc, Czech Republic
Introduction
Intestinal commensal enterobacteria in chickens and turkeys
reared on large-scale farms are commonly under
selective pressure caused by the use of antimicrobial agents
to treat or prevent bacterial infections (Schwarz et al.
2001). Antimicrobial-resistant faecal Escherichia coli strains
originating from poultry can be transmitted to humans
both directly and via the food chain (van den Bogaard
et al. 2001). At slaughter, poultry meat can be contaminated
with antimicrobial-resistant E. coli from the gut of
poultry carcasses. These bacteria may colonize humans
and ⁄ or may become sources of antimicrobial-resistance
genes for human endogenous flora (van den Bogaard et al.
2001; Trobos et al. 2009). The use of cephalosporins in
food-producing animals could be a selective factor for the
appearance of extended-spectrum beta-lactamase (ESBL)producing
bacteria in animals (Cavaco et al. 2008).
Because of their critical importance for human and veterinary
medicine, resistance to cephalosporins is of special
interest (FAO ⁄WHO ⁄OIE 2007).
Some recent studies have documented frequent occurrence
of ESBL-producing E. coli isolates in poultry
(Dierikx et al. 2010; Randall et al. 2011). The aim of this
Keywords
antimicrobial resistance, extended-spectrum
beta-lactamase, integron, plasmid, poultry.
Correspondence
Monika Dolejska, Department of Biology and
Wildlife Diseases, Faculty of Veterinary
Hygiene and Ecology, Palackeho 1–3, 612
42Brno, Czech Republic.
E-mail: dolejskam@vfu.cz
2011 ⁄ 0412: received 11 March 2011, revised
2 June 2011 and accepted 2 June 2011
doi:10.1111/j.1472-765X.2011.03099.x
Abstract
Aim: The occurrence and epidemiology of extended-spectrum beta-lactamase
(ESBL)-producing Escherichia coli in the environment of turkey farms in the
Czech Republic were studied.
Methods and Results: Extended-spectrum beta-lactamase-producing E. coli
isolates were found on 8 (20%) of 40 turkey farms surveyed. A total of 200
environmental smears were examined, and a total of 25 ESBL-producing E. coli
were isolated. These isolates were analysed using XbaI pulsed-field gel electrophoresis
and divided into nine pulsotypes. Most of the isolates harboured the
gene blaSHV-12 on a 40-kb plasmid of the IncFII group with an identical EcoRV
restriction profile. Indistinguishable or clonally related SHV-12-producing isolates
belonging to the same pulsotypes were found at some unrelated farms.
Conclusions: Widespread occurrence of ESBL-producing E. coli isolates with
blaSHV-12 carried on IncFII plasmids in meat production flocks in the Czech
Republic was demonstrated.
Significance and Impact of the Study: Results indicate vertical transmission of
ESBL-producing E. coli within the turkey production pyramid. The study
shows the risk of multiresistant ESBL-producing bacteria and antibiotic-resistance
genes being transmitted to humans via the food chain.
Letters in Applied Microbiology ISSN 0266-8254
ª 2011 The Authors
Letters in Applied Microbiology 53, 271–277 ª 2011 The Society for Applied Microbiology 271
study was to characterize the ESBL-producing E. coli isolates
in the environment of turkey farms within the Czech
Republic and to analyse the antimicrobial-resistance genes
responsible for the ESBL production in relation to plasmids
present in isolates and their conjugative ability.
Materials and methods
Sampling
As of 2006, the Czech Republic had 183 registered turkey
meat production flocks. A baseline survey on the prevalence
of Salmonella in these flocks was carried out by the
Czech State Veterinary Authority during a 2006–2007
investigation period. Five pooled environmental faeces
samples were taken from each flock. Each pooled sample,
comprising faecal material taken by swab from boots of
workers on the farms, was tested by an authorized laboratory
in accordance with ISO 6579 (Sanco 2006). For purposes
of this study, 200 samples enriched in buffered
peptone water (Oxoid, UK) originating from 40 turkey
meat production flocks were randomly selected and
stored at )70°C.
Isolating ESBL-producing E. coli and testing of resistance
genes
The specimens were cultivated on MacConkey agar
(MCA, Oxoid) containing cefotaxime (2 mg l)1
) at 37°C
for 24 h. All the isolates growing on MCA with cefotaxime
were examined for the production of ESBL using the
double-disc synergy test (CLSI 2008). The cultures were
identified using API 10S (bioMe´rieux, France). Identification
of E. coli phylogenetic groups and the presence of
the cib gene for colicin production using primers eibIF
(5¢-CTGAGAGAATACGGATTCC-3¢) and cibIR (5¢-CAGAATATTGCGTTTATAGTCC-3¢)
were performed using
polymerase chain reaction (PCR) (Clermont et al. 2000).
The genes responsible for the ESBL phenotype (blaTEM,
blaSHV, blaCTX-M) were identified by PCR (for the list of
primers, see Literak et al. 2010a), and PCR products were
analysed using sequencing (ABI 310 Genetic Analyser;
Applied Biosystems, Foster city, CA). The antibiotic susceptibility
of ESBL-producing E. coli isolates was tested by
disc diffusion method on Mueller–Hinton agar (Oxoid)
(CLSI 2008) using 12 antimicrobial substances (Literak
et al. 2010b). In these isolates, PCR was used for detecting
specific antibiotic-resistance genes, the class 1 and 2 integrase
genes int1⁄int2 and gene cassettes within class 1 and 2
integrons (Literak et al. 2010b). Isolates were also tested
for plasmid-mediated quinolone-resistance genes qnrA,
qnrB, qnrC, qnrD, qnrS, qepA and aac-(6¢)-Ib-cr by PCR
(for the list of primers, see Literak et al. 2010a).
Pulsed-field gel electrophoresis (PFGE) and transferability
of ESBL-resistance genes by conjugation
The isolates were typed by XbaI PFGE (CDC 2002).
Profiles were analysed using the BioNumerics fingerprinting
software (Applied Maths, Ghent, Belgium).
Cluster analysis of the Dice similarity indices performed
to generate a dendrogram describing the relationships
among PFGE profiles. Isolates were considered to be
related and to belong to the same PFGE cluster if their
Dice similarity index was ‡85% according to Tenover’s
criteria (£6 bands of difference) (Tenover et al. 1995).
Transferability of bla genes was tested by conjugation.
Plate-mating experiments were performed using plasmidfree,
rifampicin and sodium azide-resistant E. coli
MT102RN and Salmonella enterica subsp. enterica serovar
Typhimurium SL5325 as recipients (Literak et al.
2010b).
Characterization of ESBL-carrying plasmids
Plasmid DNA from ESBL-producing E. coli was isolated
by alkaline extraction procedure (Birnboim and Doly
1979). Plasmid DNA was introduced to competent E. coli
DH5a (Invitrogen, Carlsbad, USA) by chemical transformation
followed by the selection of transformants on BHI
agar (Oxoid) supplemented with cefotaxime (2 mg l)1
).
The presence of the relevant bla gene in transformants
was confirmed by PCR. The size of the plasmid with the
ESBL gene from transformants was determined by S1PFGE
(Barton et al. 1995). Plasmids were replicon-typed
as described previously (Carattoli et al. 2005). Plasmid
DNA from transformants was digested with EcoRV, and
the fragments were separated by gel electrophoresis in 1%
agarose gel for 16 h at 67 V⁄ cm.
Results
ESBL-producing E. coli characterization
A total of 25 ESBL-producing E. coli isolates were isolated
from the 200 pooled samples examined (Table 1). ESBLproducing
E. coli isolates originated from 8 (20%) of 40
turkey farms surveyed. ESBL production was associated
with the presence of blaSHV-12 gene in 23 of the 25 E. coli
isolates, while the remaining two ESBL-positive isolates
contained blaCTX-M-1 or blaCTX-M-14. Most isolates
belonged to phylogenetic groups A and B1. The isolate
with blaCTX-M-14 belonged to group D. The gene cib for
colicin Ib production was found in 15 ESBL-producing
isolates. Resistance to additional antibiotic groups was
detected (Table 1). Resistance to nalidixic acid and ciprofloxacin
was most prevalent, even if no plasmid-mediated
ESBL-producing E. coli in turkey farms M. Dolejska et al.
272 Letters in Applied Microbiology 53, 271–277 ª 2011 The Society for Applied Microbiology
ª 2011 The Authors
Table1CharacterizationofESBL-producingE.coliisolatesfromturkeyfarmsintheCzechRepublic
Farm
PFGE
type
No.of
isolatesESBLtype
Additional
resistance*
Additionalantibiotic-resistance
genesandintegrons,gene
forcolicinproduction(cib)
Phylogenetic
group
PlasmidharbouringESBLgene 
Conjugation
Size
(kb)IncEcoRVECST
IA1
1SHV-12CipNaSSuSxtblaTEM)1,strA,sul2,cibA))40FIII
C1SHV-12TtetB,cibB1++40FIII
KD1
4SHV-12blaTEM)1,cibB1++40FIII
1SHV-12blaTEM)1,cib++130FII-I1II
B1CTX-M-14CipNaSuSxtTblaTEM)1,sul1,sul2,tetD,int1,
integron1Æ7kb:aadA1
D++60FIIIII
LD1
1SHV-12cibB1++40FIII
PD2
1SHV-12B1))40FIII
D3
3SHV-12B1))40FIII
D4
1SHV-12cibB1))40FIII
H1SHV-12cibB1++40FIII
WE1SHV-12B1++40FIII
I1SHV-12CipNaA))40FIII
G1CTX-M-1CipGnNaSSuSxtTblaTEM)1,catA1,strA,sul1,tetA,int1,
integron1Æ6kb:dfrA1-aadA1,cib
A)+NTNTNT
YA1
1SHV-12CipNaSuSxtTsul1,tetA,cibA))40FIII
NNF3SHV-12CipNaA+)40FIII
OOA1
1SHV-12CipNaSuSxtTsul1,tetA,cibA))40FIII
1SHV-12CipNablaTEM)1,cib))40FIII
A2
1SHV-12CipNaSuSxtTsul1,tetA,int1,integron
1Æ6kb:dfrA1-aadA1,cib
A))40FIII
ESBL,extended-spectrumbeta-lactamase;PFGE,Pulsed-fieldgelelectrophoresis.
*Cip,ciprofloxacin;Gn,gentamicin;Na,nalidixicacid;S,streptomycin;Su,sulfonamidescompound;Sxt,sulfamethoxazole-trimethoprim;T,tetracycline.
 EC,EscherichiacoliMT102RN;ST,SalmonellaTyphimuriumSL5325;IncIncompatibilitygroup;EcoRV,restrictionprofilesdesignedbyplasmidDNAdigestionbyenzymeEcoRV;NT,plasmidhar-
bouringblaCTX-M-1wasnottypedbecauseofunsuccessfultransformationandconjugationofsingleCTX-M-1plasmidtorecipientcells.
M. Dolejska et al. ESBL-producing E. coli in turkey farms
ª 2011 The Authors
Letters in Applied Microbiology 53, 271–277 ª 2011 The Society for Applied Microbiology 273
quinolone-resistance genes were detected. Five multiresistant
E. coli isolates also contained a class 1 integron,
which is 1Æ6 kb in size with dfr1-aadA1 gene cassettes (4
isolates) or 1Æ7 kb in size with the aadA1 gene cassette.
Class 2 integrons were not detected.
Macrorestriction profile analysis
Using PFGE, the 25 ESBL-producing E. coli isolates from
eight farms were divided into nine different groups using
letters A–I based on their XbaI macrorestriction profiles
(Fig. 1). Clonally related isolates (defined as having
85–90% similarity of PFGE profiles) were detected and
marked by index numbers. Dissemination of some pulsotypes
(A, D, F) inside one farm was also demonstrated.
Interestingly, indistinguishable or clonally related SHV-
12-producing isolates belonging to pulsotypes A and D
were detected in three unrelated farms.
Plasmid profiling
In 22 SHV-12-producing E. coli isolates of seven different
pulsotypes, the gene blaSHV-12 was located on a plasmid
40 kb in size belonging to incompatibility group FII
(Table 1). All the plasmids showed the same EcoRV
restriction profiles. In most of the strains, conjugative
transfer of SHV-12-harbouring plasmids to E. coli and ⁄ or
Salmonella was demonstrated. Transfer of additional resistance
genes together with ESBL genes was not detected.
In one isolate, a large 130-kb plasmid carrying the blaSHV-
12 gene was found. Surprisingly, two positive PCRs during
replicon typing showed that the gene blaSHV-12 was probably
located on a fused FII-I1 plasmid. In a CTX-M-14producing
isolate, a conjugative IncFII plasmid 60 kb in
size with unique EcoRV restriction profile was also
detected.
Discussion
We report a widespread occurrence of ESBL-producing
E. coli isolates in meat production flocks in the Czech
Republic. Presence of ESBL-producing E. coli in turkey
farms had been studied also by Randall et al. (2011), who
had isolated CTX-M-carrying E. coli from 5% of turkey
meat production farms and 7% of turkey breeder farms
in Great Britain. The frequency of ESBL-producing
E. coli’s occurrence at chicken farms or slaughterhouses in
various European countries has been shown to range
from 10 to 40% (Blanc et al. 2006; Machado et al. 2008;
Costa et al. 2009; Dierikx et al. 2010).
SHV-12- as well as CTX-M-1-producing E. coli were
recently found in poultry at slaughterhouses in the Czech
Republic (Kolar et al. 2010). Similarly to the situation in
the Czech Republic, isolates with SHV-12 were recently
dominant among ESBL-producing E. coli and Salmonella
isolates from poultry in Italy (Chiaretto et al. 2008; Bortolaia
et al. 2010). The ESBL genes have been frequently
observed among E. coli belonging to the phylogenetic
groups B1 and A, which are associated with animal or
human commensal E. coli strains (Clermont et al. 2000).
We also detected one CTX-M-14-producing E. coli strain
from phylogenetic group D, however, which is associated
with extraintestinal human infection (Mora et al. 2011).
To our knowledge, this is the first detection of an E. coli
strain with CTX-M-14 in the Czech Republic. CTX-M-14
has been identified as most frequent in poultry farms in
Spain and the UK (Brin˜as et al. 2005; Blanc et al. 2006;
Randall et al. 2011). Isolates with CTX-M-14 also have
been increasingly found in human clinical E. coli isolates
in various European countries in recent years (Coque
et al. 2008).
We attributed the presence of E. coli isolates of the
same pulsotypes from different farms to contamination of
Farm ESBL
PFGE
type
No.of
isolates
E 1 W SHV-12
G 1 W CTX-M-1
D1
D4
D3
D2
6 K,L SHV-12
1 P SHV-12
3 P SHV-12
1 P SHV-12
H 1 P SHV-12
B 1 K CTX-M-14
C 1 I SHV-12
4 I,Y,OO SHV-12
1 OO SHV-12
I 1 W SHV-12
F 3 NN SHV-12
S. Braenderup H9812
S. Braenderup H9812
A1
A2
40
60
80
100
Figure 1 Pulsed-field gel electrophoresis
analysis of ESBL-producing E. coli isolates
from turkey farms in the Czech Republic.
ESBL-producing E. coli in turkey farms M. Dolejska et al.
274 Letters in Applied Microbiology 53, 271–277 ª 2011 The Society for Applied Microbiology
ª 2011 The Authors
the turkey production pyramid. We have learned that
turkey eggs or 1-day-old turkey chicks upon which the
turkey broiler production in these Czech farms was based
had been bought from the same foreign producer. Antimicrobial
practice in the production pyramid of this
supplier is unknown. Our hypothesis is supported by the
results of a recent Italian study in which dissemination of
genetically identical clones of ESBL-producing E. coli in
different poultry farms has been demonstrated even
though no cephalosporins were used on those farms (Bortolaia
et al. 2010).
The wide distribution of ESBL-positive E. coli among
faecal isolates of healthy food-producing animals presents
a food safety problem, and it is important to analyse the
factors that could contribute to this situation (Costa et al.
2009). The major factor selecting for antibiotic-resistant
bacteria is antibiotic use, and of additional importance
are the high concentration and poor sanitation that are
typical for intense poultry farming (van den Bogaard
et al. 2001). The use of cephalosporins in food-producing
animals could be a selective factor for the appearance of
ESBL-containing bacteria in animals, and this has been
previously documented (Cavaco et al. 2008; Dolejska
et al. 2011). Ceftiofur use in chickens has resulted in
ESBL-based cephalosporin resistance in salmonellae from
chickens, and these resistant bacteria have subsequently
infected humans (Dutil et al. 2010). Ceftiofur was previously
authorized for injection of day-old chickens to
prevent septicaemia, but there are currently no cephalosporin-containing
products authorized for the use in
poultry species within the EU (thus including the Czech
Republic). Off-label in ovo use of ceftiofur and prophylactic
use of cephalosporins in day-old chickens have
been reported at chicken hatcheries in North America
and Europe (EMA 2009; Dutil et al. 2010). No cephalosporins
were administered on turkey farms in the Czech
Republic during the course of the study (Lucie Pokludova
from the Institute for State Control of Veterinary Biologicals
and Medicaments in the Czech Republic, personal
communication).
The clonal diversity of isolates with blaSHV-12 carried by
IncFII plasmids suggests that horizontal gene transmission
may have contributed to the recent spread of these variants
in the country. Recently, it has been documented
that both the genes blaSHV-12 and blaCTX-M-14 can be
located on plasmids of different Inc groups including I1,
FII, FIB, K, A ⁄ C and HI2 in both human and animal
isolates (Carattoli 2009). IncF plasmids are usually conjugative
with narrow host range specificity, and they are
well adapted for E. coli.
Taking into account that no cephalosporins are administrated
in turkey production within the Czech Republic
and that we do not know the antimicrobial practice in
the producer of turkey eggs or 1-day-old chicks, we considered
also another hypothesis to explain the presence of
ESBL-producing E. coli isolates on Czech turkey farms. In
that, some of the ESBL-producing E. coli isolates
harboured also a wide variety of other antimicrobialresistance
genes, and there exists the possibility of coselection
owing to the use of nonbeta-lactams. Tetracyclines,
penicillins, macrolides, quinolones, diterpenes and
sulfonamides are the antibiotics most frequently used on
turkey farms in the Czech Republic (Lucie Pokludova,
personal communication) and may help to coselect isolates
resistant to both old-generation antimicrobials and
cephalosporins. However, most E. coli isolates produced
SHV-12 and did not harboured other antibiotic-resistance
genes; thus, our first hypothesis of dissemination of
genetically identical clones in turkey production pyramid
from a foreign producer seems more likely.
These results indicate vertical transmission of ESBLproducing
E. coli within the turkey production pyramid.
A colonization of turkey breeding lines of primary flocks
acquired from the same producer was regarded as the
reason for widespread occurrence of these isolates within
the turkey broiler production system in the Czech Republic.
The risk of multiresistant ESBL-producing bacteria
being transmitted to humans via the food chain, including
through turkey meat, should be evaluated. Monitoring
of ESBL-producing enterobacteria should be continued at
various levels (animals, human, and environment), while
investigating the factors that contribute to their selection
and dissemination.
Acknowledgements
This study was funded by the Czech Science Foundation
(P502⁄ 10 ⁄ P083), the Ministry of Education, Youth and
Sports of the Czech Republic (MSM6215712402), the
Internal Grant Agency of the University of Veterinary and
Pharmaceutical Sciences Brno, Czech Republic (162 ⁄2008
FVL) and the project "CEITEC–Central European Institute
of Technology" (CZ.1.0511.1.00102.0068) from the
European Regional Development Fund. We thank Lenka
Slowioczkova, Simona Krepelova, Katerina Dibdakova
and Marie Slavikova for excellent laboratory work. Our
thanks also go to Lucie Pokludova from the Institute for
State Control of Veterinary Biologicals and Medicaments,
Brno, Czech Republic for providing data on antimicrobial
practice in poultry in the Czech Republic and European
Union. Our thank goes to Henrik Hasman and Lina
Cavaco from the National Food Institute, Copenhagen,
Denmark for providing control strains, to Department of
Food and Feed Safety, Veterinary Research Institute,
Brno, Czech Republic and Czech Collection of Microorganisms,
Brno, Czech Republic, for PFGE analysis.
M. Dolejska et al. ESBL-producing E. coli in turkey farms
ª 2011 The Authors
Letters in Applied Microbiology 53, 271–277 ª 2011 The Society for Applied Microbiology 275
References
Barton, B.M., Harding, G.P. and Zuccarelli, A.J. (1995) A general
method for detecting and sizing large plasmids. Anal
Biochem 226, 235–240.
Birnboim, H.C. and Doly, J. (1979) Rapid alkaline extraction
procedure for screening recombinant plasmid DNA.
Nucleic Acids Res 7, 1513–1523.
Blanc, V., Mesa, R., Saco, M., Lavilla, S., Prats, G., Miro´, E.,
Navarro, F., Corte´s, P. et al. (2006) ESBL- and plasmidic
class C b-lactamases in Escherichia coli strains isolated
from poultry, pig and rabbit farms. Vet Microbiol 118,
299–304.
van den Bogaard, A.E., London, N., Drissen, C. and Stobberingh,
E.E. (2001) Antibiotic resistance of fecal E. coli in
poultry, poultry farmers and poultry slaughterers. J Antimicrob
Chemother 47, 763–771.
Bortolaia, V., Guardabassi, L., Trevisani, M., Bisgaard, M.,
Venturi, L. and Bojesen, A.M. (2010) High diversity of
extended-spectrum beta-lactamases in Escherichia coli
isolates from Italian broiler flocks. Antimicrob Agents Chemother
54, 1623–1626.
Brin˜as, L., Moreno, M.A., Teshager, T., Sa´enz, Y., Porrero,
M.C., Domı´nguez, L. and Torres, C. (2005) Monitoring
and characterization of extended-spectrum beta-lactamases
in Escherichia coli strains from healthy and sick animals in
Spain in 2003. Antimicrob Agents Chemother 49, 1262–
1264.
Carattoli, A. (2009) Resistance plasmid families in Enterobacteriaceae.
Antimicrob Agents Chemother 53, 2227–2238.
Carattoli, A., Bertini, A., Villa, L., Falbo, V., Hopkins, K.L. and
Threlfall, E.J. (2005) Identification of plasmids by PCRbased
replicon typing. J Microbiol Methods 63, 219–228.
Cavaco, L.M., Abitith, E., Aarestrup, F.M. and Guardabassi, L.
(2008) Selection and persistence of CTX-M-producing
Escherichia coli in the intestinal flora of pigs treated with
amoxicillin, ceftiofur, or cefquinome. Antimicrob Agents
Chemother 52, 3612–3616.
CDC (2002). One-day (24–28 h) Standardized Laboratory Protocol
for Molecular Subtyping of Escherichia coli O157:H7,
Non-Typhoidal Salmonella Serotypes, and Shigella Sonnei
by Pulsed Field Gel Electrophoresis (PFGE). Center for
Disease Control and Prevention, Atlanta, GA: The National
Molecular Network for Foodborne Disease Surveillance
CDCP, 15 p.
Chiaretto, G., Zavagnin, P., Bettini, F., Mancin, M., Minorello,
C., Saccardin, C. and Ricci, A. (2008) Extended spectrum
b-lactamase SHV-12-producing Salmonella from poultry.
Vet Microbiol 128, 406–413.
Clermont, O., Bonacorsi, S. and Bingen, E. (2000) Rapid and
simple determination of the Escherichia coli phylogenetic
group. Appl Environ Microbiol 66, 4555–4558.
CLSI (2008). Performance Standards for Antimicrobial Susceptibility
Testing, 8th Informational Supplement. CLSI, Wayne,
PA: Clinical and Laboratory Standards Institute.
Coque, T.M., Baquero, F. and Canton, R. (2008) Increasing
prevalence of ESBL-producing Enterobacteriaceae in Europe.
Eurosurveillance 13, 1–11.
Costa, D., Vinue´, L., Poeta, P., Coelho, A.C., Matos, M., Sa´enz,
Y., Somalo, S., Zarazaga, M. et al. (2009) Prevalence of
extended-spectrum beta-lactamase-producing Escherichia
coli isolates in faecal samples of broilers. Vet Microbiol 138,
339–344.
Dierikx, C., van Essen-Zandbergen, A., Veldman, K., Smith, H.
and Mevius, D. (2010) Increased detection of extended
spectrum beta-lactamase producing Salmonella enterica and
Escherichia coli isolates from poultry. Vet Microbiol 145,
273–278.
Dolejska, M., Jurcickova, Z., Literak, I., Pokludova, L., Bures,
J., Hera, A., Kohoutova, L., Smola, J. et al. (2011) IncN
plasmids carrying blaCTX-M-1 in Escherichia coli isolates on
a dairy farm. Vet Microbiol 149, 513–516.
Dutil, L., Irwin, R., Finley, R., Ng, L.K., Avery, B., Boerlin, P.,
Bourgault, A.M., Cole, L. et al. (2010) Ceftiofur resistance
in Salmonella enterica serovar Heidelberg from chicken
meat and humans, Canada. Emerg Infect Dis 14, 48–54.
EMA (2009) Revised Reflection Paper on the use of 3rd and 4th
Generation Cephalosporins in Food-Producing Animals in
the European Union: Development of Resistance and Impact
on Human and Animal Health. London: European
Medicines Agency.
FAO ⁄ WHO ⁄ OIE (2007) Joint FAO ⁄ WHO ⁄ OIE expert meeting
on critically important antimicrobials. 2008. Report of a
meeting held in FAO, Rome, Italy, 26–30 November 2007.
FAO, Rome, Italy and WHO, Geneva, Switzerland.
Kolar, M., Bardon, J., Chroma, M., Hricova, K., Stosova, T.,
Sauer, P. and Koukalova, D. (2010) ESBL and AmpC betalactamase-producing
Enterobacteriaceae in poultry in the
Czech Republic. Vet Med 55, 119–124.
Literak, I., Dolejska, M., Janoszowska, D., Hrusakova, J.,
Meissner, W., Rzyska, H., Bzoma, S. and Cizek, A.
(2010a) Antibiotic-resistant Escherichia coli bacteria,
including strains with genes encoding the extended-spectrum
beta-lactamase and QnrS, in waterbirds on the Baltic
Sea Coast of Poland. Appl Environ Microbiol 76,
8126–8134.
Literak, I., Dolejska, M., Radimersky, T., Klimes, J., Friedman,
M., Aarestrup, F.M., Hasman, H. and Cizek, A. (2010b)
Antimicrobial resistant faecal Escherichia coli in wild mammals
in central Europe: multiresistant Escherichia coli producing
extended-spectrum beta-lactamases in wild boars.
J Appl Microbiol 108, 1702–1711.
Machado, E., Coque, T.M., Canto´n, R., Sousa, J.C. and Peixe,
L. (2008) Antibiotic resistance integrons and extendedspectrum
b-lactamases among Enterobacteriaceae isolates
recovered from chickens and swine in Portugal. J Antimicrob
Chemother 6, 296–302.
Mora, A., Blanco, M., Lo´pez, C., Mamani, R., Blanco, J.E.,
Alonso, M.P., Garcı´a-Garrote, F., Dahbi, G. et al. (2011)
Emergence of clonal groups O1:HNM-D-ST59, O15:H1ESBL-producing
E. coli in turkey farms M. Dolejska et al.
276 Letters in Applied Microbiology 53, 271–277 ª 2011 The Society for Applied Microbiology
ª 2011 The Authors
D-ST393, O20:H34 ⁄ HNM-D-ST354, O25b:H4-B2-ST131
and ONT:H21,42-B1-ST101 among CTX-M-14-producing
Escherichia coli clinical isolates in Galicia, northwest Spain.
Int J Antimicrob Agents 37, 16–21.
Randall, L.P., Clouting, C., Horton, R.A., Coldham, N.G., Wu,
G., Clifton-Hadley, F.A., Davies, R.H. and Teale, C.J.
(2011) Prevalence of Escherichia coli carrying extendedspectrum
b-lactamases (CTX-M and TEM-52) from broiler
chickens and turkeys in Great Britain between 2006 and
2009. J Antimicrob Chemother 66, 86–95.
Sanco, D.G. (2006) European Commission Directorate General
for Health and Consumer Affairs. Baseline survey on the
prevalence of Salmonella in flocks of turkeys in the European
Union: Technical specifications. SANCO ⁄ 2083 ⁄ 2006.
Working document. Available at: http://ec.europa.eu/food/
food/biosafety/salmonella/tech_spec_sanco-2083-
2006_rev1_en.pdf (accessed 18 July 2006).
Schwarz, S., Kehrenberg, C. and Walsh, T.R. (2001) Use of
antimicrobial agents in veterinary medicine and food
animal production. Int J Antimicrob Agents 17, 431–437.
Tenover, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A.,
Murray, B.E., Persing, D.H. and Swaminathan, B. (1995)
Interpreting chromosomal DNA restriction patterns produced
by pulsed-field gel electrophoresis: criteria for
bacterial strain typing. J Clin Microbiol 33, 2233–2239.
Trobos, M., Lester, C.H., Olsen, J.E., Frimodt-Møller, N. and
Hammerum, A.M. (2009) Natural transfer of sulphonamide
and ampicillin resistance between Escherichia coli
residing in the human intestine. J Antimicrob Chemother
63, 80–86.
M. Dolejska et al. ESBL-producing E. coli in turkey farms
ª 2011 The Authors
Letters in Applied Microbiology 53, 271–277 ª 2011 The Society for Applied Microbiology 277
Příloha 9
DOLEJSKA, M., FLOREK, M., FLORKOVA, P., JAMBOROVA, I., PURGERTOVA, M., KUTILOVA, I.,
CIZEK, A., GUENTHER, S., LITERAK, I., 2011, CTX-M-15-producing Escherichia coli clone B2-O25bST131
and Klebsiella spp. isolates in municipal wastewater treatment plant effluents: Journal of
Antimicrobial Chemotherapy, v. 66, p. 2784-2790.
Souhrn
V rámci této studie byl sledován výskyt enterobakterií rezistentních k cefalosporinům ve vzorcích přečištěné
odpadní vody odebrané na odtoku z brněnské Čistírny odpadních vod. Tři čtvrtiny vyšetřených vzorků
obsahovaly kmeny s produkcí ESBL, nejčastěji CTX-M-15. Jedná se o první studii, která upozorňuje na riziko
šíření pandemického multirezistentního kmene E. coli B2-O25b-ST131 do vodního prostředí. Výsledky zároveň
dokumentují nedostatečnou funkčnost procesu čištění v odstranění některých patogenních a rezistentních
bakterií.
CTX-M-15-producing Escherichia coli clone B2-O25b-ST131 and
Klebsiella spp. isolates in municipal wastewater treatment
plant effluents
Monika Dolejska1,2*, Petra Frolkova1, Magdalena Florek1,3, Ivana Jamborova1, Michaela Purgertova1, Iva Kutilova1,
Alois Cizek2,4, Sebastian Guenther5 and Ivan Literak1,2
1
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical
Sciences Brno, Palackeho 1-3, 612 42 Brno, Czech Republic; 2
CEITEC VFU, University of Veterinary and Pharmaceutical Sciences Brno,
Palackeho 1-3, 612 42 Brno, Czech Republic; 3
Department of Microbiology, Faculty of Veterinary Medicine, Wroclaw University of
Environmental and Life Sciences, C.K. Norwida 30, 50-375 Wroclaw, Poland; 4
Institute of Microbiology and Infectious Diseases, Faculty of
Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno, Palackeho 1-3, 612 42 Brno, Czech Republic; 5
Institute
of Microbiology and Epizootics, Veterinary Faculty, Free University Berlin, Philippstr. 13, 10115 Berlin, Germany
*Corresponding author. Tel: +420-541-562-643; Fax: +420-541-562-631; E-mail: m.dolejska@centrum.cz
Received 29 July 2011; returned 3 August 2011; revised 10 August 2011; accepted 11 August 2011
Objectives: The global occurrence of antibiotic resistance genes in bacteria in water environments is an increasing
concern. Treated wastewater was sampled daily over a 45 day period from the outflow of a municipal
wastewater treatment plant in Brno, Czech Republic, and examined for extended-spectrum b-lactamase
(ESBL)-producing bacteria.
Methods: Water samples were cultivated on MacConkey agar with cefotaxime (2 mg/L) and individual colonies
were examined for ESBL production. Phenotypic ESBL-positive bacteria identified as Escherichia coli or Klebsiella
spp. were tested for the presence of antibiotic resistance genes, the virulence gene afa/dra and the blaCTX-M
upstream region. Genetic relatedness was analysed by PFGE, multilocus sequence typing and plasmid analysis.
Results: A total of 68 ESBL-producing Enterobacteriaceae isolates were detected in 34 out of 45 wastewater
samples. ESBL-producing isolates included 26 E. coli isolates, 4 Klebsiella pneumoniae isolates and 1 Klebsiella
oxytoca isolate. The pandemic and multiresistant B2-O25b-ST131 clone was predominant, being detected
among 19 E. coli isolates, and 17 of the B2-O25b-ST131 isolates were positive for the FIA replicon and the
afa/dra operon and had an IS26 element flanking blaCTX-M-15. Seventeen of the B2-O25b-ST131 isolates
showed closely related PFGE profiles (defined by 84% band similarity) and belonged to identical clonal groups.
Conclusions: The results highlight the inadequacy of the treatment process in removing multiresistant bacteria
from municipal wastewater and point to a risk of transmission of clinically important multiresistant strains,
such as the pandemic ST131 clone, to the environment. This is the first study demonstrating the pandemic
ST131 clone in wastewater.
Keywords: antibiotic resistance, MLST, plasmids
Introduction
The global occurrence of antibiotic resistance genes in bacteria
in water environments is an increasing concern. Microorganisms
that carry genes encoding resistance to a broad
range of antibiotics have been found in hospital wastewater
and animal production wastewater as well as in sewage,
wastewater treatment plant (WWTP) effluents, surface
water, river water, groundwater and drinking water.1
Aquatic
environments are described as natural reservoirs of
antibiotic-resistant bacteria, and WWTPs are among the
leading water reservoirs of these microorganisms.2
Conditions
such as pH, temperature, nutrient concentration and high bacterial
biomass, favouring close contact of bacterial cells, make
WWTPs ideal locations for gene transfer and the spread of
resistance. In addition, the presence of antibiotics and their
metabolites in sewage may promote both the selection of
resistant strains and the horizontal transfer of antibiotic resistance
genes.3
Wastewater treatment does not eliminate all pathogens and
resistant bacteria.2
Consequently, introducing treated wastewater
effluents into natural water resources escalates the risk
# The Author 2011. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: journals.permissions@oup.com
J Antimicrob Chemother 2011; 66: 2784–2790
doi:10.1093/jac/dkr363 Advance Access publication 27 September 2011
2784
atIstitutoSuperiorediSanitaonNovember29,2011http://jac.oxfordjournals.org/Downloadedfrom
of human exposure to resistant bacteria via drinking water
systems4
and the dissemination of these strains into wildlife.4
Emerging extended-spectrum b-lactamase (ESBL)-producing
and fluoroquinolone-resistant bacteria have become a main
issue in current human medicine. In 2008, worldwide pandemic
spread of Escherichia coli sequence type (ST) 131, which produces
CTX-M b-lactamase and is resistant to fluoroquinolones,
was identified.5
The clone belongs to pathogenic group B2 and
mainly causes urinary tract infections in humans. Strains of
this ST harbour a broad range of virulence and resistance
genes on a transferable plasmid, most of which are of the IncF
group.6
While broad distribution has been demonstrated
among antimicrobial-resistant E. coli from humans7
our knowledge
of the dissemination of ST131 remains limited.
The aim of this study was to isolate ESBL-producing
and plasmid-mediated fluoroquinolone-resistant bacteria from
treated water at a municipal WWTP with particular attention
to E. coli and Klebsiella pneumoniae. To our knowledge, this
was the first study investigating the occurrence of the multiresistant
epidemiological uropathogenic clone E. coli B2-O25b-ST131
in municipal wastewater.
Materials and methods
Sampling
The municipal WWTP used for this study is situated in Brno, the second
largest city in the Czech Republic, with a population of about 400000.
The WWTP is a two-stage facility using a combined mechanical and
biological treatment process with anaerobic sludge stabilization. It serves
most districts of the city and its suburban areas, including several hospitals
and long-term care facilities. Treated wastewater was sampled at the
outflow of the WWTP, from which the effluents go directly into the
Svratka River. The water samples were taken daily (except weekends) over
a 45 day period between 26 November 2008 and 2 February 2009. The
samples were taken using the Moore swab method.8
The cotton swabs
were exposed to the water effluents for 24 h, after which the swabs were
collected, placed into sterile bags, then transported to the laboratory.
Isolation of ESBL-producing Enterobacteriaceae
and antibiotic susceptibility testing
Wastewater samples diluted to 1023
were cultured on MacConkey agar
(MCA; Oxoid, UK) with cefotaxime (2 mg/L) to isolate ESBL-producing
bacteria. All colonies showing differing morphology were selected from
each plate, identified using the API 10S test kit (bioMerieux, France)
and tested for ESBL production by the double-disc synergy test and
for susceptibility to 12 antimicrobial agents according to the CLSI
method,9
as described previously.10
Colonies identified as E. coli or
Klebsiella spp. were further characterized.
Antibiotic resistance gene testing
PCR and sequencing were used to test for the presence of blaTEM, blaCTX-M,
blaSHV and blaOXA genes in the ESBL-positive E. coli and Klebsiella spp.
isolates.11
Isolates resistant to additional antibiotics (aminoglycosides,
chloramphenicol, sulphonamides and tetracycline) were tested for
selected antibiotic resistance genes by PCR. For a list of primers and positive
controls see Table S1 (available as Supplementary data at JAC
Online). Isolates were screened for the presence of integrons; the
genes int1 and int2, the variable region of the class 1 integron, the variable
region of the class 2 integron and the gene cassettes dfr1, dfr12,
dfr17, aadA1, aadA2, aadA5, estX and sat1/2 were tested for by PCR
(Table S1). MICs of ciprofloxacin and nalidixic acid were determined for
all strains using the CLSI agar dilution method9
and strains were tested
for the plasmid-mediated quinolone resistance genes aac(6′
)-Ib-cr,
qepA, qnrA, qnrB, qnrC, qnrD and qnrS by PCR and sequencing.10
Upstream region of blaCTX-M genes
The genetic context of blaCTX-M genes was investigated by testing for the
presence of and linkage with sequences previously reported to be associated
with the CTX-M group genes, such as upstream regions ISEcp1
and IS26. PCR and sequencing using previously described primers were
employed to investigate these surrounding regions. The ISEcp1 region
was searched using ISEcp1 5′
primer (5′
-TTCAAAAAGCATAATCAAAG
CC-3′
)12
binding in the 5′
region of ISEcp1 and using ISEcp1 UP primer
(5′
-AAAAATGATTGAAAGGTGGT3′
)13
binding to the transposase gene tnpA
of ISEcp1, located in the immediate blaCTX-M upstream region. The presence
of IS26 linked to blaCTX-M was tested using tnpA IS26 primer
(5′
-AGCGGTAAATCGTGGAGTGA-3′
),12
recognizing the transposase gene of
the IS26 element. All primers were used in combination with reverse
primer CTX-M-RCJ (5′
-AGCGGCACACTTCCTAAC-3′
), recognizing the 5′
region of blaCTX-M genes.14
Phenotypic and molecular typing methods
Identification of E. coli phylogenetic groups was performed using a multiplex
PCR assay.15
All isolates were subjected to serotyping.16
Allelespecific
PCR was performed to identify the O25-ST131 clone of E. coli.17
The presence of replicons was tested by multiplex PCR.18
E. coli and
Klebsiella spp. isolates were typed by XbaI PFGE.19
Profiles were analysed
using BioNumerics fingerprinting software (Applied Maths, Belgium).
Cluster analysis of the Dice similarity indices was done to generate a dendrogram
describing the relationships among PFGE profiles. Isolates were
considered to be related and to belong to the same PFGE cluster if their
Dice similarity index was ≥80%. Multilocus sequence typing (MLST) was
carried out as described previously.20
Gene amplification and sequencing
were performed using primers specified at the E. coli MLST web site (http://
mlst.ucc.ie/mlst/mlst/dbs/Ecoli). Sequences were analysed using the
software package Ridom SeqSphere 0.9.19 (http://www3.ridom.de/
seqsphere) and STs were computed automatically. MLST typing
of K. pneumoniae strains was performed using the Institute
Pasteur (Paris, France) scheme.21
Conjugation and transformation experiments
Conjugative transfer of ESBL genes was tested. Plate-mating experiments
were performed using plasmid-free, rifampicin- and sodium
azide-resistant E. coli and Salmonella recipients.22
The strains were
grown to the exponential phase and then mixed (1:1), and 500 mL of
the donor and recipient mixture was incubated using a bacteriological
filter on the surface of Luria–Bertani (LB) agar at 378C overnight. Transconjugants
were selected on LB agar supplemented with rifampicin,
nalidixic acid and cefotaxime. Plasmid DNA from E. coli was isolated by
the alkaline extraction procedure23
and introduced to competent E. coli
DH5a (Invitrogen, USA) by chemical transformation followed by selection
of transformants on LB agar (Difco, USA) supplemented with cefotaxime
(2 mg/L). The presence of the relevant bla gene in transformants and
transconjugants was confirmed by PCR. Co-transfer of other antibiotic
resistance genes during transformation and conjugation was tested by
the disc diffusion test followed by PCR.
Plasmid characterization
The size of plasmids with ESBL genes from transformants or transconjugants
was determined by S1-PFGE.24
Plasmid DNA from transformants or
transconjugants was digested with EcoRV, followed by gel electrophoresis
in 1% agarose gel for 16 h at 67 V/cm. Plasmids were replicon typed.18,25
Antibiotic-resistant E. coli and K. pneumoniae
2785
JAC
atIstitutoSuperiorediSanitaonNovember29,2011http://jac.oxfordjournals.org/Downloadedfrom
Plasmids belonging to incompatibility group FIIK were typed using a
plasmid MLST scheme.25
Results
Isolation of cefotaxime-resistant and ESBL-producing
Enterobacteriaceae
Forty-five water samples were taken between November 2008
and February 2009. A total of 114 cefotaxime-resistant Enterobacteriaceae
isolates were obtained by incubation on MCA
with cefotaxime (2 mg/L). Apart from resistance to b-lactam
antibiotics, cefotaxime-resistant isolates showed resistance to
nalidixic acid (90% of the isolates), followed by resistance to
ampicillin/clavulanic acid and sulphonamides (46%), ciprofloxacin
(45%), tetracycline (44%), sulfamethoxazole/trimethoprim
(39%), streptomycin (27%), gentamicin (12%) and chloramphenicol
(10%). ESBL production was detected in 68 (60%) Enterobacteriaceae
isolates. At least one ESBL-producing isolate was
detected in 34 (76%) out of 45 wastewater samples. ESBL producers
included 26 isolates of E. coli, 4 isolates of K. pneumoniae
and 1 isolate of Klebsiella oxytoca.
Determination of phenotypic and genotypic resistance
in E. coli isolates
From the total of 26 ESBL-producing E. coli isolates, the gene
blaCTX-M-15 was detected in 23 (88%) isolates, while blaCTX-M-14b
and blaCTX-M-1 were detected in 1 and 2 isolates, respectively.
All the isolates were multiresistant (resistant to two or more
antibiotic groups); resistance to nalidixic acid and ciprofloxacin
was the most prevalent (26 isolates), followed by sulphonamides
(21), sulfamethoxazole/trimethoprim (19), tetracycline (19) and
streptomycin (8) (Figure 1). In 21 isolates, the MIC of nalidixic
acid was .256 mg/L and that of ciprofloxacin was .8 mg/L.
Corresponding antibiotic resistance genes were detected using
PCR, revealing that resistance to sulphonamides was connected
mainly with the gene sul1 (16 isolates). Only one isolate
contained the gene sul2, and the combination of sul1 and sul2
was found in four isolates. Resistance to tetracycline was
connected with the presence of the gene tet(A). Most ESBLproducing
isolates also contained blaOXA-1 and the aac(6′
)-Ib-cr
aminoglycoside–quinolone resistance gene.
Class 1 and class 2 integrons were detected in 23 ESBLproducing
E. coli. Class 1 integrons 1.7 kb in size with
dfr17-aadA5 gene cassettes were the most common, being
found in 19 isolates. Two isolates contained a 2.5 kb integron
with dfr17-aadA5 or an integron 1 kb in size containing the
aadA1 gene cassette. Class 2 integrons 2.5 kb in size and containing
a dfr1-sat-aadA1 gene cassette were detected in two of
the isolates.
Phylogenetic grouping and O typing
Twenty of the CTX-M-producing isolates belonged to phylogenetic
group B2. Isolates of A (four isolates) and D (two) phylogenetic
groups were also detected. Nineteen isolates of the
B2 group were typed as O25 by serotyping. Allele-specific PCR
confirmed the presence of the rfbO25b locus in these isolates,
showing that all of them belonged to the O25b type. Another
four isolates belonged to the O55 (one), O101 (two) and O153
(one) serotypes and three isolates were not typeable by standard
agglutination tests.
PFGE analysis and MLST
Cluster analysis of macrorestriction patterns was performed
on all 26 ESBL-producing E. coli isolates. Nineteen
CTX-M-15-producing B2-O25b E. coli isolates revealed two main
clusters, I and II, at a genetic linkage of 73% (Figure 1). Cluster
I consisted of just two isolates and both of them differed from
cluster II in the absence of the afa/dra operon and different
constitutions of the upstream region of blaCTX-M-15. Isolates
belonging to cluster II shared 84% banding pattern similarity.
Three PFGE groups, A–C, were found inside cluster II. Group A
comprised eight isolates with genetic linkage of 88%, group B
comprised six isolates with 89% band similarity, and group C
comprised three isolates with 98% band similarity. All 17
B2-O25b E. coli isolates from cluster II were positive for the
afa/dra operon and contained an integron 1.7 kb in size with
dfr17-aadA5 gene cassettes, and the IS26 element was found
upstream of blaCTX-M-15. The isolates from groups A and B both
carried aac(6′
)-Ib-cr and blaOXA-1 genes, whereas isolates from
group C were negative for these genes. MLST analysis in all
isolates from cluster I and five selected isolates from cluster II
showed that they belonged to the epidemiologically important
clone ST131.
Plasmids associated with blaCTX-M in E. coli
From a total of 26 CTX-M-producing isolates, conjugation to
E. coli and/or Salmonella was demonstrated only in 4. Transconjugants
to E. coli and Salmonella were obtained from one ST131
strain (OV54/B). In this strain, the gene blaCTX-M-15 was located
on a 140 kb IncFIA conjugative plasmid together with
aac(6′
)-Ib-cr, blaOXA-1 and tet(A) genes. Another transconjugant
was obtained from a B2-O101 isolate (OV86/B), where the
gene blaCTX-M-15 was harboured by a 120 kb FIB plasmid along
with aac(6′
)-Ib-cr and blaOXA-1 genes. The two CTX-M-1-positive
isolates showing related PFGE profiles (OV9/B, OV10/B) conjugated
to E. coli and Salmonella, and 40 kb IncN plasmids of
identical HincII profiles were found in these isolates. No
transconjugants were obtained from CTX-M-15-producing
B2-O25b-ST131 isolates of cluster II. Chemical transformation
of B2-O25b-ST131 isolates was successful only in isolate OV22/B
from cluster II, where a 95 kb plasmid of IncFIA with
blaCTX-M-15, aac(6′
)-Ib-cr, blaOXA-1 and tet(A) genes was found.
This OV22/B transformant showed an IncF plasmid EcoRV
profile related to the OV54/B transconjugant.
ESBL-producing Klebsiella spp.
Four ESBL-producing K. pneumoniae and one K. oxytoca were isolated
(Table 1). All isolates were multiresistant and produced
CTX-M-15, and ISEcp1 was identified upstream of blaCTX-M-15.
The XbaI PFGE profile of each K. pneumoniae isolate was
unique except that two isolates, OV17/B and OV28/B, showed
only one band difference. Using MLST, K. pneumoniae isolates
were identified as ST14 (one isolate), ST321 (two isolates) and
ST323 (one isolate). Conjugative transfer of ESBL plasmids to
Dolejska et al.
2786
atIstitutoSuperiorediSanitaonNovember29,2011http://jac.oxfordjournals.org/Downloadedfrom
Strain
no.
Sampl.
day PG
O
type CTX-M
Upstream of blaCTX-M-15
a
OXA-1
aac(6´)Ib-cr
afa/dra Replicon Integron
b
Additional antibiotic resistance MIC (mg/L)
ISEcp1 5´ ISEcp1 UP
tnpA
CIPNLAgenesphenotypeIS26
− FIB − GEN, STR, SUL strA, sul2
GEN, STR, SUL strA, sul1, sul2− FIA, FIB Ic
− Y I2 − −
STR, SUL, SXT, TET blaTEM-1 , strA, tet(D), cat
TET tet (A), sul1
SUL, SXT, TET tet(A), sul1, sul2
STR, SUL, SXT, TET strA, tet(A), sul1, sul2
SUL, SXT, TET tet (A), sul1
STR, SUL, SXT, TET tet (A), sul1
OV31/B 10 B2 O25b 15 − − 0.4 + + + FIA Ia SUL, SXT, TET tet(A), sul1
SUL, SXT, TET blaTEM-1b, tet(A), sul1
STR, SUL, SXT, TET tet(A), sul1
SUL, SXT sul1, sul2
SUL, SXT, TET tet(A), sul1
SUL, SXT, TET tet(A), sul1
SUL, SXT, TET tet(A), sul1
SUL, SXT, TET tet(A), sul1
SUL, SXT, TET blaTEM-1b ,tet(A), sul1
SUL, SXT, TET bla TEM-1b , tet(A), sul1
SUL, SXT, TET tet(A), sul1
STR, SUL, SXT, TET tet(A), sul1
STR, SUL, SXT, TET tet (A), sul1
SUL, SXT sul1
TET tet(A)
− N − − −
OV88/B 34 A O101 15 2.5 0.25 − +
OV86/B 31 A O101 15 2.5 0.25 − +
+
+
OV59/B 17 D NT 15 2.5 0.25 − − −
OV25/B 8 D O153 15 2.5 0.25 − + − − − I2
OV54/B 16 B2 O25b 15 2.5 0.25 − + + − FIA Ia
OV32/B 10 B2 O25b 15 − 0.25 0.9 + + − FIA Ia
OV45/B 12 B2 O25b 15 − − 0.4 + + + FIA Ia
OV46/B 12 B2 O25b 15 − − 0.4 + + + FIA Ia
OV2/B 2 B2 O25b 15 − − 0.4 + + + FIA Ia
OV24/B 8 B2 O25b 15 − − 0.4 + + + FIA Ia
OV4/B 2 B2 O25b 15 − − 0.4 + + + FIA Ia
OV5/B 2 B2 O25b 15 − − 0.4 + + + FIA Ia
OV22/B 7 B2 O25b 15 − − 0.4 + + + FIA, Y Ia
OV68/B 26 B2 O25b 15 − − 0.4 + + + FIA Ia
OV70/B 28 B2 O25b 15 − − 0.4 + + + FIA Ia
OV56CH 13 B2 O25b 15 − − 0.4 + + + FIA Ia
OV3/B 2 B2 O25b 15 − − 0.4 + + + FIA Ia
OV8/B 3 B2 O25b 15 − − 0.4 + + + FIA Ia
OV95/B 38 B2 O25b 15 − − 0.4 + + + FIA Ia
OV10/B 3 B2 O25b 15 − − 0.4 − − + FIA Ia
OV19/B 4 B2 O25b 15 − − 0.4 − − + FIA Ia
OV9/B 3 B2 O25b 15 − − 0.4 − − + FIA Ia
OV27/B 9 B2 O55 15 − − 0.4 − + − P, I1 Ib
OV18/B 5 A NT 1 − 0.3 0.6 − −
OV20/B 6 A NT 1 − 0.3 0.6 − − − N − − −
>256 >8
>256 >8
128 >8
256 4
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 >8
>256 0.25
256 >8
256 >8
60
82
I
II A
73
B
C
84
70 80 90 100
Figure 1. Characterization of 26 ESBL-producing E. coli isolates from a WWTP. The dendrogram consists of two main PFGE clusters, I and II, with genetic relatedness of 73%; cluster II
contains three groups of isolates, named A, B and C, with 84% band similarity. PG, phylogenetic group; O type, serotype of E. coli determined by conventional serotyping and/or PCR; NT,
not typeable; GEN, gentamicin; STR, streptomycin; SUL, sulphonamides; SXT, sulfamethoxazole/trimethoprim; TET, tetracycline; NAL, nalidixic acid; CIP, ciprofloxacin. a
ISEcp1 5′
, linkage
between the 5′
region of ISEcp1 and blaCTX-M; ISEcp1 UP, linkage between ISEcp1 and blaCTX-M using forward primer for transposase gene of ISEcp1 and reverse primer for blaCTX-M; tnpA
IS26, linkage between IS26 and blaCTX-M. b
Ia, class 1 integron 1.7 kb: dfr17-aadA5; Ib, class 1 integron 1 kb: aadA1; Ic, class 1 integron 2.5 kb: dfr17-aadA5; I2, class 2 integron 2.5 kb:
dfr1-sat-aadA1.
Antibiotic-resistantE.coliandK.pneumoniae
2787
JAC
atIstitutoSuperiorediSanitaonNovember29,2011 http://jac.oxfordjournals.org/ Downloadedfrom
E. coli and/or Salmonella was demonstrated. Characterization of
ESBL-carrying plasmids showed the presence of blaCTX-M-15 on a
110 kb IncFIIK conjugative plasmid in the K. pneumoniae isolates.
Multiple antibiotic resistance genes [blaTEM-1, blaOXA-1,
strA, tet(A), aac(6′
)-Ib-cr, aac(3′
)-II and qnrB1] were located on
this FIIK plasmid together with blaCTX-M-15. FIIK plasmids
showed related EcoRV profiles. The nucleotide sequence of the
copA gene of all FIIK plasmids was identical and showed a
novel allele. The sequence of the new copA gene allele differed
from those of alleles K3 (AJ009980) and K5 (FJ628167) (available
at http://pubmlst.org/plasmid/) at one and two nucleotides,
respectively, and has been assigned to the allele K6. In the transformant
of the K. oxytoca isolate, OV88/B, the gene blaCTX-M-15
was found on a 130 kb conjugative plasmid of the FIA/FIB
incompatibility group. No other antibiotic resistance genes were
found on this plasmid.
Upstream region of blaCTX-M genes
PCR using different primer combinations identified the insertion
sequence ISEcp1, entirely or partially truncated, upstream of
the blaCTX-M gene in eight isolates (Figure 1). PCR using the
ISEcp1 5′
primer showed a 2.5 kb fragment of the entire ISEcp1
in four non-ST131 E. coli isolates and one ST131 (OV54/B)
E. coli isolate as well as in all Klebsiella isolates. The upstream
region of blaCTX-M-15 in all ST131 isolates from cluster II, analysed
by PCR, contained the transposase gene of the insertion
sequence IS26. However, PCR with the ISEcp1 5′
primer as well
as a primer binding to the tnpA gene of ISEcp1 were negative.
As confirmed by sequencing, these strains had IS26 flanking a
partially truncated ISEcp1, thus separating the blaCXT-M-15 from
its usual promoter. Two CTX-M-1-positive isolates (OV18/B,
OV20/B) and one ST131 isolate (OV32/B) also showed the presence
of IS26 disrupted by ISEcp1 at a different position compared
with isolates from cluster II and not separating
blaCTX-M-15 from its promoter. Both CTX-M-1-positive isolates
had a 48 bp region (W sequence) upstream of the blaCTX-M-1
gene and an additional 32 bp X sequence, as observed in a previous
sequence reported in the GenBank database (accession no.
AM003904). The CTX-M-15-positive E. coli and Klebsiella isolates
were characterized by the presence of only the 48 bp W
sequence, as previously described (AM040707).
Discussion
Human sewage represents an important source of pathogenic
and antibiotic-resistant bacteria and of antibiotic residues in
the environment. We documented the frequent presence of bacteria
of the Enterobacteriaceae with emerging resistance mechanisms
in treated water from a municipal WWTP. There are only
a few reports on the isolation of ESBL-producing bacteria from
wastewater ecosystems.26
The presence of low concentrations of antibiotics in WWTPs
has been documented,27
and these antibiotics may exert
selective pressure favouring resistant strains. Cephalosporins
and fluoroquinolones hold the third and fourth positions on the
European antibiotics market and their use is tending to
increase.28
They are extracted into the urine and discharged
into hospital and municipal wastewater.29
Fluoroquinolones, trimethoprim
and sulphonamides have been found to be poorly
removed during wastewater treatment30,31
and therefore
might exert selective pressure on bacteria within the sewage
plant.
Using sequencing and MLST analysis, we found that 73% of
CTX-M-15, phylogroup B2 E. coli strains corresponded to the
worldwide emerging O25b-ST131 clonal group. This clone was
detected in almost 25% of treated wastewater samples during
the 45 day sampling period. Recently, ST131, O25:H4 and phylogenetic
group B2 were shown to characterize the major clone
(88% of total) among CTX-M-15-producing E. coli isolates in
Europe, Asia and North America.32
To our knowledge, this is
the first evidence of this emerging multiresistant clone in municipal
wastewater. The multiresistant CTX-M-producing ST131 clone
has recently been isolated from river water in the UK,33
probably
resulting from significant influx of raw sewage contamination.
This provides evidence of the survival of the ST131 clone in
river water and its potential further dissemination into the
environment and wildlife.
Association of IS26 and blaCTX-M-15 in the ST131 clone has
been observed previously.34
The afa/dra operon is a virulence
Table 1. CTX-M-15-carrying plasmids from E. coli and Klebsiella isolates from a WWTP
Strain no.
Donor strain
CTX-M
Plasmid
species PG O type MLST Inc RFLP size (kb) additional antibiotic resistance genes
OV18/B.tc E. coli A NT ND 1 N I 40 —
OV20/B.tc E. coli A NT ND 1 N I 40 —
OV22/B.tf E. coli B2 O25b ST131 15 FIA IIa 95 blaOXA-1, aac(6′
)-Ib-cr, tet(A)
OV54/B.tc E. coli B2 O25b ST131 15 FIA IIb 140 blaOXA-1, aac(6′
)-Ib-cr, tet(A)
OV86/B.tc E. coli B2 O101 ND 15 FIB III 120 blaOXA-1, aac(6′
)-Ib-cr
OV17/B.tf K. pneumoniae ND ND ST321 15 FIIK V 110 blaTEM-1, blaOXA-1, strA, tet(A), aac(6′
)-Ib-cr, aac(3′
)-II, qnrB1
OV28/B.tf K. pneumoniae ND ND ST321 15 FIIK V 110 blaTEM-1, blaOXA-1, strA, tet(A), aac(6′
)-Ib-cr, aac(3′
)-II, qnrB1
OV60/B.tf K. pneumoniae ND ND ST323 15 FIIK V 110 blaTEM-1, blaOXA-1, strA, tet(A), aac(6′
)-Ib-cr, aac(3′
)-II, qnrB1
OV88/B.tc K. oxytoca ND ND ND 15 FIA/FIB IV 130 —
tc, transconjugant; tf, transformant; PG, phylogenetic group; O type, serotype of E. coli determined by conventional serotyping and/or PCR; NT, not typeable;
ND, not determined; Inc, plasmid incompatibility group; RFLP, restriction fragment length polymorphism profile of plasmid DNA using EcoRV or HincII.
Dolejska et al.
2788
atIstitutoSuperiorediSanitaonNovember29,2011http://jac.oxfordjournals.org/Downloadedfrom
gene encoding Dr family adhesins found in diffusely adhering E.
coli strains, including CTX-M-15-producing O25b-ST131 clones.35
In our study, IS26 linked to the gene blaCTX-M-15 as well as the
afa/dra operon were found in all the ST131 strains from the
dominant cluster II. CTX-M-15-producing O25b-ST131 E. coli
clones with the afa/dra operon and IS26 element flanking
blaCTX-M-15 have been isolated from human urinary tract infections
in Spain.34
Interestingly, E. coli isolates from cluster
II/PFGE group A exhibited PFGE patterns closely related (having
one- and two-band differences) to a human B2-O25b-ST131
CTX-M-15-producing, afa/dra operon-positive strain, DSM22664,
representing the human pandemic virulent group of clonally
related strains isolated from a case of bloody enteritis in
Germany.32,35
It seems that this diffusely adhering ST131 clone
with IS26 flanking blaCTX-M-15 is successfully spreading in the
human population as well as in companion animals in some
European countries.35
Interestingly, all ST131 E. coli isolates in our study harboured an
FIA plasmid. Other studies also show that the blaCTX-M-15 in ST131
clones is not only located on FII plasmids but also on plasmids of
the FI incompatibility group.35,36
It has been demonstrated that a
temperature of 208C is more conducive than 378C (the temperature
used in our study) to the transfer of resistance plasmids
between E. coli strains contained in river water in the laboratory,37
which mayexplain the low level of conjugative transfer of FIA plasmids
in ST131 clones observed in our study. Nevertheless, plasmid
analysis of one transconjugant and one transformant of two
ST131 strains showed the presence of blaCTX-M-15 on multiresistance
plasmids along with blaOXA-1, aminoglycoside–fluoroquinolone
gene aac(6′
)-Ib-cr and the tetracycline resistance
determinant tet(A). Association of blaCTX-M-15 with these antibiotic
resistance genes present on IncF plasmids is well documented.6
Both the CTX-M-1-positive isolates from WWTP harboured the
blaCTX-M-1 gene on a conjugative plasmid of incompatibility group
N. It is noteworthy that IncN plasmids with related restriction
fragment length polymorphism profiles of plasmid DNA have
been isolated from CTX-M-1-producing animal and human E. coli
strains in the Czech Republic.11,38,39
In our study, four CTX-M-15-producing K. pneumoniae strains of
three different MLST STs (ST14, ST321 and ST323) were isolated
from treated wastewater and all the isolates harboured large
FIIK plasmids with multiple antibiotic resistance genes and conjugative
ability to E. coli. These FIIK plasmids identified in Klebsiella
are mostly regarded as virulence plasmids.25
Association of
blaCTX-M-15 with IncFIIK has recently been documented and a
high capacity for these plasmids to diffuse and persist over time
has been suggested.40
IncFII plasmids harbouring the CTX-M-15
gene and associated with multiple resistance genes [blaOXA-1,
blaTEM-1, tet(A), aac(6′
)-Ib-cr and aac(3)-II], as found in Klebsiella
isolates in our study, have been found previously also in mainly
human E. coli and K. pneumoniae isolates from different continents,
thus demonstrating their worldwide dissemination.41,42
To
our knowledge, this is the first study documenting these multiple
antibiotic resistance elements on FIIK plasmids. The differences
in the presence of particular antibiotic resistance genes in our plasmids
compared with other studies suggest new genetic rearrangements.
The results highlight the evolution of IncF plasmids into
new variants containing novel antibiotic resistance elements.
Further studies are needed to examine the dissemination of FIIK
multiple resistance plasmids and their role in spreading ESBL and
quinolone resistance genes in Enterobacteriaceae in the Czech
Republic and elsewhere.
This study demonstrated the insufficient effect of the treatment
process in removing bacteria harbouring antibiotic resistance,
increased survival of specific multiresistant clones, such
as CTX-M-15-producing E. coli ST131, and the risk of transmitting
clinically important antibiotic-resistant strains into the environment
through municipal wastewater. Further studies are
needed to understand the dissemination of ST131 pandemic
clones in water ecosystems and their impact on human health.
Acknowledgements
We would like to thank Lucie Novakova, Simona Krepelova, Petra Slamova,
Daniela Kohutova, Eva Suchanova and Marie Slavikova for excellent
laboratory cooperation. Our thanks go to Pavel Alexa (Veterinary
Research Institute, Brno, Czech Republic) for serotyping of E. coli, to
Henrik Hasman and Lina Cavaco (National Food Institute, Copenhagen,
Denmark) and Alessandra Carattoli (Instituto Superior di Sanita, Rome,
Italy) for positive control strains, to Pavel Svec (Czech Collection of
Microorganisms, Brno, Czech Republic) for help with PFGE analysis and to
Jan Kyzlink from the WWTP in Brno, Czech Republic. This publication
made use of the Plasmid MLST web site (http://pubmlst.org/plasmid/)
developed by Keith Jolley and sited at the University of Oxford.
Funding
This study was supported by the Ministry of Education, Youth and Sports
of the Czech Republic (MSM6215712402), the Czech Science Foundation
(P502/10/P083) and the project ‘CEITEC - Central European Institute
of Technology’ (CZ.1.05/1.1.00/02.0068) of the European Regional
Development Fund.
Transparency declarations
None to declare.
Supplementary data
Table S1 is available as Supplementary data at JAC Online (http://jac.
oxfordjournals.org/).
References
1 Zhang X, Zhang T, Fang HHP. Antibiotic resistance genes in water
environment. Appl Microbiol Biotechnol 2009; 82: 397–414.
2 Ferreira da Silva M, Vaz-Moreira I, Gonzalez-Pajuelo M et al. Antimicrobial
resistance patterns in Enterobacteriaceae isolated from an urban
wastewater treatment plant. FEMS Microbiol Ecol 2007; 60: 166–76.
3 Andersen SR. Effects of waste water treatment on the species
composition and antibiotic resistance of coliform bacteria. Curr
Microbiol 1993; 26: 97–103.
4 Guenther S, Grobbel M, Beutlich J et al. Detection of pandemic
B2-O25-ST131 Escherichia coli harbouring the CTX-M-9 extendedspectrum
b-lactamase type in a feral urban brown rat (Rattus
norvegicus). J Antimicrob Chemother 2010; 65: 582–4.
5 Rogers BA, Sidjabat HE, Paterson DL. Escherichia coli O25b-ST131: a
pandemic, multiresistant, community-associated strain. J Antimicrob
Chemother 2011; 66: 1–14.
Antibiotic-resistant E. coli and K. pneumoniae
2789
JAC
atIstitutoSuperiorediSanitaonNovember29,2011http://jac.oxfordjournals.org/Downloadedfrom
6 Woodford N, Carattoli A, Karisik E et al. Complete nucleotide sequences
of plasmids pEK204, pEK499, and pEK516, encoding CTX-M enzymes in
three major Escherichia coli lineages from the United Kingdom, all
belonging to the international O25:H4-ST131 clone. Antimicrob Agents
Chemother 2009; 53: 4472–82.
7 Naseer U, Sundsfjord A. The CTX-M conundrum: dissemination of
plasmids and Escherichia coli clones. Microb Drug Resist 2011; 17: 83–97.
8 Moore B. The detection of paratyphoid carriers in towns by means of
sewage examination. Mon Bull Minist Health Public Health Lab Serv
1948; 9: 72–8.
9 Clinical and Laboratory Standards Institute. Performance Standards for
Antimicrobial Susceptibility Testing: Eighteenth Informational Supplement
M100-S18. CLSI, Wayne, PA, USA, 2008.
10 Literak I, Dolejska M, Janoszowska D et al. Antibiotic-resistant
Escherichia coli bacteria, including strains with genes encoding the
extended-spectrum b-lactamase and QnrS, in waterbirds on the Baltic
Sea coast of Poland. Appl Environ Microbiol 2010; 76: 8126–34.
11 Dolejska M, Duskova E, Rybarikova J et al. Plasmids carrying blaCTX-M-1
and qnr genes in Escherichia coli isolates from an equine clinic and a
horseback riding centre. J Antimicrob Chemother 2011; 66: 757–64.
12 Eckert C, Gautier V, Arlet G. DNA sequence analysis of the genetic
environment of various blaCTX-M genes. J Antimicrob Chemother 2006;
57: 14–23.
13 Eckert C, Gautier V, Saladin-Allard M et al. Dissemination of
CTX-M-type b-lactamases among clinical isolates of Enterobacteriaceae
in Paris, France. Antimicrob Agents Chemother 2004; 48: 1249–55.
14 Diestra K, Juan C, Curiao T et al. Characterization of plasmids
encoding blaESBL and surrounding genes in Spanish clinical isolates of
Escherichia coli and Klebsiella pneumoniae. J Antimicrob Chemother
2009; 63: 60–6.
15 Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of
Escherichia coli phylogenetic group. Appl Environ Microbiol 2000; 66:
4555–8.
16 Salajka E, Salajkova Z, Alexa P et al. Colonization factor different
from K88, K99, F41 and 987P in enterotoxigenic Escherichia coli
strains isolated from postweaning diarrhea in pigs. Vet Microbiol
1992; 32: 163–75.
17 Clermont O, Dhanji H, Upton M et al. Rapid detection of the
O25b-ST131 clone of Escherichia coli encompassing the CTX-M-15producing
strains. J Antimicrob Chemother 2009; 64: 274–7.
18 Carattoli A, Bertini A, Villa L et al. Identification of plasmids by
PCR-based replicon typing. J Microbiol Methods 2005; 63: 219–28.
19 One-Day (24–28 h) Standardized Laboratory Protocol for Molecular
Subtyping of Escherichia coli O157:H7, non-typhoidal Salmonella
serotypes, and Shigella sonnei by Pulsed Field Gel Electrophoresis (PFGE).
http://www.cdc.gov/pulsenet/protocols/ecoli_salmonella_shigella_protocols.
pdf (1 May 2008, date last accessed).
20 Wirth T, Falush D, Lan R et al. Sex and virulence in Escherichia coli: an
evolutionary perspective. Mol Microbiol 2006; 60: 1136–51.
21 Diancourt L, Passet V, Verhoef J et al. Multilocus sequence typing of
Klebsiella pneumoniae nosocomial isolates. J Clin Microbiol 2005; 43:
4178–82.
22 Olesen I, Hasman H, Aarestrup FM. Prevalence of b-lactamases
among ampicillin-resistant Escherichia coli and Salmonella isolated
from food animals in Denmark. Microb Drug Resist 2004; 10: 334–40.
23 Birnboim HC, Doly J. A rapid alkaline extraction procedure for
screening recombinant plasmid DNA. Nucleic Acids Res 1979; 7: 1513–23.
24 Barton BM, Harding GP, Zuccarelli AJ. A general method for detecting
and sizing large plasmids. Anal Biochem 1995; 226: 235–40.
25 Villa L, Garcia-Fernandez A, Fortini D et al. Replicon sequence typing
of IncF plasmids carrying virulence and resistance determinants.
J Antimicrob Chemother 2010; 65: 2518–29.
26 Reinthaler FF, Feierl G, Galler H et al. ESBL-producing E. coli in Austrian
sewage sludge. Water Res 2010; 44: 1981–5.
27 Watkinson AJ, Micalizzi GB, Graham GM et al. Antibiotic-resistant
Escherichia coli in wastewaters, surface waters, and oysters from an
urban riverine system. Appl Environ Microbiol 2007; 73: 5667–70.
28 Sande-Bruinsma N, Grundmann H, Verloo D et al. Antimicrobial drug
use and resistance in Europe. Emerg Infect Dis 2008; 14: 1722–30.
29 Lindberg R, Jarnheimer P, Olsen B et al. Determination of antibiotic
substances in hospital sewage water using solid phase extraction and
liquid chromatography/mass spectrometry and group analogue internal
standards. Chemosphere 2004; 57: 1479–88.
30 Gobel A, Thomsen A, McArdell CS et al. Extraction and determination
of sulfonamides, macrolides, and trimethoprim in sewage sludge.
J Chromatogr A 2005; 1085: 179–89.
31 Golet EM, Strehler A, Alder AC et al. Determination of fluoroquinolone
antibacterial agents in sewage sludge and sludge-treated soil using
accelerated solvent extraction followed by solid-phase extraction. Anal
Chem 2002; 74: 5455–62.
32 Nicolas-Chanoine MH, Blanco J, Leflon-Guibout V et al.
Intercontinental emergence of Escherichia coli clone O25:H4-ST131
producing CTX-M-15. J Antimicrob Chemother 2008; 61: 273–81.
33 Dhanji H, Murphy NM, Akhigbe C et al. Isolation of fluoroquinoloneresistant
O25b:H4-ST131 Escherichia coli with CTX-M-14 extendedspectrum
b-lactamase from UK river water. J Antimicrob Chemother
2011; 66: 512–6.
34 Oteo J, Orden B, Bautista V et al. CTX-M-15-producing urinary
Escherichia coli O25b-ST131-phylogroup B2 has acquired resistance to
fosfomycin. J Antimicrob Chemother 2009; 64: 712–7.
35 Ewers C, Grobbel M, Stamm I et al. Emergence of human pandemic
O25:H4-ST131 CTX-M-15 extended-spectrum-b-lactamase-producing
Escherichia coli among companion animals. J Antimicrob Chemother
2010; 65: 651–60.
36 Gonullu N, Aktas Z, Kayacan CB et al. Dissemination of CTX-M-15
b-lactamase genes carried on Inc FI and FII plasmids among clinical
isolates of Escherichia coli in a university hospital in Istanbul, Turkey.
J Clin Microbiol 2008; 46: 1110–2.
37 Grabow WO, Prozesky OW. Drug resistance of coliform bacteria in
hospital and city sewage. Antimicrob Agents Chemother 1973; 3: 175–80.
38 Dolejska M, Jurcickova Z, Literak I et al. IncN plasmids carrying
blaCTX-M-1 in Escherichia coli isolates on a dairy farm. Vet Microbiol 2011;
149: 513–6.
39 Literak I, Petro R, Dolejska M et al. Antimicrobial resistance in fecal
Escherichia coli isolates from healthy urban children of two age groups
in relation to their antibiotic therapy. Antimicrob Agents Chemother
2011; 55: 3005–7.
40 Coelho A, Gonza´lez-Lopez JJ, Miro E et al. Characterisation of the
CTX-M-15-encoding gene in Klebsiella pneumoniae strains from the
Barcelona metropolitan area: plasmid diversity and chromosomal
integration. Int J Antimicrob Agents 2010; 36: 73–8.
41 Ruiz E, Rojo-Bezares B, Sa´enz Y et al. Outbreak caused by a
multi-resistant Klebsiella pneumoniae strain of new sequence type
ST341 carrying new genetic environments of aac(6′
)-Ib-cr and qnrS1
genes in a neonatal intensive care unit in Spain. Int J Med Microbiol
2010; 300: 464–9.
42 Karisik E, Ellington MJ, Pike R et al. Molecular characterization of
plasmids encoding CTX-M-15 b-lactamases from Escherichia coli strains
in the United Kingdom. J Antimicrob Chemother 2006; 58: 665–8.
Dolejska et al.
2790
atIstitutoSuperiorediSanitaonNovember29,2011http://jac.oxfordjournals.org/Downloadedfrom
Příloha 10
TAUSOVA, D., DOLEJSKA, M., CIZEK, A., HANUSOVA, L., HRUSAKOVA, J., SVOBODA, O., CAMLIK,
G., LITERAK, I., 2012, Escherichia coli with extended-spectrum β-lactamase and plasmid
mediated quinolone resistance genes in great cormorants and mallards in Central Europe:
Journal of Antimicrobial Chemotherapy, v. 67, p. 1103-1107.
Souhrn
Studie dokumentuje bakterie s klinicky významnou rezistencí k cefalosporinům a fluorochinolonům u vodních
ptáků (kachna divoká a kormorán velký) ze Slovenské a České republiky. U izolátů byly detekovány geny
kódující beta-laktamázy CTX-M-15 a CTX-M-27 a geny qnrS a aac(6’)-Ib-cr pro sníženou citlivost
k fluorochinolonům, které byly neseny epidemickými plazmidy z různých inkompatibilních skupin.
Escherichia coli with extended-spectrum b-lactamase and
plasmid-mediated quinolone resistance genes in great cormorants
and mallards in Central Europe
Dagmar Tausova1, Monika Dolejska1,2, Alois Cizek2,3, Ladislava Hanusova1, Jolana Hrusakova1, Ondrej Svoboda1,
Gaspar Camlik4 and Ivan Literak1,2*
1
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical
Sciences Brno, Palackeho 1–3, 612 42 Brno, Czech Republic; 2
CEITEC—Central European Institute of Technology, University of Veterinary
and Pharmaceutical Sciences Brno, Palackeho 1–3, 612 42 Brno, Czech Republic; 3
Department of Infectious Diseases and Microbiology,
Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno, Palackeho 1–3, 612 42 Brno, Czech Republic;
4
Lipinska 835, 696 42 Vracov, Czech Republic
*Corresponding author. Tel: +420-541-562-630; Fax: +420-541-562-631; E-mail: literaki@vfu.cz
Received 30 November 2011; returned 4 January 2012; revised 12 January 2012; accepted 12 January 2012
Objectives: Faecal Escherichia coli strains were isolated from great cormorants (Phalacrocorax carbo) and mallards
(Anas platyrhynchos), which are commonly occurring waterbirds in Europe, and studied for resistance to
cephalosporins and fluoroquinolones.
Methods: Cloacal swabs or faeces from great cormorants and mallards in Central Europe were cultivated to
isolate Escherichia coli strains with extended-spectrum b-lactamase (ESBL) and plasmid-mediated quinolone
resistance (PMQR) genes.
Results: Ten ESBL-producing E. coli with the blaCTX-M-15 or blaCTX-M-27 gene were isolated from eight great cormorants
(1.6%, n¼499). The blaCTX-M genes were harboured by plasmids of F and I1 incompatibility groups.
CTX-M-27-producing isolates were identified as the epidemiologically important B2-O25b-ST131 clone. No
ESBL-producing E. coli was isolated from 305 mallards. Eight E. coli isolates with PMQR genes [six aac(6′
)-Ib-cr
and two qnrS1] were detected in six great cormorants (1.2%). Seventeen strains with qnrS1 were detected
in 17 mallards (6%). The PMQR genes were located on plasmids of incompatibility groups F, N or X2. ESBL
and PMQR genes were found on conjugative plasmids, enabling the horizontal spread of resistance.
Conclusions: Both great cormorants and mallards can spread epidemiologically important antimicrobialresistant
E. coli isolates to water bodies throughout Europe.
Keywords: ESBLs, PMQR, Anas, Phalacrocorax, B2-O25b-ST131
Introduction
The emergence of multidrug-resistant bacteria in the natural environment
constitutes a serious risk to domestic animal and
human health. Wild cormorants and mallards are associated
with aquatic environments, to which their search for food is
almost exclusively restricted. It can thus be presumed that resistant
bacteria colonizing these birds originated in that aquatic environment.
The importance of waterbirds, including mallards, in
the spread of Escherichia coli resistant to cephalosporins and
fluoroquinolones has been recently demonstrated in Poland.1
In this study, faecal E. coli strains were isolated from cormorants
and mallards, which are commonly occurring waterbirds in
Europe, and studied for resistance to cephalosporins and
fluoroquinolones. The study was focused on extended-spectrum
b-lactamase (ESBL) and plasmid-mediated quinolone resistance
(PMQR) genes and their genetic environments, including possibilities
for their horizontal transfer.
Materials and methods
Cloacal swabs or fresh faeces of great cormorants (Phalacrocorax carbo)
and mallards (Anas platyrhynchos) were examined. Cloacal swabs were
obtained from 49 cormorants shot in the Czech Republic during winter
2006/07 and 2007/08. Moreover, cormorant faeces (n¼300) were collected
at a roosting place along the Morava River, Czech Republic, in
winter 2007/08. Cormorant faeces (n¼150) were also collected at a
roosting place along the Vah River, Slovak Republic, in January 2009.
# The Author 2012. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: journals.permissions@oup.com
J Antimicrob Chemother 2012; 67: 1103–1107
doi:10.1093/jac/dks017 Advance Access publication 9 February 2012
1103
atIstitutoSuperiorediSanitaonJune19,2012http://jac.oxfordjournals.org/Downloadedfrom
Cloacal swabs from mallards (n¼305) shot at various locations in the
Czech Republic were obtained during the autumn hunting season
in 2008.
Individual cloacal swabs or faeces samples were enriched in MacConkey
broth and then cultivated on MacConkey agar (MCA) with cefotaxime
(2 mg/L) and MCA with ciprofloxacin (0.05 mg/L). The E. coli colonies
grown on MCA with cefotaxime were examined using the double-disc
synergy test for the production of ESBLs.2
In the E. coli isolates that
were resistant to cefotaxime or ciprofloxacin, susceptibilities to 12 antimicrobial
substances were tested using the disc diffusion method
according to the CLSI.1,2
E. coli strains were identified using the API 10S
test (bioMe´rieux, Marcy l’E´toile, France). Genes responsible for the ESBL
phenotype (blaTEM, blaSHV, blaOXA and blaCTX-M) were identified by PCR
and sequencing.1
The colonies grown on MCA with ciprofloxacin were
tested for PMQR genes [qnrA, qnrB, qnrC, qnrD, qnrS, aac(6′
)-Ib-cr and
qepA] by PCR, as described previously.1
All of the other methods used in this study are described elsewhere.3
Briefly, ESBL- and/or PMQR-positive E. coli isolates were typed by XbaI
PFGE, and E. coli phylogenetic groups were identified. In isolates belonging
to phylogenetic group B2, allele-specific PCR was performed to identify
the O25b-ST131 clone of E. coli. Multilocus sequence type (MLST)
determination was carried out in isolates positive by allele-specific PCR.
Gene amplification and sequencing were performed using primers specified
at the E. coli MLST web site (http://mlst.ucc.ie/mlst/mlst/dbs/Ecoli).
The insertion sequence ISEcp1 in the upstream region of the blaCTX-M
genes was tested.
The transferability of the bla genes and PMQR genes was tested by
conjugation. Plasmid DNA from E. coli was isolated and introduced into
competent E. coli DH5a (Invitrogen, USA) by chemical transformation,
followed by the selection of transformants on brain heart infusion agar
(Oxoid) supplemented with cefotaxime (2 mg/L) or ciprofloxacin
(0.05 mg/L). The presence of a relevant bla gene and/or PMQR gene in
the transformants was confirmed by PCR. All transformants, transconjugants
and their corresponding donors were examined for minimum inhibitory
concentrations of ciprofloxacin and nalidixic acid using the
agar dilution method.2
The size of the plasmids with ESBL or quinolone
resistance genes from transformants or transconjugants was designated
by S1-PFGE. The restriction fragment length polymorphism (RFLP) of
plasmid DNA from transformants/transconjugants was determined. Plasmids
were replicon typed as described elsewhere.4
Results
Using selective cultivation on MCA with cefotaxime, 10 ESBLproducing
E. coli strains were isolated from eight great cormorants
(1.6%; n¼499) (Table 1). Their ESBL phenotype was
caused by the presence of the blaCTX-M-27 or blaCTX-M-15 gene.
The insertion sequence ISEcp1 was found upstream from all
blaCTX-M genes. Both CTX-M-27-producing isolates showed the
same XbaI-PFGE profile and belonged to the B2-O25b-ST131
lineage (Table 1). All CTX-M-15-producing isolates were multiresistant,
and most of them contained aac(6′
)-Ib-cr and a class 1
integron, 1.7 kb in length with the gene cassettes dfrA17-aadA5.
The blaCTX-M-15 gene was located on two different plasmid types:
IncI1 or IncFIA-FIB (Table 1).
Using selective cultivation on MCA with ciprofloxacin, four
PMQR-positive E. coli strains were isolated from four cormorants
(0.8%, n¼499). Two isolates were positive for qnrS1 and another
two isolates contained aac(6′
)-Ib-cr (Table 2). The qnrS1 gene
was located on 50 kb conjugative plasmids of the IncN group
with the same RFLP profile in both of the isolates. In the
strains carrying aac(6′
)-Ib-cr, the genes blaCTX-M-15 and blaOXA-1
were detected (Tables 1 and 2).
No ESBL-producing E. coli isolate was detected in mallards.
Using selective cultivation with ciprofloxacin, 17 qnrS1-positive
E. coli isolates were detected in 17 mallards (6%, n¼305)
(Table 2). The qnrS1 gene was transferred by conjugation to
E. coli and Salmonella. The qnrS1 gene was located on conjugative
plasmids of incompatibility groups X2 or N that ranged in size
from 30 to 45 kb (Table 2).
As determined by the x2
test, the prevalence of ESBL-positive
E. coli isolates in cormorants was statistically higher than in mallards
and, in contrast, the prevalence of PMQR-positive strains in
mallards was statistically higher than in cormorants.
Discussion
CTX-M enzymes are currently the most prevalent ESBLs in the
world and they are identified mainly in E. coli.5
We report here
E. coli isolates with ESBL genes in cormorants for the first time.
Great cormorants and mallards are common waterbirds in
Central Europe, and thus the detection of CTX-M-type ESBL and
PMQR genes in these wild birds may indicate a rapid spread of
these resistance genes within the environment. As these waterbirds
are almost exclusively associated with the water environment,
we suppose that they were colonized with resistant
E. coli strains from this environment; they can then become important
reservoirs and potential vectors of the bacteria in the
water environment.
In the present study, the blaCTX-M-15 gene was harboured on
conjugative plasmids of the incompatibility groups IncF and
IncI1. The association between the genes blaCTX-M-15, blaOXA-1
and aac(6′
)-Ib-cr and the IncF plasmid was recently described
in clinical and food animal E. coli isolates.6
Plasmids belonging
to the IncI1 group carrying blaCTX-M-15 have also recently been
described in E. coli isolates.7
In our study, the blaCTX-M-27 gene was found in two epidemiologically
related E. coli isolates from cormorants. To our knowledge,
this is the first report of CTX-M-27-producing E. coli in
wild animals. Moreover, these CTX-M-27-positive isolates belonging
to the B2 phylogenetic group were identified as the
O25b-ST131 clone, which has high virulence potential all over
the world and represents a major public health problem. This is
the first detection of a CTX-M-27 ESBL type in an O25b-ST131
isolate in Europe. To date, the only finding of a
CTX-M-27-producing E. coli clone B2-O25-ST131 has been
reported in China.8
In this study, E. coli isolates with qnrS1 were detected at a
prevalence of 6% in mallards. Recently, four E. coli isolates
with qnrS genes were found in mallards from the Polish coast
of the Baltic Sea.1
In all E. coli strains from Central European mallards,
the qnrS1 gene was located on transferable plasmids of incompatibility
groups X2 or N. The IncX2 plasmid is not common,
and the association between this plasmid and qnrS has been
described only very recently.1,9
In four E. coli isolates, qnrS1
was found to be located on conjugative plasmids of the IncN
group. The association of qnrS and IncN plasmids has been recently
reported.1,10
Selective pressure or sources of colonization probably differ in
great cormorants and mallards, as shown by the different
Tausova et al.
1104
atIstitutoSuperiorediSanitaonJune19,2012http://jac.oxfordjournals.org/Downloadedfrom
Table 1. Characterization of ESBL-producing E. coli isolates from great cormorants
Strain no. AR phenotypea
ESBL bla genes
Additional AR
genes and
integronsb
PFGE
profile
Phylogenetic
group
Conjugation
to E. coli
Conjugation
to Salmonella
Plasmid
Inc group
Plasmid
size (kb)
Plasmid
RFLP profile
AR genes
and integrons
on plasmidb
KO 141 B AMP, CEF — — A D 2 2 NT NT NT
KO 178 B AMP, CEF, CIP, NAL, STR,
SUL, SXT, TET
blaCTX-M-27 strA, sul2, tet(A), Int1 B B2 2 2 NT NT NT
KO 198 B AMP, CEF, CIP, NAL, STR,
SUL, SXT, TET
blaCTX-M-27 strA, sul2, tet(A), Int1 B B2 2 2 FIA-FIB 120 VII blaCTX-M-27, strA,
tet(A), sul2, Int1
KO 255 B AMP, CEF, CAZ, CHL, CIP,
GEN, NAL, STR, SUL,
SXT, TET
blaCTX-M-15 blaTEM-1b, strA, tet(B), cat, Int1 C D 2 2 NT NT NT
KT 58 C AMP, CEF, CHL, CIP, GEN,
NAL, SUL, SXT, TET
blaCTX-M-15 blaOXA-1, aac(6′
)-Ib-cr, tet(A),
tet(B), cat, sul2, Int1
D A + 2 I1 100 V blaCTX-M-15, sul2,
cat, Int1
KT 87c
AMP, CEF, CHL, CIP, NAL,
SUL, SXT, TET
blaCTX-M-15 blaOXA-1, aac(6′
)-Ib-cr, tet(A),
tet(B), cat, sul2, dfr1, Int1
D A + 2 FIA-FIB 170 VI blaCTX-M-15, blaOXA-1,
aac(6′
)-Ib-cr, tet(A),
tet(B), cat, Int1
KT 87 C AMP, CEF, CHL, CIP,
NAL, SUL, SXT, TET
blaCTX-M-15 blaTEM-1b, blaOXA-1, aac(6′
)-Ib-cr,
tet(A), tet(B), cat, sul2, dfr1,
aadA1, sat, Int1
D A 2 2 NT NT NT
KT 121 Bc
AMP, CEF, CHL, CIP, NAL,
SUL, SXT, TET
blaCTX-M-15 blaOXA-1, aac(6′
)-Ib-cr, tet(A),
tet(B), cat, sul2, dfr1, Int1
D A 2 2 NT NT NT
KT 121 C AMP, CEF, CHL, CIP,
NAL, SUL, SXT, TET
blaCTX-M-15 blaOXA-1, aac(6′
)-Ib-cr, tet(A),
tet(B), cat, sul2, int2, dfr1,
aadA2, sat, Int1
D A 2 2 NT NT NT
KT 126 C AMP, CEF, CHL, CIP NAL,
SUL, SXT, TET
blaCTX-M-15 blaOXA-1, aac(6′
)-Ib-cr, tet(A),
tet(B), cat, sul2, int2, dfr1,
aadA2, sat, Int1
D A + 2 I1 100 V blaCTX-M-15, sul2,
dfr1, cat, Int1
AR, antibiotic resistance; Inc, incompatibility group; NT, not typeable.
RFLP profile determined by EcoRV and HincII digestion.
a
Twelve substances were tested using the disc diffusion method according to the CLSI: AMC, amoxicillin/clavulanic acid; AMP, ampicillin; CEF, cefalotin; CAZ, ceftazidime; CHL, chloramphenicol;
CIP, ciprofloxacin; GEN, gentamicin; NAL, nalidixic acid; STR, streptomycin; SUL, sulphonamides; SXT, trimethoprim/sulfamethoxazole; and TET, tetracycline.
b
Int1: sul1, int1, class 1 integron 1.7 kb: dfrA17-aadA5.
c
ESBL- and PMQR-positive E. coli strains isolated by selective cultivation with ciprofloxacin (see Table 2).
ResistantE.coliincormorantsandmallards
1105
JAC
atIstitutoSuperiorediSanitaonJune19,2012 http://jac.oxfordjournals.org/ Downloadedfrom
Table 2. Characterization of PMQR-positive E. coli from great cormorants and mallards
Origin Strain no. AR phenotypea
PMQR genes
Additional AR genes
and integronsb
MIC (mg/L)c
of NAL
and CIP
PFGE
profile
Phylogenetic
group
Conjugation
to E. coli
Conjugation to
Salmonella
Plasmid
Inc
group
Plasmid
size
(kb)
Plasmid
RFLP
profile
Additional AR
gene(s) on
plasmid
Cormorants KT 58 A STR, TET qnrS1 strA, tet(A) 128 0.125 f1 A + 2 N 50 I strA, tet(A)
KT 87d
AMP, CHL, CEF, CIP,
NAL, SUL, SXT, TET
aac(6′
)-Ib-cr blaCTX-M-15, blaOXA-1, tet(A),
tet(B), cat, sul2, dfr1, Int1
.256 .8 D A 2 2 NT NT NT
KT 121 Bd
AMP, CHL, CEF, CIP,
NAL, SUL, SXT, TET
aac(6′
)-Ib-cr blaCTX-M-15, blaOXA-1, tet(A),
tet(B), cat, sul2, dfr1, Int1
.256 .8 D A 2 2 NT NT NT
KT 136 A STR, TET qnrS1 strA, tet(A) 128 0.125 f A + + N 50 I strA, tet(A)
Mallards 174 AMP, NAL, TET qnrS1 blaTEM, tet(B) .256 4 a A 2 2 NT NT NT
175 TET qnrS1 — .256 0.25 b A + 2 X2 35 IV —
177 TET qnrS1 tet(B) 128 0.5 c A + 2 X2 30 III —
178 TET qnrS1 tet(B) 256 4 c A + + X2 35 III —
188 A TET qnrS1 tet(A) .256 1 d A + + X2 35 IV tet(A)
194 TET qnrS1 tet(A) .256 .8 e B1 + 2 X2 35 IV tet(A)
195 A AMP, CHL, CEF, CIP,
NAL, SUL, SXT, TET
qnrS1 blaTEM, tet(B), cat, sul1 .256 .8 NT B1 + 2 NT NT NT
203 A TET qnrS1 tet(A) .256 .8 e B1 + 2 X2 40 IV tet(A)
204 TET qnrS1 tet(A) 128 0.25 e B1 + 2 X2 35 IV tet(A)
206 TET qnrS1 tet(A) 128 0.5 g A + + X2 35 IV tet(A)
209 AMP, TET qnrS1 blaTEM, tet(A) 128 0.5 h A + + N 45 II blaTEM, tet(A)
212 TET qnrS1 tet(A) .256 0.5 i A + 2 X2 35 IV tet(A)
220 TET qnrS1 tet(A) 128 0.5 j A + + X2 35 IV tet(A)
226 B TET qnrS1 tet(A) .256 0.5 k A + + X2 35 IV tet(A)
231 AMP qnrS1 blaTEM .256 0.5 l A + + N 40 IIa blaTEM
234 TET qnrS1 tet(A) 64 0.25 m A + + X2 40 IV tet(A)
242 TET qnrS1 tet(A) 128 0.25 j A + 2 X2 40 IV tet(A)
AR, antibiotic resistance; Inc, incompatibility group; NT, not typeable.
RFLP profile determined by EcoRV and HincII digestion.
a
Twelve substances were tested using the disc diffusion method according to the CLSI: AMC, amoxicillin/clavulanic acid; AMP, ampicillin; CEF, cefalotin; CAZ, ceftazidime; CHL, chloramphenicol;
CIP, ciprofloxacin; GEN, gentamicin; NAL, nalidixic acid; STR, streptomycin; SUL, sulphonamides; SXT, trimethoprim/sulfamethoxazole; and TET, tetracycline.
b
Int1: sul1, int1, class 1 integron 1.7 kb: dfrA17-aadA5.
c
MIC of nalidixic acid and ciprofloxacin for donor strains.
d
E. coli strains positive for PMQR and ESBL genes (see Table 1).
Tausovaetal.
1106
atIstitutoSuperiorediSanitaonJune19,2012 http://jac.oxfordjournals.org/ Downloadedfrom
prevalences of ESBL-producing and PMQR-positive E. coli isolates
in great cormorants and mallards, respectively. As common
waterbirds, both great cormorants and mallards can spread epidemiologically
important antimicrobial-resistant E. coli, including
the pandemic O25b-ST131 clone.
Funding
This study was funded by the Czech Science Foundation (grant no. P502/
10/P083). This study was also supported by the project ‘CEITEC—Central
European Institute of Technology’ (CZ.1.05/1.1.00/02.0068) from the
European Regional Development Fund.
Transparency declarations
None to declare.
References
1 Literak I, Dolejska M, Janoszowska D et al. Antibiotic-resistant
Escherichia coli bacteria, including strains with genes encoding the
extended-spectrum b-lactamase and QnrS, in waterbirds on the Baltic
Sea Coast of Poland. Appl Environ Microbiol 2010; 76: 8126–34.
2 Clinical and Laboratory Standards Institute. Performance Standards for
Antimicrobial Susceptibility Testing: Eighteenth Informational Supplement
M100-S18. CLSI, Wayne, PA, USA, 2008.
3 Dolejska M, Frolkova P, Florek M et al. CTX-M-15-producing Escherichia
coli clone B2-O25b-ST131 and Klebsiella spp. isolates in municipal
wastewater treatment plant effluents. J Antimicrob Chemother 2011;
66: 2784–90.
4 Carattoli A, Bertini A, Villa L et al. Identification of plasmids by
PCR-based replicon typing. J Microbiol Methods 2005; 63: 219–28.
5 Perez F, Endimiani A, Hujer KM et al. The continuing challenge of ESBLs.
Curr Opin Pharmacol 2007; 7: 459–69.
6 Lopez-Cerero L, Egea P, Serrano L et al. Characterisation of clinical and
food animal Escherichia coli isolates producing CTX-M-15
extended-spectrum b-lactamase belonging to ST410 phylogroup A. Int
J Antimicrob Agents 2011; 37: 365–7.
7 Smet A, van Nieuwerburgh F, Vandekerckhove TT et al. Complete
nucleotide sequence of CTX-M-15-plasmids from clinical Escherichia coli
isolates: insertional events of transposons and insertion sequences.
PLoS ONE 2010; 5: e11202.
8 Sun J, Liao X, Li L et al. Emergence of pandemic B2-O25-ST131
Escherichia coli harboring blaCTX-M-3, blaCTX-M-27 and qnrS1 genes. J Med
Microbiol 2011; 60: 1711–2.
9 Fortini D, Fashae K, Garcia-Fernandez A et al. Plasmid-mediated
quinolone resistance and b-lactamases in Escherichia coli from
healthy animals from Nigeria. J Antimicrob Chemother 2011; 66:
1269–72.
10 Garcia-Fernandez A, Fortini D, Veldman K et al. Characterization of
plasmids harbouring qnrS1, qnrB2 and qnrB19 genes in Salmonella.
J Antimicrob Chemother 2009; 63: 274–81.
Resistant E. coli in cormorants and mallards
1107
JAC
atIstitutoSuperiorediSanitaonJune19,2012http://jac.oxfordjournals.org/Downloadedfrom
Příloha 11
ALBRECHTOVA, K., DOLEJSKA, M., CIZEK, A., TAUSOVA, D., KLIMES, J., BEBORA, L., LITERAK, I.,
2012, Dogs of nomadic pastoralists in northern Kenya are reservoirs of plasmid-mediated
cephalosporin- and quinolone-resistant Escherichia coli, including pandemic clone B2-O25ST131:
Antimicrobial Agents and Chemotherapy, v. 56, p. 4013-4017.
Souhrn
Ve studii byl sledován výskyt rezistentních bakterií v gastrointestinálním traktu psů, koček a kočovných
pastevců v Keni. Studie ukazuje na rozšíření beta-laktamázy CTX-M-15 a pandemického klonu E. coli
B2-O25b-ST131 v odlehlých oblastech, ve kterých se širokospektré cefalosporiny používají pouze zřídka. Nález
kmenů E. coli s identickým genotypem u psů a pastevců ukazuje na výměnu bakterií mezi zvířetem a člověkem,
kteří sdílí společné prostředí.
Dogs of Nomadic Pastoralists in Northern Kenya Are Reservoirs of
Plasmid-Mediated Cephalosporin- and Quinolone-Resistant
Escherichia coli, Including Pandemic Clone B2-O25-ST131
Katerina Albrechtova,a
Monika Dolejska,a,c
Alois Cizek,b,c
Dagmar Tausova,a
Jiri Klimes,a
Lily Bebora,d
and Ivan Literaka,c
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech
Republica
; Institute of Microbiology and Infectious Diseases, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech
Republicb
; CEITEC VFU, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republicc
; and Department of Veterinary Pathology, Microbiology and
Parasitology, Faculty of Veterinary Medicine, University of Nairobi, Kapenguria Road, Nairobi, Kenyad
Resistance in Escherichia coli isolates colonizing gastrointestinal tracts of dogs, cats, and their owners in Northern Kenya was
investigated with an emphasis on extended-spectrum beta-lactamases (ESBLs). Totals of 47 (22%, n ‫؍‬ 216), 2 (4%, n ‫؍‬ 50), and 4
(17%, n ‫؍‬ 23) CTX-M-15-producing E. coli isolates were obtained from dogs, cats, and humans, respectively. CTX-M-15-producing
E. coli isolates with identical PFGE profiles were detected in animals and humans living in the same area.
Transfer of resistant bacteria between humans and their dogs
has been documented in various studies from the Western
world (12). There have been no such data, however, from developing
African countries. Dogs have been repeatedly recognized as
comprising reservoirs or sentinels for zoonotic and livestock-infecting
pathogens and, as such, are useful for epidemiological
monitoring in rural parts of Africa (5). This study investigated the
prevalence and molecular epidemiology of extended-spectrum
beta-lactamase (ESBL)-producing Escherichia coli strains in
Northern Kenya, an area inhabited mainly by nomadic herders of
the Samburu, Turkana, El Molo, Rendille, and Gabra tribes. Although
certain allopathic antimicrobials (mainly oxytetracycline)
are occasionally used to treat livestock, veterinary medicine for
small animals is virtually absent in the area (2). As direct selective
antibiotic pressure is minimized in these animals, domestic carnivores
can serve as sentinels of environmental contamination.
Rectal swabs of 216 dogs, 50 cats, and 23 humans were collected
into Amies medium in September and October 2009 in nine
settlements in Marsabit and Samburu Districts of Northern Kenya.
Swabs were plated in parallel on plain MacConkey agar
(MCA) (Oxoid, United Kingdom) and MCA with cefotaxime (2
mg/liter). One lactose-fermenting colony was isolated from each
plate and tested for susceptibility to 12 antimicrobial agents using
the disc diffusion method (8). Colonies obtained on cefotaximesupplemented
MCA were identified by using the API test (bioMérieux,
France) and examined by the double-disc synergy test
(8). The ESBL-positive E. coli isolates were tested by PCR and
sequencing for (i) ESBL-coding genes blaTEM, blaCTX-M, blaSHV,
and blaOXA, (ii) plasmid-mediated quinolone-resistance genes
aac(6=)-Ib-cr, qepA, qnrA, qnrB, qnrC, qnrD, and qnrS, and (iii)
additional antibiotic resistance genes and integrons as described
previously (14). All other methods used were described elsewhere
(10). In brief, ESBL-producing E. coli were typed and clustered by
pulse-field gel-electrophoresis (PFGE) (4) and their phylogenetic
groups were identified by multiplex PCR assay (6). In isolates
belonging to phylogenetic group B2, allele-specific PCR was performed
to identify the O25-ST131 clone (7). Multilocus sequence
typing (MLST) determination was carried out in isolates positive
by allele-specific PCR and analyzed at http:/mlst.ucc.ie/mlst/dbs
/Ecoli (17). The insertion sequence ISEcpI in the upstream region
of bla genes was tested (11). Chemical transformation of plasmids
and conjugation experiments to E. coli MT102RN and Salmonella
enterica serovar Typhimurium SL5325 were performed (15). Plasmids
were analyzed by S1-PFGE (1), replicon typing (3), and restriction
fragment length polymorphism profiles obtained by
EcoRV digestion.
A total of 267 lactose-fermenting isolates were obtained by
cultivating the swabs on MCA without antibiotics. The resistance
patterns of these isolates ranged from 1 (ampicillin, gentamicin,
tetracycline, streptomycin, or nalidixic acid) to all 12 of the antibiotics
tested. Multiresistance to ampicillin, streptomycin, sulfonamides,
tetracycline, and trimethoprim-sulfamethoxazole was the
most frequent phenotype.
Totals of 47 (22%, n ϭ 216), 2 (4%, n ϭ 50), and 4 (17%, n ϭ
23) ESBL-positive E. coli isolates were obtained from dogs, cats,
and humans, respectively, by cultivation on cefotaxime-supplemented
MCA. Resistance to amoxicillin-clavulanic acid was
found in 15% and resistance to ceftazidime in 11% of the ESBLproducing
isolates. Apart from resistance to beta-lactam antibiotics,
these isolates showed resistance to tetracycline (100% of
the ESBL-producing isolates), trimethoprim-sulfamethoxazole
(100%), sulfonamides (98%), nalidixic acid (96%), ciprofloxacin
(94%), gentamicin (87%), chloramphenicol (43%), and streptomycin
(34%). Comparison of PFGE banding patterns clustered
the ESBL-producing isolates into five groups of closely related
isolates (Ͼ85% similarity) designated clusters K, L, M, N, and O
(Fig. 1). Overall, 36 (70%) of the ESBL-producing isolates belonged
to either cluster K or L. Isolates with identical PFGE profiles
were detected from 8 dogs and 2 humans, and closely related
(Ͼ95% similarity) isolates were found in 1 human and 1 cat sampled
in the same town. Three dogs were found to harbor isolates of
Received 5 October 2011 Returned for modification 9 January 2012
Accepted 10 April 2012
Published ahead of print 16 April 2012
Address correspondence to Katerina Albrechtova, albkat@seznam.cz.
Copyright © 2012, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AAC.05859-11
July 2012 Volume 56 Number 7 Antimicrobial Agents and Chemotherapy p. 4013–4017 aac.asm.org 4013
onJune19,2012byguesthttp://aac.asm.org/Downloadedfrom
TABLE1StrainandplasmidcharacteristicsofESBL-producingE.coliisolatesfromdogs,cats,andhumansa
Locality
Characteristicsof:
StrainPlasmidc
Source
and
identifier
PFGE
cluster
Phylogroup,
sequence
typeResistancephenotype
Resistancegenesinadditionto
␤-lactamasesb
Conjugationor
transformation
Size(kb),Inc
group
Genescotransferred
withblaCTX-M-15and
blaOXA1-like
EcoRV
restriction
pattern
GasDog231LAAmStSuTeSxCmCfNaGnCpsul2,catA1,tet(B),dhfr12,dhfr1,strA,
aac(6=)-lb-cr
Dog233LAAmStSuTeSxCfCzint1,sul2,tet(B),dhfr1,strA,aac(6=)-lb-crConjE.coli160,FIA/FIBint1,aac(6=)-lb-cr4
Dog235KAAmStSuTeSxCfNaCzGnAcCpint1,sul2,catA1,tet(B),aac(6=)-lb-cr
Dog232XAAmStSuTeSxCfCzsul2,tet(B),aadA2,strA,aac(6=)-lb-cr
Arapaland
Gatabd
Dog166KAAmSuTeSxCmCfNaCzGnCpint1,sul2,catA1,tet(B),strA,aac(6=)-lb-crTrans,conjE.coli160,FIA/FIBint1,sul2,tet(B),catA1,
aac(6=)-lb-cr
3
Dog20KAAmSuTeSxCmCfNaGnCpint1,catA1,tet(B),strA,aac(6=)-lb-cr
Dog36KAAmSuTeSxCmCfNaGnCpint1,sul2,tet(B),aac(6=)-lb-cr
Dog49KAAmSuTeSxCmCfNaGnCpint1,sul2,catA1,tet(B),aac(6=)-lb-cr
Dog89KAAmSuTeSxCmCfNaGnCpint1,tet(B),aac(6=)-lb-cr
Dog38MAAmStSuTeSxCmCfNaGnAcCpsul2,catA1,cml,tet(B),aac(6=)-lb-cr
cat346XAAmSuTeSxCmCfNaGnCpint1,catA1,tet(B),aadA2,aac(6=)-lb-crTrans,conjE.coli160,FIA/FIBint1,sul2,tet(B),catA1,
aac(6=)-lb-cr
3
SouthHorrDog168NB2,ST131AmSuTeSxCfNaCpint1,sul2,tet(A),aac(6=)-lb-crConjE.coli
Dog198NB2,ST131AmSuTeSxCfNaCpint1,sul2,tet(A),aadA2,aac(6=)-lb-cr
Dog209NB2,ST131AmStSuTeSxCfNaAcCpint1,sul2,tet(A),strA,aac(6=)-lb-cr
Dog205XAAmSuTeSxCfNaGnCpint1,tet(B),aac(6=)-lb-cr
LoyiangalaniDog62KAAmSuTeSxCmCfNaGnCpint1,sul2,catA1,tet(B),aac(6=)-lb-crTrans160,FIA/FIBint1,sul2,tet(B),catA1,
aac(6=)-lb-cr
3
Dog110KAAmSuTeSxCmCfNaGnCpint1,sul2,catA1,tet(B),aac(6=)-lb-cr
Dog119KAAmSuTeSxCmCfNaGnAcCpint1,catA1,tet(B),aac(6=)-lb-cr
Dog128KAAmSuTeSxCmCfNaGnCpint1,sul2,tet(B),aac(6=)-lb-cr
Dog130KAAmSuTeSxCmCfNaGnCpcatA1,sul2,tet(B),strA,aac(6=)-lb-crTrans,conjE.coli110,FIBsul2,tet(B),catA1,
aac(6=)-lb-cr
1
Dog131KAAmSuTeSxCmCfNaGnCpint1,sul2,catA1,tet(B),aac(6=)-lb-cr
Dog135KAAmSuTeSxCmCfNaGnCpint1,sul2,catA1,tet(B),strA,aac(6=)-lb-cr
Dog154KAAmStSuTeSxCmCfNaGnCpint1,sul2,catA1,tet(B),strA,aac(6=)-lb-cr
Dog239KAAmStSuTeSxCmCfNaGnCpint1,sul2,catA1,tet(B),aac(6=)-lb-cr
Dog242KAAmSuTeSxCmCfNaGnAcCpint1,sul2,tet(B),dhfr12,aac(6=)-lb-crConjE.coli
Dog7LAAmSuTeSxCfNaGnCpint1,sul2,tet(B),aac(6=)-lb-crConjE.coli160,FIA/FIBsul2,int1,aac(6=)-lb-cr5
Dog41LAAmSuTeSxCfNaGnCpint1,sul2,strA,tet(B),dhfr1,aac(6=)-lb-cr
Dog42LAAmSuTeSxCfNaGnCpint1,sul2,tet(B),dhfr1,aac(6=)-lb-cr
Dog43LAAmSuTeSxCfNaGnCpint1,sul2,tet(B),dhfr1,aac(6=)-lb-cr
Dog115LAAmSuTeSxCfNaGnCpint1,sul2,tet(B),aac(6=)-lb-cr
Dog136LAAmSuTeSxCmCfNaGnCpint1,sul2,tet(B),strA
Dog137LAAmStSuTeSxCfNaint1,sul2,tet(B),aadA1,strA,
aac(6=)-lb-cr
Dog140LAAmTeSxCfNaGnCpint1,sul2,tet(B),aadA1ConjE.coli
Dog146LAAmSuTeSxCfNaGnCpint1,sul2,tet(B),aac(6=)-lb-cr
Dog150LAAmSuTeSxCfNaGnCpint1,sul2,tet(B),strA,aac(6=)-lb-cr
Albrechtova et al.
4014 aac.asm.org Antimicrobial Agents and Chemotherapy
onJune19,2012byguesthttp://aac.asm.org/Downloadedfrom
Dog156LAAmSuTeSxCfNaGnCpint1,sul2,tet(B),aadA1,strA,
aac(6=)-lb-cr
Dog229LAAmStSuTeSxCfNaCzGnCpint1,sul2,tet(B),dhfr1,strA,aac(6=)-lb-crConjE.coli150,FIA/FIBint1,aac(6=)-lb-cr,
catA1
2
Dog237LAAmSuTeSxCfNaCzGnAcCpint1,sul2,tet(B),aac(6=)-lb-crConjS.
Typhimurium
Dog238LAAmSuTeSxCfNaGnCpint1,sul2,tet(B),aac(6=)-lb-cr
Dog240LAAmSuTeSxCfNaGnCpint1,sul2,tet(B),aac(6=)-lb-crConjE.coli150,FIBint1,tet(B),
aac(6=)-lb-cr
2
Human1LAAmSuTeSxCfNaGnCpint1,sul2,tet(B),aac(6=)-lb-cr
Human18LAAmSuTeSxCfNaGnCpint1,sul2,tet(B),dhfr12,aac(6=)-lb-crConjE.coli150,FIBint1,tet(B),
aac(6=)-lb-cr
2
Human23LAAmStSuTeSxCfNaGnCpint1,sul2,tet(B),strA,aac(6=)-lb-crConjE.coli150,FIBint1,tet(B),
aac(6=)-lb-cr
2
Dog116MAAmStSuTeSxCmCfNaGnCpint1,sul2,catA1,tet(B),aadA1,strA,
aac(6=)-lb-cr
ConjE.coli,S.
Typhimurium
110,FIBsul2,tet(B),catA1,
aac(6=)-lb-cr
1
Dog124MAAmSuTeSxCfNaCzGnCpint1,sul2,tet(B),strA,aac(6=)-lb-cr
Dog126MAAmStSuTeSxCmCfNaGnCpsul2,catA1,tet(B),strA,aac(6=)-lb-crTrans,conjE.coli110,FIBsul2,tet(B),catA1,
aac(6=)-lb-cr
1
Dog138MAAmStSuTeSxCmCfNaGnAcCpcatA1,sul2,tet(B),strA,aac(6=)-lb-cr
Dog114OB1AmStSuTeSxCpint1,tet(B),aac(6=)-lb-cr
cat344OB1AmStSuTeSxCfNaCzGnAcCpint1,tet(A),tetD,strA,aac(6=)-lb-cr
Human12OB1AmStSuTeSxCmCfNaGnCpint1,catA1,tet(B),aadA1,strA,
aac(6=)-lb-cr
ConjE.coli
Dog141XB1AmSuTeSxCmCfNaGnCpint1,sul2,catA1,cml,tet(A),strA,
aac(6=)-lb-cr
ConjE.coli90,I1sul2
Dog153XB1AmSuTeSxCfNaGnCpsul1,tet(B),aac(6=)-lb-cr
Human15XAAmStSuTeSxCfNaGnCpint1,sul2,tet(B),aadA1,dhfr12,strA,
aac(6=)-lb-cr
ConjE.coli150,FIBint1,tet(B),
aac(6=)-lb-cr
2
a
Am,ampicilin;St,streptomycin;Su,sulfonamidecompounds;Te,tetracycline;Sx,trimethoprim-sulfamethoxazole;Cm,chloramphenicol;Cf,cephalotin;Na,nalidixicacid;Gn,gentamicin;Cp,ciprofloxacin;Cz,ceftazidime;Ac,
amoxycilin-clavulanate.
b
AllstrainsharboredtheblaCTX-M-15geneandtheblaOXA-1-likegene.int1isintegron1withdfrA17-aadA5genecassettes.
c
Plasmidcharacteristicsarestatedforthosetransformants/transconjugantswhichharboredoneplasmid.Conj,conjugation;Trans,transformation.
d
ArapalandGatabareclosetoeachother,sothesamplesweregroupedtogether.
Kenyan Dogs as Reservoirs of Resistant E. coli
July 2012 Volume 56 Number 7 aac.asm.org 4015
onJune19,2012byguesthttp://aac.asm.org/Downloadedfrom
the B2-O25-ST131 lineage. The genes blaCTX-M-15 and blaOXA-1-like
were found in all ESBL-producing E. coli isolates; all of these isolates
also tested positive for the gene aac-(6=)-Ib-cr, but none of
them had qnr genes. The upstream region of blaCTX-M-15 in all
ST131 isolates contained the transposase gene of the IS26 sequence.
All other isolates had the ISEcp1 insertion sequence upstream
from the blaCTX-M gene, but PCR for IS26 was negative.
Five distinct types of plasmids were detected: (i) a 90-kb plasmid
of incompatibility group I1 (IncI1), (ii) a 110-kb plasmid of group
IncFIB, (iii) a 150-kb plasmid of group IncFIB, (iv) a 150-kb plasmid
of group IncFIA and IncFIB (IncFIA/FIB), and (v) a 160-kb
plasmid of group IncFIA/FIB (Table 1). All these plasmids carried
the blaCTX-M-15 and aac(6=)-Ib-cr genes together with various
combinations of other resistance genes, dfrA17-aadA5, tet(B), or
catA1. Plasmids of the 160-kb, IncFIA/FIB, and identical EcoRV
profile carrying int1, tet(B), catA1, and aac(6=)-Ib-cr were found in
PFGE-unrelated isolates from dogs and a cat sampled in different
villages. The EcoRV restriction fragment length polymorphism
(RFLP) patterns of all IncF plasmids shared more than 85% similarity
(difference in up to five bands).
The findings of this study corroborate the recognized worldwide
spread of CTX-M-15-producing isolates, including the O25ST131
clone, even in very remote areas where extended spectrum
cephalosporins are used very rarely (9, 13, 16). The blaCTX-M-15
gene was found on large conjugative plasmids together with genes
encoding resistance to other groups of antibiotics. Such a genetic
constellation, along with the warm climate and lack of sanitary
facilities in rural Africa, probably facilitates the spread of multiresistant
bacteria and their transfer between humans and domestic
carnivores. The relatively lower resistance rates in isolates from
cats compared to the resistance rates in isolates from dogs could be
explained by the different foraging behaviors of the two species.
While cats may prefer hunting in the bush, dogs are probably
more reliant on household leftovers and more prone to
coprophagy. Such a scavenger strategy renders dogs good sentinels
of environmental contamination and suitable for monitoring
of local resistance patterns. Further studies are needed to specify
the role of livestock, the mainstay of nomadic pastoralist communities,
as well as omnipresent domestic rodents, in the epidemiology
of antibiotic-resistant bacteria.
ACKNOWLEDGMENTS
We acknowledge David Modry (UVPS Brno, CZ) and VSF-CZ, Margita
Fuchsova and the support provided by the Embassy of the Czech Republic
in Nairobi, Kenya, and Pavel Svec (MU Brno, CZ) and Pavel Alexa (VRI
Brno, CZ) for laboratory and analysis support.
The laboratory part of the study was funded by grant IGA 64/2010/
FVHE from the Internal Grant Agency of the University of Veterinary and
Pharmaceutical Sciences Brno, grant no. MSM6215712402 from the Ministry
of Education, Youth and Sports of the Czech Republic, and by the
project CEITEC (Central European Institute of Technology) (CZ.1.05/
1.1.00/02.0068) from the European Regional Development Fund.
REFERENCES
1. Barton BM, Harding GP, Zuccarelli AJ. 1995. A general method for
detecting and sizing large plasmids. Anal. Biochem. 226:235–240.
2. Bett B, Jost Cand Mariner J. 2008. Participatory investigation of important
animal health problems amongst the Turkana pastoralists: relative
incidence, impact on livelihoods and suggested interventions. Discussion
Paper No. 15. Targeting and Innovation. International Livestock Research
Institute, Nairobi, Kenya.
3. Caratolli A, et al. 2005. Identification of plasmids by PCR-based replicon
typing. J. Microbiol. Methods 63:219–228.
4. CDC. 2004. Standardized molecular subtyping of foodborne bacterial
pathogens by pulse-field gel electrophoresis. Centers for Disease Control,
Atlanta, GA.
FIG 1 Dendrogram of CTX-M-producing E. coli isolates’ PFGE profiles, generated
by cluster analysis of the Dice similarity indices in the BioNumerics fingerprinting
software (optimization 1%, band matching tolerance 1%, tolerance
change1%).Gat,Gatab;Loy,Loyiangalani;Gas,Gas;Ara,Arapal;SH,SouthHorr.
D, dog; H, human; C, cat.
Albrechtova et al.
4016 aac.asm.org Antimicrobial Agents and Chemotherapy
onJune19,2012byguesthttp://aac.asm.org/Downloadedfrom
5. Cleaveland S, Meslin FX, Breiman R. 2006. Dogs can play useful role as
sentinel hosts for disease. Nature 440:605.
6. Clermont O, Bonacorsi S, Bingen E. 2000. Rapid and simple determination
of Escherichia coli phylogenetic group. Appl. Environ. Microbiol. 66:
4555–4558.
7. Clermont O, et al. 2009. Rapid detection of the O25-ST131 clone of
Escherichia coli encompassing the CTX-M-15-producing strains. J. Antimicrob.
Chemother. 64:274–277.
8. CLSI. 2008. Performance standards for antimicrobial susceptibility testing,
18th informational supplement. CLSI document M100-S18. CLSI,
Wayne, PA.
9. Coque TM, et al. 2008. Dissemination of clonally related Escherichia coli
strains expressing extended-spectrum beta-lactamase CTX-M-15. Emerg.
Infect. Dis. 14:195–200.
10. Dolejska, M., et al. CTX-M-15-producing Escherichia coli clone B2O25b-ST131
and Klebsiella spp. in municipal wastewater treatment plant
effluents. J. Antimicrob. Chemother. 66:2784–2790.
11. Eckert C, Gautier V, Arlet G. 2006. DNA sequence analysis of the genetic
environment of various blaCTX-M genes. J. Antimicrob. Chemother. 57:
14–23.
12. Guardabassi L, Schwarz S, Lloyd DH. 2004. Pet animals as reservoirs of
antimicrobial-resistant bacteria. J. Antimicrob. Chemother. 54:321–332.
13. Hernandez J, et al. 2010. Globally disseminated human pathogenic Escherichia
coli of O25-ST131 clone, harboring blaCTX-M-15, found in glaucouswinged
gull at remote Commander Islands, Russia. Environ. Microbiol.
Rep. 2:329–332.
14. Literak I, et al. 2010. Antimicrobial-resistant faecal Escherichia coli in wild
mammals in central Europe: multiresistant Escherichia coli producing extended-spectrum
beta-lactamases in wild boars. J. Appl. Microbiol. 108:
1702–1711.
15. Olesen I, Hasman H, Aarestrup FM. 2004. Prevalence of beta-lactamases
among ampicillin-resistant Escherichia coli and Salmonella isolated from
food animals in Denmark. Microb. Drug Resist. 10:334–340.
16. Pallecchi L, et al. Rapid dissemination and diversity of CTX-M extendedspectrum
beta-lactamase genes in commensal Escherichia coli isolates
from healthy children from low-resource setting in Latin America. Antimicrob.
Agents Chemother. 51:2720–2725.
17. Wirth T, et al. 2006. Sex and virulence in Escherichia coli: an evolutionary
perspective. Mol. Microbiol. 60:1136–1151.
Kenyan Dogs as Reservoirs of Resistant E. coli
July 2012 Volume 56 Number 7 aac.asm.org 4017
onJune19,2012byguesthttp://aac.asm.org/Downloadedfrom
Příloha 12
DOLEJSKA, M., BRHELOVA, E., DOBIASOVA, H., KRIVDOVA, J., JURANKOVA J., SEVCIKOVA, A.,
DUBSKA, L., LITERAK, I., CIZEK, A., VAVRINA, M., KUTNIKOVA, L., STERBA, J., 2012, Dissemination
of IncFIIK-type plasmids in multiresistant CTX-M-15-producing Enterobacteriaceae isolates from
children in hospital paediatric oncology wards: International Journal of Antimicrobial Agents, v.
40, p. 510-515.
Souhrn
U dětí s nádorovým onemocněním hospitalizovaných na Klinice dětské onkologie byla po dobu osmi měsíců
sledována kolonizace GIT enterobakteriemi s produkcí ESBL. Byla provedena kompletní charakteristika
fenotypových a genotypových vlastností kmenů s cílem pochopit epidemiologii šíření producentů ESBL
u pacientů na klinice. Byla zjištěna přítomnost různých druhů enterobakterií, zejména K. pneumoniae, s betalaktamázou
CTX-M-15 a rezistencí k několika skupinám antimikrobiálních látek. Přenos multirezistentního
plazmidu IncFIIK mezi nepříbuznými bakteriemi a jejich udržování v souvislosti s empirickou terapii
cefalosporiny u onkologických pacientů představoval zásadní aspekt outbreaku.
International Journal of Antimicrobial Agents 40 (2012) 510–515
Contents lists available at SciVerse ScienceDirect
International Journal of Antimicrobial Agents
journal homepage: http://www.elsevier.com/locate/ijantimicag
Dissemination of IncFIIK-type plasmids in multiresistant CTX-M-15-producing
Enterobacteriaceae isolates from children in hospital paediatric oncology wards
Monika Dolejskaa,b,∗
, Eva Brhelovaa
, Hana Dobiasovaa
, Jana Krivdovaa
, Jana Jurankovac
,
Alena Sevcikovac
, Lenka Dubskad
, Ivan Literaka,b
, Alois Cizekb,e
, Martin Vavrinaf
,
Lucia Kutnikovaf
, Jaroslav Sterbaf
a
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences Brno,
Palackeho tr. 1/3, 612 42 Brno, Czech Republic
b
CEITEC VFU, University of Veterinary and Pharmaceutical Sciences Brno, Palackeho tr. 1/3, 612 42 Brno, Czech Republic
c
Department of Clinical Microbiology, The University Hospital Brno, Jihlavska 20, 625 00 Brno, Czech Republic
d
Department of Laboratory Medicine, Masaryk Memorial Cancer Institute, Brno, Zluty kopec 7, 656 53, Brno, Czech Republic
e
Institute of Microbiology and Infectious Diseases, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno,
Palackeho tr. 1/3, 612 42 Brno, Czech Republic
f
Paediatric Oncology Department, Clinic of Child Oncology, The University Hospital Brno, Cernopolni 212/9, 613 00 Czech Republic
a r t i c l e i n f o
Article history:
Received 23 May 2012
Accepted 19 July 2012
Keywords:
Antimicrobial resistance
ESBL
MLST
Children
Klebsiella spp.
Escherichia spp.
a b s t r a c t
In this study, extended-spectrum ␤-lactamase (ESBL)-producing Enterobacteriaceae isolates in children
with malignancies hospitalised at a paediatric oncology department in the Czech Republic were
investigated. From June 2009 to January 2010, a total of 50 ESBL-producing faecal isolates of Enterobacteriaceae
were obtained from 28 patients. These isolates were characterised with regard to ESBL enzymes,
plasmid-mediated quinolone resistance genes, multilocus sequence typing (MLST) and plasmids conferring
resistance to cephalosporins and fluoroquinolones. ESBL-producing isolates included Klebsiella
pneumoniae (n = 36), Escherichia coli (n = 7), Klebsiella oxytoca (n = 3), Enterobacter cloacae (n = 2) and Citrobacter
freundii (n = 2). Klebsiella pneumoniae isolates belonged to 7 MLST types, including sequence types
ST280, ST321, ST323 and ST416 as well as the novel types ST626, ST627 and ST628. The multiresistant
epidemic clone E. coli B2-O25b-ST131 was detected in one patient. The gene blaCTX-M-15 was found on
large conjugative IncFIIK plasmids along with blaTEM-1, blaOXA-1, qnrB1, aac(6 )-Ib-cr, strA, sul2, aac(3 )-II
and tet(A) genes in most isolates. Dissemination of IncFIIK plasmids among various Enterobacteriaceae
isolates was considered an important aspect of nosocomial colonisation in the wards by Enterobacteriaceae
species producing ESBLs. This is the first study documenting multiple antibiotic resistance elements,
including qnr genes, in IncFIIK plasmids in various bacterial species isolated in a single hospital department.
The results highlight the evolution of IncFIIK plasmids into new variants containing novel antibiotic
resistance elements and their important role in spreading ESBL-producing bacteria among hospitalised
patients.
© 2012 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
1. Introduction
Resistance in Enterobacteriaceae species to cephalosporins
owing to extended-spectrum ␤-lactamases (ESBLs) as well as
plasmid-mediated quinolone resistance (PMQR) has become a serious
public health problem in recent decades [1,2]. ESBL-producing
Klebsiella pneumoniae is one of the most common Gram-negative
bacteria showing multiple antibiotic resistance. This opportunistic
pathogen is responsible in particular for nosocomial infections in
∗ Corresponding author. Tel.: +420 54 1562 643; fax: +420 54 1562 631.
E-mail address: m.dolejska@centrum.cz (M. Dolejska).
Intensive Care Units and creates a major risk, especially to immunocompromised
patients treated in these wards [3,4].
Clonal dissemination of CTX-M-15-producing K. pneumoniae
has been observed in several countries [5,6]. Rapid international
spread of CTX-M-15 has been associated with the global dissemination
of Escherichia coli clones such as sequence type 131
(ST131) harbouring blaCTX-M-15 on IncFII conjugative plasmids
[7]. CTX-M-15-producers are commonly multiresistant to various
antibiotic agents such as fluoroquinolones, aminoglycosides and
sulphonamides [8].
The IncF plasmid family plays a major role in the dissemination
of antimicrobial resistance in Enterobacteriaceae. They contribute
to the fitness of their bacterial host by providing virulence and
antimicrobial resistance genes and show rapid evolution [9]. IncF
0924-8579/$ – see front matter © 2012 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
http://dx.doi.org/10.1016/j.ijantimicag.2012.07.016
M. Dolejska et al. / International Journal of Antimicrobial Agents 40 (2012) 510–515 511
plasmids are widely diffused in clinically relevant Enterobacteriaceae,
representing one of the most frequent plasmid types
[10]. Dissemination of genetic elements with blaCTX-M-15 between
Enterobacteriaceae species by conjugative transfer of IncFII plasmids
has been demonstrated [11].
Patients with neutropenia are at high risk of various infections.
Extended-spectrum ␤-lactam monotherapy alone or in combination
with aminoglycosides is generally accepted as the empirical
regimen for febrile neutropenia following chemotherapy for malignancy
[12]. Recently, we have experienced increased nosocomial
colonisation caused by ESBL-producing Enterobacteriaceae species
in paediatric oncology patients hospitalised in a regional hospital
in the Czech Republic. During an 8-month study period, ESBLproducing
bacteria in hospitalised children were characterised and
the spread of these epidemiologically important bacteria within a
hospital department was studied.
2. Materials and methods
2.1. Paediatric oncology department
The Paediatric Oncology Department of The University Hospital
Brno (Brno, Czech Republic) is a tertiary referral cancer centre
focused on treating patients with the entire spectrum of paediatric
malignancies. The hospital covers an area of 5 million inhabitants,
with 150 newly diagnosed cases of cancer among children and adolescents
annually and 2000 hospital admissions. The department
consists of three wards and 34 inpatient beds, with 10 private
rooms. Most patients were admitted for evaluation and management
of malignant diseases (chemotherapy administration, disease
staging and recovery after surgery). Hospitalisation of the studied
patients ranged from 1 day to 7 months, with a mean hospitalisation
length of 14 days. A total of 360 episodes of febrile neutropenia,
defined as an absolute neutrophil count of <0.5 × 109/l and fever,
are diagnosed and treated here each year.
For several years prior to the study period, the standard firstline
treatment for children admitted with neutropenic fever had
been piperacillin/tazobactam (TZP) in combination with aminoglycosides.
The frequency of ESBL-producing bacteria at the paediatric
oncology ward rapidly increased during 2008–2009 and resulted
in a prevalence of 47% of patients colonised with ESBL-producing
bacteria (Alena Sevcikova, The University Hospital Brno, Czech
Republic, unpublished data). A change in the treatment strategy
was made in July 2009 in consideration of an outbreak of serious
nosocomial infection caused by ESBL-producing strains in
hospitalised patients. The new treatment of choice was to use
carbapenems (meropenem or imipenem) in combination with
aminoglycosides or glycopeptides.
From June 2009 to January 2010, rectal swab samples from a
total of 148 patients were examined for carriage of ESBL-producing
strains. All clinically unstable patients newly admitted with febrile
neutropenia were tested for possible carriage of an ESBL-producer.
Some patients were thus screened repeatedly based on their
respective clinical scenario.
2.2. Isolation and determination of extended-spectrum
ˇ-lactamase-producing Enterobacteriaceae species and antibiotic
susceptibility testing
Samples were inoculated onto chromIDTM ESBL agar
(bioMérieux, Marcy l’Étoile, France) to isolate ESBL-producing
Enterobacteriaceae species. Single colonies showing different
colour and/or morphology were selected from each plate.
Bacterial identification was performed using the API 10S test
kit (bioMérieux). Isolates were tested for ESBL production by the
double-disk synergy test and for susceptibility to the following nine
antimicrobial agents by the disk diffusion method [13]: amikacin
(30 ␮g); amoxicillin/clavulanic acid (20/10 ␮g); chloramphenicol
(30 ␮g); gentamicin (10 ␮g); imipenem (10 ␮g); sulfamethoxazole/trimethoprim
(SXT) (1.25/23.7 ␮g); sulphonamide
compounds (300 ␮g); tetracycline (30 ␮g); and tobramycin
(10 ␮g). All isolated strains were examined for their minimum
inhibitory concentration (MIC) to ciprofloxacin, nalidixic acid and
colistin using the agar dilution method [13]. Identification of E. coli
phylogenetic groups was made by a multiplex PCR assay [14].
2.3. Antibiotic resistance gene testing
Using PCR and sequencing, ESBL-positive Enterobacteriaceae
isolates were tested for ESBL genes as well as PMQR genes (for list
of primers, see Supplementary Table S1).
Supplementary material related to this article can be found,
in the online version, at http://dx.doi.org/10.1016/j.ijantimicag.
2012.07.016.
2.4. Pulsed-field gel electrophoresis (PFGE) and multilocus
sequence typing (MLST) of Enterobacteriaceae species
All isolates were typed by XbaI PFGE [15]. Restriction profiles
of K. pneumoniae were analysed using BioNumerics fingerprinting
software (Applied Maths, Sint-Martens-Latem, Belgium). Cluster
analysis of the Dice similarity indices was done to generate a dendrogram
describing the relationships among PFGE profiles. Isolates
were considered to be related and to belong to the same PFGE
cluster if their Dice similarity indices were ≥80%. MLST of K. pneumoniae
strains was performed using the Institute Pasteur (Paris,
France) scheme [16]. Allele-specific PCR was performed to identify
the O25b-ST131 clone in E. coli isolates [17] and positive results
were confirmed by MLST (http://mlst.ucc.i.e./mlst/mlst/dbs/Ecoli,
accessed 16 June 2011).
2.5. Transferability of extended-spectrum ˇ-lactamase and
plasmid-mediated quinolone resistance genes and plasmid
characterisation
Conjugative transfer of ESBL genes was tested. Plate-mating
experiments were performed using plasmid-free, rifampicin- and
sodium-azide-resistant E. coli and Salmonella recipients. Transconjugants
were tested for the presence of ESBL and PMQR genes
found in original strains by PCR. Plasmid DNA from E. coli was isolated
by the alkaline extraction procedure [18] and was introduced
to competent E. coli DH5␣ (Invitrogen, Carlsbad, CA) by chemical
transformation followed by selection of transformants on
Luria–Bertani agar (Difco, Franklin Lakes, NJ) supplemented with
cefotaxime (2 mg/L). Presence of the relevant bla gene in transformants
and transconjugants was confirmed by PCR. Sizes of plasmids
with ESBL genes from donors and transformants were determined
by S1-PFGE [19]. Transformants with a single ESBL gene-harbouring
plasmid were used for further plasmid analysis. Plasmid DNA from
transformants was replicon-typed [10,20]. Plasmids belonging to
incompatibility group FIIK were typed using a replicon sequence
typing (RST) scheme [10]. The presence of additional antibiotic
resistance genes on the blaESBL-harbouring plasmids was tested by
PCR (Supplementary Table S1).
3. Results
3.1. Isolation of extended-spectrum ˇ-lactamase-producing
Enterobacteriaceae species and antibiotic susceptibility testing
During the 8-month sampling period from June 2009 to January
2010, a total of 50 ESBL-producing Enterobacteriaceae were
512 M. Dolejska et al. / International Journal of Antimicrobial Agents 40 (2012) 510–515
obtained from 28 children with cancer. A total of 26 patients
colonised with ESBL-producing Enterobacteriaceae species were
diagnosed with febrile neutropenia. Carbapenem (meropenem and
imipenem) monotherapy or a combination of carbapenem and
amikacin was used in 24 patients found to be colonised by an ESBLproducing
strain.
ESBL-producing strains included K. pneumoniae (n = 36 isolates),
E. coli (n = 7), Klebsiella oxytoca (n = 3), Enterobacter cloacae (n = 2)
and Citrobacter freundii (n = 2). All of the ESBL isolates were multiresistant,
with resistance to five to nine antimicrobial agents tested.
Additional resistance to sulphonamides (96%), SXT (86%), tetracycline
(78%), tobramycin (75%), gentamicin (69%), chloramphenicol
(10%), amikacin (4%) and imipenem (2%) were found. All isolates
(100%) and 80% of isolates were resistant to nalidixic acid and
ciprofloxacin, respectively. MICs varied from 32 mg/L to >256 mg/L
for nalidixic acid and from 0.128 mg/L to >8 mg/L for ciprofloxacin.
All isolates were susceptible to colistin (MIC ≤ 2 mg/L).
3.2. Antibiotic resistance genes and replicons in
extended-spectrum ˇ-lactamase-producing Enterobacteriaceae
species
The ESBL phenotype was caused by the presence of the gene
blaCTX-M-15 in most isolates (Fig. 1; Table 1). This gene was detected
in 38 Enterobacteriaceae (76%). The genes blaSHV-2, blaSHV-12 or
blaCTX-M-2 were found in other isolates (data not shown). A total of
35 isolates carried both the qnrB1 and aac(6 )-Ib-cr genes. Plasmids
of incompatibility group FIIK were the most prevalent replicons
found in 42 isolates. Plasmids of incompatibility groups FIB, P, I1,
L/M or X1 were also found (Tables 1 and 2).
Fig. 1. Characterisation of extended-spectrum ␤-lactamase (ESBL)-producing Klebsiella pneumoniae isolates from hospitalised children with malignancies. The dendrogram
was obtained by cluster analysis of pulsed-field gel electrophoresis (PFGE) profiles of ESBL-producing K. pneumoniae isolates. Isolates were considered to be related and
belong to the same PFGE cluster if their Dice similarity indices were ≥80%. Patients with multiple ESBL-producing Enterobacteriaceae isolates are highlighted in bold and
underlined. ST, sequence type; PMQR, plasmid-mediated quinolone resistance. a
IncFIIK identified in transformants; plasmid type is based on antibiotic resistance genes
content and size (see Section 3.5 and Table 2).
M. Dolejska et al. / International Journal of Antimicrobial Agents 40 (2012) 510–515 513
Table 1
Characterisation of extended-spectrum ␤-lactamase (ESBL)-producing Enterobacteriaceae isolates from hospitalised children with malignancies.
Species Strain/patienta
Date ESBL PG/ST PFGE
profile
Plasmid Inc
group
PMQR genes ESBL/PMQR plasmid transferred
qnrB1 aac(6 )-Ib-cr Inc AR genes on plasmidb
Escherichia coli 1 H Dec. 09 SHV-12 B1 a FIB, L/M − − L/M blaSHV-12, strA, sul2
10 I Aug. 09 CTX-M-15 B2/ST131 b FIIK + − FIIK (type F) blaCTX-M-15
b1
37 W Dec. 09 CTX-M-2 D c P, FIB − − P blaCTX-M-2, strA, sul2, tet(A)
47 CC Jan. 10 CTX-M-15 A d FIIK + +
48 W Jan. 10 CTX-M-2 D c P, FIB, X1 − − P blaCTX-M-2, strA, sul2, tet(A)
53 T Jan. 10 CTX-M-15 A e FIIK + +
57 T Jan. 10 SHV-12 D f I1 − −
Enterobacter cloacae 14 M Aug. 09 CTX-M-15 nt g – + + NT blaCTX-M-15
b2
40 Z Dec. 09 CTX-M-15 nt h FIIK + + FIIK (type A) blaCTX-M-15
b3
Citrobacter freundii 28 K Dec. 09 CTX-M-15 nt i FIIK + −
32 K Dec. 09 CTX-M-15 nt i FIIK + +
Klebsiella oxytoca 24 R Nov. 09 CTX-M-15 nt k FIIK + +
50 R Jan. 10 CTX-M-15 nt k FIIK + +
51 R Jan. 10 CTX-M-15 nt k FIIK + +
PG, phylogenetic group; ST, sequence type by multilocus sequence typing; PFGE, pulsed-field gel electrophoresis; Inc, incompatibility; PMQR, plasmid-mediated quinolone
resistance; AR, antibiotic resistance; nt, not tested; NT, non-typeable.
a
Patients with multiple ESBL-producing Enterobacteriaceae isolates are highlighted in bold.
b
Additional antibiotic resistance genes were found: b1
blaTEM-1, qnrB1, strA, sul2, aac(3 )-II; b2
blaTEM-1, blaOXA-1, qnrB1, aac(6 )-Ib-cr, aac(3 )-II, strA, sul2, catA1; b3
blaTEM-1,
blaOXA-1, qnrB1, aac(6 )-Ib-cr, aac(3 )-II, strA, sul2, tet(A).
Table 2
Characterisation of IncFIIK plasmids in transformants obtained from Enterobacteriaceae species isolates from hospitalised children with malignancies.
IncFIIK type Size (kb) ␤-Lactamases PMQR genes Additional AR genes Species or ST No. of isolates
CTX-M-15 TEM-1 OXA-1 aac(6 )-Ib-cr qnrB1 strA sul2 tet (A) aac(3 )-II
A 120 + + + + + + + + + Klebsiella pneumoniae ST416 6
+ + + + + + + + + K. pneumoniae ST321 2
+ + + + + + + + + K. pneumoniae ST280 1
+ + + + + + + + + K. pneumoniae ST628 1
+ + + + + + + + + Enterobacter cloacae 1
B 100 + + + + − + + − + K. pneumoniae ST280 1
C 120 + + + + + + + + − K. pneumoniae ST626 3
D 100 − − + + + − − − + K. pneumoniae ST323 3
K. pneumoniae ST627 1
E 220 + + + + + + + + + K. pneumoniae ST416 1
F 100 + + − − + + + − + Escherichia coli B2-O25b-ST131 1
PMQR, plasmid-mediated quinolone resistance; AR, antibiotic resistance; ST, sequence type.
3.3. Pulsed-field gel electrophoresis and multilocus sequence
typing of Enterobacteriaceae species
Cluster analysis of macrorestriction patterns obtained by XbaI
PFGE analysis was performed on 36 K. pneumoniae isolates. The isolates
were divided into seven clusters based on their XbaI restriction
profiles. Isolates clustering together by PFGE analysis also showed
an identical MLST type (Fig. 1). Seven MLST types were found:
ST280 (3 isolates); ST321 (5); ST323 (7); ST416 (9); and novel
types ST626 (3), ST627 (7) and ST628 (2). Klebsiella pneumoniae
isolates of ST321, ST323 and ST416 were isolated from different
patients during the 8-month sampling period (Fig. 1). Seven E. coli
isolates showed six different PFGE profiles (Fig. 1). The multiresistant
highly virulent epidemic E. coli B2-O25b-ST131 clone with
CTX-M-15 was detected by PCR and MLST in one patient. Both
E. cloacae strains isolated from different patients showed <65%
band similarity, whereas two C. freundii from patient K and three
K. oxytoca from patient R had identical PFGE profiles (data not
shown).
Only in one patient, was more than one ESBL-producing isolate
of different species obtained from one rectal swab (Fig. 1;
Table 1) (patient K, strains 27, 28, 30 and 32). Nine patients
were sampled on more than one occasion during one to three
single hospitalisations (highlighted patients in Fig. 1; Table 1;
Supplementary Table S2). In five patients with multiple hospitalisations
during the study period, different ESBL-producing clones were
isolated during each single hospitalisation incident (patients D, K, T,
H and N). On the other hand, the same ESBL-producing strains were
observed in four patients (K, L, T and R) during two or three separate
hospitalisations with up to 3-month intervals between each of
them.
Supplementary material related to this article found, in
the online version, at http://dx.doi.org/10.1016/j.ijantimicag.
2012.07.016.
3.4. Conjugative transfer of blaESBL genes carrying plasmids
Conjugative transfer of ESBL plasmids to E. coli and/or Salmonella
was demonstrated in 27 Enterobacteriaceae isolates (54%). Conjugative
transfer of ESBL plasmids was more frequent in K.
pneumoniae (transfer demonstrated in 61% of isolates) than
in other Enterobacteriaceae species (33%). ESBL plasmids were
transferred more to E. coli (47%) than to Salmonella (20%).
Resistance to other antibiotic agents (quinolones, aminoglycosides,
sulphonamides, tetracycline and SXT) was transferred along
with ESBL genes, and IncFIIK plasmids were found in most
transconjugants.
514 M. Dolejska et al. / International Journal of Antimicrobial Agents 40 (2012) 510–515
3.5. Molecular characterisation of plasmids belonging to
incompatibility group FIIK
A total of 26 ESBL/PMQR-harbouring plasmids (IncFIIK, IncP and
IncL/M) were obtained from transformants for further characterisation.
The IncFIIK plasmid was found in 22 transformants (Table 2).
Sequences of the copA gene of all IncFIIK plasmids were identical
and showed allele type 7 (http://pubmlst.org/plasmid/, accessed
14 May 2012) establishing the RST formula K7:A-:B-. In 11 transformants
of different species and K. pneumoniae sequence types,
blaCTX-M-15 was found on 120-kb conjugative plasmids along with
blaTEM-1, blaOXA-1, qnrB1, aac(6 )-Ib-cr, aac(3 )-II, strA, sul2 and tet(A)
(Table 2, plasmid type A). IncFIIK plasmids with differences in size
(100 kb and 220 kb) and antibiotic resistance genes were found in
the isolates (Table 2).
3.6. Molecular characterisation of extended-spectrum
ˇ-lactamase plasmids of other incompatibility groups
Transformation of six single ESBL-harbouring non-IncFIIK plasmids
into E. coli recipient cells was performed. In transformants
from both E. coli isolates with blaCTX-M-2, the blaCTX-M-2 gene was
found on an 80-kb non-conjugative IncP plasmid along with the
strA, sul2 and tet(A) genes. One transformant from E. coli positive
for blaSHV-12 was carried by a conjugative IncL/M plasmid. One nontypeable
conjugative 140-kb plasmid from E. cloacae was detected.
This plasmid carrying blaCTX-M-15 contained antibiotic resistance
genes also found in most IncFIIK plasmids in addition to the catA1
gene conferring chloramphenicol resistance and that was not found
in other FIIK plasmids.
4. Discussion
Klebsiella pneumoniae producing CTX-M-15 is responsible for
nosocomial infections [3,21]. In this study, the blaCTX-M-15 gene was
found in 76% of Enterobacteriaceae isolates, mainly identified as
K. pneumoniae. Carbapenems are the most commonly used antibiotics
in the treatment of hospital-acquired infections caused by
multiresistant K. pneumoniae strains. However, the risk of selection
and dissemination of carbapenemase-producing strains has
to be considered when applying antibiotic strategies and policy
in a hospital ward. Colonisation usually precedes infection, and
massive colonisation is therefore considered a risk factor for bacteraemia
in cancer patients. An empirical therapeutic regimen
combining carbapenems and aminoglycosides (amikacin) has been
efficiently used in children with febrile neutropenia hospitalised in
the paediatric oncology department during the period of this study.
No carbapenemase-producing bacteria were found in hospitalised
patients (data not shown). The prevalence of ESBL-producing bacteria
after changing the first-line antibacterial therapy from TZP
in combination with aminoglycosides decreased markedly during
January 2010 to September 2011 from 47% to 22% of patients
colonised by ESBL-producing bacteria (data not shown).
Cluster analysis and MLST of K. pneumoniae isolates showed
the dissemination of four major clonal groups in different hospitalised
patients (ST321, ST323, ST416 and ST627). Predominance of
the four main STs of K. pneumoniae isolates sustains the hypothesis
of clonal dissemination by patient-to-patient transmission.
Different ESBL-producing strains found in the same patient can
be assigned to horizontal transfer of ESBL-harbouring plasmids
between different bacterial strains in the patient’s intestinal flora,
as has been previously demonstrated [4]. Analysis of plasmid
content in the CTX-M-15-producing isolates in the current study
showed that horizontal gene transfer by IncFIIK plasmid exchange
was more probably involved in the dissemination of CTX-M-15
than was single dissemination of particular clones. Plasmids of
incompatibility group F are among the most prevalent antibiotic
resistance plasmids in Enterobacteriaceae species [10]. Plasmids
of the incompatibility group FII were identified as the main vehicles
of blaCTX-M-15 in E. coli and K. pneumoniae, as well as for other
antibiotic genes conferring resistance to tetracyclines, aminoglycosides
and fluoroquinolones present on IncFII plasmids along with
ESBL genes [4,11,22]. Most of the K. pneumoniae isolates as well
as other Enterobacteriaceae isolates, including multiresistant epidemiological
clone E. coli B2-O25b-ST131, in this study harboured
large IncFIIK plasmids with multiple antibiotic resistance genes and
showed conjugative ability to E. coli as well as Salmonella. All of the
IncFIIK plasmids obtained from transformants showed the same
RST formula K7:A:-B:, including the ST131 clone. Differences in
size of IncFIIK plasmids (100–220 kb) and various sets of antibiotic
resistance genes suggest their strong ability for gene rearrangements
and evolution into new variants as described elsewhere
[4,10].
Genetic linkage of three ␤-lactamase genes, blaCTX-M-15, blaTEM-1
and blaOXA-1, as well as additional antibiotic resistance genes such
as aac(6 )-Ib-cr, aac(3 )-II and tet(A) also found in most IncFIIK
plasmids in this study, has been previously described in plasmids
pEK499 and pEK516 isolated in the UK from the E. coli ST131
clone and in the pC15-1a plasmid disseminating in E. coli clones
in Canada [23,24]. All of the plasmids contain a multidrug resistance
region (MRR) with the antibiotic resistance genes mentioned
above. Recently, this MRR typical for E. coli ST131 FII plasmids was
found in the 220-kb IncFIIK plasmid pUUH239.2 [4]. This plasmid
was found to be disseminated in K. pneumoniae ST16 during a hospital
nosocomial outbreak in Sweden. We hypothesise that this MRR
is also present in the IncFIIK plasmids found in this study, but further
mapping of this MRR is needed. The current results confirm
the great variability of IncFIIK plasmids and their ability to change
rapidly in time to acquire various antimicrobial gene content by
acquisition of resistance determinants.
The IncFIIK plasmids identified in Klebsiella are mostly considered
as virulence plasmids with the ability to co-exist with other
IncFII plasmids in a single cell [10], and their association with such
antibiotic resistance genes as blaCTX-M-15 has been documented
[25]. Recently, these plasmids with identical antibiotic resistance
gene content size (120 kb) were identified in three K. pneumoniae
ST321 and ST323 isolates from a wastewater treatment plant in
Brno, Czech Republic [26]. It seems that these IncFIIK plasmids
are becoming important vehicles of multiple antibiotic resistance
genes, including blaCTX-M-15 in K. pneumoniae, and they have the
ability to disseminate to, and persist within, other Enterobacteriaceae
species, including the multiresistant epidemiological clone
E. coli B2-O25b-ST131. Additional studies on IncFIIK plasmids
encoding CTX-M-15 from other geographical areas as well as
plasmid comparison studies are warranted in order to reveal the
mechanism driving the success in spreading these MRR plasmids.
Acknowledgments
The authors would like to thank Eva Suchanova and Marie
Slavikova for excellent laboratory co-operation. Thanks go to Henrik
Hasman and Lina Cavaco from the National Food Institute
(Copenhagen, Denmark) for positive control strains. The authors
also thank Alessandra Carattoli (Istituto Superiore di Sanità, Rome,
Italy) for providing the positive control strains and for help with
replicon typing, as well as Pavel Svec (Czech Collection of Microorganisms,
Masaryk University, Brno, Czech Republic) for help with
PFGE analysis, and Sebastian Guenther (Institute of Microbiology
and Epizootics, Veterinary Faculty, Free University Berlin,
Germany) for MLST analysis of an isolate of E. coli B2-O25bST131.
This publication made use of the Plasmid Multi Locus
M. Dolejska et al. / International Journal of Antimicrobial Agents 40 (2012) 510–515 515
Sequence Typing website (http://pubmlst.org/plasmid/, accessed
28 November 2011) developed by Keith Jolley and sited at the
University of Oxford (Oxford, UK).
Funding: This study was supported by the Ministry of Education,
Youth and Sports of the Czech Republic (MSM6215712402 and
MSM6198959223); the Czech Science Foundation (P502/10/P083);
and the European Regional Development Fund and state budget
of the Czech Republic for ‘CEITEC—Central European Institute of
Technology’ (CZ.1.05/1.1.00/02.0068) and for ‘RECAMO—Regional
Centre for Applied Molecular Oncology’ (CZ.1.05/2.1.00/03.0101).
Competing interests: None declared.
Ethical approval: Not required.
References
[1] Oteo J, Pérez-Vázquez M, Campos J. Extended-spectrum ␤-lactamase producing
Escherichia coli: changing epidemiology and clinical impact. Curr Opin Infect Dis
2010;23:320–6.
[2] Strahilevitz J, Jacoby GA, Hooper DC, Robicsek A. Plasmid-mediated quinolone
resistance: a multifaceted threat. Clin Microbiol Rev 2009;22:664–89.
[3] Ruiz E, Rojo-Bezares B, Sáenz Y, Olarte I, Esteban I, Rocha-Gracia R, et al. Outbreak
caused by a multi-resistant Klebsiella pneumoniae strain of new sequence
type ST341 carrying new genetic environments of aac(6 )-Ib-cr and qnrS1 genes
in a neonatal intensive care unit in Spain. Int J Med Microbiol 2010;300:
464–9.
[4] Sandegren L, Linkevicius M, Lytsy B, Melhus Å, Andersson DI. Transfer of
an Escherichia coli ST131 multiresistance cassette has created a Klebsiella
pneumoniae-specific plasmid associated with a major nosocomial outbreak. J
Antimicrob Chemother 2012;67:74–83.
[5] Damjanova I, Tóth A, Pászti J, Hajbel-Vékony G, Jakab M, Berta J, et al. Expansion
and countrywide dissemination of ST11, ST15 and ST147 ciprofloxacinresistant
CTX-M-15-type ␤-lactamase-producing Klebsiella pneumoniae epidemic
clones in Hungary in 2005—the new ‘MRSAs’? J Antimicrob Chemother
2008;62:978–85.
[6] Mugnaioli C, Luzzaro F, De Luca F, Brigante G, Perilli M, Amicosante G, et al.
CTX-M-type extended-spectrum ␤-lactamases in Italy: molecular epidemiology
of an emerging countrywide problem. Antimicrob Agents Chemother
2006;50:2700–6.
[7] Peirano G, Pitout JD. Molecular epidemiology of Escherichia coli producing
CTX-M ␤-lactamases: the worldwide emergence of clone ST131 O25:H4. Int
J Antimicrob Agents 2010;35:316–21.
[8] Nicolas-Chanoine MH, Blanco J, Leflon-Guibout V, Demarty R, Alonso MP,
Canic¸ a MM, et al. Intercontinental emergence of Escherichia coli clone O25:H4ST131
producing CTX-M-15. J Antimicrob Chemother 2008;61:273–81.
[9] Johnson TJ, Nolan LK. Pathogenomics of the virulence plasmids of
Escherichia coli. Microbiol Mol Biol Rev 2009;73:750–4.
[10] Villa L, García-Fernández A, Fortini D, Carattoli A. Replicon sequence typing
of IncF plasmids carrying virulence and resistance determinants. J Antimicrob
Chemother 2010;65:2518–29.
[11] Novais A, Cantón R, Moreira R, Peixe L, Baquero F, Coque TM. Emergence and
dissemination of Enterobacteriaceae isolates producing CTX-M-1-like enzymes
in Spain are associated with IncFII (CTX-M-15) and broad-host-range (CTX-M-
1, -3, and -32) plasmids. Antimicrob Agents Chemother 2007;51:796–9.
[12] Maschmeyer G, Hiddemann W, Link H, Cornely OA, Buchheidt D, Glass B, et al.
Management of infections during intensive treatment of hematologic malignancies.
Ann Hematol 1997;75:9–16.
[13] Clinical and Laboratory Standards Institute. Performance standards for antimicrobial
susceptibility testing; eighteenth informational supplement. Document
M100-S18. Wayne, PA: CLSI; 2008.
[14] Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of
Escherichia coli phylogenetic group. Appl Environ Microbiol 2000;66:4555–8.
[15] PulseNet USA. One-day (24–28 h) standardized laboratory protocol for
molecular subtyping of Escherichia coli O157:H7, non-typhoidal Salmonella
serotypes, and Shigella sonnei by pulsed field gel electrophoresis (PFGE).
http://www.cdc.gov/pulsenet/protocols/ecoli salmonella shigella protocols.pdf
[accessed 01.05.08].
[16] Diancourt L, Passet V, Verhoef J, Grimont PA, Brisse S. Multilocus sequence
typing of Klebsiella pneumoniae nosocomial isolates. J Clin Microbiol
2005;43:4178–82.
[17] Clermont O, Dhanji H, Upton M, Gibreel T, Fox A, Boyd D, et al. Rapid detection
of the O25b-ST131 clone of Escherichia coli encompassing the CTX-M-15producing
strains. J Antimicrob Chemother 2009;64:274–7.
[18] Birnboim HC, Doly J. A rapid alkaline extraction procedure for screening recombinant
plasmid DNA. Nucleic Acids Res 1979;7:1513–23.
[19] Barton BM, Harding GP, Zuccarelli AJ. A general method for detecting and sizing
large plasmids. Anal Biochem 1995;226:235–40.
[20] Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ. Identification of
plasmids by PCR-based replicon typing. J Microbiol Methods 2005;63:219–28.
[21] Abbassi MS, Torres C, Achour W, Vinué L, Sáenz Y, Costa D, et al. Genetic characterisation
of CTX-M-15-producing Klebsiella pneumoniae and Escherichia coli
strains isolated from stem cell transplant patients in Tunisia. Int J Antimicrob
Agents 2008;32:308–14.
[22] Krol JE, Nguyen HD, Rogers LM, Beyenal H, Krone SM, Top EM. Increased transfer
of a multidrug resistance plasmid in Escherichia coli biofilms at the air–liquid
interface. Appl Environ Microbiol 2011;77:5079–88.
[23] Woodford N, Carattoli A, Karisik E, Underwood A, Ellington MJ, Livermore DM.
Complete nucleotide sequences of plasmids pEK204, pEK499, and pEK516,
encoding CTX-M enzymes in three major Escherichia coli lineages from the
United Kingdom, all belonging to the international O25:H4-ST131 clone.
Antimicrob Agents Chemother 2009;53:4472–82.
[24] Boyd DA, Tyler S, Christianson S, McGeer A, Muller MP, Willey BM, et al. Complete
nucleotide sequence of a 92-kilobase plasmid harboring the CTX-M-15
extended-spectrum ␤-lactamase involved in an outbreak in long-term-care
facilities in Toronto, Canada. Antimicrob Agents Chemother 2004;48:3758–64.
[25] Coelho A, González-López JJ, Miró E, Alonso-Tarrés C, Mirelis B, Larrosa MN,
et al. Characterisation of the CTX-M-15-encoding gene in Klebsiella pneumoniae
strains from the Barcelona metropolitan area: plasmid diversity and chromosomal
integration. Int J Antimicrob Agents 2010;36:73–8.
[26] Dolejska M, Frolkova P, Florek M, Jamborova I, Purgertova M, Kutilova I,
et al. CTX-M-15-producing Escherichia coli clone B2-O25b-ST131 and Klebsiella
spp. isolates in municipal wastewater treatment plant effluents. J Antimicrob
Chemother 2011;66:2784–90.
Příloha 13
LITERAK, I., MICUDOVA, M., TAUSOVA, D., CIZEK, A., DOLEJSKA, M., PAPOUSEK, I., PROCHAZKA,
J., VOJTECH, J., BORLEIS, F., GUARDONE, L., GUENTHER, S., HORDOWSKI, J., LEJAS, C., MEISSNER,
W., MARCOS, BF., TUCAKOV, M., 2012, Plasmid-mediated quinolone resistance genes in fecal
bacteria from rooks commonly wintering throughout Europe: Microbial Drug Resistance, v. 18,
p. 567-573.
Souhrn
Byl sledován výskyt enterobakterií s plazmidově determinovanou rezistencí k fluorochinolonům v trusu
havranů polních na devíti evropských zimovištích. Třetina vzorků obsahovala enterobakterie s PMQR geny
různých variant s dominancí qnrS1. Byly zjištěny významné rozdíly v prevalenci PMQR pozitivních kmenů mezi
jednotlivými lokalitami, které se pohybovaly v rozmezí 3-92 %. Jako migrující ptáci mohou havrani šířit bakterie
s klinicky významnou rezistencí k fluorochinolonům na dlouhé vzdálenosti.
Plasmid-Mediated Quinolone Resistance
Genes in Fecal Bacteria from Rooks Commonly
Wintering Throughout Europe
Ivan Literak,1,2
Maria Micudova,1
Dagmar Tausova,1
Alois Cizek,2,3
Monika Dolejska,1,2
Ivo Papousek,1
Jakub Prochazka,1
Jiri Vojtech,1
Frank Borleis,4
Lisa Guardone,5
Sebastian Guenther,6
Jozef Hordowski,7
Cyrille Lejas,8
Wlodzimierz Meissner,9
Benito Fuertes Marcos,10
and Marko Tucakov11
This study concerned the occurrence of fecal bacteria with plasmid-mediated quinolone resistance (PMQR) genes
in rooks (Corvus frugilegus, medium-sized corvid birds) wintering in continental Europe during winter 2010/
2011. Samples of fresh rook feces were taken by cotton swabs at nine roosting places in eight European countries.
Samples were transported to one laboratory and placed in buffered peptone water (BPW). The samples from
BPW were enriched and subcultivated onto MacConkey agar (MCA) supplemented with ciprofloxacin
(0.06 mg/L) to isolate fluoroquinolone-resistant bacteria. DNA was isolated from smears of bacterial colonies
growing on MCA and tested by PCR for PMQR genes aac(6¢)-Ib, qepA, qnrA, qnrB, qnrC, qnrD, qnrS, and oqxAB.
All the PCR products were further analyzed by sequencing. Ciprofloxacin-resistant bacteria were isolated from
37% (392 positive/1,073 examined) of samples. Frequencies of samples with ciprofloxacin-resistant isolates
ranged significantly from 3% to 92% in different countries. The qnrS1 gene was found in 154 samples and qnrS2
in 2 samples. The gene aac(6¢)-Ib-cr was found in 16 samples. Thirteen samples were positive for qnrB genes in
variants qnrB6 (one sample), qnrB18 (one), qnrB19 (one), qnrB29 (one), and qnrB49 (new variant) (one). Both the
qnrD and oqxAB genes were detected in six samples. The genes qnrA, qnrC, and qepA were not found. Wintering
omnivorous rooks in Europe were commonly colonized by bacteria supposedly Enterobacteriaceae with PMQR
genes. Rooks may disseminate these epidemiologically important bacteria over long distances and pose a risk for
environmental contamination.
Introduction
The second generation of quinolones (fluoroquinolones)
are commonly used in antimicrobial treatment
in both human and veterinary medicine worldwide,
including Europe. With the continuing development of new
quinolone congeners with expanded clinical indications reflecting
an expanding antibacterial spectrum for some
members of the fluoroquinolones, understanding as to limitations
posed by the occurrence of bacterial resistance to
fluoroquinolones is of increasing importance.17
Plasmidmediated
quinolone resistance (PMQR) was identified in
Enterobacteriaceae bacteria for the first time in 1998.31
Wild bird populations sympatric to areas inhabited by
people and areas with high density of livestock have been
colonized with antibiotic-resistant strains that probably have
1
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical
Sciences Brno, Brno, Czech Republic.
2
CEITEC VFU, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republic.
3
Department of Microbiology and Immunology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences
Brno, Brno, Czech Republic.
4
Bern, Switzerland.
5
Department of Animal Pathology, Faculty of Veterinary Medicine, University of Pisa, Pisa, Italy.
6
Institute of Microbiology and Epizootics, Veterinary Faculty, Free University Berlin, Berlin, Germany.
7
Arboretum i Zaklad Fizjografii w Bolestraszycach, Przemysl, Poland.
8
Federation Departementale de Lutte contre les Organismes Nuisibles d’Ille et Vilaine (FEVILDEC), ZAC Atalante Champeaux, Rennes,
France.
9
Avian Ecophysiology Unit, Department of Vertebrate Ecology and Zoology, Gdansk University, Gdansk, Poland.
10
Department of Zoology, Faculty of Biology, University of Leon, Leon, Spain.
11
Institute for Nature Conservation of Vojvodina Province, Novi Sad, Serbia.
MICROBIAL DRUG RESISTANCE
Volume 18, Number 6, 2012
ª Mary Ann Liebert, Inc.
DOI: 10.1089/mdr.2012.0075
567
been selected by antibiotic practice in humans and domestic
animals. Antibiotic-resistant Escherichia coli isolates have
been found in various corvids, including rooks (Corvus corone,
C. frugilegus, C. macrorhynchos, Pica pica, and Pyrrhocorax
pyrrhocorax).3,27,28,32,41
Corvids and gulls feeding on garbage
dumps in urbanized areas are frequently colonized with
antibiotic-resistant strains of E. coli and they are considered
to be important reservoirs and vectors of these isolates in the
environment.
The rook (Corvus frugilegus) is a migrating omnivorous
corvid with Palearctic distribution.12
Large numbers of these
birds regularly winter in central and western Europe. Rooks
winter mostly in lowlands and they traditionally keep gregarious
roosting places. Rooks leave their roosting places
during the day to search for food, usually within 10–25 km
around their roosting places. In the past, rooks migrated for
the winter so far as to such south European countries as Italy
and Spain.4,39
Today, wintering rooks are rare in Italy and
only a small sedentary population of rooks winters in Spain.
The origin of those rooks wintering still in huge numbers in
both central and western parts of continental Europe is
mostly in eastern Europe—Russia, Belorussia, and Ukraine.
Wintering rooks in central Europe can serve as reservoirs
and vectors of E. coli and Salmonella isolates resistant to oldgeneration
antibiotics and potentially can transmit these
isolates over long distances during their migrations.27
This study concerned bacterial strains resistant to fluoroquinolones,
as such strains have emerged recently in gulls
in Italy, Portugal, Greenland, and the Czech Republic.5,10,15,42
PMQR in E. coli isolates from wild birds has been reported
very recently for mallards (Anas platyrhynchos), herring gulls
(Larus argentatus), and great cormorants (Phalacrocorax carbo)
in Poland and Czech Republic.26,45
Given the scavenging diet
of rooks in winter and the long distances traveled, it may be
postulated that rooks could be important vectors for disseminating
bacteria with PMQR throughout Europe.
Materials and Methods
Rooks examined
Samples of rook feces were taken in roosting places
throughout Europe during winter 2010/2011, except for
France, where samples were collected on 8 April 2011 (Fig.
1). The roosts were used by hundreds or thousands of rooks
together with various numbers of other corvids, such as
jackdaws (C. monedula) or crows (C. corone and C. cornix).
Fecal samples were collected at each location only once. They
were picked up individually in the morning from a large
plastic film exposed overnight on the ground beneath the
roosting place. Rooks were dropping on the film during the
evening when they arrived to the roosting place and in early
morning when leaving the location. Samples were collected
in the Czech Republic (Prerov, 49°28¢ N, 17°27¢ E, 12 December
2010, 150 samples), France (Pire sur Seiche, 48°00¢ N,
1°25¢ W, 8 April 2011, 31 samples), Germany (Wilhelmshaven,
53°32¢ N, 8°04¢ E, 5 February 2011, 100 samples),
Italy (San Benedetto Po, 45°2¢ N, 10°55¢ E, 27 February 2011,
150 samples), Poland (Gdynia and near vicinity, 54°31¢ N,
FIG. 1. Map of Europe indicating where fecal samples from rooks (Corvus frugilegus) were collected during winter 2010/
2011. Full circles indicate locations of sampling. At each location, the number of samples collected is presented in parentheses.
568 LITERAK ET AL.
18°33¢ E, 2–7 February 2011, 150 samples), Poland (Jaroslaw,
50°00¢ N, 22°41¢ E, 9 February 2011, 150 samples), Spain (La
Baneza, 42°18¢ N, 5°54¢ W, 4 February 2011, 150 samples,
sedentary population), Serbia (Novi Sad, 45°14¢ N, 19°51¢ E,
17 January 2011, 150 samples), and Switzerland (Bern, 46°56¢
N, 7°26¢ E, 8 February 2011, 49 samples).
Bacteriological examinations and DNA
analyses for detecting PMQR
Samples from fresh feces were taken by cotton swabs that
were then transported in Amies transport medium to the
laboratory and pre-enriched overnight in buffered peptone
water (BPW) at 37°C. The samples from BPW were selectively
enriched in MacConkey broth and subcultivated onto
MacConkey agar (MCA) supplemented with ciprofloxacin
(0.06 mg/L) to isolate fluoroquinolone-resistant en-
terobacteria.
DNA was isolated from smears of bacterial colonies
growing on MCA with ciprofloxacin (one smear from one
rook sample). The DNA from these colonies was tested by
PCR for PMQR genes aac(6¢)-Ib, qepA, qnrA, qnrB, qnrC, qnrD,
qnrS, and oqxAB (Table 1).7,9,23,24,35,36,38,47
All the PCR
products were further analyzed by sequencing (ABI 310
Genetic Analyzer, Applied Biosystems).
In each case of a sample where new variants of PMQR
genes might possibly appear, a smear of unidentified bacteria
from each sample was frozen at - 80°C for later bacterial
species determination. In such case, the bacteria were cultivated
on MCA supplemented with ciprofloxacin (0.06 mg/L)
and subsequently identified using the API 20E system (bio-
Merieux).
Results
In total, 1,073 samples of rook feces were collected.
Ciprofloxacin-resistant bacteria supposedly Enterobacteriaceae
were isolated from 392 (37%) samples (Table 2). Proportions
of samples with bacteria resistant to ciprofloxacin ranged
greatly—from 3% to 92%—in the different countries. The
highest frequencies of ciprofloxacin-resistant Enterobacteriaceae
bacteria of 92%, 69%, and 41% were found
in the Czech Republic and the two locations in Poland, respectively.
Numbers of samples with PMQR genes ranged
from 0% to 60% in different countries and the highest frequencies
of 60%, 27%, and 14% were again in the Czech
Republic and the two locations in Poland, respectively.
The most numerous gene qnrS was found in 156 samples
originating mainly from the Czech Republic and Poland.
Sequence analysis of the qnrS genes showed the presence of
two variants, qnrS1 and qnrS2. The gene qnrS1 occurred most
frequently and was found in 154 samples, while qnrS2 was
identified in two samples.
The fluoroquinolone-aminoglycoside resistance gene
aac(6¢)-Ib-cr was the gene second most frequently detected in
rook feces. It was found in 16 (1.5%) samples. The aac(6¢)-IbTable
1. Primers for Plasmid-Mediated Quinolone Resistance Genes Used in This Study
Primers Sequence (5¢–3¢)
Target
gene
Annealing
temperature
(°C)
Amplicon
size (bp)
Positive
control Reference
qnrA-F ATT TCT CAC GCC AGG ATT TG qnrA 53 516 Escherichia coli
J53 pMG252
38
qnrA-R GAT CGG CAA AGG TTA GGT CA
qnrB-F GAT CGT GAA AGC CAG AAA GG qnrB 53 476 E. coli J53
pMG298
23
qnrB-R ATG AGC AAC GAT GCC TGG TA
qnrB_VI CTARCCAATMAYCGCGATGCCAAG qnrB 53 645 E. coli J53
pMG298
Primers
designed
for this
study
qnrB_VII ATGRCTCTGGCRTTAGTTRGCGAAA
qnrB19.seq1F ATG ACT CTG GCA TTA GTT GG qnrB19
part 1
53 411 E. coli
DH5T15
11
qnrB19.seq1R CCA CAG CTC ACA CTT TTC CA
qnrB19.seq2F TGC CAT TTT CAA AAG CTG TG qnrB19
part 2
53 457 E. coli
DH5T15
11
qnrB19.seq2R GTA ACC AAT CAC AGC GAT GC
qnrC-F GGG TTG TAC ATT TAT TGA ATC G qnrC 53 307 E. coli DH10B
pHsII Tf1
23
qnrC-R CAC CTA CCC ATT TAT TTT CA
qnrS-F GCA AGT TCA TTG AAC AGG GT qnrS 53 428 E. coli J53
pMG306
6
qnrS-R TCT AAA CCG TCG AGT TCG GCG
qnrS1.seq1F ATGGAAACCTACAATCATACATATCG qnrS1
part1
55 443 E. coli J53
pMG306
11
qnrS1.seq1R TTCGTTCCTATCCAGCGATT
qnrS1.seq2F TTC GTG ATG CAA GTT TCC AA qnrS1
part2
55 467 E. coli J53
pMG306
11
qnrS1.seq2R TTA GTC AGG ATA AAC AAC AAT AAC C
qnrD-F CGA GAT CAA TTT ACG GGG AAT A qnrD 55 582 E. coli TG1
p2007057 Tf1
8
qnrD-R AAC AAG CTG AAG CGC CTG
aac(6¢)Ib-F TTG CGA TGC TCT ATG AGT GGC TA aac(6¢)-Ib 55 482 Salmonella
Infantis 14
35
aac(6¢)Ib-R CTC GAA TGC CTG GCG TGT TT
qepA-F TGG TCT ACG CCA TGG ACC TCA qepA 53 1136 E. coli 20III-09 36
qepA-R TGA ATT CGG ACA CCG TCT CCG 47
oqxBs TTCTCCCCCGGCGGGAAGTAC oqxB 64 512 E. coli CSH26
RifR/pOLA52
24
oqxBa2 CTCGGCCATTTTGGCGCGTA
oqxA-F CTCGGCGCGATGATGCT oqxA 60 392 E. coli CSH26
RifR/pOLA52
24
oqxA-R CCACTCTTCACGGGAGACGA
PMQR GENES IN BACTERIA FROM ROOKS 569
cr-positive samples originated mainly from the Czech Republic
(eight samples) and Germany (seven). Thirteen samples
were positive for the qnrB genes. These samples originated
from the Czech Republic, Poland, and Italy. The qnrB genes
were identified as the qnrB6 (one sample), qnrB18 (one), qnrB19
(nine), and qnrB29 (one) variants. A new variant of the
qnrB gene was found in one sample. The nucleotide sequence of
this gene was compared with other qnrB genes available in
the GenBank database using BLAST sequence analysis
(http://blast.ncbi.nlm.nih.gov/Blast.cgi). The new gene variant
differed from the qnrB20 in two nucleotides (GenBank Accession
No. AB379831), meaning one amino acid substitution
(Ala156Thr). The new variant was classified as qnrB49. The
full sequence of this gene is included in GenBank under the
accession number JQ582718. Retrospective analysis of the
sample positive for the qnrB new variant showed this new
variant to be present in two isolates of Citrobacter freundii
isolated from a rook fecal sample collected in San Benedetto
Po, Italy, on 27 February 2011.
Both the genes qnrD and oqxAB were detected in six (0.6%)
different samples, four of which were collected in the Czech
Republic. The genes qnrA, qnrC, and qepA were not detected
in any rook fecal sample.
Discussion
In 2003, a single clone of Shigella flexneri was found to be
resistant to ciprofloxacin and this strain was also harboring a
unique conjugative plasmid that transferred quinolone resis-
tance.16
Cloning identified an open reading frame encoding a
218-amino-acid protein of the pentapeptide repeat family that
was named QnrS (the gene is named qnrS1). A qnrS variant,
qnrS2, was detected on a plasmid from Salmonella enterica
serovar Anatum.14
The qnrS gene has been identified as the
most prevalent PMQR gene.25
This gene has been detected in
quinolone-resistant human, poultry, and swine E. coli and
Salmonella isolates.8,18,48
The qnrS1 gene was predominant in
the fecal bacteria from rooks throughout Europe. Rooks excreted
feces with these bacteria commonly in the Czech Republic,
both Polish locations, Spain, Serbia, and Germany. We
consider that the sources of these bacteria could be food animals
and their products and/or excrements because Salmonella
and/or E. coli isolates with the qnrS1 gene were found
recently in food and turkeys in Germany; in cattle, pigs,
chickens, and turkeys in Poland; in sheep in Italy; and in
chickens in Spain.46
The qnrS1 gene was predominant among
the qnr genes found in S. enterica and E. coli isolates from
animals, humans, food, and the environment in 13 European
countries,46
and these findings accord with the result in rooks.
Two samples of rook feces obtained in the Czech Republic
were positive for the qnrS2 gene. This gene has been detected
recently in Aeromonas spp. isolates recovered from diseased
fish and water environments in different parts of Asia and in
Switzerland, as well as from human clinical isolates in
Spain.1,6,30,37
The gene qnrS2 has been found also in clinical
isolates of Salmonella in Japan.44
We report the qnrS2 gene in
bacteria from wild birds for the first time.
The spectrum of qnrB genes is broader than those of qnrA
and qnrS.43
While studying strains of Klebsiella pneumoniae,
Jacoby et al.22
found the PMQR gene qnrB1. A number of
other variants (from qnrB2 to qnrB48) were found subsequently
among various Enterobacteriaceae (www.lahey.org/qnrstudies,
accessed 13 February 2012). From all
the qnrB genes, qnrB19 was predominant in the fecal bacteria
obtained from rook feces. This gene has very recently
been demonstrated to be prevalent in Enterobacteriaceae
from food-producing animals in different parts of Europe
and in Nigeria, from humans in South America and the
Netherlands, and from horses in the Czech Repub-
lic.11,13,19,34,46
It seems that the frequency of the qnrB19 gene
in rooks reflects the general situation in domestic animals
and humans in Europe.
Moreover, the genes qnrB6, qnrB18, and qnrB29 were
present in rook samples obtained from the Czech Republic
Table 2. Plasmid-Mediated Quinolone Resistance Genes in Fecal Bacterial Samples
from Rooks (Corvus frugilegus) Wintering in Europe During Winter 2010/2011
Czech
Republic France Germany Italy
Poland,
Gdynia
Poland,
Jaroslaw Spain Serbia Switzerland
Total
(%)
No. of samples 150 31 100 145 150 148 150 150 49 1,073 (100)
No. of samples with bacteria
resistant to ciprofloxacin (%)
139 (92) 1 (3) 20 (20) 9 (6) 104 (69) 61 (41) 26 (17) 30 (20) 2 (4) 392 (37)
No. of samples with
plasmid-mediated
quinolone resistance genes
89 (60) 0 (0) 9 (9) 1 (0.7) 40 (27) 20 (14) 9 (6) 7 (5) 0 (0) 175 (16)
No. of samples with qnrA — — — — — — — — — — (0)
No. of samples with qnrB6 — — — — — 1 — — — 1 (0.1)
No. of samples with qnrB18 — — — — — 1 — — — 1 (0.1)
No. of samples with qnrB19 3 — — — 6 — — — — 9 (1)
No. of samples with qnrB29 1 — — — — — — — — 1 (0.1)
No. of samples with qnrB49 — — — 1 — — — — — 1 (0.1)
No. of samples with qnrC — — — — — — — — — — (0)
No. of samples with qnrD 4 — — — — 2 — — — 6 (0.6)
No. of samples with qnrS1 82 — 4 — 38 15 9 6 — 154 (14)
No. of samples with qnrS2 2 — — — — — — — — 2 (0.2)
No. of samples with aac(6¢)-Ib-cr 8 — 7 — — — — 1 — 16 (1.5)
No. of samples with oqxAB 4 — — — — 1 — 1 — 6 (0.6)
No. of samples with qepA — — — — — — — — — — (0)
570 LITERAK ET AL.
and Poland. The gene qnrB6 has been detected mainly in
clinical isolates of Enterobacteriaceae bacteria in China and
Spain, in isolates obtained from dogs and ducks, and from
the environment in China.29,40,49,50
Until now, the genes
qnrB18 and qnrB29 had been found only in Citrobacter freundii
isolates in Spain and Korea (GenBank Accession No.
AM919399; GenBank Accession No. HM439649). Our rare
findings of these genes provide the first evidence of their
occurrence in European wildlife.
Six variants of qnrB (qnrB2, qnrB4, qnrB6, qnrB7, qnrB12,
and qnrB19) were recently identified among PMQR Salmonella
and/or E. coli isolates from Germany, Poland, and
Spain.46
Most of the qnrB-positive isolates in that study
originated from turkeys. Hence, turkeys should be considered
an important source for rooks of fecal bacteria carrying
qnrB genes.
The new variant of the qnrB gene was found in Citrobacter
freundii from a rook in Italy. Most known variants of the qnrB
gene have been discovered from Citrobacter freundii, a potential
reservoir for new variants of this gene.21
Another gene, designated qnrD, was found in S. enterica
isolates, and it was transferable on small plasmids of about
4.3 kb.9
This gene encodes a 214-amino-acid pentapeptide
repeat protein designated QnrD. Six samples of rook feces
obtained in the Czech Republic and Poland were positive for
qnrD. This gene was recently identified in PMQR Salmonella
isolates from Italy and Spain.46
Most of the qnrD-positive
isolates in that study originated from laying hens in Spain,
while some isolates with the qnrD gene originated from
chickens, turkeys, and food in Italy. Hence, chickens and turkeys
should be considered as sources of fecal bacteria carrying
qnrD genes found in rooks. In addition, qnrD has been detected
in E. coli isolates obtained from pigs in China and in clinical
isolates of Proteus and Pseudomonas in Nigeria.33,49
An additional important PMQR gene is aac(6¢)-Ib-cr. It encodes
a specific aminoglycoside acetyltransferase, AAC(6¢)-Ibcr,
that confers increase of minimum inhibitory concentration
selectively for norfloxacin and ciprofloxacin.38
The gene aac(6¢)Ib-cr,
like its parent aac(6¢)-Ib, is an integron cassette with an
associated attC site. It is hence found in various integrons, but
especially on IncFII plasmids expressing CTX-M-15 that have
spread rapidly such that CTX-M-15 has become the predominant
extended-spectrum beta-lactamase in many countries
throughout the world. The gene aac(6¢)-Ib-cr has been associated
with other PMQR genes and with other beta-lactamases.
In our study, aac(6¢)-Ib-cr was the gene second most frequently
detected in rook feces and mainly among those obtained in
the Czech Republic and Germany. In a contrast to our study,
the aac(6¢)-Ib-cr gene has only exceptionally been identified in
PMQR Enterobacteriaceae bacteria in Europe.46
The plasmid-mediated quinolone transporter OqxAB was
found in several samples. OqxAB is a multidrug efflux pump
that confers resistance to quinolone, quinoxaline, and other
agents, including chloramphenicol. Plasmid-mediated OqxAB
has been detected in human clinical E. coli and the
oqxAB gene was also found on the chromosome of
K. pneumoniae.24
Moreover, the oqxAB gene has been found in
E. coli strains from pigs, chicken, farm workers, and a farm
environment.47
In our study, we report the first isolation of
oqxAB gene in bacteria originating from wild animals.
Migratory birds in close contact with humans and domestic
animals, such as rooks, can play an important role in
the dispersion of E. coli and Salmonella isolates resistant to
old-generation antimicrobials.27
The sources colonizing rooks
with these isolates could be food and/or drinking water.
Direct observation in the field has shown rooks to have an
omnivorous feeding pattern in agricultural, rural, and urban
areas during winter.20
Outside of the breeding season, huge
flocks of this species forage in communal refuse dumps,
which still exist in central and eastern Europe.2
Thus, rooks
could be colonized with antibiotic-resistant bacteria, including
PMQR bacteria, from both animal and human sources
even if their populations are not directly influenced by antibiotic
practice. Consequently, once infected, rooks may
disseminate these bacteria over long distances throughout
Europe and pose a risk for environmental contamination.
Being congregative medium-sized birds, rooks excrete locally
in various European countries large quantities of fecal
coliforms. They are capable through their feces to contaminate
environments inhabited by humans and domestic animals.
It is important to prevent these birds from feeding on
garbage dumps, the main suspected source of resistant bacteria
and including bacteria with PMQR. Not to supply food
for these birds is a simple way of limiting potential problems.
The common occurrence of PMQR bacteria supposedly Enterobacteriaceae
in populations of wild rooks, where there is
no selective pressure, can imply that such resistance will be
difficult to displace.
Acknowledgments
The authors thank Francisco de la Calzada, Joanna Drozdowska,
Dragan Fabijan, Sebastian Franco, Susanne Homma,
Iva Jamborova, Ruben Gonzales Janez, Jiri Klimes,
Adam Konecny, Tomas Lang, Zuzana Markova, Veronika
Oravcova, Radim Petro, Marko Sciban, Marie Slavikova, Eva
Suchanova, and Raluca Uricariu for excellent cooperation in
the field or in the laboratory. Our thanks go to Lars Hansen
(University of Copenhagen, Denmark), and Lina Cavaco and
Henrik Hasman (National Food Institute, Copenhagen,
Denmark) for control strains. This study was funded by
Grant No. MSM6215712402 of the Ministry of Education,
Youth and Sports of the Czech Republic, and the project
‘‘CEITEC—Central European Institute of Technology’’
(CZ.1.05/1.1.00/02.0068) from the European Regional Development
Fund.
Disclosure Statement
No competing financial interests exist.
References
1. Arias, A., C. Seral, F. Navarro, E. Miro, P. Coll, and F.J.
Castillo. 2010. Plasmid-mediated QnrS2 determinant in an
Aeromonas caviae isolate recovered from a patient with diarrhoea.
Clin. Microbiol. Infect. 16:1005–1007.
2. Betleja, J., and W. Meissner. 2005. The occurrence of corvids
Corvidae on rubbish-dumps in Poland in 2002–2004. In
L. Jerzak, B.P. Kavanagh, and P. Tryjanowski (eds.), Corvids
of Poland. Bogucki Scientific Press, Poznan, pp. 207–214 (In
Polish with summary in English).
3. Blanco, G., J.A. Lemus, and J. Grande. 2009. Microbial
pollution in wildlife: linking agricultural manuring and
bacterial antibiotic resistance in red-billed choughs. Environ.
Res. 109:405–412.
PMQR GENES IN BACTERIA FROM ROOKS 571
4. Bogliani, G. 1985. Distribuzione ed ecologia del corvo,
Corvus frugilegus, svernante in Italia. Riv. Ital. Orn. Milano
55:140–150.
5. Camarda, A., E. Circella, D. Pennelli, A. Madio, G. Bruni,
V. Lagrasta, G. Marzano, E. Mallia, and E. Campagnari.
2006. Wild birds as biological indicators of environmental
pollution: biotyping and antimicrobial resistance patterns of
Escherichia coli isolated from Audouin’s gulls (Larus audouinii)
living in the Bay of Gallipoli (Italy). Italian. J. Anim. Sci.
5:287–290.
6. Cattoir, V., L. Poirel, C. Aubert, C.-J. Soussy, and P.
Nordmann. 2008. Unexpected occurrence of the plasmidmediated
quinolone resistance determinants in environmental
Aeromonas spp. Emerg. Infect. Dis. 14:231–237.
7. Cattoir, V., L. Poirel, V. Rotimi, C.J. Soussy, and P. Nordmann.
2007. Multiplex PCR for detection of plasmid-mediated
quinolone resistance qnr genes in ESBL-producing enterobacterial
isolates. J. Antimicrob. Chemother. 60:394–397.
8. Cavaco, L.M., N. Frimodt-Moller, H. Hasman, L. Guardabassi,
L. Nielsen, and F.M. Aarestrup. 2008. Prevalence of
quinolone resistance mechanisms and associations to minimum
inhibitory concentrations in quinolone-resistant Escherichia
coli isolated from humans and swine in Denmark.
Microb. Drug Resist. 14:163–169.
9. Cavaco, L.M., H. Hasman, S. Xia, and F.M. Aarestrup. 2009.
qnrD, a novel gene conferring transferable quinolone resistance
in Salmonella enterica serovars Kentucky and Bovismorbificans
of human origin. Antimicrob. Agents
Chemother. 53:603–608.
10. Dolejska, M., B. Bierosova, L. Kohoutova, I. Literak, and
A. Cizek. 2009. Antibiotic-resistant Salmonella and Escherichia
coli isolates with integrons and extended-spectrum
beta-lactamases in surface water and sympatric blackheaded
gulls. J. Appl. Microbiol. 106:1941–1950.
11. Dolejska, M., E. Duskova, J. Rybarikova, D. Janoszowska,
E. Roubalova, K. Dibdakova, G. Maceckova, L. Kohoutova,
I. Literak, J. Smola, and A. Cizek. 2011. Plasmids carrying
blaCTX-M-1 and qnr genes in Escherichia coli isolates from
an equine clinic and a horseback riding centre. J. Antimicrob.
Chemother. 66:757–764.
12. dos Anjos, L. 2009. Family Corvidae (Crows). In J. del Hoyo,
A. Elliot, and D.A. Christie (eds.), Handbook of the Bird of
the World. Vol 14. Bush-shrikes to Old World Sparrows.
Lynx Edicions, Barcelona, pp. 494–640.
13. Fortini, D., K. Fashae, A. Garcia-Fernandez, L. Villa, and
A. Carattoli. 2011. Plasmid-mediated quinolone resistance
and b-lactamases in Escherichia coli from healthy
animals from Nigeria. J. Antimicrob. Chemother. 66:
1269–1272.
14. Gay, K., A. Robicsek, J. Strahilevitz, C.H. Park, G. Jacoby,
T.J. Barrett, F. Medalla, T.M. Chiller, and D.C. Hooper.
2006. Plasmid mediated quinolone resistance in nonTyphi
serotypes of Salmonella enterica. Clin. Infect. Dis. 43:
297–304.
15. Gionechetti, F., P. Zucca, F. Gombac, C. Monti-Bragadin,
C. Lagatolla, E. Tonin, E. Edalucci, L.A. Vitali, and L.
Dolzani. 2008. Characterization of antimicrobial resistance
and class 1 integrons in Enterobacteriaceae isolated from
Mediterranean herring gulls (Larus cachinans). Microb. Drug
Resist. 14:93–99.
16. Hata, M., M. Suzuki, and M. Matsumoto. 2005. Cloning of
a novel gene for quinolone resistance from a transferable
plasmid in Shigella flexneri 2b. Antimicrob. Agents Chemother.
49:801–803.
17. Hooper, D.C., and E. Rubinstein. 2003. Quinolone Antimicrobial
Agents, 3rd edition. ASM Press, Washington,
D.C., 485 pp.
18. Hopkins, K.L., L. Wootton, M.R. Day, and E.J. Threlfall.
2007. Plasmid-mediated quinolone resistance determinant
qnrS1 found in Salmonella enterica strains isolated in the UK.
J. Antimicrob. Chemother. 59:1071–1075.
19. Hordijk, J., A.B. Bosman, A. van Essen-Zandbergen, K.
Veldman, C. Dierikx, J.A. Wagenaar, and D. Mevius. 2011.
qnrB19 gene bracketed by IS26 on a 40-kilobase IncR plasmid
from an Escherichia coli isolate from a veal calf. Antimicrob.
Agents Chemother. 55:453–454.
20. Hubalek, Z., and V. Kubik. 1983. Roosts and habits of
Corvus frugilegus wintering in Czechoslovakia. Acta Sci. Nat.
Acad. Sci. Bohemoslovacae Brno 17:1–52.
21. Jacoby, G.A., C.M. Griffin, and D.C. Hooper. 2011. Citrobacter
spp. as a source of qnrB alleles. Antimicrob. Agents
Chemother. 55:4979–4984.
22. Jacoby, G.A., K.E. Walsh, D.M. Mills, V.J. Valker, H. Oh,
A. Robicsek, and D.C. Hooper. 2006. qnrB, another plasmidmediated
gene for quinolone resistance. Antimicrob. Agents
Chemother. 50:1178–1182.
23. Kim, H.B., C.H. Park, C.J. Kim, E.C. Kim, G.A. Jacoby, and
D.C. Hooper. 2009a. Prevalence of plasmid-mediated quinolone
resistance determinants over a 9-year period. Antimicrob.
Agents Chemother. 53:639–645.
24. Kim, H.B., M. Wang, C.H. Park, E.C. Kim, G.A. Jacoby,
and D.C. Hooper. 2009b. oqxAB encoding a multidrug efflux
pump in human clinical isolates of Enterobacteriaceae. Antimicrob.
Agents Chemother. 53:3582–3584.
25. Lavilla, S., J.J. Gonzalez-Lopez, M. Sabate, A. GarciaFernandez,
M.N. Larrosa, R.M. Bartolome, A. Carattoli and
G. Prats. 2008. Prevalence of qnr genes among extendedspectrum
beta-lactamase-producing enterobacterial isolates
in Barcelona, Spain. J. Antimicrob. Chemother. 61:291–295.
26. Literak, I., M. Dolejska, M. Janoszowska, J. Hrusakova, W.
Meissner, H. Rzyska, S. Bzoma, and A. Cizek. 2010.
Antibiotic-resistant Escherichia coli bacteria, including strains
with genes encoding the extended-spectrum beta-lactamase
and qnrS, in waterbirds on the Baltic Sea coast of Poland.
Appl. Environ. Microbiol. 76:8126–8134.
27. Literak, I., R. Vanko, M. Dolejska, A. Cizek, and R.
Karpiskova. 2007. Antibiotic resistant Escherichia coli and
Salmonella in Russian rooks (Corvus frugilegus) wintering in
the Czech Republic. Lett. Appl. Microbiol. 45:616–621.
28. Livermore, D.M., M. Warner, L.M.C. Hall, V.I. Enne, S.J.
Projan, P.M. Dunman, S.L. Wooster, and G. Harrison. 2001.
Antibiotic resistance in bacteria from magpies (Pica pica) and
rabbits (Oryctolagus cuniculus) from west Wales. Environ.
Microbiol. 3:658–661.
29. Ma, J.Y., Z.L. Zeng, Z., X. Xu, X.Y. Wang, Y.T. Deng, D.H.
Lu, L.Z. Huang, Y.Y. Zhang, L.H. Liu, and M.G. Wang.
2009. High prevalence of plasmid-mediated quinolone resistance
determinants qnr, aac(6¢)-Ib-cr, and qepA among
ceftiofur-resistant Enterobacteriaceae isolates from companion
and food-producing animals. Antimicrob. Agents Chemother.
53:519–524.
30. Majumdar, T., B. Das, R.K. Bhadra, B. Dam, and S.
Mazumder. 2011. Complete nucleotide sequence of a quinolone
resistance gene (qnrS2) carrying plasmid of Aeromonas
hydrophila isolated from fish. Plasmid 66:79–84.
31. Martinez-Martinez, L., A. Pascual, and G.A. Jacoby. 1998.
Quinolone resistance from a transferable plasmid. Lancet
351:797–799.
572 LITERAK ET AL.
32. Nakamura, M., H. Yoshimura, and T. Koeda. 1982. Drug
resistance and R plasmids of Escherichia coli strains isolated
from six species of wild birds. Jpn. J. Vet. Sci. 44:465–471.
33. Ogbolu, D.O., O.A. Daini, A. Ogunledun, A.O. Alli, and
M.A. Webber. 2011. High levels of multidrug resistance in
clinical isolates of Gram-negative pathogens from Nigeria.
Int. J. Antimicrob. Agents 37:62–66.
34. Pallecchi, L., E. Riccobono, A. Mantella. F. Bartalesi, S.
Sennati, H. Gamboa, E. Gotuzzo, A. Bartoloni, and G.M.
Rossolini. 2009. High prevalence of qnr genes in commensal
enterobacteria from healthy children in Peru and Bolivia.
Antimicrob. Agents Chemother. 53:2632–2635.
35. Park, C.H., A. Robicsek, G.A. Jacoby, D. Sahm, and D.C.
Hooper. 2006. Prevalence in the United States of aac(6¢)Ib-cr
encoding a ciprofloxacin-modifying enzyme. Antimicrob.
Agents Chemother. 50:3953–3955.
36. Perichon, B., P. Courvalin, and M. Galimand. 2007.
Transferable resistance to aminoglycosides by methylation
of G1405 in 16S rRNA and to hydrophilic fluoroquinolones
by qepA-mediated efflux in Escherichia coli. Antimicrob.
Agents Chemother. 51:2464–2469.
37. Picao, R.C., L. Poirel, A. Demarta, C.S. Ferreira Silva, A.R.
Corvaglia, O. Petrini, and P. Nordmann. 2008. Plasmidmediated
quinolone resistance in Aeromonas allosaccharophila
recovered from a Swiss lake. J. Antimicrob. Chemother. 62:
948–950.
38. Robicsek, A., J. Strahilevitz, G.A. Jacoby, M. Macielag, D.
Abbanat, C.H. Park, K. Bush, and D.C. Hooper. 2006.
Fluoroquinolone-modifying enzyme: a new adaptation of a
common aminoglycoside acetyltransferase. Nat. Med. 12:
83–88.
39. Roman, J., and C. Gutierrez. 2009. La graja Corvus frugilegus
deja de invernar en Espana: Un nuevo caso de acortamiento
en las migraciones? Ardeola 55:229–235.
40. Sanchez-Cespedes, J., S. Marti, S.M. Soto, V. Alba, C.
Melcion, M. Almela, F. Marco, and J. Vila. 2009. Two
chromosomally located qnrB variants, qnrB6 and the new
qnrB16, in Citrobacter spp. isolates causing bacteraemia. Clin.
Microbiol. Infect. 15:1132–1138.
41. Sato, G., C. Oka, M. Asagi, and N. Ishiguro. 1978. Detection
of conjugative R plasmids conferring chloramphenicol resistance
in Escherichia coli isolated from domestic and feral
pigeons and crows. Zbl. Bakt. Mikrobiol. Hyg. I Abt. Orig. A
241:407–417.
42. Sjolund, M., J. Bonnedahl, J. Hernandez, S. Bengtsson, G.
Cederbrant, J. Pinhassi, G. Kahlmeter, and B. Olsen. 2008.
Dissemination of multidrug-resistant bacteria into Arctic.
Emerg. Infect. Dis. 14:70–72.
43. Strahilevitz, J., G.A. Jacoby, D.C. Hooper, and A. Robicsek.
2009. Plasmid-mediated quinolone resistance: a
multifaceted threat. Clin. Microbiol. Rev. 22:664–689.
44. Taguchi, M, R. Kawahara, K. Seto, K. Inoue, A. Hayashi,
N. Yamagata, K. Kamakura, and E. Kashiwagi. 2009. Plasmid-mediated
quinolone resistance in Salmonella isolated
from patients with overseas travelers’ diarrhea in Japan. Jpn.
J. Infect. Dis. 62:312–314.
45. Tausova, D., M. Dolejska, A. Cizek, L. Hanusova, J. Hrusakova,
O. Svoboda, G. Camlik, and I. Literak. 2012. Escherichia
coli with extended-spectrum beta-lactamase and
plasmid-mediated quinolone resistance genes in great cormorants
and mallards in Central Europe. J. Antimicrob.
Chemother. 67:1103–1107.
46. Veldman, K., L.M. Cavaco, D. Mevius, A. Battisti, A.
Franco, N. Botteldorn, M. Bruneau, A. Perrin-Gyuomard,
T. Cerny, C.D. Escobar, B. Guerra, A. Schroeter, M. Gutierrez,
K. Hopkins, A.L. Myllyniemi, M. Sunde, D. Wasyl,
and F.M. Aarestrup. 2011. International collaborative study
on the occurrence of plasmid-mediated quinolone resistance
in Salmonella enterica and Escherichia coli isolated from animals,
humans, food and the environment in 13 European
countries. J. Antimicrob. Chemother. 66:1278–1286.
47. Yamane, K., J. Wachino, S. Suzuki, and Y. Arakava. 2008.
Plasmid-mediated qepA gene among Escherichia coli clinical
isolates from Japan. Antimicrob. Agents Chemother. 52:
1564–1566.
48. Yue, L., H.X. Jiang, X.P. Liao, J.H. Liu, S.J. Li, X.Y. Chen,
C.X. Chen, D.H. Lu, and Y.H. Liu. 2008. Prevalence of
plasmid-mediated quinolone resistance qnr genes in poultry
and swine clinical isolates of Escherichia coli. Vet. Microbiol.
132:414–420.
49. Zhao, J., Z. Chen, S. Chen, Y.T. Deng, Y.H. Liu, W. Tian,
X.H. Huang, C.M. Wu, Y.X. Sun, Y. Sun, Z.L. Zeng, and J.H.
Liu. 2010. Prevalence and dissemination of oqxAB
in Escherichia coli isolates from animals, farmworkers, and the
environment. Antimicrob. Agents Chemother. 54:4219–4224.
50. Zhou, T.L., X.J. Chen, M.M. Zhou, Y.J. Zhao, X.H. Luo, and
Q.Y. Bao. 2011. Prevalence of plasmid-mediated quinolone
resistance in Escherichia coli isolates in Wenzhou, Southern
China, 2002–2008. Jpn. J. Infect. Dis. 64:55–57.
Address correspondence to:
Ivan Literak, D.V.M., Ph.D.
Department of Biology and Wildlife Diseases
Faculty of Veterinary Hygiene and Ecology
University of Veterinary and Pharmaceutical Sciences Brno
Palackeho 1-3
612 42 Brno
Czech Republic
E-mail: literaki@vfu.cz
PMQR GENES IN BACTERIA FROM ROOKS 573
Příloha 14
DOLEJSKA, M., VILLA, L., HASMAN, H., HANSEN, L., CARATTOLI, A., 2013, Characterization of IncN
plasmids carrying blaCTX-M-1 and qnr genes in Escherichia coli and Salmonella from animals,
environment and humans: Journal of Antimicrobial Chemotherapy, v. 68, p. 333-339.
Souhrn
Byla provedena komparativní analýza sbírky IncN plazmidů nesoucích geny qnr a blaCTX-M-1 za využití RFLP,
pMLST a hybridizace se specifickými sondami. U vybraných plazmidů byla stanovena primární nukleotidová
sekvence metodou nové generace sekvenování a bioinformatickým zpracováním dat. Plazmidy pocházely
z nepříbuzných kmenů E. coli a Salmonella spp. z lidí, různých skupin zvířat a prostředí v Evropě. Byly
identifikovány příbuzné plazmidy cirkulující u humánních i animálních izolátů. Studie dokumentuje význam
epidemických IncN plazmidů v šíření rezistence k cefalosporinům a fluorochinolonům.
Characterization of IncN plasmids carrying blaCTX-M-1 and qnr
genes in Escherichia coli and Salmonella from animals,
the environment and humans
Monika Dolejska1,2, Laura Villa3, Henrik Hasman4, Lars Hansen4 and Alessandra Carattoli3*
1
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical
Sciences Brno, Brno, Czech Republic; 2
CEITEC VFU, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republic;
3
Department of Infectious, Parasitic and Immune-Mediated Diseases, Istituto Superiore di Sanita`, Rome, Italy; 4
Research Group for
Microbial Genomics and Antimicrobial Resistance, National Food Institute, Technical University of Denmark, Lyngby, Denmark
*Corresponding author. Tel: +39-06-4990-3128; Fax: +39-06-4938-7112; E-mail: alecara@iss.it
Received 18 June 2012; returned 27 July 2012; revised 20 August 2012; accepted 2 September 2012
Objectives: The aim of the study was to characterize a collection of Escherichia coli and Salmonella harbouring
qnr and blaCTX-M-1 genes on IncN plasmids isolated from humans, food-producing, companion and wild
animals, and the environment from six European countries.
Methods: Nineteen IncN plasmids were compared using restriction fragment length polymorphism (RFLP),
plasmid multilocus sequence typing (pMLST) and hybridization with repN, qnrS1, qnrB19 or blaCTX-M-1 probes.
Plasmids pKT58A and pHHA45 were sequenced using the 454-Genome Sequencer FLX platform on a library
constructed from plasmid DNA purified from the respective E. coli transformants.
Results: Three types of IncN plasmids carrying blaCTX-M-1, qnrS1 and qnrB19 genes were identified in strains isolated
from the Czech Republic, Poland, Slovakia, Denmark, Italy and the Netherlands, corresponding to pMLST
sequence type (ST) 1, ST3 and ST8, respectively. Related plasmids circulating in human and animal isolates
were identified. Complete nucleotide sequences of the ST1 pHHA45 plasmid carrying blaCTX-M-1, isolated from
E. coli from pigs in Denmark, and the ST3 pKT58A plasmid harbouring qnrS1, identified in E. coli from a
water bird, were obtained.
Conclusions: Our results demonstrated wide distribution of specific IncN plasmids disseminating blaCTX-M-1 and
qnr genes among animals and humans in Europe.
Keywords: quinolone resistance, ESBLs, plasmid MLST
Introduction
Plasmids of the incompatibility N group (IncN) have a broad host
range, conjugate at high frequency and are stably maintained in
the bacterial host cell thanks to partitioning and antirestriction
systems.1
IncN plasmids show a relatively high prevalence in
faecal flora of healthy animals (10.9%) and in bacterial populations
not pre-selected for antimicrobial resistance, and are one of
the major vehicles for the dissemination of the extendedspectrum
b-lactamase (ESBL) CTX-M-1 and plasmid-mediated
quinolone resistance (PMQR) genes in Escherichia coli and Salmonella
isolates from humans, animals and the environment.2
–10
The plasmid multilocus sequence typing (pMLST)
database (http://pubmlst.org/plasmid/, 5 August 2012) contains
112 entries of bacterial isolates carrying IncN plasmids from
Europe, the USA, China and Australia, assigned to 13 different
sequence types (STs).7
Sixty-seven IncN plasmids belong to ST1
(60%) and 56 of them (50%) carry the blaCTX-M-1 gene. ST1 plasmids
included in the database are from E. coli and Salmonella
from humans, poultry, pigs, cattle, companion animals and the
environment and were obtained from Denmark, Germany,
Italy, Greece and the Netherlands. The second most prevalent
IncN plasmid type is ST11 (15 entries, 13%), which had,
however, a limited diffusion being associated with the local
spread of the carbapenemase VIM in Greece. The third and
fourth most frequent IncN types are ST8 (n¼8, 7%) and ST3
(n¼7, 6%), carrying blaCTX-M or qnr genes, detected in several
European countries from human and animal sources (http
://pubmlst.org/plasmid/, 5 August 2012).
Complete nucleotide sequences of 21 IncN plasmids are available
in the GenBank database, all showing a conserved set of
core genes, involved in essential functions such as replication,
# The Author 2012. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: journals.permissions@oup.com
J Antimicrob Chemother 2013; 68: 333–339
doi:10.1093/jac/dks387 Advance Access publication 11 October 2012
333
atNewCopenhagenUniversityonMarch4,2013http://jac.oxfordjournals.org/Downloadedfrom
transfer and maintenance, and various accessory genes encoding
resistance to cephalosporins, carbapenems, tetracyclines,
quinolones, aminoglycosides and sulphonamides as well as
heavy metal resistance genes.
The aim of this work was to study a collection of IncN plasmids
identified in E. coli or Salmonella from wild and farm
animals, the environment and humans from six different European
countries among plasmids harbouring PMQR or blaCTX-M-1
genes. Complete DNA sequences of two representative ST1 and
ST3 plasmids carrying blaCTX-M-1 and qnrS1 genes, respectively,
were obtained and compared with ST1, ST3 and ST8 IncN
plasmid scaffolds already available in GenBank.
Material and methods
Plasmids
Nineteen E. coli transformants obtained from clonally unrelated strains,
each carrying one single IncN plasmid, were selected from a collection
of previously studied E. coli or Salmonella strains obtained from human
and animal clinical samples and carriers and from environmental
samples from the Czech Republic, Slovakia, Poland, Denmark, Italy and
the Netherlands (Table 1). Ten and nine plasmids showing differences in
antibiotic resistance gene content and size were randomly selected
among those carrying the blaCTX-M-1, qnrS1 and qnrB19 genes, respectively.
All plasmids were analysed by restriction fragment length polymorphism
(RFLP) using the PvuII (Bioline Ltd, UK) restriction enzyme. Digested fragments
were separated by electrophoresis in a 0.8% agarose gel. Cluster
analysis of RFLP patterns was performed, generating dendrograms and
measuring plasmid similarity by the Dice Similarity Index (DSI). Plasmids
with a DSI ≥85% were assigned to the same cluster (designated with
numbers 1, 2, 3 and 4). Letters were used to discriminate RFLP patterns
assigned to the same cluster, but differing by one or two restriction
bands (i.e. 1a, 1b, 1c etc.). Prototypic restricted plasmids were transferred
to a positively charged nylon membrane (Roche Diagnostics, Monza, Italy)
by Southern blot and hybridized with repN, qnrS1, qnrB19 and blaCTX-M-1
probes labelled with DIG-11-dUTP by PCR using a PCR Dig Probe Synthesis
Kit (Roche Diagnostics).10–12
Detection of hybridizations was performed
using the DIG Nucleic Acid Detection Kit (Roche Diagnostics).
pMLST
All plasmids were typed by pMLST performed as previously described7
on
total DNA obtained by the Wizard Genomic DNA Purification System
(Promega, Madison, WI, USA). Amplicons were purified and sequenced
by fluorescent dye-labelled dideoxynucleotides using an ABI 3730
DNA sequencing instrument (Applied Biosystems, Foster City, CA, USA).
Plasmids were assigned to STs at the www.pubmlst.org/plasmid/ site,
analysing the ST prevalence at the IncN isolate database (http
://pubmlst.org/plasmid/).
Plasmid sequencing
Shotgun libraries were obtained from the qnrS1-positive pKT58A plasmid
identified in 2010 in E. coli from a cloacal sample of a wild bird in Slo-
vakia9
and the pHHA45 blaCTX-M-1-positive plasmid recovered in 2006 in
E. coli from pigs in Denmark (this study). These plasmids were randomly
selected as representative of the ST1 and ST3 IncN plasmid type among
those carrying blaCTX-M-1 or qnrS1 genes, respectively. Plasmid DNA was
purified using the Plasmid Midi Prep Kit (Qiagen). Sequencing was performed
using the 454-Genome Sequencer FLX platform (Roche Diagnostics)
following the standard GS FLX sequencing procedure (Roche
Diagnostics). Plasmid coverage was .80×. Reads were aligned and
assembled using Newbler assembler software version 2.0.01.14 (Roche
Diagnostics).
Bioinformatics
Open reading frames (ORFs) were predicted and annotated using Artemis
software (Wellcome Trust Sanger Institute, Cambridge, UK). Each predicted
protein was compared against the protein database using BlastP
(http://blast.ncbi.nlm.nih.gov/Blast.cgi) with a minimum cut-off of 30%
identity over 80% length coverage. Gene sequences were further compared
and aligned with GenBank data using BLAST (http://blast.ncbi.
nlm.nih.gov/Blast.cgi) and CLUSTAL W (http://www.ebi.ac.uk/clustalw).
The IncN plasmids R46 (GenBank accession number AY046276) and
pRSB206 (GenBank accession number JN102344) were used as reference
plasmids for annotation. GenBank files were compiled using Sequin (http:
//www.ncbi.nlm.nih.gov/Sequin/).
Nucleotide sequences
The GenBank accession numbers for the pHHA45 and pKT58A plasmids
are JX065630 and JX065631, respectively.
Results and discussion
IncN comparative analysis
ST1 IncN plasmids harbouring the blaCTX-M-1 gene, showing identical
or related RFLP patterns assigned to cluster 1 (DSI ≥88.9%),
were identified in strains from different sources from the Czech
Republic, Poland, Denmark and Italy, suggesting the European
spread of common, highly diffused IncN plasmids responsible
for the dissemination of CTX-M-1 (Table 1 and Figure 1). ST1 plasmids
carrying qnrS1 from E. coli and Salmonella from the Czech
Republic and the Netherlands showed related patterns by RFLP
assigned to cluster 2 (DSI .84.9%; Table 1 and Figure 1).
Overall the ST1 plasmids showed highly related restriction patterns
(DSI ≥84.0%), and hybridization experiments suggested
that divergences observed were mostly due to the regions containing
different resistance genes, as suggested by hybridization
with the blaCTX-M-1 and qnrS1 probes, but also to rearrangements
occurring in proximity to the repN gene (plasmid 209, lane 1;
Figure 1).
ST3 qnrS1-carrying plasmids identified in human and animal
strains in Slovakia, Poland and the Netherlands showed RFLP
patterns assigned to cluster 3, differing from those of plasmid
ST1 (DSI .65.5%). Restriction and hybridization analysis of ST3
plasmids suggested that transfer of related qnrS1-harbouring
plasmids may occur between Salmonella and E. coli of animal
and human origin.
ST8 plasmids carrying qnrB19 showed RFLP patterns assigned
to cluster 4 (DSI .71.3%). These plasmids showed identical
RFLPs and the location of the qnrB19 gene was comparable to
that expected for the previously fully sequenced plasmid
pQNR2078 (GenBank accession number HE613857), belonging
to ST8 and carrying the qnrB19 gene, identified in E. coli from a
horse in Germany.13
Overall the comparative analysis of the IncN plasmid structure
clearly highlighted the existence of plasmids carrying
blaCTX-M-1, qnrS1 or qnrB19 shared between bacterial strains of
different origins and sources belonging to ST1, ST3 and ST8,
respectively.
Dolejska et al.
334
atNewCopenhagenUniversityonMarch4,2013http://jac.oxfordjournals.org/Downloadedfrom
Table 1. List of ESBL- or qnr-carrying IncN plasmids from E. coli or Salmonella strains from Europe analysed in this study
Plasmid
name Country
Year of
isolation Strain Source
ESBL/
PMQR RFLPa
pMLST
Plasmid
size
Additional antibiotic
resistance genes on
plasmid
Conjugative transfer to
ReferenceE. coli
Salmonella
Typhimurium
15/B CR 2009 E. coli cattle blaCTX-M-1 1a ST1 30 — + + 6
279/B CR 2009 E. coli cattle blaCTX-M-1 1a ST1 30 — + + 6
KK6 CR 2008 E. coli horse blaCTX-M-1 1a ST1 30 aadA1 + 2 27
62510 CR 2008 E. coli horse blaCTX-M-1 1a ST1 30 aadA1, tet(B) + 2 27
27 NS CR 2009 E. coli human blaCTX-M-1 1b ST1 45 tet(A) + + 28
5 PL PL 2009 E. coli wild water bird blaCTX-M-1 1c ST1 35 — + + 29
11 OV CR 2009 E. coli WWTP blaCTX-M-1 1d ST1 40 — + + 30
Env1 DK 2006 E. coli pig farm
environment
blaCTX-M-1 1d ST1 40 NT NT NT 7
pHHA45 DK 2006 E. coli pig blaCTX-M-1 1d ST1 40 — + NT this study
35IT IT 2007 E. coli broiler blaCTX-M-1 1e ST1 40 NT NT NT 7
209 CR 2010 E. coli wild water bird qnrS1 2a ST1 45 tet(A), blaTEM-1 + + 9
231 CR 2010 E. coli wild water bird qnrS1 2c ST1 40 blaTEM-1 + + 9
p128.12(T) NL UN Salmonella
Kentucky
chicken qnrS1 2b ST1 50 NT + NT 5
pKT58A SK 2010 E. coli wild water bird qnrS1 3a ST3 50 strA, tet(A) + 2 9
58PLCIP PL 2010 E. coli wild water bird qnrS1 3b ST3 45 blaTEM-1, sul2, tet(A) + + 29
p168.27(T) NL UN Salmonella
Saintpaul
human qnrS1 3a ST3 50 NT + NT 5
31 PL 2009 E. coli wild water bird qnrS1 3b ST3 45 blaTEM-1, sul2, tet(A) + + 29
T20/B CR 2008 E. coli horse qnrB19 4 ST8 40 — + + 27
152.40(T) NL UN Salmonella
Typhimurium
human qnrB19 4 ST8 40 NT + NT 5
CR, Czech Republic; PL, Poland; SK, Slovakia; NL, the Netherlands; DK, Denmark; IT, Italy; UN, unknown; WWTP, wastewater treatment plant; NT, not tested.
a
RFLP by PvuII digestion.
IncNplasmidscarryingblaCTX-M-1andqnrgenesinEurope
335
JAC
atNewCopenhagenUniversityonMarch4,2013 http://jac.oxfordjournals.org/ Downloadedfrom
DNA sequencing of pKT58A and pHHA45 plasmids
Both the pMLST database and RFLP results give clear evidence
that the gene blaCTX-M-1 is mobilized by IncN plasmids belonging
to ST1, and plasmids of this group are the most prevalent
and widely distributed in Europe. Since the sequences of
ST1-CTX-M-1 plasmids were not present in GenBank, the entire
DNA sequence of the pHHA45 plasmid was determined, as representative
of this plasmid type. pHHA45 was 39510 bp in size,
encoding 51 predicted ORFs. The backbone region was
34179 bp while the region carrying the resistance determinants
was 5331 bp (Figure 2).
Since no DNA sequence of an IncN ST3-qnrS1 plasmid was
present in GenBank, plasmid pKT58A, identified in a wild water
bird in 2010, was randomly selected for complete sequence analysis
as representative of this plasmid type. pKT58A was
52148 bp, encoding 59 predicted ORFs. The plasmid comprised
a 36154 bp core region, encoding plasmid replication, horizontal
transfer machinery, maintenance and stability functions, and a
continuous 15994 bp variable region, which included the qnrS1
resistance gene, insertion sequences or transposons (Figure 2).
Sequence analysis of pKT58A showed a high similarity with
four antibiotic resistance IncN plasmids: pRSB201 (JN102341),
pRSB205 (JN102343), pRSB206 (JN102344) and pKOX105
(NC_014208). pRSB plasmids were identified in uncultured
bacteria from wastewater treatment plants in Germany14
and
pKOX105 originates from a human Klebsiella oxytoca strain
harbouring blaVIM-1 and qnrS1 from Italy.15
Comparative analysis of the two sequenced plasmids with
the IncN reference plasmid R46 demonstrated that they both
maintained a typical IncN plasmid scaffold, including the replicon,
the stbA-stbB-stbC genes involved in plasmid stability, the
mucA-mucB genes involved in mutagenesis enhancement, the
ardA-ardB and ardK-ardR genes providing antirestriction functions,
the ccg genes (ccgD-ccgD-ccgAI-ccgAII) that encode
products protecting plasmid DNA from the type I restriction
system and the two regions composing the conjugative apparatus
(first gene cluster: traL, traM, traA, traB, traC, traD,
traN, traE, traO, traF and traG; second gene cluster: traI, traJ
and traK)16 –18
(see Figure 2). These regions showed 99.9% nucleotide
identity. The ST1 and ST3 plasmids differed in the organization
of the antibiotic resistance region as well as in their
integration site within the plasmid scaffold. The blaCTX-M-1 gene
in pHHA45 is inserted between the mrr gene encoding type IV restriction
endonuclease and the EcoRII restriction/antirestriction
system, resulting in the deletion of part of the EcoRII gene. The
qnrS1 gene in pKT58A is located between the fipA and nuc
genes (Figure 2). Both of these two integration sites (between
the fipA and nuc genes or in proximity of the EcoRII restriction/
antirestriction system) have been observed in other IncN
plasmids. These two regions represent the two major hot spot
integration sites of transposable elements within the IncN
plasmid scaffold.14,15,19,20
Analysis of the antibiotic resistance region of plasmid
pKT58A
The antibiotic resistance region of pKT58A includes the streptomycin
resistance genes strB-strA as a part of a relic of the transposon
Tn5393 followed by the Tn1721-like element with the
gene pecM encoding a transporter protein and the tet(A)–
tet(R) tetracycline resistance cluster. The region containing the
quinolone resistance gene qnrS1 is located downstream of the
Figure 1. PvuII restriction profiles of selected IncN plasmids of ST1, ST3 and ST8. Restriction fragments identified by probes used for the Southern blot
hybridization experiments are indicated as follows: asterisks for repN, open circles for qnr and filled circles for blaCTX-M-1 probes. Two restriction
fragments are expected for the hybridization with the blaCTX-M-1 probe, since this gene contains an internal PvuII restriction site. DNA on the gel:
lane 1, E. coli 209; lane 2, Salmonella Kentucky p128.12(T); lane 3, E. coli 279/B; lane 4, E. coli Env1; lane 5, E. coli 35IT; lane 6, E. coli T20/B; lane
7, Salmonella Typhimurium 152.40(T); lane 8, Salmonella Saintpaul p168.27(T); lane 9, E. coli pKT58A; lane 10, 1 kb DNA extension ladder
(Invitrogen). Dendrograms were obtained by cluster analysis of RFLP profiles. Plasmids with DSIs ≥85% were assigned to the same cluster
designated with numbers 1, 2, 3 or 4. Letters were used to distinguish RFLP patterns belonging to the same cluster, but diverging for one or two
restriction bands (i.e. 1a, 1b, 1c etc.).
Dolejska et al.
336
atNewCopenhagenUniversityonMarch4,2013http://jac.oxfordjournals.org/Downloadedfrom
tet(R) gene. Both Tn5395 and Tn1721 have been found in many
plasmids of different incompatibility groups, but interestingly,
the same arrangement of Tn5395 followed by Tn1721 has
been recently demonstrated in the IncN ST3 pRSB205 plasmid
isolated in a wastewater treatment plant in Germany, which
was, however, negative for the presence of the qnrS1 gene.14
Plasmid pRSB205 may therefore represent the precursor of
pKT58A before the acquisition of the qnrS1 gene.
The genetic environment of the qnrS1 gene in pKT58A is novel
(Figure 3). The insertion sequence DISEcl2 is located upstream of
the qnrS1 gene (position 28823–29938) and consists of two
ORFs. It has been hypothesized that this insertion sequence
could have played a role in the original acquisition of qnrS1.21
Downstream of the qnrS1 five ORFs are present (positions
30899–34445) up to the nuc gene at the integration site.
These five ORFs encode a partially truncated resolvase and a
segment showing homology with the E. coli CS12 fibrial gene
cluster (AY009096). Similar arrangements of the qnrS1 gene
environment, including DISEcl2 upstream and the five ORFs
downstream, have been described in several plasmids,15,22– 25
but interestingly, in pKT58A the fibrial gene cluster is duplicated
upstream of DISEcl2 (Figure 3). The origin of this duplication is
not clear, and this arrangement represents a novel environment
of the qnrS1 gene.
Analysis of the antibiotic resistance region of plasmid
pHHA45
The blaCTX-M-1 region consisted of 214 bp of an ISEcp1 element
located upstream of the blaCTX-M-1 gene, truncated by the
integration of an IS26. The CTX-M-1 cluster flanked by IS26 on
both sides is integrated between the mrr and EcoRII genes,
belonging to the restriction/antirestriction system of IncN
plasmids (Figure 2). Downstream of the blaCTX-M-1 gene a nonfunctional
macrolide-resistance gene cluster was detected,
represented by a truncated mrx gene followed by the mph(A)
Figure 2. Major structural features of pKT58A and pHHA45 in comparison with IncN plasmid pRSB206, pQNR2078-ST8 and the IncN reference plasmid
R46. White boxes indicate plasmid scaffold regions that are in common among IncN plasmids. The tra genes composing the loci Tra 1 and Tra 2 are
indicated with capital letters inside the boxes. Orange boxes indicate antibiotic resistance genes and red boxes indicate transposon-related genes
(tnpA, tnpR and uvp1) or insertion sequences. The CUP-controlled regulon (ccg genes) is indicated by green boxes. The fipA and nuc genes are
indicated by blue boxes. The origin of transfer oriT is indicated by a blue circle. Areas shaded in grey indicate homologies in plasmid scaffold regions.
IncN plasmids carrying blaCTX-M-1 and qnr genes in Europe
337
JAC
atNewCopenhagenUniversityonMarch4,2013http://jac.oxfordjournals.org/Downloadedfrom
gene for macrolide 2′
-phosphotransferase followed by a second
IS26 element. The gene module IS26-DISEcp1-blaCTX-M-1Dmrx-mph(A)-IS26
was recently found in E. coli plasmids, including
those from the successful clone ST131 and those from
E. coli from pigs in Germany.26
In particular, this structure was
demonstrated in IncN plasmids pKC394 (HM138652), pKC406
(GQ274934), pKC409 (GQ274927) and pCTX246 (FN806790)
and IncI1 plasmid pKCT398 (GQ274931). Since the identical
structure of the blaCTX-M-1 region can be found in plasmids of different
incompatibility groups, it has been hypothesized that the
whole structure can be exchanged between different plasmid
backbones as a composite transposon mediated by an IS26
transposition event.26
Conclusions
All IncN plasmids harbouring the blaCTX-M-1 gene analysed in this
study, isolated from humans, animals and the environment from
different European countries, showed identical or closely related
RFLPs and belonged to the same ST1 group. Three qnrS1-carrying
plasmids isolated from water birds from Slovakia and Poland and
a human Salmonella enterica Saintpaul from the Netherlands
showed related RFLPs and belonged to the same ST3 group.
Two qnrB19-carrying plasmids originating from a horse E. coli
strain from the Czech Republic and a human S. enterica
Typhimurium from the Netherlands have been assigned to ST8
and also showed identical RFLP patterns. Therefore both pMLST
and RFLP results give clear evidence that there are specific
IncN plasmids that are successfully spreading in Europe, disseminating
specific resistance genes among different isolates from
animal and human sources. Multiple antibiotic resistance genes
were found to be collocated together with the PMQR or ESBL
genes on IncN plasmids; therefore, the role of selective pressure
by other antibiotic groups such as tetracyclines, which are widely
used in veterinary medicine, on plasmid dissemination needs to
be considered. ST1 and ST3 prototypic plasmids demonstrated
that although the IncN scaffold is very well conserved (99%
nucleotide identity), it is possible to classify them by pMLST in
homogeneous subgroups, which are confirmed by RFLP comparative
analysis. Two major integration sites within the IncN
plasmid scaffold are prevalently observed for the acquisition of
mobile elements carrying resistance genes. Resistance genes
and insertion sequences represent the major source of variability
for the evolution of IncN plasmids.
Figure 3. Comparison of the qnrS1 gene environments in different plasmids. The reading frames are shown as arrows, with the arrowhead indicating
the direction of transcription. The reading frames marked as 259, 213, res and 196 represent the region showing homology to the CS12 fimbrial gene
cluster of E. coli. The 5 bp TAAAA direct repeats at the boundaries of the Tn3 elements in pAH0276 and pINF5, as well as upstream of the qnrS1 region
of pKT58A, are shown in boxes. The grey boxes indicate the terminal inverted repeats of ISEcl2. Areas shaded in grey indicate homologies to the
sequences below and above the map of pKT58A. The broken lines between pKT58A and pKOX105 indicate inversion of a qnrS1 downstream region
in pKOX105 with respect to pKT58A. Four reading frames—196, res, 213 and 259—inside the light grey box indicate another copy of the region
showing homology to the CS12 fimbrial gene cluster of E. coli.
Dolejska et al.
338
atNewCopenhagenUniversityonMarch4,2013http://jac.oxfordjournals.org/Downloadedfrom
Funding
This study was funded by grants to: M. D. by the Czech Science Foundation
(P502/10/P083) and CEITEC (CZ.1.05/1.1.00/02.0068); H. H. by the
Center for Genomic Epidemiology (09-067103/DSF); L. H. by the Lundbeck
Foundation (DK nr R44-A4384); and A. C. by MIUR CNR flagship PB05
‘InterOmics’ project. M. D. received the FEMS Advanced Fellowship 2011
to work in the laboratory of A. C. at Istituto Superiore di Sanita`, Rome.
Transparency declarations
None to declare.
References
1 Belogurov AA, Delver EP, Rodzevich OV. IncN plasmid pKM101 and
IncI1 plasmid ColIb-P9 encode homologous antirestriction proteins in
their leading regions. J Bacteriol 1992; 174: 5079–85.
2 Johnson TJ, Wannemuehler YM, Johnson SJ et al. Plasmid replicon
typing of commensal and pathogenic Escherichia coli isolates. Appl
Environ Microbiol 2007; 73: 1976–83.
3 Carattoli A. Resistance plasmid families in Enterobacteriaceae.
Antimicrob Agents Chemother 2009; 53: 2227–38.
4 Moodley A, Guardabassi L. Transmission of IncN plasmids carrying
blaCTX-M-1 between commensal Escherichia coli in pigs and farm
workers. Antimicrob Agents Chemother 2009; 53: 1709–11.
5 Garcı´a-Ferna´ndez A, Fortini D, Veldman K et al. Characterization of
plasmids harbouring qnrS1, qnrB2 and qnrB19 genes in Salmonella.
J Antimicrob Chemother 2009; 63: 274–81.
6 Dolejska M, Jurcickova Z, Literak I et al. IncN plasmids carrying
blaCTX-M-1 in Escherichia coli isolates on a dairy farm. Vet Microbiol 2011;
149: 513–6.
7 Garcı´a-Ferna´ndez A, Villa L, Moodley A et al. Multilocus sequence typing
of IncN plasmids. J Antimicrob Chemother 2011; 66: 1987–91.
8 Szmolka A, Fortini D, Villa L et al. First report on IncN plasmid-mediated
quinolone resistance gene qnrS1 in porcine Escherichia coli in Europe.
Microb Drug Resist 2011; 17: 567–73.
9 Tausova D, Dolejska M, Cizek A et al. Escherichia coli with
extended-spectrum b-lactamase and plasmid-mediated quinolone
resistance genes in great cormorants and mallards in Central Europe.
J Antimicrob Chemother 2012; 67: 1103–7.
10 Carattoli A, Bertini A, Villa L et al. Identification of plasmids by
PCR-based replicon typing. J Microbiol Methods 2005; 6: 219–28.
11 Hopkins KL, Wootton L, Day MR et al. Plasmid-mediated quinolone
resistance determinant qnrS1 found in Salmonella enterica strains
isolated in the UK. J Antimicrob Chemother 2007; 59: 1071–5.
12 Pitout JD, Hossain A, Hanson ND. Phenotypic and molecular detection
of CTX-M-b-lactamases produced by Escherichia coli and Klebsiella spp.
J Clin Microbiol 2004; 42: 5715–21.
13 Schink AK, Kadlec K, Schwarz S. Detection of qnr genes among
Escherichia coli isolates of animal origin and complete sequence of the
conjugative qnrB19-carrying plasmid pQNR2078. J Antimicrob Chemother
2012; 67: 1099–102.
14 Eikmeyer F, Hadiati A, Szczepanowski R et al. The complete genome
sequences of four new IncN plasmids from wastewater treatment
plant effluent provide new insights into IncN plasmid diversity and
evolution. Plasmid 2012; 68: 13–24.
15 Carattoli A, Aschbacher R, March A et al. Complete nucleotide
sequence of the IncN plasmid pKOX105 encoding VIM-1, QnrS1 and
SHV-12 proteins in Enterobacteriaceae from Bolzano, Italy compared
with IncN plasmids encoding KPC enzymes in the USA. J Antimicrob
Chemother 2010; 65: 2070–5.
16 Clerch B, Bravo JM, Llagostera M. Efficiency of MucAB and Escherichia
coli UmuDC proteins in quinolone and UV mutagenesis in Salmonella
typhimurium: effect of MucA and UmuD processing. Mutat Res 1996;
349: 201–8.
17 Delver EP, Belogurov AA. Organization of the leading region of IncN
plasmid pKM101 (R46): a regulation controlled by CUP sequence
elements. J Mol Biol 1997; 271: 13–30.
18 Paterson ES, More´ MI, Pillay G et al. Genetic analysis of the
mobilization and leading regions of the IncN plasmids pKM101 and
pCU1. J Bacteriol 1999; 181: 2572–83.
19 Gootz TD, Lescoe MK, Dib-Hajj F et al. Genetic organization of
transposase regions surrounding blaKPC carbapenemase genes on
plasmids from Klebsiella strains isolated in a New York City hospital.
Antimicrob Agents Chemother 2009; 53: 1998–2004.
20 Poirel L, Bonnin RA, Nordmann P. Analysis of the resistome of a
multidrug-resistant NDM-1-producing Escherichia coli strain by
high-throughput genome sequencing. Antimicrob Agents Chemother
2011; 55: 4224–9.
21 Poirel L, Leviandier C, Nordmann P. Prevalence and genetic analysis of
plasmid-mediated quinolone resistance determinants QnrA and QnrS in
Enterobacteriaceae isolates from a French university hospital.
Antimicrob Agents Chemother 2006; 50: 3992–7.
22 Chen YT, Shu HY, Li LH et al. Complete nucleotide sequence of pK245,
a 98-kilobase plasmid conferring quinolone resistance and extendedspectrum-b-lactamase
activity in a clinical Klebsiella pneumoniae
isolate. Antimicrob Agents Chemother 2006; 50: 3861–6.
23 Hu FP, Xu XG, Zhu DM et al. Coexistence of qnrB4 and qnrS1 in a
clinical strain of Klebsiella pneumoniae. Acta Pharmacol Sin 2008; 29:
320–4.
24 Hata M, Suzuki M, Matsumoto M et al. Cloning of a novel gene for
quinolone resistance from a transferable plasmid in Shigella flexneri 2b.
Antimicrob Agents Chemother 2005; 49: 801–3.
25 Kehrenberg C, Friederichs S, de Jong A et al. Identification of the
plasmid-borne quinolone resistance gene qnrS in Salmonella enterica
serovar Infantis. J Antimicrob Chemother 2006; 58: 18–22.
26 Cullik A, Pfeifer Y, Prager R et al. A novel IS26 structure surrounds
blaCTX-M genes in different plasmids from German clinical Escherichia
coli isolates. J Med Microbiol 2010; 59: 580–7.
27 Dolejska M, Duskova E, Rybarikova J et al. Plasmids carrying blaCTX-M-1
and qnr genes in Escherichia coli isolates from an equine clinic and a
horseback riding centre. J Antimicrob Chemother 2011; 66: 757–64.
28 Literak I, Petro R, Dolejska M et al. Antimicrobial resistance in fecal
Escherichia coli isolates from healthy urban children of two age groups
in relation to their antibiotic therapy. Antimicrob Agents Chemother
2011; 55: 3005–7.
29 Literak I, Dolejska M, Janoszowska D et al. Antibiotic-resistant
Escherichia coli bacteria, including strains with genes encoding the
extended-spectrum b-lactamase and QnrS, in waterbirds on the Baltic
Sea Coast of Poland. Appl Environ Microbiol 2010; 76: 8126–34.
30 Dolejska M, Frolkova P, Florek M et al. CTX-M-15-producing Escherichia
coli clone B2-O25b-ST131 and Klebsiella spp. isolates in municipal
wastewater treatment plant effluents. J Antimicrob Chemother 2011;
66: 2784–90.
IncN plasmids carrying blaCTX-M-1 and qnr genes in Europe
339
JAC
atNewCopenhagenUniversityonMarch4,2013http://jac.oxfordjournals.org/Downloadedfrom
Příloha 15
DOLEJSKA, M., VILLA, L., POIREL, L., NORDMANN, P., CARATTOLI, A., 2013, Complete sequencing
of an IncHI1 plasmid encoding the carbapenemase NDM-1, the ArmA 16S RNA methylase and a
resistance-nodulation-cell division/multidrug efflux pump: Journal of Antimicrobial
Chemotherapy, v. 68, p. 34-39.
Souhrn
V této práci byla metodou nové generace sekvenování stanovena primární nukleotidová sekvence IncHI1
plazmidu nesoucího geny pro karbapenemázu NDM-1 a ArmA pro rezistenci k aminoglykosidům. Gen
blaNDM-1 se na plazmidu nacházel jako součást nové genetické platformy. Anotace kódujících genů a komparace
s daty v genové bance ukázala na přítomnost sekvence profága, ve které byly neseny geny pro multirezistentní
RND efluxní pumpu. Studie popisuje jedinečnou strukturu multirezistentního plazmidu nesoucího gen
pro celosvětově rozšířenou karbapenemázu NDM-1.
Complete sequencing of an IncHI1 plasmid encoding the
carbapenemase NDM-1, the ArmA 16S RNA methylase and a
resistance–nodulation–cell division/multidrug efflux pump
Monika Dolejska1, Laura Villa1, Laurent Poirel2, Patrice Nordmann2 and Alessandra Carattoli1*
1
Department of Infectious, Parasitic and Immuno-Mediated Diseases, Istituto Superiore di Sanita`, Rome, Italy; 2
Service de Bacte´riologieVirologie,
INSERM U914 ‘Emerging Resistance to Antibiotics’, Hoˆpital de Biceˆtre, Faculte´ de Me´decine et Universite´ Paris-Sud,
K.-Biceˆtre, France
*Corresponding author. Tel: +39-06-4990-3128; Fax: +39-06-4938-7112; E-mail: alecara@iss.it
Received 25 June 2012; returned 18 July 2012; revised 25 July 2012; accepted 9 August 2012
Objectives: To characterize the pNDM-CIT plasmid identified in Citrobacter freundii carrying genes encoding the
metallo-b-lactamase NDM-1 and the 16S RNA methylase ArmA.
Methods: The complete DNA sequence of pNDM-CIT was obtained by using the 454-Genome Sequencer FLX
procedure on a library obtained using plasmid DNA purified from the pNDM-CIT Escherichia coli J53 transconjugant.
Contig assembly and predicted gaps were confirmed and filled by PCR-based gap closure. Comparative
analysis with IncHI1 incompatibility group plasmids was performed using BLASTN and BLASTP algorithms.
Results: Plasmid pNDM-CIT was 288920 bp and revealed an IncHI1 plasmid scaffold, showing novel resistance and
potential virulence determinants. The blaNDM-1 gene was identified within a novel genetic context, flanked by a
duplicationoftheclass1integrononbothsides.ThereplicasegenerepAciN,originatingfromAcinetobacterspp.plasmids,
was identified in a close association with the Tn1548::armA transposon and the macrolide resistance mel–
mph2 cluster. The same structure was identified in silico from a series of enterobacterial plasmids carrying the
armA gene. The repAciN gene probably represents a remnant sign of the original occurrence of the armA gene in
Acinetobacter plasmids. A CP4-like prophage sequence was identified in pNDM-CIT, containing a resistance–nodulation–cell
division/multidrug resistance (RND/MDR) efflux pump cluster surrounded by two IS1-like elements. This
resistance determinant, associated with such a prophage sequence, has never been reported on plasmids.
Conclusions: Plasmid pNDM-CIT differed significantly from all known blaNDM-1-carrying plasmids identified in
Enterobacteriaceae, since it combines the metallo-b-lactamase NDM-1, the 16S RNA methylase ArmA and a
cryptic prophage carrying the RND/MDR efflux pump.
Keywords: MexA, MexB, CP4 prophage, replicons, Citrobacter freundii
Introduction
The emergence of NDM-1-producing isolates is one of the latest
threats in multidrug resistance in Gram-negative bacteria. It has
been shown that the emergence of the blaNDM-1 gene is not
related to the spread of epidemic clones (different strain
genetic backgrounds have been identified and several bacterial
species are involved) or epidemic plasmids.1
The different plasmid scaffolds that have been shown to contribute
to the dissemination of the blaNDM-1 gene basically belong
to several families, including IncN, IncA/C, IncL/M and IncH.2–7
In
addition, large (.250 kb) and non-typeable plasmids (nontypeable
using the current PCR-based replicon typing scheme)8
showing conjugative transfer significantly more frequent at 308C
than at 378C have recently been identified in NDM-1-producing
isolates from seepage and public tap water collected in New
Delhi, India.9
This has led to the hypothesis that these plasmids
will further contribute to the dissemination of the blaNDM-1 gene
among bacterial species in water and soil environments.
The IncH family includes several plasmid types producing along
and flexible conjugation H-type pilus.10,11
Thermosensitivity of the
conjugative apparatus is a well-known phenomenon described for
the IncHI plasmids.12
Transcriptional analysis of the transfer
region revealed that one of the key genes in the transfer locus is
transcribed in a temperature-dependent manner, with reduced
levels of expression at 378C and optimal transfer at 22–308C.13
Plasmid R27, originally identified in tetracycline-resistant Salmonella
enterica serovar Typhimurium strain 1M1407 (erroneously
reported as Salmonella Typhi, http://www.genome.wisc.edu/
sequencing/sty2.htm), isolated in the UK in 1961, represents the
# The Author 2012. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: journals.permissions@oup.com
J Antimicrob Chemother 2013; 68: 34–39
doi:10.1093/jac/dks357 Advance Access publication 11 September 2012
34
atNewCopenhagenUniversityonAugust7,2013http://jac.oxfordjournals.org/Downloadedfrom
archetype of an IncHI1 plasmid type, whereas plasmid R478, identified
in Serratia marcescens from the USA in 1969, represents the
archetype of an IncHI2 plasmid type.11
Plasmids R27 and R478
have been fullysequenced and extensivelystudied, demonstrating
that they actually possess two transfer regions (Tra1 and Tra2),
sharing 71%–78% nucleotide identity, and carry specific replicons
that are unique to this plasmid family (RepHIA and RepHI1B).14 –16
We recently described an IncH-like plasmid, pNDM-MAR, carrying
the blaNDM-1 gene. This plasmid harbours novel replicons
and transfer loci, defining a novel plasmid type within the
IncH plasmid family. This plasmid co-harbours the extendedspectrum
b-lactamase (ESBL) gene blaCTX-M-15 together with the
quinolone resistance gene qnrB1, but did not carry any 16S rRNA
methylase gene, by contrast to other blaNDM-1-positive plasmids.4
We report here the full sequence of the plasmid recovered from
Citrobacter freundii STE, causing a urinary infection inapatientwho
was hospitalized in south-eastern India in July 2010. This isolate
possessed an extremely large number of resistance genes, including
nine different b-lactamase genes, namely blaNDM-1, blaVIM-4,
blaOXA-181, blaCTX-M-15, blaOXA-1, blaOXA-9, blaOXA-10, blaTEM-1 and
blaCMY, in addition to the 16S RNA methylase armA gene, which
confers high-level resistance to all aminoglycosides.17
All these resistance
genes had been identified on four different plasmids.17
The blaNDM-1 gene was co-transferred together with armA by conjugation,
and both genes were shown to be located on a very large
plasmid (.200 kb), named pNDM-CIT. The objective of this study
was to identify the genetic structure and characteristics of that
plasmid.
Materials and methods
Bacterial strains
Plasmid pNDM-CIT was obtained by conjugation using C. freundii STE as
the donor.17
Mating-out assays were performed at 308C and 378C
using an azide-resistant Escherichia coli strain, J53, as the recipient. Selection
of transconjugants was undertaken by plating on Mueller–
Hinton agar containing cefoxitin (10 mg/L) and azide (100 mg/L) in
order to specifically recover the blaNDM-1-carrying plasmid. PCR analysis
confirmed that plasmid pNDM-CIT harboured both blaNDM-1 and armA
genes. Plasmid analysis performed by using the Kieser method showed
that plasmid pNDM-CIT was larger than 250 kb.18
Plasmid DNA sequencing
The complete DNA sequence of the pNDM-CIT plasmid was obtained by
using the 454-Genome Sequencer FLX procedure (Roche Diagnostic,
Monza, Milan) on a library obtained using plasmid DNA purified from
the pNDM-CIT E. coli J53 transconjugant. Plasmid DNA was purified
using the Invitrogen PureLinkTM
HiPure Plasmid Filter Midiprep Kit (Invitrogen,
Milan, Italy), according to the manufacturer’s procedure.
De novo assembly of DNA reads and gap closure
Nineteen contigs ranging from 119994 to 217 bp, with at least a 50-fold
coverage, were obtained using the GS-FLX gsAssembler software. Contigs
were first assembled in silico by the 454 ReadStatus output file, generated
by the gsAssembler software, identifying reads overlapping adjacent
contigs. Contig assembly and predicted gaps were then confirmed and
filled by PCR-based gap closure, by Sanger DNA sequencing of the
amplicons (Applied Biosystems, Foster City, CA, USA).
Annotation
Gene prediction was performed for the complete plasmid sequence with
Artemis Version 8 (Sanger Institute). Pairwise alignment was performed
by a BLASTN and BLASTP homology search (http://blast.ncbi.nlm.nih.
gov/Blast.cgi). The region relative to the CP4-like prophage was analysed
by BLASTP at the http://www.ecogene.org/ website.
Phylogenetic analysis of IncHI plasmids
Phylogenetic analysis of nucleotide alignments was performed on
the following IncHI1 plasmid sequences, downloaded from GenBank:
pMAK1 (AB366440), pHCM1 (AL513383), pAKU_1 (AM412236), pO111_1
(AP010961) and R27 (AF250878).14,19–22
The analysis also included the
IncHI2 plasmid R478 (NC_005211) and pNDM-MAR belonging to a novel,
not yet defined, IncH group (JN420336). Repetitive regions or inserted
sequences were excluded, so that the phylogenetic analysis was limited
to the conserved IncHI1 core regions, including the replicons, and the
Tra1 and Tra2 regions (shaded in Figure 1). The alignment was generated
using DNAMAN phylogenetic analysis software (Lynnon BioSoft, Vaudreuil,
Quebec, Canada) for quick alignment with a gap penalty of 7, K-tuple of 3,
number of top diagonals of 5 and a window size of 5, based on the Kimura
method, generating rooted trees.23
Nucleotide sequence accession number
The complete sequence of pNDM-CIT has been deposited in the EMBL
Nucleotide Sequence Database under GenBank accession number
JX182975.
Results and discussion
Complete sequence of plasmid pNDM-CIT
Plasmid pNDM-CIT was 288920 bp, thus amounting to the
largest blaNDM-1-bearing plasmid ever described, being also one
of the largest plasmids identified in Enterobacteriaceae so far.
It contained 265 predicted coding sequences (CDSs) [Figure 1
and Table S1 (available as Supplementary data at JAC Online)].
BLASTN comparison revealed a novel IncHI1 plasmid scaffold,
showing 80%–100% nucleotide identity and 47%–53% coverage
with plasmids pMAK1 from S. enterica Choleraesuis, pHCM1
from S. enterica Typhi, pAKU_1 from S. enterica Paratyphi
A, pO111_1 from E. coli and R27 from S. enterica Typhimurium.14,19
–22
The Tra1–Tra2 regions of plasmid pNDM-CIT
showed 88%–90% nucleotide identity with those of the
other previously mentioned IncHI1 plasmids (Figure 2). The
pNDM-CIT was non-typeable by IncHI1 plasmid multilocus sequence
typing (http://pubmlst.org/plasmid/), since it lacked the
HCM1.178ac allele and showed limited similarity (85%–93% nucleotide
identity) with the alleles of the other IncHI1 plasmids.24
However, plasmid pNDM-CIT harboured two replicons showing
91% and 97% nucleotide identity with, respectively, RepHI1B
and RepHIA of the other IncHI1 plasmids. The RepHI1B replicon
is specific to the IncHI1 subgroup, whereas plasmids IncHI1 and
IncHI2 are not compatible with each other since they share the
common replicon RepHIA.11,15
Phylogenetic analysis suggested
that pNDM-CIT belongs to a new plasmid type, highly related
to the IncHI1 plasmid family (Figure 2). Novel primers HI1-FW
(5′
-ATT CCA GAA AAC CGA TCT CTT T-3′
) and HI1-RV (5′
-AAT CAT
GGT GTG GGA TCG TTT-3′
), amplifying an expected 534 bp
fragment, were designed to provide an updated and specific
IncHI1 plasmid carrying blaNDM-1
35
JAC
atNewCopenhagenUniversityonAugust7,2013http://jac.oxfordjournals.org/Downloadedfrom
PCR-based replicon typing scheme to identify all plasmids
belonging to the IncHI1 family, including plasmid pNDM-CIT,
but not the IncH pNDM-MAR plasmid, whose specific primers
have been reported previously.4
In fact, pNDM-MAR differs significantly
from pNDM-CIT and the other IncHI1 plasmids, sharing
only 71%–78% nucleotide identity in the two transfer regions
and 61% identity in the RepHI1B replicon and lacking RepHIA
(Figures 1 and 2).
Transposon Tn1548 carrying armA harbours an
Acinetobacter replicase gene
A third replicase gene, that we termed repAciN, was identified on
the same plasmid, pNDM-CIT, between nucleotide positions
31861 and 32688, and encoding a putative replicase protein
belonging to the Rep3 family (pfam1051; Figure 3). Using
BLASTN analysis, the repAciN sequence was found to match
perfectly (100% nucleotide identity) with plasmids pMR0211
and pNDM-HK, both carrying the blaNDM-1 gene, identified,
respectively, from Providencia stuartii (JN687470)25
and E. coli
(HQ451074),2
but also with a series of plasmids including pXD1
from S. enterica Paratyphi B recovered from chickens in China
(JN225877),26
pPG010208 from E. coli recovered from cattle in
Chile (HQ023861),27
pFP10-2 from Klebsiella oxytoca recovered
from humans in China (HQ651093),28
pKPN5 from Klebsiella
pneumoniae recovered from humans in the USA (NC_009651),
pKP048 from K. pneumoniae recovered from humans in China
(FJ628167),29
pMUR050 from E. coli recovered from pigs in
Figure 1. Major structural features of pNDM-CIT in comparison with: IncHI1 plasmids pHCM1 (GenBank accession number AL513383), pAKU_1
(GenBank accession number AM412236) and R27 (GenBank accession number AF250878); IncHI2 plasmid R478 (GenBank accession number
NC_005211); and IncH-like plasmid pNDM-MAR (GenBank accession number JN420336). White boxes indicate plasmid scaffold regions that are in
common among plasmids. Shaded regions were used for phylogenetic analysis (shown in Figure 2). The locus Tra is indicated by white boxes with
capital letters indicating the respective tra genes (i.e. J, traJ; D, traD; I, traI, etc.). Resistance genes are indicated by orange boxes, except the
blaNDM-1 gene, which is indicated by a blue box, and the RND/MDR efflux pump cluster, which is shown in pale blue. Transposon-related genes
(tnpA, tnpR and tnpM), the class 1 integrase and insertion sequences are indicated by red boxes. Other genes are indicated by coloured boxes as
follows: violet, replicase genes; grey, restriction enzyme and DNA methylase genes; dark green, genes encoding prophage-related proteins; and
pale green, groEL-groES cluster.
Dolejska et al.
36
atNewCopenhagenUniversityonAugust7,2013http://jac.oxfordjournals.org/Downloadedfrom
Spain (AY522431)30
and pCTX-M3 from C. freundii recovered from
humans in Poland (AF550415).31
It is worth noting that the
repAciN gene has also been identified on plasmid pMDR-ZJ06
(CP001938) obtained from the multidrug-resistant Acinetobacter
baumannii strain MDR-ZJ06,32
in this case being the only replicase
gene identified on that plasmid. In all the plasmids mentioned
above, the repAciN gene was located close to the
mph2 gene (encoding high-level resistance to macrolides)
and the Tn1548::armA transposon (encoding resistance to all
aminoglycosides). BLASTP analysis identified proteins sharing
60%–100% amino acid identity with the Rep3 replicase in more
than 20 different plasmids from different Acinetobacter species,
including A. baumannii, Acinetobacter lwoffii, Acinetobacter venetianus,
Acinetobacter haemolyticus and Acinetobacter johnsonii.
However, none of these plasmids harboured any armA gene.
This comparative analysis strongly suggests that the original mobilization
of the Tn1548::armA-mel-mph2-repAciN module occurred
through an IS26-mediated transposition targeting an
Acinetobacter sp. plasmid such as pMDR-ZJ06, and that the
module was then transferred to enterobacterial plasmids, thus
Figure 3. Comparative analysis of the Tn1548::ArmA region among plasmids, and the genetic environment of the blaNDM-1 gene in pNDM-CIT. Pairwise
comparison of plasmid regions in pNDM-CIT (JX182975), pMR0211 (JN687470), pNDM-HK (HQ451074), pMDR-ZJ06 (CP001938), pXD1 (JN225877) and
pCTX-M3 (AF550415). The Tn1548::armA transposon is indicated by orange arrows and the blaNDM-1 and mel-mph2 genes are indicated by blue and
green arrows, respectively. Grey and red arrows indicate the ISCR1 and IS26 elements, respectively. The repAciN gene is indicated by violet arrows.
Figure 2. Phylogenetic relationship among IncH plasmids. The phylogenetic analysis was performed by aligning 70000 bp of concatenated
sequences (corresponding to regions shaded in Figure 1), identified among eight publicly available IncH plasmid sequences: pNDM-CIT (JX182975),
pMAK1 (AB366440), pHCM1 (AL513383), pAKU_1 (AM412236), pO111_1 (AP010961), R27 (AF250878), R478 (NC_005211) and pNDM-MAR
(JN420336). The phylogenetic tree was obtained using the DNAMAN phylogenetic analysis software (Lynnon BioSoft, Vaudreuil, Quebec, Canada).
The bar corresponds to the scale of sequence divergence.
IncHI1 plasmid carrying blaNDM-1
37
JAC
atNewCopenhagenUniversityonAugust7,2013http://jac.oxfordjournals.org/Downloadedfrom
promoting the spread of the armA gene. It is likely that the repAciN
gene was trapped in that module, and our hypothesis is that it
now represents a remnant sign of the original occurrence of the
armA gene among Acinetobacter plasmids.
Genetic environment of the blaNDM-1 gene and other
resistance genes on pNDM-CIT
Transposon Tn1548::armA was flanked by a class 1 integron harbouring
different resistance gene cassettes and associated with
the ISCR1 element. In particular, the dfrA12 and aadA2 gene cassettes,
encoding resistance to trimethoprim and streptomycin respectively,
were identified (Figure 3). In all previously analysed
armA-positive plasmids, the module encompassing the integron/Tn1548/repAciN
sequences was flanked by two directly
repeated IS26 elements that probably mediated the acquisition
of the element by promoting homologous recombination
processes. In plasmid pNDM-CIT, a duplication of the class 1 integron
was observed and the duplicated element carried the
blaNDM-1 gene into a novel genetic context. Immediately upstream
of the blaNDM-1 gene, a remnant of the ISAba125 insertion
sequence was identified (Figure 3). This truncated ISAba125
comprised the 235 promoter sequence leading to blaNDM-1
gene expression and was previously observed in all the blaNDM-1
genetic environments.3
Downstream of the blaNDM-1 gene, the
bleMBL gene encoding resistance to bleomycin was identified,
together with a truncated gene encoding a phosphoribosylanthranilate
isomerase, as previously found on most other
blaNDM-1-carrying plasmids as well.2,3
The ISCR1 insertion sequence
was then identified, followed by an identical class 1 integron
structure containing dfrA12 and aadA2 gene cassettes. The
duplicated intI1 gene was followed by the tnpR and tnpA genes
of transposon Tn21, then by a copy of insertion sequence IS4321,
by the cat gene (encoding resistance to chloramphenicol) and
finally by a copy of IS1. Plasmid pNDM-CIT also harboured gene
clusters encoding resistance to tellurite and arsenic, suggesting
a soil origin of this plasmid. In addition to those resistance
determinants, plasmid pNDM-CIT, as previously described for
pNDM-MAR, carried genes encoding the EcoRII endonuclease
and DNA methylases, promoting plasmid stability (Figure 1).
Features of the resistance–nodulation–cell division/
multidrug resistance (RND/MDR) efflux pump cluster
and its genetic context
From nucleotide positions 147112 to 187668, a CP4-like prophage
sequence was identified that contained an RND/MDR
efflux pump cluster surrounded by two IS1-like elements. This
cluster encodes the AcrR transcriptional repressor for the RND/
MDR system, comprising a membrane fusion protein similar to
MexA, an RND/MDR efflux transporter similar to MexB and an
outer membrane lipoprotein component, similar to the CusC
for silver and copper efflux (Figure 1). The MexA-like protein
shared the highest identity with that of Bordetella petrii (68%),
the MexB-like protein shared the highest identity with that of
Enterobacter mori (74%) and the OprD-like outer membrane
protein shared the highest identity with that of the waterborne
Rahnella aquatilis species (63%).
The CP4-like prophage carrying this efflux system module is a
chimeric form of the CP4-6 and CP4-57 prophages. It has formerly
been shown that nine different prophages, including CP4-6 and
CP4-57, have been captured at different stages during the evolution
of the E. coli K-12 genome, but they have been reported only
rarely on plasmids.33,34
The CP4-57 and CP4-6 cryptic prophages
that have integrated into the chromosome of E. coli K-12 are defective
prophages of 22030 bp (22 genes and 4 pseudogenes)
and 34308 bp (29 genes and 5 pseudogenes), respectively (http
://www.ecogene.org/); they require a P2 help phage to form
virions, but can excise and replicate on their own as free plas-
mids.35,36
The beneficial impact of the cryptic prophages on host
physiology has been extensively studied, demonstrating that
they confer the ability to grow more rapidly and to obtain higher
yields on nutrients, being also involved in biofilm development
and increased resistance to antimicrobials. These prophages
carry toxin–antitoxin systems, consisting of the YpjF–YfjZ
(CP4-57) and YkfI–YafW (CP4-6) protein pairs, directly related to
the resistance to antibiotics due to persister cell formation,
biofilm formation and general stress response.34,35
However, the
CP4-like prophage identified in pNDM-CIT is likely to be a relict,
whose unique relevant function may be associated with the
toxin–antitoxin system that is well conserved and probably functioning.
The toxin–antitoxin system identified on plasmid
pNDM-CIT consisted of a chimeric YkfI–YfjZ toxin–antitoxin pair,
composed of the toxin of CP4-6 and the antitoxin of CP4-57. The
integrases IntA and AlpA, known to be a key transcriptional regulator
of IntA, were also identified on pNDM-CIT. Interestingly, it has
been demonstrated that the overexpression of AlpA encoded by
CP4-57 led to the excision from planktonic cells of the prophage,
and this excision was associated with cell death. In the
pNDM-CIT sequence, the alpA gene was disrupted by the integration
of the RND/MDR efflux pump cluster, and therefore the overexpression
of AlpA is unlikely to occur.
Conclusions
Plasmid pNDM-CITpossesses interesting features, since it contains
genes encoding the metallo-b-lactamase NDM-1 and the 16S RNA
methylase ArmA, in addition to a cryptic prophage carrying the
RND/MDR efflux pump. Association of phage-like genes has been
described for rare ESBL genes such as the blaCTX-M ESBL genes.37
The impact of the expression of this acquired efflux pump on antibiotic
resistance, and the process of its acquisition, merits further
investigation. This work further indicates that plasmids carrying
the blaNDM-1 gene are very diverse in terms of genetic structure.
Nevertheless, they accumulate a series of antibiotic resistance
determinants in most cases. The existence of co-resistance
markers, located on single plasmids, suggests that the process
of the selection of NDM-1-carrying plasmids may be associated
with many unrelated antibiotic molecules or toxic compounds.
Acknowledgements
We thank Claudia Feudi (Istituto Superiore di Sanita`, Rome, Italy) for
excellent laboratory assistance.
Funding
This work was supported by the grant ‘Interomics’ financed by the Italian
National Council of Research (CNR) and by a grant from the INSERM
(U914).
Dolejska et al.
38
atNewCopenhagenUniversityonAugust7,2013http://jac.oxfordjournals.org/Downloadedfrom
Transparency declarations
None to declare.
Supplementary data
Table S1 is available as Supplementary data at JAC Online (http://jac.
oxfordjournals.org/).
References
1 Nordmann P, Poirel L, Walsh TR et al. The emerging NDM
carbapenemases. Trends Microbiol 2011; 19: 588–95.
2 Ho PL, Lo WU, Yeung MK et al. Complete sequencing of pNDM-HK
encoding NDM-1 carbapenemase from a multidrug-resistant Escherichia
coli strain isolated in Hong Kong. PLoS One 2011; 6: e17989.
3 Poirel L, Dortet L, Bernabeu S et al. Genetic features of blaNDM-1-positive
Enterobacteriaceae. Antimicrob Agents Chemother 2011; 55: 5403–7.
4 Villa L, Poirel L, Nordmann P et al. Complete sequencing of an IncH
plasmid carrying the blaNDM-1, blaCTX-M-15 and qnrB1 genes. J Antimicrob
Chemother 2012; 67: 1645–50.
5 Sekizuka T, Matsui M, Yamane K et al. Complete sequencing of the
blaNDM-1-positive IncA/C plasmid from Escherichia coli ST38 isolate
suggests a possible originfrom plant pathogens. PLoS One 2011; 6: e25334.
6 Kumarasamy KK, Toleman MA, Walsh TR et al. Emergence of a new
antibiotic resistance mechanism in India, Pakistan, and the UK: a
molecular, biological, and epidemiological study. Lancet Infect Dis
2010; 10: 597–602.
7 Bonnin RA, Poirel L, Carattoli A et al. Characterization of an IncFII
plasmid encoding NDM-1from Escherichia coli ST131. PLoS One 2012; 7:
e34752.
8 Carattoli A, Bertini A, Villa L et al. Identification of plasmids by
PCR-based replicon typing. J Microbiol Methods 2005; 63: 219–28.
9 Walsh TR, Weeks J, Livermore DM et al. Dissemination of NDM-1
positive bacteria in the New Delhi environment and its implications for
human health: an environmental point prevalence study. Lancet Infect
Dis 2011; 11: 355–62.
10 Taylor DE, Grant RB. Incompatibility and surface exclusion properties
of H1 and H2 plasmids. J Bacteriol 1977; 131: 174–8.
11 Phan MD, Wain J. IncHI plasmids, a dynamic link between resistance
and pathogenicity. J Infect Dev Ctries 2008; 2: 272–8.
12 Taylor DE, Levine JG. Studies of temperature-sensitive transfer and
maintenance of H incompatibility group plasmids. J Gen Microbiol 1980;
116: 475–84.
13 Gunton JE, Gilmour MW, Alonso G et al. Subcellular localization and
functional domains of the coupling protein, TraG, from IncHI1 plasmid
R27. Microbiology 2005; 151: 3549–61.
14 Sherburne C, Lawley TD, Gilmour MWet al. The complete DNA sequence
and analysis of R27, a large IncHI plasmid from Salmonella typhi that is
temperature sensitive for transfer. Nucleic Acids Res 2000; 28: 2177–86.
15 Gilmour MW, Thomson NR, Sanders M et al. The complete nucleotide
sequence of the resistance plasmid R478: defining the backbone
components of incompatibility group H conjugative plasmids through
comparative genomics. Plasmid 2004; 52: 182–202.
16 Gabant P, Newnham P, Taylor D et al. Isolation and location on the
R27 map of two replicons and an incompatibility determinant specific
for IncHI1 plasmids. J Bacteriol 1993; 175: 7697–701.
17 Poirel L, Ros A, Carricajo A et al. Extremely drug-resistant Citrobacter
freundii isolate producing NDM-1 and other carbapenemases identified
in a patient returning from India. Antimicrob Agents Chemother 2011;
55: 447–8.
18 Kieser T. Factors affecting the isolation of CCC DNA from Streptomyces
lividans and Escherichia coli. Plasmid 1984; 12: 19–36.
19 Parkhill J, Dougan G, James KD et al. Complete genome sequence of a
multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature
2001; 413: 848–52.
20 Holt KE, Thomson NR, Wain J et al. Multidrug-resistant Salmonella
enterica serovar Paratyphi A harbors IncHI1 plasmids similar to those
found in serovar Typhi. J Bacteriol 2007; 189: 4257–64.
21 Smith HR, Grindley ND, Humphreys GO et al. Interactions of group H
resistance factors with the F factor. J Bacteriol 1973; 115: 623–8.
22 Ogura Y, Ooka T, Iguchi A et al. Comparative genomics reveal the
mechanism of the parallel evolution of O157 and non-O157
enterohemorrhagic Escherichia coli. Proc Natl Acad Sci USA 2009; 106:
17939–44.
23 Kimura M. A simple method for estimating evolutionary rates of base
substitutions through comparative studies of nucleotide sequences. J Mol
Evol 1980; 16: 111–20.
24 Phan MD, Kidgell C, Nair S et al. Variation in Salmonella enterica
serovar Typhi IncHI1 plasmids during the global spread of resistant
typhoid fever. Antimicrob Agents Chemother 2009; 53: 716–27.
25 McGann P, Hang J, Clifford RJ et al. Complete sequence of a novel
178-kilobase plasmid carrying blaNDM-1 in a Providencia stuartii strain
isolated in Afghanistan. Antimicrob Agents Chemother 2012; 56: 1673–9.
26 Du XD, Li DX, Hu GZ et al. Tn1548-associated armA is co-located with
qnrB2, aac(6′
)-Ib-cr and blaCTX-M-3 on an IncFII plasmid in a Salmonella
enterica subsp. enterica serovar Paratyphi B strain isolated from
chickens in China. J Antimicrob Chemother 2012; 67: 246–8.
27 Ferna´ndez-Alarco´n C, Singer RS, Johnson TJ. Comparative genomics of
multidrug resistance-encoding IncA/C plasmids from commensal and
pathogenic Escherichia coli from multiple animal sources. PLoS One
2011; 6: e23415.
28 Li B, Sun JY, Liu QZ et al. First report of Klebsiella oxytoca strain
coproducing KPC-2 and IMP-8 carbapenemases. Antimicrob Agents
Chemother 2011; 55: 2937–41.
29 Jiang Y, Yu D, Wei Z et al. Complete nucleotide sequence of Klebsiella
pneumoniae multidrug resistance plasmid pKP048, carrying blaKPC-2,
blaDHA-1, qnrB4, and armA. Antimicrob Agents Chemother 2011; 54: 3967–9.
30 Gonza´lez-Zorn B, Teshager T, Casas M et al. armA and aminoglycoside
resistance in Escherichia coli. Emerg Infect Dis 2005; 11: 954–6.
31 Gołebiewski M, Kern-Zdanowicz I, Zienkiewicz M et al. Complete
nucleotide sequence of the pCTX-M3 plasmid and its involvement in
spread of the extended-spectrum b-lactamase gene blaCTX-M-3.
Antimicrob Agents Chemother 2007; 51: 3789–95.
32 Zhou H, Zhang T, Yu D et al. Genomic analysis of the
multidrug-resistant Acinetobacter baumannii strain MDR-ZJ06 widely
spread in China. Antimicrob Agents Chemother 2011; 55: 4506–12.
33 Petty NK, Feltwell T, Pickard D et al. Citrobacter rodentium is an
unstable pathogen showing evidence of significant genomic flux. PLoS
Pathog 2011; 7: e1002018.
34 Wang X, Kim Y, Ma Q et al. Cryptic prophages help bacteria cope with
adverse environments. Nat Commun 2010; 1: 147.
35 Wang X, Kim Y, Wood TK. Control and benefits of CP4-57 prophage
excision in Escherichia coli biofilms. ISME J 2009; 3: 1164–79.
36 Christie GE, Calendar R. Interactions between satellite bacteriophage
P4 and its helpers. Annu Rev Genet 1990; 24: 465–90.
37 Muniesa M, Garcia A, Miro E et al. Bacteriophages and diffusion of
b-lactamase genes. Emerg Infect Dis 2004; 10: 1134–7.
IncHI1 plasmid carrying blaNDM-1
39
JAC
atNewCopenhagenUniversityonAugust7,2013http://jac.oxfordjournals.org/Downloadedfrom
Příloha 16
LITERAK, I., REITSCHMIED, T., BUJNAKOVA, D., DOLEJSKA, M., CIZEK, A., BARDON, J., POKLUDOVA,
L., ALEXA, P., HALOVA, D., JAMBOROVA, I., 2013, Broilers as a source of quinolone-resistant and
extraintestinal pathogenic Escherichia coli in the Czech Republic: Microbial Drug Resistance, v.
19, p. 57-63.
Souhrn
Cílem studie bylo vyšetřit opracovaná těla jatečných brojlerů na přítomnost rezistentních a patogenních
kmenů E. coli. Rezistence k antibiotikům byla prokázána u 82 % izolátů, přičemž dominovala rezistence
ke kyselině nalidixové a ciprofloxacinu. Dvacet procent rezistentních kmenů náleželo k ExPEC. Plazmidově
determinovaná rezistence k fluorochinolonům se vyskytovala ojediněle a žádné izoláty s produkcí ESBL nebyly
zachyceny. Vysoká prevalence kmenů rezistentních k ciprofloxacinu je odrazem frekventovaného použití
fluorochinolonů v chovech drůbeže v ČR. Drůbeží maso může představovat významný zdroj rezistentních a
patogenních bakterií pro člověka.
VETERINARY MICROBIOLOGY
Broilers as a Source of Quinolone-Resistant
and Extraintestinal Pathogenic Escherichia coli
in the Czech Republic
Ivan Literak,1,2
Tomas Reitschmied,1
Dobroslava Bujnakova,3
Monika Dolejska,1,2
Alois Cizek,2,4
Jan Bardon,5,6
Lucie Pokludova,7
Pavel Alexa,8
Dana Halova,1
and Ivana Jamborova1
Extraintestinal Escherichia coli infections are associated with extraintestinal pathogenic E. coli (ExPEC) strains.
A total of 114 E. coli isolates were characterized regarding their antimicrobial resistance in a prospective study of
319 broilers from 12 slaughterhouses in the Czech Republic, a European Union member, during 2008. PCR-based
assays to define ExPEC-associated traits were performed in resistant strains. Consumption of antimicrobial
drugs by poultry in the Czech Republic was also analyzed. Antibiotic resistance was detected in 82% of isolates.
Resistance to nalidixic acid and ciprofloxacin was predominant. Plasmid-mediated quinolone resistance genes,
qnrB19 and qnrS1, were detected in 1 and 3 of 93 resistant isolates, respectively. Twenty-three percent of resistant
isolates were considered as ExPEC. In total, 972 kg of flumequine, enrofloxacin, and difloxacin were used in
poultry in the Czech Republic during 2008. High prevalence of broilers with ciprofloxacin-resistant E. coli
isolates was linked to consumption of quinolones in poultry. Broilers may comprise an important vehicle
for community-wide dissemination of fluoroquinolone-resistant E. coli and ExPEC. Withdrawal of fluoroquinolones
from use in chicken production should be seriously considered in the Czech Republic and the
European Union as well.
Introduction
Escherichia coli causing extraintestinal diseases are
known as extraintestinal pathogenic E. coli (ExPEC)
and include the uropathogenic E. coli (UPEC), neonatal
meningitis E. coli, and avian-pathogenic E. coli (APEC)
subpathotypes.44
A number of studies have shown that
members of various ExPEC subpathotypes harbor similar
virulence-associated genes. Characterization of ExPEC
strains using various typing techniques has shown many
similarities, despite their isolation from different host species,
thus leading to the hypothesis that ExPEC may have
zoonotic potential.44
The use of fluoroquinolone agents in food animal production
is suspected of selecting fluoroquinolone-resistant
E. coli that can be transmitted to humans via the food
chain.18
The epidemiological link between poultry consumption
and human disease due to fluoroquinoloneresistant
bacteria, combined with the high prevalence of
fluoroquinolone-resistant bacteria in retail poultry products,
has prompted the U.S. Food and Drug Administration
to propose the withdrawal of fluoroquinolones from use in
poultry.6
In the European Union, including the Czech Republic,
there are currently, in place, recommendations for
the prudent use of fluoroquinolones in food-producing
animals.16
Retail poultry products are routinely contaminated heavily
with avian fecal E. coli. Such E. coli extensively contaminate
kitchen surfaces during meal preparation and can
subsequently be isolated from the feces of a person preparing
1
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical
Sciences Brno, Brno, Czech Republic.
2
CEITEC VFU, Veterinary and Pharmaceutical University Brno, Brno, Czech Republic.
3
Institute of Animal Physiology, Slovak Academy of Sciences, Kosice, Slovakia.
4
Department of Infectious Diseases and Microbiology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical
Sciences Brno, Brno, Czech Republic.
5
State Veterinary Institute, Olomouc, Czech Republic.
6
Department of Microbiology, Faculty of Medicine and Dentistry, Palacky University Olomouc, Olomouc, Czech Republic.
7
Institute for State Control of Veterinary Biologicals and Medicaments, Brno, Czech Republic.
8
Veterinary Research Institute, Brno, Czech Republic.
MICROBIAL DRUG RESISTANCE
Volume 19, Number 1, 2013
ª Mary Ann Liebert, Inc.
DOI: 10.1089/mdr.2012.0124
57
meals.32
Thus, the possibility of foodborne transmission of
ExPEC and/or fluoroquinolone-resistant E. coli from poultry
to humans is highly plausible.
As early as 1976, Levy et al. reported the transfer of tetracycline
resistance genes between chicken E. coli strains,
from chicken to chicken, and from chicken to humans.31
The
aim of our study was to characterize fluoroquinolone- and
cephalosporin-resistant E. coli and ExPEC isolates from
broilers in the Czech Republic and the overall consumption
of quinolones and cephalosporins used in poultry in the
country during 2008.
Materials and Methods
Chicken meat sampling scheme and isolation of E. coli
Broilers were examined from April to December 2008 at 12
poultry slaughterhouses in the Czech Republic serving more
than 300 Czech broiler farms. A total of 319 broilers were
sampled. Each randomly sampled broiler originated from a
group of broilers from one farm sent to a slaughterhouse on 1
day. The whole chilled broiler was placed individually into a
sterile plastic bag and transported on ice to the laboratory.
The skin of the broiler’s body was detached from the rest of
the body and a piece weighing 27 g was taken as a sample.
The skin sample was homogenized for 1 min using a homogenizer
in 243 ml of buffered peptone water (Oxoid). Onemilliliter
aliquots from individual suspension samples were
frozen with a few drops of glycerin at - 18°C until further
examination. Individual samples were then enriched in the
MacConkey broth and cultivated on MacConkey agar
(MCA; Oxoid) for E. coli isolation. All E. coli strains were
identified using the API 10S test (bioMerieux). One E. coli
isolate per sample was randomly selected and further
analyzed.
Antibiotic susceptibility testing
The disk-diffusion method8
was used to test susceptibilities
of E. coli isolates to 12 antimicrobial substances: amoxicillin/
clavulanic acid (30 mg), ampicillin (10 mg), cephalothin (30 mg),
ceftazidime (30 mg), chloramphenicol (30 mg), ciprofloxacin
(5mg), gentamicin (10 mg), nalidixic acid (30 mg), streptomycin
(10 mg), sulfamethoxazole/trimethoprim (25 mg), sulfonamide
compounds (300mg), and tetracycline (30 mg) (Oxoid). For
the selective isolation of ESBL (extended-spectrum betalactamase)-positive
E. coli, all samples enriched in the MacConkey
broth were subcultivated on MCA with cefotaxime
(2mg/L) and the cefotaxime-resistant isolates should have
been tested in the double-disk synergy test.43
PCR and testing of antibiotic resistance genes
In E. coli isolates found to be resistant to one or more of the
antibiotics listed above, antibiotic resistance genes and integrons
were detected by PCR using specific primers as described
previously.33
These E. coli isolates were also tested for
the plasmid-mediated quinolone resistance (PMQR) genes
qnrA, qnrB, qnrC, qnrD, qnrS, aac(6’)-Ib-cr, qepA, and oqxAB
and the PCR products were further analyzed by sequenc-
ing.3,4,12,27,28,37,38,40,47
PMQR-positive isolates were examined
for minimum inhibition concentrations of ciprofloxacin and
nalidixic acid using the agar dilution method in accordance
with CLSI standards.8
Detection of extraintestinal pathogenic E. coli
Lysates of each E. coli isolate resistant to antimicrobials
were tested by PCR amplification for virulence factors or
genes iutA, cvaC, kpsII, iss, tsh, papC, ibeA, and
felA.11,13,17,22,30,35
The PCR cycle was 94°C for 5 min followed
by 30 cycles at 94°C for 1 min, at the annealing temperature
specific for each pair of primers for 1 min, and at 72°C for
1 min. As previously reported,23
ExPEC was defined by detection
of ‡ 2 of iutA, kpsII, tsh, papC, ibeA, and felA genes.
Serotyping
Somatic O-antigen typing was performed using a U-type
microplate agglutination assay. E. coli strains were cultured
in the nutrient broth (Imuna). After cultivation, viability
staining of E. coli strains was made using triphenyltetrazolium
chloride and heating at 120°C for 1 h followed.
Agglutination was performed with a set of 70 types of
O-antisera, encompassing the most common O-serogroups.
O-antisera were prepared by immunization of rabbits.41
Pulse-field gel electrophoresis, determination of E. coli
phylogenetic group, and transferability of PMQR genes
by conjugation
PMQR-positive E. coli isolates were typed by XbaI pulsefield
gel electrophoresis (PFGE).5
Macrorestriction patterns
were analyzed using the BioNumerics 6.6 fingerprinting
software (Applied Maths). Cluster analysis of the Dice similarity
indices was done to generate a dendrogram describing
the relationships among PFGE profiles. The level of similarity
between patterns was defined at 85%. Identification of
E. coli phylogenetic groups (A, B1, B2, and D) was performed
using PCR.7
Transferability of PMQR genes was tested by
conjugation and transformation.36
Consumption of antimicrobial drugs in poultry
in the Czech Republic
Sales data were collected from all wholesalers and feed
mills licensed in the Czech Republic during the period
monitored during 2008. Special attention was given to the
groups of fluoroquinolones and cephalosporins of the 3rd
and 4th generations, in relation to which detailed data have
been collected, as these substances have been under a prudent
use regimen in the Czech Republic since 1998.
Results
Antimicrobial resistance in chicken E. coli isolates
A total of 114 E. coli isolates was obtained from 319 broiler
samples. Resistance to one or more antibiotics was detected
in 93 (82%) isolates. In total, 33 (29%) of 93 isolates were
resistant to only one antimicrobial agent and the remaining
60 isolates were resistant to more than one agent. The resistance
patterns in individual isolates were highly variable.
Resistance to nalidixic acid and ciprofloxacin was predominant,
being found in 78 (68%) and 30 (26%, Table 1) isolates,
respectively. Resistance to tetracycline was detected in 29
(25%) isolates, to ampicillin in 27 (24%), to sulfonamides in
22 (19%), to streptomycin in 18 (16%), to sulfamethoxazole/
trimethoprim in 11 (10%), to cephalothin and chloramphenicol
each in 4 (4%), and to amoxicillin-clavulanic acid and
58 LITERAK ET AL.
ceftazidime each in two (2%) isolates. None of the isolates
was resistant to gentamicin. No ESBL-producing isolates
were found in the Czech broilers.
The following genes were identified in E. coli isolates: tetA,
tetB (resistance to tetracycline), blaTEM (beta-lactams), strA,
aadA1 (streptomycin), sul1, sul2, sul3 (sulfonamides), cat and
cmlA (chloramphenicol). All ampicillin-resistant isolates
were positive for the presence of the blaTEM gene. As regards
to tetracycline resistance determinants, the tetA gene was
detected in 22 and tetB in 7 of 29 tetracycline-resistant strains.
Screening for sul-genes revealed the presence of at least one
sul-type determinant in sulfonamide-resistant E. coli isolates.
In 18 isolates, a single sul-type resistance determinant was
found (sul1 in 5, sul2 in 11, and sul3 in two isolates), while in
5 isolates, 2 different sul genes (both sul1 and sul2) were
found. Resistance to streptomycin was connected with the
gene strA and/or aadA1. All chloramphenicol-resistant isolates
were positive for presence of either the gene cat or clmA.
Eleven of 93 antibiotic-resistant E. coli isolates from the
broiler samples yielded the intI1 gene and class 1 integron. A
class 1 integron of 1 kb with the gene cassette aadA1 was present
in seven E. coli isolates, and four isolates contained a 1.5-kb
integron with the gene cassettes, dfr1-aadA1. Two of all the
antibiotic-resistant isolates were positive for the intI2 and class
2 integron with the gene cassettes, estX-sat-aadA1 (Table 2).
From a total of 93 antibiotic-resistant E. coli isolates obtained
from the broiler samples, PMQR genes were detected
in 4 (4%) strains. Three isolates were positive for the qnrS1
gene and one isolate was positive for the qnrB19 gene (Table
3). The genes qnrA, qnrC, qnrD, aac(6¢)-Ib-cr, qepA, and oqxAB
were not detected. Transformation and conjugation to the
E. coli and Salmonella strains of plasmids harboring the qnr
genes were successful.
Phylogenetic analysis, detection of virulence genes
(ExPEC), O-antigen serotypes
PCR analysis of the 93 resistant isolates showed that
phylogroup B2 was predominant (41%) followed by phylogroups
A (26%) and D (24%), whereas phylogroup B1 (9%)
was minor in our collection. In total, 65% of isolates belonged
to pathogenic groups B2 and D. Two of the PMQR-positive
isolates showed the same PFGE profile and belonged to the
B1 phylogenetic group (Table 3).
Table 1. Ciprofloxacin-Resistant Escherichia coli
(Results of Disk Diffusion Method) from Broilers
(n = 319) Slaughtered in the Czech Republic
Antibiotic
resistance
phenotype
Antibiotic resistance
genes and integrons
Number
of isolates
CipNa Not determined 10
CipNa int1, class 1 integron
1 kb: aadA1
1
ACipNa blaTEM 3
CipNaS aadA1 1
CipNaS strA 1
CipNaT tetA 2
ACipNaS blaTEM, strA 1
ACipNaSu blaTEM, sul2 1
CipNaSSu strA, sul2 1
CipNaSuT sul2, tetA 1
ACCipNaSu blaTEM, cat, sul1, int1,
class 1 integron 1 kb:
aadA1
1
ACipNaSSu blaTEM, strA, sul2 1
ACipNaST blaTEM, strA, tetB 1
CipNaSuSxtT sul1, sul2, tetA 1
ACipNaSSuT blaTEM, strA, sul2, tetA 1
CipNaSSuSxtT strA, aadA1, sul1, sul2, tetA 1
ACfCipNaSuSxtT blaTEM, sul2, tetB 1
ACCfCipNaSSuSxtT blaTEM, cmlA,
aadA1, sul3, tetA,
1
Total 30
Antibiotic resistance phenotype: A, ampicillin; C, chloramphenicol;
Cf, cephalothin; Cip, ciprofloxacin; Na, nalidixic acid; S, streptomycin;
Su, sulfonamides cp.; Sxt, sulfamethoxazole/trimethoprim; T,
tetracycline.
Table 2. Characteristics of Escherichia coli Isolates with Class 1 and 2 Integrons and Gene Cassettes
Isolate
No.
Phylo-
genetic
group
O-antigen
serotype
Size of class
1 and 2
integron (kb)
Gene
cassettes intI1 intI2 sul
Antibiotic
resistance
phenotype
Additional
resistance genes Virulence genes
O/67 A O20 1 aadA1 + - — Na — iutA
J/85 D O25 1 aadA1 + - — CipNa — iutA, cvaC, iss, kps
J/102 B2 nt 1 aadA1 + - sul3 ACSu blaTEM, cmlA iutA, tsh
J/33 B2 O108 1 aadA1 + - — NaST tetA iutA, cvaC
P/70 B2 nt 1 aadA1 + - sul2 ASSuSxt blaTEM, strA iutA, cvaC, iss
J/43 B2 nt 1 aadA1 + - sul1 ANaSuT blaTEM, tetB iutA, cvaC, tsh, papC
J/53 B2 O145 1 aadA1 + - sul1 ACCipNaSu blaTEM, cat iutA
J/3 B2 O140 1.5 dfr1-aadA1 + - — ANa blaTEM cvaC
J/76 B2 nt 1.5 dfr1-aadA1 + - — NaT tetA iutA, cvaC, kps
J/4 D nt 1.5 dfr1-aadA1 + - sul1 NaSuSxtT tetA cvaC, tsh
P/64 B2 nt 1.5 dfr1-aadA1 + - sul1, sul2 ASSuSxtT blaTEM, strA,
tetA
tsh
J/99 B2 O8 2.5 estX-sat-aadA1 - + — ANaS blaTEM iutA, cvaC
P/105 D O86 2.5 estX-sat-aadA1 - + — ANaS blaTEM iutA
Antibiotic resistance phenotype: A, ampicillin; C, chloramphenicol; Cip, ciprofloxacin; Na; nalidixic acid; S, streptomycin; Su, sulfonamides
cp.; Sxt, sulfamethoxazole/trimethoprim; T, tetracycline; nt, not typeable.
QUINOLONE-RESISTANT E. COLI AND EXPEC IN BROILERS 59
At least one virulence gene was detected in 68 (73%) out of
93 resistant isolates. The genes iutA, cvaC, tsh, kpsII, iss, papC,
ibeA, and felA occured in frequencies of 46%, 28%, 26%, 22%,
20%, 4%, 1%, and 0%, respectively. Among these 93 isolates,
21 (23%) carried two or more virulence genes iutA, kpsII, tsh,
papC, and ibeA, and hence, were considered as ExPEC iso-
lates.
The O-antigen serotypes were highly variable. A total of
48 out of 93 resistant isolates were successfully determined
by agglutination. These strains belonged to the following
serotypes (according Johnson et al.,24
those strains in bold
should be considered as associated with ExPEC: O2 (1 isolate,
B2 phylogroup, with iutA, cvaC, tsh, kpsII, iss, and ibA
genes), O4 (1, A, without virulence genes tested), O7 (1, A,
without virulence genes tested), O8 (6), O9 (3), O11 (1, B2,
cvaC, tsh, kpsII), O18 (1, A, iutA), O20 (2), O22 (2), O25 (1, D,
iutA, cvaC, iss, kpsII), O51 (1), O54 (1), O69 (1), O71 (2), O75
(1, A, iss), O86 (6), O88 (1), O103 (2), O108 (2), O115 (1), O119
(2), O139 (4), O140 (1), and O145 (4).
Consumption of antimicrobial drugs in chickens
and turkeys in the Czech Republic
In 2008, tetracyclines (15,200 kg), aminopenicillins
(5,400 kg), and sulfonamides, including sulfonamides in
combinations (2,660 kg) were the three groups of antimicrobials
used most frequently in chickens and turkeys (for mass
medication). One substance from the quinolone group (flumequine)
and two from the fluoroquinolone group (enrofloxacin
and difloxacin) are used in poultry in the Czech
Republic. Totally, 972 kg of these substances were consumed
in chickens and turkeys in 2008. This takes in *70% of the
total consumption of all quinolones and fluoroquinolones
used in animals for which veterinary medicinal products
containing these substances are authorized in the Czech
Republic. Veterinary medicinal products containing cephalosporins
are not authorized for poultry in the Czech
Republic.
Discussion
Antimicrobial resistance in selected bacteria from poultry
was broadly reviewed by Gyles.19
APEC isolates were found
to be often highly resistant, especially to tetracycline, streptomycin,
and sulfonamides. The European data on antimicrobial
resistance in commensal E. coli from poultry show
remarkable differences in various countries. The situation in
the Czech Republic is similar to those in the Netherlands,
France, and UK regarding the resistance to old-generation
antibiotics and similar to those in Spain, Slovakia, and Iran
regarding the fluoroquinolones.
Surprisingly, a high percentage of E. coli strains resistant
to such new quinolones as ciprofloxacin, norfloxacin, flumequine,
and pefloxacin (7%–16%) was found in healthy
chickens in Spain already in the 1990s and a high prevalence
in chickens of E. coli resistant to nalidixic acid and ciprofloxacin
and carrying a virulence factor specific to ExPEC has
been found in Spain recently.2,10
Moreover, 35% of the
chicken E. coli isolates in Spain satisfied criteria for ExPEC.
It has been postulated that the most likely evolutionary
source of human fluoroquinolone-resistant E. coli
strains is fluoroquinolone-susceptible chicken and not
fluoroquinolone-susceptible human strains.9,25
Chicken
E. coli strains are not species-specific. Fluoroquinoloneresistant
isolates in humans were found to be similar to resistant
isolates in chickens and quite different from susceptible
human isolates.25
It was indicated that fluoroquinolone use in
food animals is an important source of the emerging fluoroquinolone
resistance among ExPEC and that resistant E. coli
should therefore be considered a foodborne pathogen.25
Healthy broiler chickens from various farms in Slovakia
were tested for the presence of E. coli isolates resistant to
nalidixic acid and ciprofloxacin during 2006–2008.29
High
frequencies of resistance to nalidixic acid and ciprofloxacin
were found. High quinolone resistance was considered to be
a consequence of frequent therapeutic administrations of
enrofloxacin on Slovak poultry farms. Moreover, broiler
meat at retail originating from Slovakia, Czech Republic, and
Poland was examined for the presence of ExPEC isolates.14
A
total of 28 isolates were analyzed. Thirteen of these belonged
to the B2 phylogroup and all of these B2 isolates harbored
‡ 2 of the virulence factors iutA, iss, cvaC, tsh, and papC. The
majority of those isolates belonged to the pathogenic serotype
O78.
High frequencies of E. coli isolates resistant to nalidixic
acid and ciprofloxacin were observed in Iran, and this resistance
pattern was presumed to be linked to flumequine
and enrofloxacin commonly used in poultry flocks there.34
The results of our study strongly support the hypothesis
that the emergence and dissemination of fluoroquinoloneresistant
E. coli is a consequence of fluoroquinolone use in
chickens.
Regarding the high prevalence of fluoroquinoloneresistant
E. coli in broilers presumably caused by high consumption
of fluoroquinolones on Czech chicken farms, it is
useful to mention the results of a similar nationwide study
from 2009 on the prevalence of Campylobacter spp. including
Table 3. Characterization of PMQR-Positive Escherichia coli from Broilers
Strain
No.
Antibiotic
resistance
phenotype
PMQR
genes
Additional
resistance genes
MIC
(mg/L)a
Na/Cip
PFGE
profile
Phylo-
genetic
group
O-antigen
serotype
Virulence
factor
genes
Conjugation
to E. coli Salmonella
J/13 ANa qnrS1 blaTEM-1 256/1 a A nt cvaC, iss, iut, kps, tsh + +
O/66 CfT qnrB19 tetB 32/0.25 b B1 nt kps II + +
P/65 ANa qnrS1 blaTEM-1 512/4 c B1 nt iss, kps II + +
P/67 ANa qnrS1 blaTEM-1 512/4 c B1 nt iss, kps II + +
a
Minimum inhibitory concentration of nalidixic acid and ciprofloxacin to donor strains.
Antibiotic resistance phenotype: A, ampicillin; Cf, cephalothin; Cip, ciprofloxacin; Na, nalidixic acid; T, tetracycline; PMQR, plasmidmediated
quinolone resistance; MIC, minimum inhibition concentration; PFGE, Pulse-field gel electrophoresis.
60 LITERAK ET AL.
antibiotic-resistant isolates in the Czech Republic.1
The patterns
of antibiotic resistance in Campylobacter spp. and E. coli
isolates from broilers in the Czech Republic are very similar,
and they probably are caused by the same selection pressure
of quinolones administered on farms.
We found broilers to be contaminated with 23% of E. coli
isolates considered as ExPEC. Some of the APEC strains
tested in a rat model of human neonatal meningitis were able
to cause meningitis, supporting the hypothesis that APEC
strains have a zoonotic potential.44
E. coli isolates from
broiler chicken meat in Denmark belonging to the B2 phylogroup
and carrying ‡ 2 virulence factors were tested for
their ability to cause urinary tract infection (UTI) in a murine
model representative of UTI in humans.21
All isolates tested
caused UTI in mice, and thereby in vivo evidence was provided
for the first time that E. coli UTI is a zoonosis. Moreover,
UPEC can cause significant diseases in poultry, as
has been demonstrated in vivo using a chicken challenge
model.48
Comparing serotypes supposedly associated with
ExPEC according Johnson et al.24
with the presence of virulence
genes tested, we have confirmed such an association
in serotypes O2, O11, and O25, but not in O4, O7, O18,
and O75.
The proportion of ExPEC isolates with resistance to
fluoroquinolones increased from 8% in 2001 to 26% in 2008
in Czech human microbiology laboratories15
and it can be
associated with the fact that chicken meat consumption was
increasing simultaneously in the Czech Republic to 25 kg per
person per year in 2008, which is above the EU average.
A quite different situation regarding fluoroquinoloneresistant
E. coli isolates from poultry has been reported in the
U.S. Only 1 of 62 retailed chicken products with nalidixic
acid-resistant E. coli was found to be also resistant to cipro-
floxacin.23
In that study, 21% of the E. coli isolates satisfied
the criteria for ExPEC.23
In a later study from Minnesota and
Wisconsin, only 7 out of 931 E. coli isolates of human and
poultry origin were found to be resistant to ciprofloxacin.26
Similarly, resistance to ciprofloxacin was found to be only
exceptionally occurring in ExPEC in Canada, and no such
isolate was isolated from chicken in that country.39
Due to the increasing emergence of antimicrobial resistance,
several measures have come into force within the EU during
the past decade. Using of antimicrobials as growth promoters
in food-producing animals has been wholly prohibited in the
EU since 1 January 2006. Recommendations for the prudent
use of quinolones/fluoroquinolones in food-producing animals
were published by the European Medicines Agency.16
Comparing EU policy to, for example, the U.S., where growth
promoters are allowed to be used to enhance production in
food-producing animals, EU rules seems to be more restrictive.
On the other hand, U.S. policies are more restrictive
regarding the use of fluoroquinolones, especially in respect to
utilizing this antimicrobial group in poultry. A ban is in force
on using enrofloxacin in poultry and off-label use of fluoroquinolones
also is prohibited.45
These different approaches
in the EU and U.S. can explain the great difference in the
prevalence of ciprofloxacin-resistant E. coli in chicken in these
areas. While the prevalence is high in Europe, in the U.S. it is
quite substantially lower.
The three most frequently used groups of antimicrobials on
poultry farms in the Czech Republic correspond well to the
detected resistances to tetracyclines, aminopenicillins, and
sulfonamides (including sulphonamide in combinations) in
chicken E. coli in our study. The resistance determinants indicating
the presence of ESBLs were not detected in the samples
examined. This corresponds to the fact that cephalosporins are
not approved for use in broilers in the Czech Republic.
Excessive use of antimicrobials on chicken and turkey
farms in Tunisia resulted in a high percentage of resistance to
some antimicrobials (up to 95%), including fluoroquinolones
(20% resistance to ciprofloxacin) in E. coli isolates from meat
samples.42
The presence of class 1 and 2 integrons was
demonstrated in 52% (n = 166) of E. coli isolates in that study.
Even though we found some similar integrons and sul1, sul2,
and sul3 genes in E. coli isolates from chicken reared in the
Czech Republic, the prevalence of integron-positive isolates
was much lower (only 14%). This could mean that the use of
antimicrobials in poultry in the Czech Republic is not so
excessive as is that in North African Tunisia.
We found the PMQR genes, qnrS1 and qnrB19. Salmonella
and/or E. coli isolates with the qnrS1 and qnrB19 genes were
found recently in food and food-producing animals in various
European countries.20,46
Our findings of these genes
correspond with these reports.
In conclusion, our results provide support from the Czech
Republic for the hypothesis that chicken products can be a
source of fluoroquinolone-resistant ExPEC for humans and
that selection of fluoroquinolone-resistant E. coli strains in
chickens is a result of fluoroquinolone use in chickens. These
are good reasons for efforts to eliminate such organisms from
the food supply, including by withdrawing fluoroquinolones
from use in chicken production, improving the hygienic aspects
of chicken processing, and improving distribution
practices. We agree that reducing fluoroquinolone use in
food animals will improve human health and that widespread
use of these critically important antimicrobial agents
in food animals poses a needless additional risk to humans in
both the community and the hospital.9
Acknowledgments
We thank Ivo Papousek, Marie Slavikova, Eva Suchanova,
Dagmar Tausova, and Raluca Uricariu for their cooperation
in the laboratory. Our thanks go to Lars Hansen (University
of Copenhagen, Denmark), Lina Cavaco, and Henrik Hasman
(National Food Institute, Copenhagen, Denmark) for
providing control strains. This work was supported by the
project ‘‘CEITEC—Central European Institute of Technology’’
(CZ.1.05/1.1.00/02.0068) from the European Regional
Development Fund.
Disclosure Statement
No competing financial interests exist.
References
1. Bardon, J., M. Kolar, R. Karpiskova, and K. Hricova. 2011.
Prevalence of thermotolerant Campylobacter spp. in broilers
at retail in the Czech Republic and their antibiotic resistance.
Food Control 22:328–332.
2. Blanco, J.E., M. Blanco, A. Mora, and J. Blanco. 1997.
Prevalence of bacterial resistance to quinolones and other
antimicrobials among avian Escherichia coli strains isolated
from septicemic and healthy chickens in Spain. J. Clin.
Microbiol. 35:2184–2185.
QUINOLONE-RESISTANT E. COLI AND EXPEC IN BROILERS 61
3. Cattoir, V., L. Poirel, V. Rotimi, C.J. Soussy, and P. Nordmann.
2007. Multiplex PCR for detection of plasmid-mediated
quinolone resistance qnr genes in ESBL-producing enterobacterial
isolates. J. Antimicrob. Chemother. 60:394–397.
4. Cavaco, L.M., H. Hasman, S. Xia, and F.M Aarestrup. 2009.
qnrD, a novel gene conferring transferable quinolone resistance
in Salmonella enterica serovars Kentucky and Bovismorbificans
of human origin. Antimicrob. Agents.
Chemother. 53:6038.
5. CDC. 2004. One-Day (24–28 h) Standardized Laboratory
Protocol for Molecular Subtyping of Escherichia coli O157:H7,
non-typhoidal Salmonella serotypes, and Shigella sonnei by
Pulsed Field Gel Electrophoresis (PFGE). www.cdc.gov/
pulsenet/protocols/ecoli_salmonella_shigella_protocols.pdf
(1 May 2011, date last accessed) (Online).
6. Cimons, M. 2001. FDA planning to halt ag use of two antibiotics.
ASM News 67:9–10.
7. Clermont, O., S. Bonacorsi, and E. Bingen. 2000. Rapid and
simple determination of Escherichia coli phylogenetic group.
Appl. Environ. Microbiol. 66:4555–4558.
8. Clinical and Laboratory Standards Institute. 2008. Performance
Standards for Antimicrobial Susceptibility Testing,
8th Informational Supplement. CLSI, Wayne, PA.
9. Collignon, P., and F.J. Angulo. 2006. Fluoroquinoloneresistant
Escherichia coli: food for thought. J. Infect. Dis. 194:8–10.
10. Cortes, P., V. Blanc, A. Mora, G. Dahbi, J.E. Blanco, M.
Blanco, C. Lopez, A. Andreu, F. Navarro, M.P. Alonso, G.
Bou, J. Blanco, and M. Llagostera. 2010. Isolation and
characterization of potentially pathogenic antimicrobialresistant
Escherichia coli strains from chicken and pig farms.
Appl. Environ. Microbiol. 76:2799–2805.
11. Delicato, E.R., B. Guimaraes de Brito, L.C.J. Gaziri, and
M.C. Vidotto. 2003. Virulence-associated genes in Escherichia
coli isolates from poultry with colibacillosis. Vet. Microbiol.
94:97–103.
12. Dolejska, M., E. Duskova, J. Rybarikova, D. Janoszowska,
E. Roubalova, K. Dibdakova, G. Maceckova, L. Kohoutova,
I. Literak, J. Smola, and A. Cizek. 2011. Plasmids carrying
blaCTX-M-1 and qnr genes in Escherichia coli isolates from
an equine clinic and a horseback riding centre. J. Antimicrob.
Chemother. 66:757–764.
13. Dozois, C.M., M. Dho-Moulin, A. Bree, J.M. Fairbrother,
C. Desautels, and R. Curtiss. 2000. Relation between the Tsh
autotransporter and pathogenicity of avian Escherichia coli
and localization and analysis of the tsh genetic region. Infect.
Immun. 68:414–554.
14. Drugdova, Z., V. Kmet, and D. Bujnakova. 2010. Virulence
factors in Escherichia coli isolated from chicken meat in Slovakia.
J. Food Nutr. Res. 49:10–13.
15. European Centre for Disease Prevention and Control.
2011. Antimicrobial resistance surveillance in Europe 2010.
Annual Report of the European Antimicrobial Resistance
Surveillance Network (EARS-Net). European Centre for
Disease Prevention and Control, Stockholm.
16. European Medicines Agency. 2006. Reflection Paper on the
Use of Fluoroquinolones in Food Producing Animals—
Precautions for Use in the SPC Regarding Prudent Use
Guidance, EMEA/CVMP/416168/2006-FINAL. 8 November
2006. Available at: www.ema.europa.eu/docs/en_GB/document_library/Other/2009/10/WC500005173.pdf,
Accessed
23 March 2012) (Online).
17. Foley, S.L., S.M. Horne, C.W. Giddings, M. Robinson, and
L.K. Nolan. 2000. Iss from a virulent avian Escherichia coli.
Avian Dis. 44:185–191.
18. Garau, J., M. Xercavins, M. Rodriguez-Carballeira, J.
Gomez-Vera, I. Coll, D. Vidal, T. Llovet, and A. RuizBremon.
1999. Emergence and dissemination of quinoloneresistant
Escherichia coli in the community. Antimicrob.
Agents Chemother. 43:2736–2741.
19. Gyles, C.L. 2008. Antimicrobial resistance in selected bacteria
from poultry. Anim. Health Res. Rev. 9:149–58.
20. Hordijk, J., A.B. Bosman, A. van Essen-Zandbergen, K.
Veldman, C. Dierikx, J.A. Wagenaar, and D. Mevius. 2011.
qnrB19 gene bracketed by IS26 on a 40-kilobase IncR plasmid
from an Escherichia coli isolate from a veal calf. Antimicrob.
Agents Chemother. 55:4534.
21. Jakobsen, L., A.M. Hammerum, and N. Frimodt-Moller.
2010. Virulence of Escherichia coli B2 isolates from meat and
animals in a murine model of ascending urinary tract infection
(UTI): evidence that UTI is a zoonosis. J. Clin. Microbiol.
48:2978–2980.
22. Johnson, J.R., and A.L. Stell. 2000. Extended virulence genotypes
of Escherichia coli strains from patients with urosepsis
in relation to phylogeny and host compromise. J.
Infect. Dis. 181:261–272.
23. Johnson, J.R., A.C. Murray, A. Gajewski, M. Sullivan, P.
Snippes, M.A. Kuskowski, and K.E. Smith. 2003. Isolation
and molecular characterization of nalidixic acid-resistant
extraintestinal pathogenic Escherichia coli from retail chicken
products. Antimicrob. Agents Chemother. 47:2161–2168.
24. Johnson, J.R., M.A. Kuskowski, K. Smith, T.T. O’Bryan,
and S. Tatini. 2005. Antimicrobial-resistant and extraintestinal
pathogenic Escherichia coli in retail food. J. Infect.
Dis. 191:1040–1049.
25. Johnson, J.R., M.A. Kuskowski, M. Menard, A. Gajewski,
M. Xercavins, and J. Garau. 2006. Similarity between
human and chicken Escherichia coli isolates in relation to
ciprofloxacin resistance status. J. Infect. Dis. 194:71–78.
26. Johnson, J.R., M.R. Sannes, C. Croy, B. Johnston, C. Clabots,
M.A. Kuskowski, J. Bender, K.E. Smith, P.L. Winokur,
and E.A. Belongia. 2007. Antimicrobial drug-resistant
Escherichia coli from humans and poultry products, Minnesota
and Wisconsin, 2002–2004. Emerg. Infect. Dis. 13:838–
846.
27. Kim, H.B., C.H. Park, C.J. Kim, E.C. Kim, G.A. Jacoby, and
D.C. Hooper. 2009. Prevalence of plasmid-mediated quinolone
resistance determinants over a 9-year period. Antimicrob.
Agents Chemother. 53:639–645.
28. Kim, H.B., M. Wang, C.H. Park, E.C. Kim, G.A. Jacoby,
and D.C. Hooper. 2009. oqxAB encoding a multidrug efflux
pump in human clinical isolates of Enterobacteriaceae. Antimicrob.
Agents Chemother. 53:3582–3584.
29. Kmet, V., and M. Kmetova. 2010. High level of quinolone
resistance in Escherichia coli from healthy chicken broilers.
Folia Microbiol. 55:79–82.
30. Le Bouguenec, C., M. Archambaud, and A. Labigne. 1992.
Rapid and specific detection of the pap, afa and sfa adhesinencoding
operons in uropathogenic Escherichia coli strains by
polymerase chain reaction. J. Clin. Microbiol. 30:1189–1193.
31. Levy, S.B., G.B. Fitzgerald, and A.B. Macone. 1976. Spread
of antibiotic-resistant plasmids from chicken to chicken and
from chicken to man. Nature 260:40–42.
32. Linton, A.H., K. Howe, P.M. Bennett, and M.H. Richmond.
1977. The colonization of the human gut by antibiotic resistant
Escherichia coli from chickens. J. Appl. Bacteriol.
43:465–469.
33. Literak, I., M. Dolejska, T. Radimersky, J. Klimes, M.
Friedman, F.M. Aarestrup, H. Hasman, and A. Cizek. 2010.
62 LITERAK ET AL.
Antimicrobial resistant faecal Escherichia coli in wild mammals
in central Europe: multiresistant Escherichia coli producing
extended-spectrum beta-lactamases in wild boars. J.
Appl. Microbiol. 108:1702–1711.
34. Moniri, R., and K. Dastehgoli. 2005. Fluoroquinolone-resistant
Escherichia coli isolated from healthy broilers with
previous exposure to fluoroquinolones: is there a link? Microbial.
Ecol. Health Dis. 17: 69–74.
35. Moulin-Schouleur, M., C. Schouleur, P. Tailliez, M.R.
Kao, A. Bree, P. Germon, E. Oswald, J. Mainil, M. Blanco,
and J. Blanco. 2006. Common virulence factors and genetic
relationships between O18:K1:H7 Escherichia coli isolates of
human and avian origin. J. Clin. Microbiol. 44:3484–3492.
36. Olesen, I., H. Hasman, and F.M. Aarestrup. 2004. Prevalence
of beta-lactamases among ampicillin-resistant Escherichia
coli and Salmonella isolated from food animals in
Denmark. Microb. Drug Resist. 10:334–340.
37. Park, C.H., A. Robicsek, G.A. Jacoby, D. Sahm, and D.C.
Hooper. 2006. Prevalence in the United States of aac(6¢)Ib-cr
encoding a ciprofloxacin-modifying enzyme. Antimicrob.
Agents Chemother. 50:3953–3955.
38. Perichon, B., P. Courvalin, and M. Galimand. 2007.
Transferable resistance to aminoglycosides by methylation
of G1405 in 16S rRNA and to hydrophilic fluoroquinolones
by qepA-mediated efflux in Escherichia coli. Antimicrob.
Agents Chemother. 51:2464–2469.
39. Racicot Bergeron, C., C. Prussing, P. Boerlin, D. Daignault, L.
Dutil, R.J. Reid-Smith, G.G. Zhanel, and A.R. Manges. 2012.
Chicken as reservoir for extraintestinal pathogenic Escherichia
coli in humans, Canada. Emerg. Infect. Dis. 18:415–421.
40. Robicsek, A., G.A. Jacoby, and D.C. Hooper. 2006. The
worldwide emergence of plasmid-mediated quinolone resistance.
Lancet Infect. Dis. 6:629–640.
41. Sojka, W.J. 1965. Escherichia coli in Domestic Animals and
Poultry. Review Series No. 7 of the Commonwealth Agricultural
Bureaux, Farnham Royal, Bucks, England, 205–206.
42. Soufi, L., Y. Saenz, L. Vinue, M.S. Abbassi, E. Ruiz, M.
Zarazaga, A.B. Hassen, S. Hammami, and C. Torres. 2011.
Escherichia coli of poultry food origin as reservoir of sulphonamide
resistance genes and integrons. Int. J. Food Microbiol.
144:497–502.
43. Thomson, K.S., and C.C. Sanders. 1992. Detection of
extended-spectrum beta-lactamases in members of the family
Enterobacteriaceae: comparison of the double-disk and
three-dimensional tests. Antimicrob. Agents Chemother.
36:1877–1882
44. Tivendale, A.K., C.M. Logue, S. Kariyawasam, D. Jordan,
A. Hussein, G. Li, Y. Wannemuehler, and L.K. Nolan. 2010.
Avian-pathogenic Escherichia coli strains are similar to neonatal
meningitis E. coli strains and are able to cause meningitis
in the rat model of human disease. Infect. Immun.
78:3412–3419.
45. United States Food and Drug Administration. 2005. Enrofloxacin
for poultry; final decision on withdrawal of new
animal drug application following formal evidentiary public
hearing (FR Doc No: 05-15224). Fed. Regist. 70:44105.
46. Veldman, K., L.M. Cavaco, D. Mevius, A. Battisti, A.
Franco, N. Botteldoorn, M. Bruneau, A. Perrin-Guyomard,
T. Cerny, C.D. Escobar, B. Guerra, A. Schroeter, M. Gutierrez,
K. Hopkins, A.L. Myllyniemi, M. Sunde, D. Wasyl,
and F.M. Aarestrup. 2011. International collaborative study
on the occurrence of plasmid-mediated quinolone resistance
in Salmonella enterica and Escherichia coli isolated from animals,
humans, food and the environment in 13 European
countries. J. Antimicrobiol. Chemother. 66:1278–1286.
47. Yamane, K., J. Wachino, S. Suzuki, and Y. Arakawa. 2008.
Plasmid-mediated qepA gene among Escherichia coli clinical
isolates from Japan. Antimicrob. Agents Chemother. 52:
1564–1566.
48. Zhao, L., S. Gao, H. Huan, X. Xu, X. Zhu, W. Yang, Q. Gao,
and X. Liu. 2009. Comparison of virulence factors and expression
of specific genes between uropathogenic Escherichia
coli and avian pathogenic E. coli in a murine urinary tract
infection model and a chicken challenge model. Microbiology
155:1634–1644.
Address correspondence to:
Ivan Literak, DVM, PhD
Department of Biology and Wildlife Diseases
Faculty of Veterinary Hygiene and Ecology
University of Veterinary and Pharmaceutical Sciences Brno
Palackeho tr. 1/3
612 42 Brno
Czech Republic
E-mail: literaki@vfu.cz
QUINOLONE-RESISTANT E. COLI AND EXPEC IN BROILERS 63
Příloha 17
DOLEJSKA, M., VILLA, L., DOBIASOVA, H., FORTINI, D., FEUDI, C., CARATTOLI, A., 2013, Plasmid
content of a clinically relevant Klebsiella pneumoniae clone from the Czech Republic, producing
CTX-M-15 and QnrB1: Antimicrobial Agents and Chemotherapy, v. 57, p. 1073-1076.
Souhrn
Byla stanovena primární nukleotidová sekvence plazmidů multirezistentního kmene K. pneumoniae ST416,
který pocházel z pacientů hospitalizovaných na Klinice dětské onkologie v ČR. Kmen nesl dva velké IncFIIK
plazmidy, které kromě genů rezistence k různým skupinám antibiotik jako součást multirezistentní variabilní
oblasti plazmidu, nesly další geny pro přídatné funkce. Jednalo se o geny pro rezistenci k těžkým kovům, vysoké
teplotě, pro produkci biofilmu a virulenci. Studie poukazuje na obrovskou plasticitu IncF plazmidů klinických
izolátů a jejich schopnost sdružovat se s novými faktory, které mohou hrát úlohu v adaptaci a fitness bakterie
v hostiteli.
Plasmid Content of a Clinically Relevant Klebsiella pneumoniae Clone
from the Czech Republic Producing CTX-M-15 and QnrB1
Monika Dolejska,a,b
Laura Villa,c
Hana Dobiasova,a
Daniela Fortini,c
Claudia Feudi,c
Alessandra Carattolic
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech
Republica
; CEITEC VFU, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republicb
; Department of Infectious, Parasitic and Immune-Mediated
Diseases, Istituto Superiore di Sanità, Rome, Italyc
The entire plasmid content of a multidrug-resistant, CTX-M-15-producing Klebsiella pneumoniae ST416 clone was investigated.
Two FIIK plasmids, pKDO1 (127 kb) and pKPN-CZ (207 kb), were identified and found to carry a formidable set of genes conferring
resistance to toxic compounds, metals, and antimicrobial drugs and exhibiting novel features putatively associated with
adaptation and fitness of the bacterium in the human host.
Extended-spectrum-␤-lactamase (ESBL)-producing Klebsiella
pneumoniae strains are opportunistic pathogens responsible
for nosocomial infections primarily in intensive care units, and
represent a high risk, especially for immunocompromised patients
treated in these wards (1, 2). CTX-M-15 is the dominant
type of cephalosporinase in Enterobacteriaceae in hospitalized patients
as well as in the broader community (3) and is mobilized by
plasmids of several incompatibility (Inc) groups, predominantly
IncI1 and IncF (4, 5).
Plasmids of the IncF group represent one of the most frequent
plasmid types, playing a major role in the dissemination of antimicrobial
resistance in Enterobacteriaceae. They contribute to the
fitness of their bacterial hosts by providing virulence and antimicrobial
resistance genes and show rapid evolution (6).
Recently, an outbreak caused by ESBL-producing Enterobacteriaceae,
mainly K. pneumoniae, was observed in a pediatric oncological
clinic in the Czech Republic (7). Thirty-five K. pneumoniae
strains belonging to seven sequence types (STs), carrying related
CTX-15-positive IncFIIK plasmids, were previously identified and
characterized (7) (Table 1). In this study, the entire plasmid content
of the most frequently isolated K. pneumoniae clone, ST416,
was investigated to ascertain the structure and features of the
CTX-M-15-carrying plasmid and to identify other plasmids contributing
to the successful dissemination of this clone.
The complete DNA sequence of plasmids was obtained by applying
the 454 genome sequencer FLX procedure on a library
constructed from total plasmid DNA purified from an ST416 K.
pneumoniae strain, by using an Invitrogen PureLink HiPure plasmid
filter midiprep kit (Invitrogen, Milan, Italy), according to the
manufacturer’s procedure (Roche Diagnostics, Monza, Italy).
Sixty-two contigs ranging from 33,451 to 252 bp, with at least
30-fold coverage, were obtained using GS-FLX gsAssembler software
and compared to GenBank data using BLAST (http://blast
.ncbi.nlm.nih.gov/Blast.cgi). After the read status output and
BLAST results were obtained, contigs were assembled by PCRbased
gap closure and sequencing.
DNA sequence analysis showed the presence of two plasmids:
pKDO1 (JX424423) and pKPN-CZ. pKDO1 is 127,509 bp and has
high similarity to several K. pneumoniae plasmids, such as pKF3-94
(GenBank accession no. FJ876826), pKPHS2 (CP003224), and
pKpQIL (GU595196; 52 to 61% coverage, 84 to 100% nucleotide
identity) (Fig. 1). It belongs to the incompatibility group FIIK, as it
carries the FIIK7 replicon allele (assigned by replicon sequence typing
[8]). pKDO1 also carries another replicon, encoding a Rep-3 family
initiator replication protein showing 99.6% amino acid identity with
replication proteins of pK245 (NC_010886) and pKF3-94, identified
in K. pneumoniae strains from Taiwan and China, respectively.
pKPN-CZ is 207,819 bp, carries replicon FIIK8 and an additional
FIBKPN replicon specific for pKPN3-like Klebsiella plasmids (marked
byvioletboxesinFig.1),andishighlyrelated(62to72%coverage,81
to 100% nucleotide identity) to the IncFIIK IncFIBKPN plasmids
pKPN-IT (JN233704), from the KPC-producing K. pneumoniae
ST258 clone (9), and pKPN3 (CP000648) (Fig. 1).
The plasmid pKDO1 contains a multidrug resistance region
(MRR) of 39,761 bp carrying an interesting set of antibiotic resistance
genes (red line in Fig. 1). The MRR is flanked on one side by
IS26 followed by qnrB1 and ⌬IS3000 and on the other by additional
common resistance genes with the end defined by an integron
terminal repeat (IRt) of an In4-type class 1 integron. In particular,
the MRR contains the ESBL blaCTX-M-15 gene in a region
showing high similarity to the MRR of plasmids pEK516
(EU935738) and pC15-1a (NC_005327), previously identified in
Escherichia coli strains belonging to pandemic lineage ST131 (Fig.
1) (10, 11). It also carries the plasmid-mediated quinolone resistance
qnrB1 gene, for the first time associated with an IncFIIK
plasmid, flanked by an IS26 element on the left and ⌬IS3000 truncated
by Tn5403 on the right. The same qnrB1-carrying element
structure (99% nucleotide identity) was identified in K. pneumoniae
plasmid pUC38-7 (EF682134). In addition, pKDO1 harbors
the EcoRII restriction/antirestriction system flanked by the
In4-type class 1 integron with the dfrA14 gene cassette on the left,
which showed 0 to 5 nucleotide differences from a region on some
IncN plasmids and the IncF plasmid pK245 (Fig. 1), suggesting the
Received 13 September 2012 Returned for modification 30 September 2012
Accepted 2 December 2012
Published ahead of print 10 December 2012
Address correspondence to Monika Dolejska, m.dolejska@centrum.cz.
Supplemental material for this article may be found at http://dx.doi.org/10.1128
/AAC.01886-12.
Copyright © 2013, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AAC.01886-12
February 2013 Volume 57 Number 2 Antimicrobial Agents and Chemotherapy p. 1073–1076 aac.asm.org 1073
exchange of the EcoRII restriction/antirestriction module among
unrelated plasmids. In pKDO1, this region is flanked by two IS26
elements that were likely involved in the acquisition of this
module.
Plasmid pKPN-CZ showed an increased number of putative
virulence-encoding clusters compared with other similar plasmids
previously identified in K. pneumoniae strains, such as a
KPC-producing ST258 clone (Fig. 1). In particular, a peptide/
nickel ABC transporting system, previously found in plasmids
pPANA10 (HE617161) and PAGR_p (CP003086) and on the
chromosome (CP001875) of the human- and plant-pathogenic
species Pantoea anatis, was identified on pKPN-CZ. The involvement
of peptide transporting systems in increasing colonization
abilities and virulence of bacterial strains was described previously
(12, 13). pKPN-CZ contains the mrkABCDF gene cluster, showing
Ͼ99% nucleotide identity with the mrk cluster, encoding type 3
fimbria, identified in the chromosomes of K. pneumoniae strains
HS11286 (CP003200) and MGH 78578 (CP000647) (14). The
same cluster was previously identified on IncX plasmids from E.
coli, profoundly enhancing the ability of E. coli to form biofilms
and increasing its conjugation efficiency (15, 16). To the best of
our knowledge, this is the first evidence of a type 3 fimbria cluster
associated with Klebsiella plasmids. The thermoresistance cluster
(positions 63,633 to 78,484) identified in the chromosome of the
human Cronobacter sakazakii strain ATCC 29544 (92% coverage,
99% nucleotide identity; accession no. FR714908) was also idenTABLE
1 Multidrug-resistant Klebsiella pneumoniae strains harboring IncFIIK repliconsa
MLST Strain Plasmid size(s) (kb)b
PCR result forc
:
repA fecA clpK yliB mrk
ST416 16 200, 120 ϩ ϩ ϩ ϩ ϩ
3 190, 120 ϩ ϩ ϩ ϩ ϩ
7 200, 120 ϩ ϩ ϩ ϩ ϩ
9 210, 120 ϩ ϩ ϩ ϩ ϩ
22 200, 120 ϩ ϩ ϩ ϩ ϩ
55 200, 120 ϩ ϩ ϩ ϩ ϩ
13 220, 120 ϩ Ϫ ϩ ϩ Ϫ
23 220, 140 ϩ Ϫ ϩ ϩ Ϫ
49 120 Ϫ Ϫ Ϫ Ϫ Ϫ
ST323 20 180, 120, 45 ϩ ϩ ϩ Ϫ Ϫ
27 180, 120, 45 ϩ ϩ ϩ Ϫ Ϫ
25 180, 100 ϩ ϩ ϩ Ϫ Ϫ
19 280, 220, 100 ϩ ϩ ϩ Ϫ Ϫ
11 255, 220, 100 ϩ ϩ ϩ Ϫ Ϫ
5 255, 220, 100 ϩ ϩ ϩ Ϫ Ϫ
12 120, 70 Ϫ Ϫ Ϫ Ϫ Ϫ
ST627 15 235 ϩ ϩ ϩ Ϫ Ϫ
30 235 ϩ ϩ ϩ Ϫ Ϫ
33 235 ϩ ϩ ϩ Ϫ Ϫ
39 235, 100 ϩ ϩ ϩ Ϫ Ϫ
43 235 ϩ ϩ ϩ Ϫ Ϫ
44 235 ϩ ϩ ϩ Ϫ Ϫ
ST321 41 205, 120 ϩ ϩ ϩ Ϫ Ϫ
8 217, 120, 70 ϩ ϩ ϩ Ϫ Ϫ
2 203, 92, 63 ϩ ϩ ϩ Ϫ Ϫ
4 203, 115, 63 ϩ ϩ ϩ Ϫ Ϫ
ST626 46 160, 120 Ϫ ϩ ϩ Ϫ Ϫ
52 160, 120 Ϫ ϩ ϩ Ϫ Ϫ
29 150, 120 Ϫ ϩ ϩ Ϫ Ϫ
ST280 56 220, 120, 60 ϩ ϩ ϩ Ϫ Ϫ
18 220, 100, 55 ϩ ϩ ϩ Ϫ Ϫ
42 220, 120, 55 ϩ ϩ ϩ Ϫ Ϫ
ST628 6 183, 68 ϩ Ϫ ϩ Ϫ Ϫ
17 180, 120 ϩ Ϫ ϩ Ϫ Ϫ
a
All the strains except those belonging to ST627 and strain no. 6 carry blaCTX-M-15. K. pneumonae strain 16 was selected for complete plasmid sequencing. All the strains are positive
for the FIIK replicon.
b
The plasmid sizes were determined by S1 pulsed-field gel electrophoresis in a previous study (7).
c
Results of PCR-based screening for putative virulence determinants found in pKPN-CZ in a collection of K. pneumoniae strains from pediatric oncological patients. repA is used
for detection of the FIBKPN replicon, fecA for iron(III) dicitrate transport system, clpK for the marker of thermoresistance, yliB for the peptide/nickel ABC transporting system of
Pantoea origin, and mrk for the junction between the type 3 fimbria cluster mrkABCDF and the pKPN-CZ plasmid scaffold.
Dolejska et al.
1074 aac.asm.org Antimicrobial Agents and Chemotherapy
tified in pKPN-CZ. Part of this cluster, including the gene clpK,
that was demonstrated to increase bacterial thermal tolerance was
previously found in other large IncFIIK Klebsiella plasmids (17).
We assume that transport systems, thermoresistance clusters, and
fimbria clusters found in pKPN-CZ may be involved in virulence
properties of the strains carrying them as well as in increased survival
within the hospital environment, overall contributing to the
successful dissemination and maintenance of these plasmids in K.
pneumoniae during the hospital outbreak.
A PCR assay targeting five pKPN-CZ features, including the
putative virulence determinants, was designed and tested on the
35 K. pneumoniae strains from the oncological clinic (Table 1;
also, see Table S1 in the supplemental material). The FIBKPN replicon,
the clpK gene involved in thermotolerance, and the iron(III)
uptake system were largely prevalent in the strains of our collection,
while the novel Pantoea-like peptide ABC transport system
and the type 3 fimbria cluster were found only in K. pneumoniae
ST416 clones harboring large plasmids (190 to 210 kb) (Table 1).
Plasmid analysis and the PCR-based screening revealed high plasticity
of the pKPN-CZ-like plasmids, likely due to plasmid rearrangements
that occurred during the course of the outbreak. We
propose this PCR-based approach as an efficient method for
screening virulence determinants that can be identified in K. pneumoniae
strains, presumably associated with pKPN-CZ-like plasmids,
as observed in our collection.
Our study confirms that K. pneumoniae plasmids possess a
FIG 1 Major structural features of pKDO1 and pKPN-CZ. Plasmids sequenced in this study were compared as follows: pKDO1 was compared with pKF-94
(FJ876826); a part of the MRR of pKDO1 was compared with the similar region on pEK516 (EU935738), a plasmid identified in E. coli clone ST131; and
pKPN-CZ was compared with pKPN-IT (JN233704) found in K. pneumoniae ST258 clones and with pKPN3 (CP000648). White boxes indicate plasmid scaffold
regions that are in common among the plasmids. The tra locus is indicated by white boxes with capital letters indicating the respective tra genes (i.e., W represents
traW and so on). Resistance genes are indicated by orange boxes. Transposon-related genes (tnpA and tnpR), the class 1 integrase gene, and insertion sequences
are indicated by blue boxes. Other genes are indicated by colored boxes as follows: violet, replicase genes; red, the putative virulence clusters acquired by
pKPN-IT, pKPN-CZ and pKPN3 including the lac operon, and loci corresponding to the iron(III) uptake system, phosphate/phosphonate ABC transport system
(ABC phosph locus), nickel/peptide ABC transport system of Pantoea origin (ABC peptid locus), glutathione ABC transport system (ABC glut locus), type 3
fimbriae (mrkABCDF), and thermoresistance. The lac operon, the iron(III) uptake system, and ABC transport systems represent clusters formed by several genes
but they are indicated by a unique block. Gray shading indicates Ͼ99% identity in the MRRs of pKDO1 and pEK516. Labels common to both MRRs appear only
in the pKDO1 diagram, and only differences in pEK516 are labeled. The black lines show the extent of Tn1721 and ⌬Tn2 of MRR of pKDO1 and pEK516. The
red line indicates the position of MRR in pKDO1. The region common to pKDO1, the IncN plasmids pKOX105 (FJ223605) and p12 (HM126016), and the IncF
plasmid pK245 (DQ449578) is formed by an In4-type class 1 integron with the dfrA14 gene cassette and EcoRII restriction/antirestriction system and is flanked
by two IS26 elements. The diagrams are not to scale.
Plasmids in CTX-M-15-Producing K. pneumoniae
February 2013 Volume 57 Number 2 aac.asm.org 1075
dynamic nature, the capacity for rapid evolution, and the ability to
integrate new resistance and virulence determinants, overall increasing
fitness and viability of the bacteria hosting them.
Nucleotide sequence accession numbers. The GenBank accession
numbers for the sequences determined in this study are
JX424423 (for pKDO1) and JX424424 (for pKPN-CZ).
ACKNOWLEDGMENTS
Our thanks go to Eva Brhelova and Ivana Jamborova (University of Veterinary
and Pharmaceutical Sciences, Brno, Czech Republic) for excellent
assistance in the laboratory. We also thank Alena Sevcikova, Jana Jurankova,
and Jaroslav Sterba (The University Hospital, Brno, Czech Republic)
for providing strains for analysis.
This study was funded by the travel grant “FEMS Advanced Fellowship
2011” to M.D., by grants from the Czech Science Foundation (P502/10/
P083) and CEITEC (CZ.1.05/1.1.00/02.0068) to M.D., and by a grant
from the MIUR CNR flagship PB05 “InterOmics” project to A.C.
REFERENCES
1. Ruiz E, Rojo-Bezares B, Sáenz Y, Olarte I, Esteban I, Rocha-Gracia R,
Zarazaga M, Torres C. 2010. Outbreak caused by a multi-resistant Klebsiella
pneumoniae strain of new sequence type ST341 carrying new genetic
environments of aac(6=)-Ib-cr and qnrS1 genes in a neonatal intensive care
unit in Spain. Int. J. Med. Microbiol. 300:464–469.
2. Sandegren L, Linkevicius M, Lytsy B, Melhus Å, Andersson DI. 2012.
Transfer of an Escherichia coli ST131 multiresistance cassette has created a
Klebsiella pneumoniae-specific plasmid associated with a major nosocomial
outbreak. J. Antimicrob. Chemother. 67:74–83.
3. Cantón R, González-Alba JM, Galán JC. 2012. CTX-M enzymes: origin
and diffusion. Front. Microbiol. 3:110.
4. Carattoli A. 2009. Resistance plasmid families in Enterobacteriaceae. Antimicrob.
Agents Chemother. 53:2227–2238.
5. Madec JY, Poirel L, Saras E, Gourguechon A, Girlich D, Nordmann P,
Haenni M. 2012. Non-ST131 Escherichia coli from cattle harbouring human-like
blaCTX-M-15-carrying plasmids. J. Antimicrob. Chemother. 67:
578–581.
6. Johnson TJ, Nolan LK. 2009. Pathogenomics of the virulence plasmids of
Escherichia coli. Microbiol. Mol. Biol. Rev. 73:750–754.
7. Dolejska M, Brhelova E, Dobiasova H, Krivdova J, Jurnakova J, Sevcikova
A, Dubska L, Literak I, Cizek A, Vavrina M, Kutnikova L, Sterba
J. Dissemination of IncFIIK-type plasmids in multiresistant CTX-M-15producing
Enterobacteriaceae isolates from children in hospital paediatric
oncology wards. Int. J. Antimicrob. Agents, in press.
8. Villa L, García-Fernández A, Fortini D, Carattoli A. 2010. Replicon
sequence typing of IncF plasmids carrying virulence and resistance determinants.
J. Antimicrob. Chemother. 65:2518–2529.
9. García-Fernández A, Villa L, Carta C, Venditti C, Giordano A, Venditti
M, Mancini C, Carattoli A. 2012. Klebsiella pneumoniae ST258 producing
KPC-3 identified in Italy carries novel plasmids and OmpK36/OmpK35
porin variants. Antimicrob. Agents Chemother. 56:2143–2145.
10. Boyd DA, Tyler S, Christianson S, McGeer A, Muller MP, Willey BM,
Bryce E, Gardam M, Nordmann P, Mulvey MR. 2004. Complete nucleotide
sequence of a 92-kilobase plasmid harboring the CTX-M-15 extended-spectrum
beta-lactamase involved in an outbreak in long-term-care
facilities in Toronto, Canada. Antimicrob. Agents Chemother. 48:3758–
3764.
11. Woodford N, Carattoli A, Karisik E, Underwood A, Ellington MJ,
Livermore DM. 2009. Complete nucleotide sequences of plasmids
pEK204, pEK499, and pEK516, encoding CTX-M enzymes in three major
Escherichia coli lineages from the United Kingdom, all belonging to the
international O25:H4-ST131 clone. Antimicrob. Agents Chemother. 53:
4472–4482.
12. Hiron A, Posteraro B, Carrière M, Remy L, Delporte C, La Sorda M,
Sanguinetti M, Juillard V, Borezée-Durant E. 2010. A nickel ABCtransporter
of Staphylococcus aureus is involved in urinary tract infection.
Mol. Microbiol. 77:1246–1260.
13. Samen U, Gottschalk B, Eikmanns BJ, Reinscheid DJ. 2004. Relevance of
peptide uptake systems to the physiology and virulence of Streptococcus
agalactiae. J. Bacteriol. 186:1398–1408.
14. Gerlach GF, Allen BL, Clegg S. 1989. Type 3 fimbriae among enterobacteria
and the ability of spermidine to inhibit Mr/K hemagglutination. Infect.
Immun. 57:219–224.
15. Norman A, Hansen LH, She Q, Sørensen SJ. 2008. Nucleotide sequence
of pOLA52: a conjugative IncX1 plasmid from Escherichia coli which enables
biofilm formation and multidrug efflux. Plasmid 60:59–74.
16. Ong CL, Beatson SA, McEwan AG, Schembri MA. 2009. Conjugative
plasmid transfer and adhesion dynamics in an Escherichia coli biofilm.
Appl. Environ. Microbiol. 75:6783–6791.
17. Bojer MS, Struve C, Ingmer H, Hansen DS, Krogfelt KA. 2010. Heat
resistance mediated by a new plasmid encoded Clp ATPase, ClpK, as a
possible novel mechanism for nosocomial persistence of Klebsiella pneumoniae.
PLoS One 5:e15467. doi:10.1371/journal.pone.0015467.
Dolejska et al.
1076 aac.asm.org Antimicrobial Agents and Chemotherapy
Příloha 18
KLIMES, J., MACHALKOVA, M., DOLEJSKA, M., CIZEK, A., JANOSZOWSKA, D., ALEXA, P.,
ALBRECHTOVA, K., VOJTECH, J., LITERAK, I., 2013, Escherichia coli-producing extended-spectrum
beta-lactamases CTX-M-15 in a captive South American tapir (Tapirus terrestris): Journal of Zoo
and Wildlife Medicine, v. 44, p. 173-175.
Souhrn
V brněnské zoo byl z uhynulého tapíra s intermandibulárním abscesem a pneumonií izolován multirezistentní
patogenní kmen E. coli produkující beta-laktamázu CTX-M-15. Z důvodu epidemiologického šetření byly
odebrány další vzorky od zvířat ze stejného výběhu a z prostředí. Z těchto vzorků byl izolován kmen identický
s tím, který byl zjištěn v plicích uhynulého tapíra. Studie ukazuje na šíření kmenů s patogenním potenciálem
mezi zvířaty v zoo obývající stejné prostředí.
Journal of Zoo and Wildlife Medicine 44(1): 173–175, 2013
Copyright 2013 by American Association of Zoo Veterinarians
ESCHERICHIA COLI–PRODUCING EXTENDED-SPECTRUM BETALACTAMASE
CTX-M-15 IN A CAPTIVE SOUTH AMERICAN TAPIR
(TAPIRUS TERRESTRIS)
Jiri Klimes, D.V.M., Ph.D., Marketa Machalkova, D.V.M., Monika Dolejska, M.S., Ph.D., Alois
Cizek, D.V.M., Ph.D., Dagmar Janoszowska, M. S., Pavel Alexa, D.V.M., Ph.D., Katerina
Albrechtova, D.V.M., Jiri Vojtech, and Ivan Literak, D.V.M., Ph.D.
Abstract: Only a few reports exist on the occurrence of resistant bacteria in zoo animals. Therefore, an
isolation of multiresistant Escherichia coli from the lungs of a captive South American tapir (Tapirus terrestris) lead
to its characterization and further investigation of samples from animals inhabiting the same paddock and from
the shared environment. The tapir suffered from an intermandibular abscess and pneumonia and was
euthanatized after unsuccessful therapy, including administration of antibiotics. The authors performed selective
isolation of extended-spectrum beta-lactamase (ESBL)–positive E. coli strains and identification of resistance
genes using polymerase chain reaction. Seven multiresistant, ESBL-producing E. coli isolates were obtained, all
belonging to the B2 phylogenetic group and showing identical profile on pulsed-field gel electrophoresis. These
isolates carried several resistance genes, including the gene blaCTX-M-15. This case demonstrates the transmission of
related epidemiologically important E. coli isolates whose potential transmission to other animals and zoo staff
can be assumed.
Key words: Antibiotic resistance, Escherichia coli, extended-spectrum beta-lactamase, South American tapir,
Tapirus terrestris.
BRIEF COMMUNICATION
Despite the growing importance of antibiotic
resistance and attention recently given to this
topic, only a few reports exist on the occurrence
of resistant bacteria in zoo animals.1,7
In the
present study, a multiresistant Escherichia coli
isolate in a 5-yr-old male South American tapir
(Tapirus terrestris) residing at the Brno Zoological
Garden, Czech Republic, is described.
The animal suffered from diphtheroid-ulcerative
stomatitis, swelling and prolapse of the
tongue, and intermandibular abscess. After 3 wk
of unsuccessful therapy, including administration
of antibiotics (parenteral penicillin, gentamicin,
enrofloxacin, and mouth rinsing with trimethoprim-sulfonamides),
the animal was euthanatized
because of its deteriorating condition. Fibrinopurulent
tracheobronchitis and acute purulent pneumonia
were found on postmortem examination.
Bacteriologic culture from the lungs yielded a
multiresistant E. coli isolate harboring the gene
encoding production of the extended-spectrum
beta-lactamase (ESBL) CTX-M-15. The tapir had
come from the Gdansk Zoo (Poland) 4 yr earlier
and was housed together with a female obtained
from the Riga Zoo (Latvia) and their young, born
in Brno. The three tapirs shared the paddock with
three greater rheas (Rhea americana), a pair of
capybaras (Hydrochoerus hydrochaeris), a pair of
coscoroba swans (Coscoroba coscoroba), and a pair
of upland geese (Chloephaga picta). In addition to
samples from the dead tapir, the authors examined
a total of 18 additional samples from other
animals and their environment (mouth swabs
from the female tapir and her young and pooled
samples of feces from both tapirs, capybaras,
rheas, and swans, respectively). Eight swabs from
the housing of tapirs and capybaras, and four
swabs from the shared paddock were also obtained.
Selective isolation of ESBL-positive E. coli
strains and their subsequent characterization
using polymerase chain reaction for identifying
selected resistance genes and phylogroup were
performed as described previously.4,8
The XbaI
restriction profiles of chromosomal DNA extracted
within agarose gel plugs were analyzed by
pulsed-field gel electrophoresis.3
Transferability
From the Department of Biology and Wildlife Diseases,
Faculty of Veterinary Hygiene and Ecology, University of
Veterinary and Pharmaceutical Sciences Brno, Palackeho
1–3, 612 42 Brno, Czech Republic (Klimes, Machalkova,
Dolejska, Janoszowska, Albrechtova, Vojtech, Literak);
Department of Infectious Diseases and Microbiology,
Faculty of Veterinary Medicine, University of Veterinary
and Pharmaceutical Sciences Brno, Palackeho 1–3, 612 42
Brno, Czech Republic (Cizek); CEITEC VFU, University
of Veterinary and Pharmaceutical Sciences Brno, Czech
Republic (Dolejska, Cizek, Literak); and the Veterinary
Research Institute, Hudcova 70, 621 00 Brno, Czech
Republic (Alexa). Correspondence should be directed to
Dr. Klimes (klimesj@vfu.cz).
173
of antibiotic resistance genes was tested by platemating
conjugation experiments10
and heat shock
transformation of plasmid DNA to DH5a competent
cells. Resistance-encoding plasmids were
analyzed by restriction fragment length polymorphism
patterns obtained by EcoRV digestion and
by replicon typing.2
The ESBL-producing isolates
were serotyped,5,11
and virulence factors were
determined by serologic and molecular meth-
ods,6,12
including heat-stable and heat-labile enterotoxins;
verotoxin; adherence factor intimin
(eaeA); adhesins F4, F5, F6, F18, or F41; and
genes for selected virulence factors associated
with extraintestinal pathogenic E. coli.
A total of seven ESBL-producing E. coli isolates
were obtained: one isolate from the lungs of the
dead tapir, one isolate from the feces of rheas, one
isolate from the feces of swans, one isolate from
the tapir housing environment, and three isolates
from the shared paddock. All isolates belonged to
the B2 phylogenetic group and showed identical
pulse profile on pulsed-field gel electrophoresis
(Fig. 1). They were resistant to ampicillin, cephalothin,
ciprofloxacin, nalidixic acid, and tetracycline
and carried the antibiotic resistance genes
blaCTX-M-15, tetA, and aac(6’)Ib-cr, as well as the
integrase gene intI1. Some isolates also demonstrated
resistance to amoxicillin-clavulanate, gentamicin,
and ceftazidime, an exception being the
lung isolate, which, on the other hand, was
resistant to sulfonamides and trimethoprim-sulfamethoxazole.
Serotyping was not successful,
except for one isolate from the environment that
belonged to the O8 serotype. No genes for the
virulence factors tested except for fimC was
detected. Conjugative transfer of plasmids carrying
the genes blaCTX-M-15 into recipient cells of E.
coli and Salmonella was not demonstrated. The
lung E. coli isolate differed from the other isolates
by the absence of the gene blaOXA and by the
presence of the resistance gene aadA1 and the
gene intI2. The genes blaCTX-M-15 together with tetA
and aac(6’)Ib-cr on the incompatibility group F
plasmid obtained from transformants of this
isolate were detected. The plasmid size was 105
kb.
This current case demonstrates the epidemiologic
spread of multiresistant E. coli strains
carrying the gene blaCTX-M-15. Although the abovecharacterized
isolate was probably nonpathogenic
and has not been confirmed as the primary cause
of the tapir’s disease, potential transmission to
other animals and zoo staff (animal keepers,
veterinarians) could occur, as suggested by the
Figure 1. Pulsed-field profiles of the E. coli isolates obtained from the lungs of the tapir, other animals, and the
environment. The gel plugs were embedded in 1% SEAKEM gold gel agarosis and run on Biorad a pulsed-field gel
electrophoresis apparatus under the following conditions: initial time, 2.2 sec; final time, 54.2 sec; start ratio, 1;
voltage, 200 V (6 V/cm); run time, 19 hr. Salmonella Braenderup H9812 was used as the molecular weight
standard.
174 JOURNAL OF ZOO AND WILDLIFE MEDICINE
occurrence of related E. coli isolates in animals
sharing the paddock with the tapir. A similar case
was described on a large-scale pig farm in Denmark,
where transmission of E. coli strains
carrying IncN plasmids that mediate cephalosporin
resistance was demonstrated between pigs and
farm workers.9
The findings of this current case
suggest that the spread of resistant enteric bacteria
in a captive environment is enhanced by a high
density of animals in a limited space, where
contact with feces is more frequent.
Acknowledgments: The study was funded by
grant MSM6215712402 from the Ministry of
Education, Youth, and Sports of the Czech
Republic, grant P502/10/P083 of the Czech Science
Foundation, and grant 64/2010/FVHE of the
Internal Grant Agency, University of Veterinary
and Pharmaceutical Sciences Brno. This study was
partly supported by the project ‘‘CEITEC—Central
European Institute of Technology’’ (CZ.1.05/
1.1.00/02.0068) from the European Regional Development
Fund. The authors are grateful for the
cooperation of Dr. Stanislav Mazanek, Ph.D.,
veterinarian at the Brno Zoological Garden, and
for the bacteriologic examination of postmortem
material by Dr. Ludmila Kohoutova.
LITERATURE CITED
1. Ahmed, A. M., Y. Motoi, M. Sato, A. Maruyama,
H. Watanabe, Y. Fukumoto, and T. Shimamoto. 2007.
Zoo animals as reservoirs of gram-negative bacteria
harbouring integrons and antimicrobial resistance
genes. Appl. Environ. Microb. 73: 6686–6690.
2. Carattoli, A., A. Bertini, L. Villa, V. Falbo, K. L.
Hopkins, and E. J. Threlfall. 2005. Identification of
plasmids by PCR-based replicon typing. J. Microbiol.
Methods 63: 219–228.
3. Center for Disease Control and Prevention. 2004.
Standardized molecular subtyping of foodborne bacterial
pathogens by pulsed-field gel electrophoresis.
CDC, Atlanta, Georgia.
4. Clermont, O., S. Bonacorsi, and E. Bingen. 2000.
Rapid and simple determination of the Escherichia coli
phylogenetic group. Appl. Environ. Microbiol. 66:
4555–4558.
5. Clermont, O., H. Dhanji, M. Upton, T. Gibreel,
A. Fox, D. Boyd, M. R. Mulvey, P. Nordmann, E.
Ruppe, J. L. Sarthou, T. Frank, S. Vimont, G. Arlet, C.
Branger, N. Woodford, and E. Denamur. 2009. Rapid
detection of the O25-ST131 clone of Escherichia coli
encompassing the CTX-M-15–producing strains. J.
Antimicrob. Chemother. 64: 274–277.
6. DebRoy, C., E. Roberts, B. Jayarao, and J. W.
Brooks. 2008. Bronchopneumonia associated with
extraintestinal pathogenic Escherichia coli in a horse.
J. Vet. Diagn. Invest. 20: 661–664.
7. Gopee, N. V., A. A. Adesiyun, and K. Caesar.
2000. A longitudinal study of Escherichia coli strains
isolated from captive mammals, birds, and reptiles in
Trinidad. J. Zoo Wildl. Med. 31: 353–360.
8. Literak, I., M. Dolejska, D. Janoszowska, J.
Hrusakova, V. Meissner, H. Rzyska, S. Bzoma, and A.
Cizek. 2010. Antibiotic-resistant Escherichia coli bacteria,
including strains with genes encoding the extendedspectrum
beta-lactamase and QnrS, in waterbirds on
the Baltic Sea coast of Poland. Appl. Environ. Microbiol.
76: 8136–8134.
9. Moodley, A., and L. Guardabassi. 2009. Transmission
of IncN plasmids carrying blaCTX-M-1 between
commensal Escherichia coli in pigs and farm workers.
Antimicrob. Agents Chemother. 53: 1709–1711.
10. Olesen, I., H. Hasman, and F. M. Aarestrup.
2004. Prevalence of beta-lactamases among ampicillinresistant
Escherichia coli and Salmonella isolated from
food animals in Denmark. Microb. Drug Resist. 10:
334–340.
11. Salajka, E., Z. Salajkova, P. Alexa, and M.
Hornich. 1992. Colonization factor different from
K88, K99, F41 and 987P in enterotoxigenic Escherichia
coli strains isolated from postweaning diarrhoea in
pigs. Vet. Microbiol. 32: 163–175.
12. Sramkova Zajacova, Z., L. Konstantinova, and P.
Alexa. 2012. Detection of virulence factors of Escherichia
coli focused on prevalence of EAST1 toxin in
stool of diarrheic and non-diarrheic piglets and presence
of adhesion involving virulence factors in astA
positive strains. Vet. Microbiol. 154: 369–375.
Received for publication 19 August 2011
KLIMES ET AL.—RESISTANT ESCHERICHIA COLI IN A CAPTIVE TAPIR 175
Příloha 19
ACCOGLI, M., FORTINI, D., GIUFRÈ, M., GRAZIANI, C., DOLEJSKA, M., CARATTOLI, A., CERQUETTI,
M., 2013, IncI1 plasmids associated with the spread of CMY-2, CTX-M-1 and SHV-12 in
Escherichia coli of animal and human origin: Clinical Microbiology and Infection, v. 19, p. E238-
240.
Souhrn
Byla provedena komparace sbírky plazmidů z izolátů E. coli humánního a aviárního původu nesoucích ESBL
nebo AmpC původem především z Itálie. V souboru dominovaly epidemické IncI1 plazmidy. Aviární izoláty
E. coli nesly IncI1-ST12 plazmidy s genem blaCMY-2. Podobné plazmidy byly dříve identifikovány u humánních
izolátů salmonel v USA. Identické plazmidy sdílené humánními a aviárními kmeny E. coli nebyly prokázány.
IncI1 plasmids associated with the spread of
CMY-2, CTX-M-1 and SHV-12 in Escherichia
coli of animal and human origin
M. Accogli1
, D. Fortini1
, M. Giufre1
, C. Graziani2
,
M. Dolejska3,4
, A. Carattoli1
and M. Cerquetti1
1) Department of Infectious, Parasitic and Immune-Mediated Diseases,
Istituto Superiore di Sanita, Rome, Italy, 2) Department of Veterinary
Public Health and Food Safety, Istituto Superiore di Sanita, Rome, Italy,
3) Department of Biology and Wildlife Diseases, Faculty of Veterinary
Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences,
Brno, Czech Republic and 4) CEITEC VFU, University of Veterinary and
Pharmaceutical Sciences Brno, Brno, Czech Republic
Abstract
Fourteen plasmids carrying blaCTX-M-1, blaSHV-12 or blaCMY-2 genes
from Escherichia coli of both avian and human origin were analysed.
IncI1 plasmids were largely predominant. Plasmid mutilocus
sequence typing and comparative analysis revealed that the
blaCMY-2-ST12-IncI1 plasmids from avian E. coli were identical to
those previously found in Salmonella from humans, but different to
those associated with human E. coli. The IncI1-ST3 plasmids
carrying blaCTX-M-1 or blaSHV-12 were related to those previously
identified in avian E. coli, but different to those identified in human
E. coli. Overall, no plasmids shared by E. coli of both origin (human/
avian) were identified; however, further investigations are needed.
Keywords: Zoonosis, Escherichia coli, PBRT, ESBL, pMLST
Original Submission: 16 October 2012; Revised Submission:
26 November 2012; Accepted: 9 December 2012
Editor: R. Cantón
Article published online: 17 January 2013
Clin Microbiol Infect 2013; 19: E238–E240
10.1111/1469-0691.12128
Corresponding author: Dr A. Carattoli, Department of Infectious,
Parasitic and Immuno-Mediated Diseases, Istituto Superiore di Sanita,
viale Regina Elena 299, 00161 Rome, Italy
E-mail: alecara@iss.it
The presence of extended-spectrum beta-lactamase (ESBL)producing
and/or AmpC-producing Salmonella and Escherichia
coli in animals and food has been increasingly reported
worldwide. In strains of animal origin, plasmids belonging to
the Incompatibility group I1 (IncI1) have been associated with
genes such as blaCTX-M-1, blaSHV-12 and blaCMY-2 [1–4]. Recently
in The Netherlands, Leverstein-van Hall and colleagues
demonstrated that patients, retail chicken meat and poultry
share the same ESBL genes, plasmids and strains [5]. Our
previous investigation demonstrated that E. coli carrying ESBL
and/or AmpC genes were genetically diverse between human
and avian sources, but the potential horizontal transfer of ESBL
determinants through plasmids was not investigated, and was
the objective of this study [6].
A collection of 378 E. coli strains (277 extraintestinal
pathogenic E. coli -ExPEC- strains and 101 strains from
healthy avian species), previously characterized by phylogenetic
typing, multilocus sequence typing (MLST) and for
presence of the ESBL genes [6], was further analysed for the
detection of the blaCMY-2 gene, and for plasmid content and
localization of ESBL and AmpC genes [4]. For plasmid
comparison, six previously characterized IncI1-carrying strains
were also included: two carried the blaCTX-M-1 gene, three
harboured the blaCMY-2 gene and one the blaSHV-12 gene. One
strain was isolated in Italy [7], three blaCMY-2-positive
Salmonella spp. strains were isolated in the USA [3] (kindly
provided by Dr Jason Folster, Centers for Disease Control
and Prevention, Atlanta, GA, USA), and two blaCTX-M-1positive
E. coli were from France and Poland, respectively
[8,9]. Plasmid content was analysed by the PCR-based
replicon typing (PBRT) method [10]. IncI1 plasmids were
further typed by plasmid multilocus sequence typing (pMLST),
as previously described [7]. Selected prototypic plasmids
were further characterized by restriction fragment length
polymorphism (RFLP) analysis using PstI restriction (New
England Bio-Labs, Inc., Ipswich, MA, USA) [7]. IncI1 plasmids
were transferred by transformation (MAX Efficiency DH5a;
Invitrogen, Milan, Italy) and transformants were screened by
PBRT and for the blaCTX-M, blaSHV and blaCMY genes [6,7,10].
A total of 14 E. coli strains (six human isolates and eight
avian isolates) possessing ESBL or AmpC genes were
identified: five strains carried the blaCTX-M-1 gene, five
blaCMY-2, one harboured both blaCTX-M-1 and blaCMY-2, one
blaCTX-M-2 and blaCMY-2, and two strains carried the blaSHV-12
gene (Table 1). By PBRT, all 14 blaCTX-M-1-, blaSHV-12- and/or
blaCMY-2-positive strains contained multiple replicons
(Table 1). IncF and IncI1 plasmids were the most frequent
plasmid types identified in E. coli strains of both origins and
were further analysed. Transformation experiments were
carried out on the 10 IncI1-IncF-positive strains, demonstrating
that IncI1 plasmids were associated with the blaCTXM-1-,
blaSHV-12- and/or blaCMY-2- genes in nine of 10 human
and avian strains. (Table 1).
By pMLST, the nine IncI1 plasmids were classified into seven
different sequence types (STs, Table 1): two on four blaCMY-2carrying
plasmids were assigned to ST12, the remaining two
ª2013 The Authors
Clinical Microbiology and Infection ª2013 European Society of Clinical Microbiology and Infectious Diseases
RESEARCH NOTE EPIDEMIOLOGY
plasmids showed novel sequence types (ST85 and ST86). The
three positively transferred blaCTX-M-1-carrying plasmids were
assigned to ST3, ST11 and ST97, respectively. The two blaSHV-
12-carrying plasmids were assigned to ST3 and ST26, respectively
(Table 1).
The four blaCMY-2-IncI1 plasmids (two ST12 and one ST86
from poultry, and one ST85 of human origin) were compared
with three blaCMY-2-IncI1/ST12 plasmids previously identified in
S. enterica serovars Saintpaul, Typhimurium and Heidelberg in
the USA from human sources (strains AM31196, AM31875
and AM33047), by PstI-RFLP analysis [3]. Plasmids belonging to
the same ST12 exhibited an indistinguishable profile, irrespective
of both isolate species and source, while plasmids
belonging to ST85 and ST86 showed different restriction
profiles, as expected (Fig. 1). IncI1/ST3 and IncI1/ST97 plasmids
carrying blaSHV-12 and/or blaCTX-M-1 from different
sources and origins were also compared. Two blaCTX-M-1IncI1/ST3
plasmids, both from an avian source but of different
geographical origin, showed related but not identical profiles.
Notably, two IncI1/ST3 plasmids carrying SHV-12, identified
from poultry in Italy in 2005 [7] and 2009 (this study), showed
identical restriction profiles (Fig. 1). A different profile was
exhibited by the blaCTX-M-1 -ST97 IncI1 plasmid.
Overall, ESBL-positive plasmids from our collection of E. coli
appeared different according to the human or avian source,
because they did not share any ST or RFLP types, even when
they carried the same ESBL or CMY-2 determinant and
belonged to the same Inc group.
IncI1/ST3 plasmids have been found to be associated with
the blaCTX-M-1 gene among E. coli strains of avian and human
origin in the Netherlands [5]. In this study, related blaCTX-M-1IncI1/ST3
plasmids were detected among avian strains isolated
TABLE 1. Characteristics of ESBL or AmpC-carrying plasmids in E. coli (n = 17) and Salmonella (n = 3) analysed in this study
Strain Origin Country Year
ESBL or
AmpC gene
Plasmid characterization
ReferencePBRT in donors
PBRT in
transformants
pMLSTa
IncI1-plasmid
STrepI1 ardA trbA sogS pilL
E. coli OC144 Human Italy 2009 blaCTX-M-1 I1, FIA, FIB, F, X1 I1 1 2 16 9 1 97 This study
E. coli 5c Poultry Italy 2009 blaCTX-M-1 I1, HI2, FIB, F I1 1 3 3 6 2 11 This study
E. coli 50c Poultry Italy 2009 blaCTX-M-1 I1, F I1 2 1 4 1 2 3 This study
E. coli OC146 Human Italy 2009 blaCTX-M-1 FIB, F ND ND This study
E. coli BE305 Human Italy 2009 blaCTX-M-1 FIA, FIB, F ND ND This study
b
E. coli 37c Poultry Italy 2009 blaCTX-M-1,
blaCMY-2
I1, N, FIB, F, K K – This study
E. coli 41c Poultry Italy 2009 blaCTX-M-2,
blaCMY-2
HI2, FIB, F, K, X1 ND ND This study
E. coli 65c Poultry Italy 2009 blaCMY-2 I1, FIB, F I1 1 4 3 4 1 12 This study
E. coli 90c Poultry Italy 2009 blaCMY-2 I1, FIB, F, X1 I1 1 4 3 4 1 12 This study
E. coli BE310 Human Italy 2009 blaCMY-2 I1, FIB, F I1 2 4 15 11 2 85 This study
E. coli 44c Poultry Italy 2009 blaCMY-2 I1, HI2, FIB, F I1 1 4 2 4 2 86 This study
E. coli PA263 Human Italy 2009 blaCMY-2 FIB, F, K ND ND This study
E. coli OC169 Human Italy 2009 blaSHV-12 I1, FIB, F I1 1 4 13 2 1 26 This study
E. coli 31c Poultry Italy 2009 blaSHV-12 I1, FIB, F I1 2 1 4 1 2 3 This study
S. heidelberg AM31196 Human USA 2007 blaCMY-2 ND I1 1 4 3 4 1 12 3
S. saintpaul AM31875 Human USA 2007 blaCMY-2 ND I1 1 4 3 4 1 12 3
S. typhimurium AM33047 Human USA 2007 blaCMY-2 ND I1 1 4 3 4 1 12 3
E. coli 22T Poultry France 2005 blaCTX-M-1 I1 I1 2 1 4 1 2 3 8
E. coli 2392T Poultry Italy 2005 blaSHV-12 I1 I1 2 1 4 1 2 3 7
E. coli 96 Poultry Poland 2009 blaCTX-M-1 I1 I1 2 1 4 1 2 3 9
ND, not determined.
a
Plasmid multilocus sequence typing (pMLST). Allele variants for each sequenced gene (repI1, ardA, trbA, sogS and pilL) were identified and numbered. Different sequence types
(STs) were assigned to the different combinations of allele variants observed among the IncI1 plasmids.
b
The blaCMY-2 was transferred on the IncK plasmid in this strain.
FIG. 1. Restriction analysis by PstI of the IncI1 plasmid DNAs isolated
from E. coli and Salmonella transformants. Lane M, markers (Roche
Diagnostics); lane 1, E. coli 90c (blaCMY-2); lane 2, E. coli 44c (blaCMY-2);
lane 3, E. coli 65c (blaCMY-2); lane 4, E. coli BE310 (blaCMY-2); lane 5,
S. heidelberg AM31196 (blaCMY-2); lane 6, S. saintpaul AM31875
(blaCMY-2); lane 7, S. typhimurium AM33047 (blaCMY-2), lane 8, E. coli
OC144 (blaCTX-M-1); lane 9, E. coli 22T (blaCTX-M-1); lane 10, E. coli 96
(blaCTX-M-1); lane 11, E. coli 31c (blaSHV-12); lane 12, E. coli 2392T
(blaSHV-12). pMLST type and the geographical origin of the strain are
reported above each line.
ª2013 The Authors
Clinical Microbiology and Infection ª2013 European Society of Clinical Microbiology and Infectious Diseases, CMI, 19, E238–E240
CMI Research Note E239
in different countries, including Italy, but not among ExPEC
strains.
IncI1/ST3 plasmids harbouring blaSHV-12 were previously
identified in E. coli isolates from poultry in Italy and from
humans in the Netherlands [5,7]. Our results showed persistence
of an identical blaSHV-12-IncI1/ST3 plasmid over 5 years
across avian isolates from Italy, but SHV-12 was found to be
carried by a different plasmid in ExPEC, indicating that the
epidemiology of SHV-12 on IncI1 in avian and human E. coli
may differ from that described in the Netherlands, although
this needs to be confirmed in additional isolates and plasmids.
Finally, IncI1/ST12 plasmids carrying blaCMY-2 were detected
worldwide in E. coli and Salmonella, suggesting that the IncI1/
ST12 plasmids identified in our study might be highly related to
other globally diffused epidemic plasmids (http://pubmlst.org/
plasmid/). This was clearly confirmed by RFLPs analysis that
showed indistinguishable IncI1/ST12 plasmids obtained from
both Salmonella of human origin from the USA and E. coli of an
avian source from Italy, suggesting that this plasmid type can be
successfully exchanged between commensal E. coli and Salmonella
in poultry. However, despite the intense worldwide
spread of the IncI1/ST12-CMY-2 plasmid, it was not identified
in our ExPEC collection.
A limitation of this study is the low number of plasmids
analysed. Such a low number makes any conclusion regarding
absence of genetic relatedness among plasmids a suggestion
that needs further confirmation.
In conclusion, our results suggest that, although globally
diffused epidemic plasmids were identified in E. coli from an
avian source from Italy, there was no evidence of common
plasmids shared by both human and poultry ESBL and AmpC
E. coli producers in our collection. Whether a different plasmid
epidemiology actually occurs in Italy compared with other
European countries needs to be confirmed by further studies.
Acknowledgments
We are grateful to Tonino Sofia for editorial assistance and to
Dr Jason P. Folster and Dr Jean Whichard, Division of
Foodborne, Bacterial and Mycotic Diseases, Centers for
Disease Control and Prevention, Atlanta, GA, USA, for
providing control strains.
Funding
This work was financed by Italy-USA cooperation project –
Italian Ministry of Health Grant DRE 29/12/2010-0001090
(AC) and by Ministry of Health-Centro Controllo Malattie
project ‘Surveillance on antibiotic resistance in the community
and in food-borne and zoonotic diseases’ (Grant number
9M06).
Transparency Declaration
The authors declare no conflicts of interest.
References
1. Carattoli A. Animal reservoirs for extended spectrum beta-lactamase
producers. Clin Microbiol Infect 2008; 14 (suppl 1): 117–123.
2. Carattoli A. Resistance plasmid families in Enterobacteriaceae. Antimicrob
Agents Chemother 2009; 53: 2227–2238.
3. Folster JP, Pecic G, McCullough A, Rickert R, Whichard JM Characterization
of bla(CMY)-encoding plasmids among Salmonella isolated in
the United States in 2007. Foodborne Pathog Dis 2011; 8: 1289–1294.
4. Dierikx C, van Essen-Zandbergen A, Veldman K, Smith H, Mevius D.
Increased detection of extended spectrum beta-lactamase producing
Salmonella enterica and Escherichia coli isolates from poultry. Vet
Microbiol 2010; 145: 273–278.
5. Leverstein-van Hall MA, Dierikx CM, Cohen SJ et al. Dutch patients,
retail chicken meat and poultry share the same ESBL genes, plasmids
and strains. Clin Microbiol Infect 2011; 17: 873–880.
6. Giufre M, Graziani C, Accogli M et al. Escherichia coli of human and
avian origin: detection of clonal groups associated with fluoroquinolone
and multidrug resistance in Italy. J Antimicrob Chemother 2012; 67: 860–
867.
7. Garcıa-Fernandez A, Chiaretto G, Bertini A et al. Multilocus sequence
typing of IncI1 plasmids carrying extended-spectrum beta-lactamases in
Escherichia coli and Salmonella of human and animal origin. J Antimicrob
Chemother 2008; 61: 1229–1233.
8. Girlich D, Poirel L, Carattoli A et al. Extended-spectrum betalactamase
CTX-M-1 in Escherichia coli isolates from healthy poultry in
France. Appl Environ Microbiol 2007; 73: 4681–4685.
9. Literak I, Dolejska M, Janoszowska D et al. Antibiotic-resistant
Escherichia coli bacteria, including strains with genes encoding the
extended-spectrum beta-lactamase and QnrS, in waterbirds on the
Baltic Sea Coast of Poland. Appl Environ Microbiol 2010; 76: 8126–8134.
10. Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ.
Identification of plasmids by PCR-based replicon typing. J Microbiol
Methods 2005; 63: 219–228.
ª2013 The Authors
Clinical Microbiology and Infection ª2013 European Society of Clinical Microbiology and Infectious Diseases, CMI, 19, E238–E240
E240 Clinical Microbiology and Infection, Volume 19 Number 5, May 2013 CMI
Příloha 20
DOBIASOVA, H., DOLEJSKA, M., JAMBOROVA, I., BRHELOVA, E., BLAZKOVA, L., PAPOUSEK, I.,
KOZLOVA, M., KLIMES, J., CIZEK, A., LITERAK, I., 2013, Extended spectrum beta-lactamase and
fluoroquinolone resistance genes and plasmids among Escherichia coli isolates from zoo animals,
Czech Republic: FEMS Microbiology Ecology, v. 85, p. 604-611.
Souhrn
V zoologické zahradě v Ostravě bylo sledováno rozšíření E. coli s ESBL a plazmidově determinovanou rezistencí
k fluorochinolonům u různých druhů savců a ptáků. Izoláty náležely k 18 sekvenčním typům a nesly geny
blaCTX-M-1 nebo qnrS1 na epidemických plazmidech různých imkompatibilních skupin (IncI1, IncN, IncX1).
Komparativní analýza genotypových charakteristik ukázala na šíření specifických klonů E. coli a plazmidových
linií u různých skupin zvířat v rámci zoo.
R E S E A R C H A R T I C L E
Extended spectrum beta-lactamase and fluoroquinolone
resistance genes and plasmids among Escherichia coli isolates
from zoo animals, Czech Republic
Hana Dobiasova1,2
, Monika Dolejska1,2
, Ivana Jamborova1
, Eva Brhelova1
, Lucie Blazkova1
,
Ivo Papousek1
, Marketa Kozlova1
, Jiri Klimes1
, Alois Cizek2,3
& Ivan Literak1,2
1
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences
Brno, Brno, Czech Republic; 2
CEITEC VFU, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republic; and
3
Department of Infectious Diseases and Microbiology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno,
Brno, Czech Republic
Correspondence: Hana Dobiasova,
Department of Biology and Wildlife Diseases,
Faculty of Veterinary Hygiene and Ecology,
University of Veterinary and Pharmaceutical
Sciences Brno, Palackeho tr. 1–3, CZ-612 42
Brno, Czech Republic. Tel.: +420 541 562647;
fax: +420 541 562631;
e-mail: dobiasova.hanka@gmail.com
Present address: Eva Brhelova, CEITEC MU,
Masaryk University, Kamenice 753/5, CZ-625
00, Brno, Czech Republic
Received 25 January 2013; revised 24 March
2013; accepted 12 May 2013.
Final version published online 19 June 2013.
DOI: 10.1111/1574-6941.12149
Editor: Kornelia Smalla
Keywords
captive animals; CTX-M-1; Escherichia coli;
multilocus sequence typing; qnrS; plasmids.
Abstract
Commensal Escherichia coli isolates from healthy zoo animals kept in Ostrava
Zoological Garden, Czech Republic, were investigated to evaluate the
dissemination of extended-spectrum beta-lactamase (ESBL) and plasmidmediated
quinolone resistance (PMQR) genes. A total of 160 faecal samples
of various animal species were inoculated onto MacConkey agar with cefotaxime
(2 mg LÀ1
) or ciprofloxacin (0.05 mg LÀ1
) to obtain ESBL- or PMQRpositive
E. coli isolates. Clonality of E. coli isolates was investigated by
multilocus sequence typing and pulsed-field gel electrophoresis. Plasmids
carrying ESBL or PMQR genes were typed by PCR-based replicon typing,
plasmid multilocus sequence typing and restriction fragment length polymorphism.
Forty-nine (71%, n = 69) cefotaxime-resistant and 15 (16%, n = 94)
ciprofloxacin-resistant E. coli isolates harboured ESBL or PMQR genes.
Isolates were assigned to 18 sequence types (ST) and 20 clusters according to
their macrorestriction patterns by pulsed-field gel electrophoresis. The genes
blaCTX-M-1 and qnrS1 were detected on highly related IncI1 plasmids assigned
to clonal complex 3 (ST3, ST38) and on non-related IncN plasmids of ST1
and ST3, respectively. The gene qnrS1 was located on related IncX1 plasmids.
Dissemination of antibiotic resistance is associated with spreading of
particular E. coli clones and plasmids of specific incompatibility groups
among various animal species.
Introduction
Emergence and dissemination of multidrug-resistant
(MDR) gram-negative bacteria is a significant health problem
worldwide. The impact of antibiotic resistance is associated
with a considerable decrease in the number of efficient
antimicrobials available for the treatment of various bacterial
infections (Livermore et al., 2007; Strahilevitz et al.,
2009; Platell et al., 2011). Cephalosporins and fluoroquinolones
belong to critically important antimicrobials in human
and veterinary medicine (FAO/WHO/OIE, 2007). The predominant
mechanism of resistance to b-lactam antibiotics
is mediated by extended-spectrum b-lactamases (ESBL) or
AmpC-type b-lactamases (Bergenholtz et al., 2009).
Plasmid-mediated quinolone resistance (PMQR) genes
confer only a low degree of resistance but their expression
can enable development of strains highly resistant to fluoroquinolones
(Strahilevitz et al., 2009). The co-localization
of ESBL and PMQR genes on the same mobile genetic
elements and their association with other resistance genes
is of particular concern (Literak et al., 2010; Dolejska et al.,
2011a, b).
A number of studies have been focused on MDR
Escherichia coli derived from humans, wild, domesticated
or food animals and from the environment (Literak et al.,
2010; Dolejska et al., 2011a, b; Platell et al., 2011).
ª 2013 Federation of European Microbiological Societies FEMS Microbiol Ecol 85 (2013) 604–611
Published by John Wiley & Sons Ltd. All rights reserved
MICROBIOLOGYECOLOGY
Captive animals in zoological gardens can serve as a
reservoir of antibiotic-resistant pathogenic bacteria such
as Campylobacter spp., Salmonella spp., Yersinia spp., and
pathogenic E. coli strains (Gopee et al., 2000; Stirling
et al., 2008a). A high frequency of resistance including
ESBL production and the presence of PMQR genes was
found in E. coli isolated from zoo animals in Japan and
China (Ahmed et al., 2007; Wang et al., 2012).
In this study we performed the detailed genotypic
characterization of ESBL- and PMQR-positive E. coli
isolates from animals kept in a zoo in the Czech Republic
over a period of 1 year to assess the potential role of
captive animals as a reservoir of emerging MDR bacteria
and plasmids carrying antibiotic resistance genes.
Materials and methods
Ostrava Zoological Garden and antibiotic
practice
Ostrava Zoological Garden, Czech Republic, houses
about 3300 animals of 430 different species including
76 mammalian, 126 avian and 33 reptilian species. It
occupies a wooded 1-km2
site in a suburb of the
industrial city of Ostrava in the northeastern part of
the Czech Republic. The zoo is visited by about 330 000
people per year.
Antibiotics were administered only on an individual
basis under the guidance of the veterinary surgeon for a
limited period of < 1–2 weeks in the case of suspected or
documented bacterial infections, treatment of bite
wounds or as surgical prophylaxis. In the year 2010,
when our study was conducted, and during the preceding
year, antimicrobials were therapeutically administered to
only seven mammalian and two bird species. Antimicrobials
used included cefovecin (3rd generation cephalosporin),
cefprozil (2nd generation cephalosporin), cefadroxil
(1st generation cephalosporin), amoxicillin–clavulanic
acid, penicillin, streptomycin, enrofloxacin, marbofloxacin,
tetracycline, oxytetracycline, doxycycline and
neomycin.
The zoo feeds chickens to 19 animal species including
eight mammalian and 11 bird species. All newly-hatched
chickens were treated prophylactically with doxycycline
for 5 days upon delivery and kept alive in the zoo until
being used as feed within 1 month. A limited number of
rabbits were also kept in the zoo and fed to zoo animals.
The rabbits were treated with trimethoprim–sulphonamide
irregularly in cases of digestive disorders. Carnivores
were also fed meat from slaughtered food animals not
suitable for human consumption. The meat might have
contained antibiotic-resistant bacteria and antibiotic
residues from recent antibiotic treatments.
Sampling
During the year 2010, Ostrava Zoological Garden was visited
four times to obtain faecal specimens of defined individuals
of various animal species kept in four distinct
geographic areas of the zoo. Within each of four samplings,
different animal species occupying a particular
geographic area were sampled on one-time basis.
A total number of 160 faecal samples using sterile
cotton swabs were obtained from 132 mammalian, avian
and reptilian species. From the total of 160 faecal samples,
127 faecal samples were obtained from enclosures
that were occupied by a single animal, 21 faecal samples
were taken from enclosures occupied by two or more
individuals of the same species and 12 faecal samples
were taken from enclosures occupied by defined groups
of animals belonging to two or more genera. The samples
were placed into Amies transport medium (Oxoid, UK)
and transported in an isothermal box to a laboratory for
further processing. Samples were incubated in buffered
peptone water (Oxoid) at 37 °C overnight.
Selective isolation of E. coli and antimicrobial
susceptibility testing
All samples were enriched in MacConkey (MC) broth (Oxoid)
at 37 °C for 24 h and subsequently cultured on MC
agar (Oxoid) supplemented with cefotaxime (2 mg LÀ1
)
or ciprofloxacin (0.05 mg LÀ1
) at 37 °C overnight. One
lactose-positive colony grown on MC agar with antibiotics
was selected per one sample and identified using the API
10S test kit (bioMerieux, France) and MALDI-TOF
(MALDI Biotyper, Bruker Daltonics). Cefotaxime-resistant
E. coli isolates were tested using the double-disk synergy
test to identify ESBL-production (CLSI, 2008). Escherichia
coli isolates selected on media with ciprofloxacin were
tested for MIC of nalidixic acid and ciprofloxacin using
the agar dilution method (CLSI, 2008). Both cefotaximeand
ciprofloxacin-resistant E. coli isolates were tested for
susceptibility to 12 antimicrobial agents as described previously
by Dolejska et al. (2011a) according to CLSI guidelines
(CLSI, 2008).
Testing of antibiotic resistance genes,
integrons and replicons
Genes responsible for ESBL phenotype (blaTEM, blaSHV,
blaOXA and blaCTX-M) were identified by PCR and
sequencing (Literak et al., 2010). The colonies grown on
MCA with ciprofloxacin were tested for PMQR genes
[qnrA, qnrB, qnrC, qnrD, qnrS, aac(6′)-Ib-cr, qepA and
oqxAB] by PCR and sequencing (Kim et al., 2009; Literak
et al., 2010). All isolates were screened for additional
FEMS Microbiol Ecol 85 (2013) 604–611 ª 2013 Federation of European Microbiological Societies
Published by John Wiley & Sons Ltd. All rights reserved
Multiresistant E. coli among zoo animals 605
antibiotic resistance genes and integrons as described previously
(Literak et al., 2010). Investigated resistance genes
and integrons, primers, conditions of PCR and positive
control strains used in the study are listed in Table S1
(available as Supporting Information on the FEMS
Microbiology Ecology website). Replicons were tested
using PCR-based replicon typing (Carattoli et al., 2005).
Escherichia coli molecular typing methods
All E. coli isolates were divided into phylogenetic groups
(Clermont et al., 2000). Isolates belonging to phylogenetic
groups B2 and D were tested by allele-specific rapid PCR
to determine O25b-ST131 E. coli clone (Clermont et al.,
2009). Epidemiological relatedness of E. coli isolates was
analysed by XbaI-pulsed field gel electrophoresis (PFGE)
(PulseNetUSA, 2004). All macrorestriction profiles were
compared using the BIONUMERICS fingerprinting software
(Applied Maths, Belgium) dividing the isolates into epidemiologically
related clusters (I–XV for cefotaxime- and
1–5 for ciprofloxacin-resistant E. coli isolates, respectively)
because of a Dice similarity index ≥ 85%. The clusters I
and V of cefotaxime-resistant isolates and the clusters 1
and 5 of ciprofloxacin-resistant isolates were divided into
subgroups on the basis of intraclonal diversity of these
clusters (Ia–d, Va–c of cefotaxime- and 1a–b, 5a–b of
ciprofloxacin-resistant isolates). Multilocus sequence typing
(MLST) was performed according to Wirth et al.
(2006).
Plasmid characterization
Transferability of plasmids carrying ESBL or PMQR genes
was achieved using conjugation and transformation
experiments as described elsewhere (Dolejska et al.,
2011b). Genomic DNA of transconjugants and transformants
was isolated using the boiling technique described
by Cattoir et al. (2007). Transconjugants and transformants
with one plasmid were typed by PCR-based
replicon typing (Carattoli et al., 2005), tested for the
presence of additional antibiotic resistance genes using
PCR (Table S1) and plasmid size was determined using
S1-PFGE (Barton et al., 1995). Plasmids were isolated
using the alkaline extraction method (Birnboim & Doly,
1979) and compared using restriction fragment length
polymorphism performed by EcoRV digestion of plasmid
DNA from transformants or transconjugants, dividing
them into separate groups based on their restriction
patterns. Plasmids showing an identical profile or one
band difference were designated with the same letter (e.g.
‘A’) and those with two to three band differences were
designated with a letter and a number of the particular
type (e.g. ‘A1’). Plasmids belonging to incompatibility
groups I1 and N were typed by plasmid multilocus
sequence typing (pMLST) (Garcia-Fernandez et al., 2008,
2011) and assigned to sequence types (ST) using the
on-line database http://pubmlst.org/plasmid/. Detection
of insertion sequences ISEcp1 and IS26 located upstream
of blaCTX-M-1 and ISEcl2 upstream of the gene qnrS1 was
carried out by PCR mapping (Table S1). Investigation of
the blaCTX-M-1 upstream region was conducted as previously
described (Dolejska et al., 2011b). The upstream
region of qnrS1 was investigated using forward primer
ISEcl2 binding to orfB of the insertion sequence (Poirel
et al., 2007) in combination with qnrS reverse primer
(Cattoir et al., 2007) targeting a region of c. 1.5 kb.
Results
Isolation of ESBL- and PMQR-positive E. coli
isolates and their antibiotic resistance
phenotypes
From the 160 faecal samples of various animal species, 69
(43%) cefotaxime- and 94 (59%) ciprofloxacin-resistant
E. coli isolates were found. Forty-nine (71%) cefotaximeresistant
and 15 (16%) ciprofloxacin-resistant E. coli
isolates harboured ESBL or PMQR genes, respectively. All
the ESBL-producing E. coli isolates were multiresistant
(resistant to two or more antibiotic groups). ESBLpositive
isolates showed resistance to tetracycline (98%)
sulphonamides (96%), nalidixic acid (18%), streptomycin
(16%), trimethoprim–sulphamethoxazole and gentamicin
(both 4%). Of the PMQR-positive E. coli isolates, 12 isolates
(80%) were multiresistant. PMQR-positive E. coli
isolates showed resistance to ampicillin (73%), tetracycline
(53%), sulphonamides and trimethoprim–sulphamethoxazole
(both 47%), streptomycin (20%), cephalotin
and amoxicillin–clavulanic acid (both 13%) and
gentamicin (7%). Among the PMQR-positive E. coli
isolates, MIC of nalidixic acid and ciprofloxacin varied
from 8 to > 256 mg LÀ1
and from 0.06 to > 8 mg LÀ1
,
respectively.
Resistance genes and integrons detected in
ESBL- and PMQR-positive E. coli isolates
In the 49 ESBL-producing E. coli isolates, the gene
blaCTX-M-1 was detected in 48 isolates, and blaCTX-M-15
and blaSHV-27 in one isolate (130 CTX, Fig. 1). One CTXM-1-producing
isolate (116 CTX) also harboured PMQR
gene qnrS1. In all PMQR-positive E. coli isolates, the gene
qnrS1 was detected (Table 1). The additional antibiotic
resistance genes were detected in the ESBL/PMQRpositive
isolates (Fig. 1, Table 1): tet(A), tet(B) encoding
resistance to tetracycline, sul1, sul2 encoding resistance to
ª 2013 Federation of European Microbiological Societies FEMS Microbiol Ecol 85 (2013) 604–611
Published by John Wiley & Sons Ltd. All rights reserved
606 H. Dobiasova et al.
sulphonamides, and strA encoding resistance to streptomycin.
The presence of class 1 integron was detected only in one
isolate (13z CIP, Table 1).
Molecular typing of E. coli isolates
Forty-nine ESBL-producing E. coli isolates were divided
into phylogenetic groups A (19 isolates), B1 (18), B2 (1)
and D (11). Fifteen PMQR-harbouring E. coli isolates
belonged to phylogenetic groups A (6) and B1 (9). None
of the isolates assigned to phylogenetic groups B2 and D
belonged to the O25b-ST131 type.
All E. coli were typed using XbaI-PFGE. Sixteen ESBLproducing
and four PMQR-positive isolates were
non-typeable using this method. Cluster analysis of
macrorestriction patterns was performed on 33
ESBL-producing E. coli isolates and 11 PMQR-harbouring
E. coli isolates. For MLST analysis, one to four representative
ESBL- and PMQR-positive E. coli isolates of each
cluster were chosen at random.
ESBL-producing isolates were grouped into 15 clusters
(I–XV). Seventy per cent of them belonged to one of five
clusters of clonally related isolates. Four of these clusters
(I, V, VIII, X) consisted of three to eight isolates that
were clonally related. Isolates belonging to the same
cluster of clonally related isolates were obtained from
different animal species. Ten E. coli isolates had unique
macrorestriction profiles. Twenty representative ESBL-
Origin
Strain
no.
PFGE
profile ST PG ESBL blagenes Additional AR genes
Caracal (Caracal caracal) 29 CTX Ia 58 B1 blaCTX-M-1 sul2, tet(A)
Eurasian Lynx (Lynx lynx) 30 CTX Ib 58 B1 blaCTX-M-1 sul2, tet(A)
White-tailed Eagle (Haliaeetusalbicilla) 73 CTX Ic 58 B1 blaCTX-M-1 sul2, tet(A)
Ural Owl (Strixuralensis) 72 CTX Id 58 B1 blaCTX-M-1 sul2, tet(A)
Hyacinth Macaw (Anodorhynchushyacinthinus) 116 CTX II 1324 B2 blaCTX-M-1 blaTEM-1, sul2, qnrS1
Blue Spotted Tree Monitor (Varanusmacraei) 130 CTX III 155 B1 blaCTX-M-15, blaSHV-27 aac(6')-Ib-cr, blaTEM-1, blaOXA-1, sul2, tet(A), tet(B)
Siberian Crane (Grusleucogeranus) 80 CTX IV 746 A blaCTX-M-1 sul2, tet(A)
Serval (Leptailurusserval) 32 CTX Va 155 B1 blaCTX-M-1 sul2, tet(A)
Grey Crowned-crane (Balearicaregulorum) 43 CTX Vb 155 B1 blaCTX-M-1 sul2, tet(A)
Common Chimpanzee - group (Pan troglodytes) 24 CTX Vc 847 B1 blaCTX-M-1 sul2, tet(A)
Binturong (Arctictis binturong) 14z CTX VI 38 D blaCTX-M-1 sul2, tet(A)
Amur Tiger (Pantheratigrisaltaica) 12z CTX VII 58 B1 blaCTX-M-1 sul2, tet(A)
American Flamingo (Phoenicopterusruber) 71 CTX VIII 1146 A blaCTX-M-1 sul2, tet(A)
Hooded Vulture (Necrosyrtesmonachus) 76 CTX IX 58 A blaCTX-M-1 sul2, tet(B)
Spur-winged Goose (Plectropterusgambensis) 85 CTX X 48 A blaCTX-M-1 sul2, tet(A)
Eurasian Black Vulture (Aegypiusmonachus) 74 CTX XI 3274 A blaCTX-M-1 sul2, tet(A)
Grey-headed Swamphen (Porphyriopoliocephalus) 86 CTX XII 2325 A blaCTX-M-1 sul2
Great Grey Owl (Strixnebulosa) 78 CTX XIII 1288 A blaCTX-M-1 tet(B)
Asian Black Bear (Ursusthibetanus) 34 CTX XIV 410 A blaCTX-M-1 blaTEM-1, strA, sul2, tet(A)
Common Chimpanzee (Pan troglodytes) 23 CTX XV 117 D blaCTX-M-1 strA, sul2, tet(A)
100
90
80
70
Fig. 1. Characteristics of ESBL-positive Escherichia coli isolates from animals in the zoo. AR, antibiotic resistance; PG, phylogenetic group; ST,
sequence type. Dendrogram represents diversity of E. coli isolates carrying ESBL genes. Escherichia coli isolates were divided into clusters (I-XV)
according to Dice similarity index of their XbaI macrorestriction profiles ≥ 85%. Escherichia coli isolates assigned to the clusters I and V were
divided into subgroups (Ia–d, Va–c) owing to intraclonal diversity in these clusters.
Table 1. Characteristic of PMQR-positive Escherichia coli isolates from animals in the zoo
Origin
Strain
no.
MIC (mg LÀ1
)*
NAL/CIP
PFGE
profile†
ST PG
PMQR
genes
Additional AR
genes and integrons
King Vulture (Sarcoramphus papa) 143 CIP > 256/0.25 1a 155 B1 qnrS1 –
Amur Tiger (Panthera tigris) 13z CIP > 256/> 8 1b 3275 B1 qnrS1 sul1, sul2, strA,
tet(A),Int1‡
Cottontop Tamarin - group (Saguinus oedipus) 3 CIP > 256/> 8 2 1249 B1 qnrS1 tet(A)
Serval (Leptailurus serval) 32 CIP 8/1 3 1434 A qnrS1 blaTEM-32, strA, tet(A)
American Flamingo (Phoenicopterus ruber) 71 CIP 128/0.25 4 10 A qnrS1 blaTEM-1, sul2, tet(A)
Southern Screamer (Chauna torquata) 101 CIP 16/0.125 5a 1431 B1 qnrS1 blaTEM-1, sul1, sul2, tet(A)
Indian Crested Porcupine (Hystrix indica) 103 CIP 8/0.5 5b 1431 B1 qnrS1 blaTEM-1, sul1, tet(A)
AR, antibiotic resistance; PG, phylogenetic group; ST, sequence type.
*Minimal inhibitory concentration of NAL, nalidixic acid and CIP, ciprofloxacin to donor strains.
†
Escherichia coli isolates were divided into clusters (1–5) consisting of clonally related isolates according to Dice similarity index of their XbaI
macrorestriction profiles ≥ 85%. Escherichia coli isolates assigned to the clusters 1 and 5 were divided into subgroups (1a–b, 5a–b) owing to
intraclonal diversity in these clusters.
‡
Class 1 integron 1.5 kb: dfrA1-aadA1.
FEMS Microbiol Ecol 85 (2013) 604–611 ª 2013 Federation of European Microbiological Societies
Published by John Wiley & Sons Ltd. All rights reserved
Multiresistant E. coli among zoo animals 607
positive E. coli isolates of each cluster were assigned to 13
different STs (Fig. 1).
Eleven PMQR-harbouring E. coli isolates were grouped
into five clusters (1–5). In all, 82% of PMQR-positive
E. coli belonged to one of three clusters of clonally related
isolates. Two of these clusters (clusters 2 and 5) consisted
of three and four isolates originating from different
animal species, respectively. Two PMQR-positive isolates
had unique macrorestriction profiles. Seven representative
PMQR-positive E. coli isolates of each cluster were
assigned to six distinct STs (Table 1).
Characterization of plasmids carrying ESBL or
PMQR genes
From a total of 33 CTX-M-producing and 11 PMQRpositive
isolates, conjugation to E. coli or Salmonella
enterica was demonstrated in 31 and 7, respectively.
Only two CTX-M-carrying and none of the PMQR-harbouring
plasmids were transferred through transformation.
All transformants carried multiple plasmids and
these plasmids were therefore not investigated further.
For plasmid analysis, one to four transconjugants carrying
a single plasmid with ESBL and/or PMQR gene
were chosen per one cluster. A total of 14 blaCTX-M-1and
4 qnrS1-carrying plasmids were characterized
(Table 2).
Plasmids carrying ESBL or PMQR genes belonging to
three incompatibility (Inc) groups IncI1, IncN and IncX1
were identified. The genes blaCTX-M-1 and qnrS1 were
located on IncI1 plasmids varying in size from 100 to
140 kb identified in 13 transconjugants. Plasmids showed
related restriction profile (A1–A4) and belonged to clonal
complex 3 (CC-3) except for IncI1 plasmid from the isolate
73 CTX, which could not be typed using pMLST.
IncN plasmids of ST1 and ST3 carrying blaCTX-M-1 or
qnrS1 genes were found in three transconjugants. Two
qnrS1-harbouring IncX1 plasmids showed identical
restriction profiles. ISEcl2 was located upstream of qnrS1
at the identical distance on all IncX1, IncI1 and IncN
plasmids carrying this gene, whereas the gene blaCTX-M-1
was found downstream of the continuous or truncated
ISEcp1 element (Table 2).
Discussion
Pepperell et al. (2002), Lavigne et al. (2007) and Cavaco
et al. (2008) proposed that commensal microflora could
represent a long-term reservoir of resistance genes that
could be transferred horizontally to other bacteria. In this
study, we describe the high prevalence of resistance to
third generation cephalosporins and fluoroquinolones in
commensal E. coli isolates from healthy captive animals
in a zoo in the Czech Republic. ESBL-producing and
Table 2. Characteristic of ESBL- and PMQR-positive plasmids from Escherichia coli isolates
E. coli isolates ESBL-/PMQR-positive plasmids
Strain
no.
PFGE
profile ST
Inc
group
Size
(kb)
RFLP
profile* ST/CC
ESBL-/PMQR-
genes
Additional
AR genes
Upstream region of
blaCTX-M-1/qnrS1
73 CTX Ic 58 I1 100 A1 NT blaCTX-M-1 sul2, tet(A) ISEcp1
72 CTX Id 58 I1 100 A1 38/CC-3 blaCTX-M-1 sul2, tet(A) ISEcp1
71 CTX VIII 1146 I1 105 A1 3/CC-3 blaCTX-M-1 sul2, tet(A) ISEcp1
85 CTX X 48 I1 105 A1 3/CC-3 blaCTX-M-1 sul2, tet(A) ISEcp1
80 CTX IV 746 I1 100 A2 3/CC-3 blaCTX-M-1 sul2, tet(A) ISEcp1
76 CTX IX 58 I1 100 A2 3/CC-3 blaCTX-M-1 sul2 ISEcp1
86 CTX XII 2325 I1 105 A2 3/CC-3 blaCTX-M-1 sul2 ISEcp1
29 CTX Ia 58 I1 100 A3 3/CC-3 blaCTX-M-1 sul2, tet(A) ISEcp1
30 CTX Ib 58 I1 100 A3 3/CC-3 blaCTX-M-1 sul2, tet(A) ISEcp1
116 CTX II 1324 I1 100 A3 3/CC-3 blaCTX-M-1 sul2, qnrS1 ISEcp1
12z CTX VII 58 I1 140 A3 3/CC-3 blaCTX-M-1 sul2, tet(A) ISEcp1
74 CTX XI 3274 I1 100 A3 3/CC-3 blaCTX-M-1 sul2, tet(A) ISEcp1
71 CIP 4 10 I1 125 A4 38/CC-3 qnrS1 blaTEM-1, sul2, tet(A) ISEcl2
78 CTX XIII 1288 N 40 a 1 blaCTX-M-1 – ISEcp1::IS26
34 CTX XIV 410 N 40 a 1 blaCTX-M-1 sul2, tet(A) ISEcp1::IS26
32 CIP 3 1434 N 50 b 3 qnrS1 blaTEM-32, strA, tet(A) ISEcl2
101 CIP 5a 1431 X1 50 – qnrS1 blaTEM-1 ISEcl2
13z CIP 1b 3275 X1 50 – qnrS1 – ISEcl2
AR, antibiotic resistance; CC, clonal complex; Inc, incompatibility group; NT, non-typeable; ST, sequence type.
All plasmids were successfully transferred via conjugation to E. coli MT102RN and Salmonella Typhimurium SL5325 or Salmonella Enteritidis
Fa8065 recipient strains.
*RFLP profile determined by EcoRV digestion.
ª 2013 Federation of European Microbiological Societies FEMS Microbiol Ecol 85 (2013) 604–611
Published by John Wiley & Sons Ltd. All rights reserved
608 H. Dobiasova et al.
PMQR-harbouring isolates were found in 31% (n = 160)
and 9% of sampled animals belonging to different avian,
mammalian and reptilian species, respectively. Similar
results were obtained by Wang et al. (2012), who found
32% (n = 206) ESBL-producing E. coli isolates including
strains carrying various PMQR genes in primates kept in
six zoos in China.
The high occurrence of ESBL-producing and PMQRharbouring
isolates found in our study could be
associated with antibiotic therapy used in animals for
treatment of various infections. Beta-lactam antibiotics
including the second and the third generation
cephalosporins, fluoroquinolones, tetracyclines and
aminoglycosides were applied, however, only to limited
number of animals. Selection of ESBL-producing E. coli
in the gut microflora of animals induced by cephalosporin
treatment has been demonstrated (Cavaco et al.,
2008). Most isolates showed resistance to multiple antibiotics
including tetracyclines, sulphonamides, aminoglycosides
and quinolones; therefore, the drugs of other
antibiotic groups might have played a role in co-selection
of ESBL- and PMQR-positive E. coli clones or plasmids
carrying particular resistance genes.
Several studies have concentrated on the possible
transmission of zoonotic ESBL-producing E. coli through
the food chain (Livermore et al., 2007; Leverstein-van
Hall et al., 2011; Platell et al., 2011). In the zoological
garden, 19 sampled animals were fed chickens and rabbits
treated with antibiotics. These chickens and rabbits are a
plausible source of ESBL-producing and PMQR-harbouring
E. coli isolates found in the zoo animals. Escherichia
coli clones belonging to particular sequence types (ST10,
ST58, ST117) harbouring blaCTX-M-1 or qnrS1 isolated
from different avian and mammalian species kept in the
Czech zoo have been identified previously in poultry,
poultry meat and humans in the Netherlands (Leversteinvan
Hall et al., 2011), supporting our theory of zoonotic
transmission of antibiotic-resistant E. coli clones via the
food chain. However, samples of food (chickens, rabbits
or other food sources) and water sources of zoo animals
or faecal samples of possible vectors (e.g. zoo-keepers)
were not analysed in our study.
Identical or closely related IncI1 plasmids of clonal
complex 3 were the most prevalent among blaCTX-M-1harbouring
E. coli isolates of different clonal lineages
originating from several animal species fed chickens and
rabbits. IncI1 plasmids belonging to ST3 carrying blaCTXM-1
are widely disseminated in E. coli and S. enterica isolates
from poultry throughout Europe (Garcia-Fernandez
et al., 2008; Cloeckaert et al., 2010; Leverstein-van Hall
et al., 2011) but they have been also found in other foodproducing
and companion animals as well as humans
(Madec et al., 2011). Results of plasmid analysis might
indicate that CTX-M-1-positive E. coli harbouring IncI1
plasmids isolated from zoo animals could originate in
poultry.
Plasmids of incompatibility group IncN harbouring
ESBL or PMQR genes identified in our study have been
previously demonstrated in E. coli and S. enterica isolates
from humans, animals and the environment in various
European countries (http://pubmlst.org/plasmid, Dolejska
et al., 2013). IncN plasmids belonging to ST1 harbouring
blaCTX-M-1 are broadly disseminated in E. coli isolates
from poultry, pigs, horses, cattle, wild waterbirds and
humans (http://pubmlst.org/plasmid, Dolejska et al.,
2013). Plasmids of IncX1 group carrying qnrS1 genes
have been identified in E. coli from poultry (Cerquetti
et al., 2009), wild waterbirds (Literak et al., 2010), horses
(Dolejska et al., 2011a) and humans (Literak et al.,
2011).
The abundance of MDR E. coli isolates in respective
faecal samples of zoo animals was not determined in our
study. ESBL- or PMQR-positive E. coli might have
constituted either the predominant population of E. coli
in the intestine of particular zoo animals or might have
been transient flora. Duval-Iflah et al. (1981) showed that
indigenous flora that was adapted to host intestine was
the dominant population and exerted a barrier against
the establishment of externally introduced E. coli strains.
However, even the transient presence of MDR E. coli harbouring
conjugative ESBL- or PMQR-carrying plasmids
might be of particular concern. Licht et al. (1999)
showed that conjugation in the intestine of a streptomycin-treated
mouse model occurred initially at high
rates after introduction of high numbers of the E. coli
donor cells. Thereafter the rate of horizontal transfer
of plasmids dropped but transconjugants remained
present in the faeces of investigated mice at rather high
levels.
In our study, we showed that zoo animals can
represent a reservoir of resistance genes to critically
important antimicrobials. Dissemination of these resistance
genes is of particular concern. Multiresistance can
be transmitted via direct contact between animals and
humans, as has been shown by Moodley & Guardabassi
(2009) and Dolejska et al. (2011a). Moreover, there has
been a rise in the popularity of petting farm areas of zoos
with direct contact between animals and visitors, especially
children (Stirling et al., 2008b).
In conclusion, our study showed a high prevalence of
E. coli harbouring ESBL or PMQR genes among various
animal species in the Czech zoological garden. The
extensive distribution of MDR E. coli is associated with
successful spread of particular clones as well as horizontal
gene transfer of related plasmids. Results of molecular
analyses might indicate a common source of MDR
FEMS Microbiol Ecol 85 (2013) 604–611 ª 2013 Federation of European Microbiological Societies
Published by John Wiley & Sons Ltd. All rights reserved
Multiresistant E. coli among zoo animals 609
E. coli possibly spreading via the food chain. However,
further investigation is warranted to assess the potential
impact of transmission of MDR E. coli via the food
chain in dissemination of antimicrobial resistance in zoo
animals.
Acknowledgements
The authors are grateful to the zoo director Petr Colas,
the head of zoological department II Ivo Firla, and the
zoo veterinarian Petr Gajdosik for their co-operation. We
thank George Jacoby (Lahey Clinic Inc., Burlington, MA),
Lina Cavaco, Henrik Hasman (National Food Institute,
Copenhagen, Denmark), Ming-Gui Wang (Institute of
Antibiotics, Huashan Hospital, Shanghai, China), Surbhi
Malhotra-Kumar (University of Antwerp, Antwerp, Belgium)
and Alessandra Carattoli (Instituto Superior di
Sanita, Rome, Italy) for positive control strains. We thank
Eva Suchanova and Martina Masarikova for their excellent
laboratory work. This study drew on the pMLST
website (http://pubmlst.org/plasmid/) developed by Keith
Jolley and sited at the University of Oxford, UK. This
study was funded by the project ‘CEITEC – Central European
Institute of Technology’ (CZ.1.05/1.1.00/02.0068)
from the European Regional Development Fund and
Grant no. P502/10/P083 of the Czech Science Founda-
tion.
References
Ahmed AM, Motoi Y, Sato M, Maruyama M, Watanabe H,
Fukumoto Y & Shimamoto T (2007) Zoo animals as
reservoirs of gram-negative bacteria harboring integrons and
antimicrobial resistance genes. Appl Environ Microbiol 73:
6686–6690.
Barton BM, Harding GP & Zuccarelli AJ (1995) A general
method for detecting and sizing large plasmids. Anal
Biochem 226: 235–240.
Bergenholtz RD, Jorgensen MS, Hansen LH, Jensen LB &
Hasman H (2009) Characterization of genetic determinants
of extended-spectrum cephalosporinases (ESCs) in
Escherichia coli isolates from Danish and imported poultry
meat. J Antimicrob Chemother 64: 207–209.
Birnboim HC & Doly J (1979) A rapid alkaline extraction
procedure for screening recombinant plasmid DNA. Nucleic
Acids Res 7: 1513–1523.
Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL &
Threlfall EJ (2005) Identification of plasmids by PCR-based
replicon typing. J Microbiol Methods 63: 219–228.
Cattoir V, Poirel L, Rotimi V, Soussy CJ & Nordmann P
(2007) Multiplex PCR for detection of plasmid-mediated
quinolone resistance qnr genes in ESBL-producing
enterobacterial isolates. J Antimicrob Chemother 60:
394–397.
Cavaco LM, Abatih E, Aarestrup FM & Guardabassi L (2008)
Selection and persistence of CTX-M-producing Escherichia
coli in the intestinal flora of pigs treated with amoxicillin,
ceftiofur, or cefquinome. Antimicrob Agents Chemother 52:
3612–3616.
Cerquetti M, Garcia-Fernandez A, Giufre M, Fortini D,
Accogli M, Graziani C, Luzzi I, Caprioli A & Carattoli A
(2009) First report of plasmid-mediated quinolone
resistance determinant qnrS1 in an Escherichia coli strain of
animal origin in Italy. Antimicrob Agents Chemother 53:
3112–3114.
Clermont O, Bonacorsi S & Bingen E (2000) Rapid and simple
determination of the Escherichia coli phylogenetic group.
Appl Environ Microbiol 66: 4555–4558.
Clermont O, Dhanji H, Upton M et al. (2009) Rapid detection
of the O25b-ST131 clone of Escherichia coli encompassing
the CTX-M-15-producing strains. J Antimicrob Chemother
64: 274–277.
Cloeckaert A, Praud K, Lefevre M, Doublet B, Pardos M,
Granier SA, Brisabois A & Weill FX (2010) IncI1 plasmid
carrying extended-spectrum-beta-lactamase gene bla(CTXM-1)
in Salmonella enterica isolates from poultry and
humans in France, 2003 to 2008. Antimicrob Agents
Chemother 54: 4484–4486.
CLSI (2008) Performance Standards for Antimicrobial
Susceptibility Testing: Eighteenth Informational Supplement
M100-S18. Clinical and Laboratory Standards Institute,
Wayne, PA.
Dolejska M, Duskova E, Rybarikova J et al. (2011a) Plasmids
carrying bla(CTX-M-1) and qnr genes in Escherichia coli
isolates from an equine clinic and a horseback riding centre.
J Antimicrob Chemother 66: 757–764.
Dolejska M, Frolkova P, Florek M, Jamborova I, Purgertova
M, Kutilova I, Cizek A, Guenther S & Literak I (2011b)
CTX-M-15-producing Escherichia coli clone B2-O25bST131
and Klebsiella spp. isolates in municipal wastewater
treatment plant effluents. J Antimicrob Chemother 66:
2784–2790.
Dolejska M, Villa L, Hasman H, Hansen L & Carattoli A
(2013) Characterization of IncN plasmids carrying bla
(CTX-M-1) and qnr genes in Escherichia coli and Salmonella
from animals, the environment and humans. J Antimicrob
Chemother 68: 333–339.
Duval-Iflah Y, Raibaud P & Rousseau M (1981)
Antagonisms among isogenic strains of Escherichia coli in
the digestive tracts of gnotobiotic mice. Infect Immun 34:
957–969.
FAO/WHO/OIE (2007) Report of the Joint FAO/WHO/OIE
Expert Meeting on Critically Important Antimicrobials. FAO,
Rome.
Garcia-Fernandez A, Chiaretto G, Bertini A, Villa L, Fortini
D, Ricci A & Carattoli A (2008) Multilocus sequence
typing of IncI1 plasmids carrying extended-spectrum
beta-lactamases in Escherichia coli and Salmonella of
human and animal origin. J Antimicrob Chemother 61:
1229–1233.
ª 2013 Federation of European Microbiological Societies FEMS Microbiol Ecol 85 (2013) 604–611
Published by John Wiley & Sons Ltd. All rights reserved
610 H. Dobiasova et al.
Garcia-Fernandez A, Villa L, Moodley A, Hasman H, Miriagou
V, Guardabassi L & Carattoli A (2011) Multilocus sequence
typing of IncN plasmids. J Antimicrob Chemother 66:
1987–1991.
Gopee NV, Adesiyun AA & Caesar K (2000) A longitudinal
study of Escherichia coli strains isolated from captive
mammals, birds, and reptiles in Trinidad. J Zoo Wildl Med
31: 353–360.
Kim HB, Wang MH, Park CH, Kim EC, Jacoby GA & Hooper
DC (2009) oqxAB encoding a multidrug efflux pump in
human clinical isolates of Enterobacteriaceae. Antimicrob
Agents Chemother 53: 3582–3584.
Lavigne JP, Defez C, Bouziges N, Mahamat A & Sotto A
(2007) Clinical and molecular epidemiology of multidrugresistant
Citrobacter spp. infections in a French university
hospital. Eur J Clin Microbiol 26: 439–441.
Leverstein-van Hall MA, Dierikx CM, Stuart JC et al. (2011)
Dutch patients, retail chicken meat and poultry share the
same ESBL genes, plasmids and strains. Clin Microbiol Infect
17: 873–880.
Licht TR, Christensen BB, Krogfelt KA & Molin S (1999)
Plasmid transfer in the animal intestine and other dynamic
bacterial populations: the role of community structure and
environment. Microbiology 145: 2615–2622.
Literak I, Dolejska M, Janoszowska D, Hrusakova J, Meissner
W, Rzyska H, Bzoma S & Cizek A (2010) Antibioticresistant
Escherichia coli bacteria, including strains with
genes encoding the extended-spectrum beta-lactamase and
QnrS, in waterbirds on the Baltic Sea coast of Poland.
Appl Environ Microbiol 76: 8126–8134.
Literak I, Petro R, Dolejska M, Gruberova E, Dobiasova H,
Petr J & Cizek A (2011) Antimicrobial resistance in faecal
Escherichia coli isolates from healthy urban children of two
age groups in relation to their antibiotic therapy. Antimicrob
Agents Chemother 55: 3005–3007.
Livermore DM, Canton R, Gniadkowski M et al. (2007) CTXM:
changing the face of ESBLs in Europe. J Antimicrob
Chemother 59: 165–174.
Madec JY, Doublet B, Ponsin C, Cloeckaert A & Haenni M
(2011) Extended-spectrum beta-lactamase bla(CTX-M-1)
gene carried on an IncI1 plasmid in multidrug-resistant
Salmonella enterica serovar Typhimurium DT104 in
cattle in France. J Antimicrob Chemother 66:
942–944.
Moodley A & Guardabassi L (2009) Transmission of IncN
plasmids carrying bla(CTX-M-1) between commensal
Escherichia coli in pigs and farm workers. Antimicrob Agents
Chemother 53: 1709–1711.
Pepperell C, Kus JV, Gardam MA, Humar A & Burrows LL
(2002) Low-virulence Citrobacter species encode resistance
to multiple antimicrobials. Antimicrob Agents Chemother 46:
3555–3560.
Platell JL, Johnson JR, Cobbold RN & Trott DJ (2011)
Multidrug-resistant extraintestinal pathogenic Escherichia
coli of sequence type ST131 in animals and foods. Vet
Microbiol 153: 99–108.
Poirel L, Cattoir V, Soares A, Soussy CJ & Nordmann P
(2007) Novel Ambler class A beta-lactamase LAP-1 and its
association with the plasmid-mediated quinolone resistance
determinant QnrS1. Antimicrob Agents Chemother 51:
631–637.
PulseNetUSA (2004) One-day (24–28 h) standardized
laboratory protocol for molecular subtyping of Escherichia
coli O157:H7, non-typhoidal Salmonella serotypes, and
Shigella sonnei by pulsed field gel electrophoresis (PFGE).
PulseNet PFGE manual 5.1–5.3: 1–13.
Stirling J, Griffith M, Blair I et al. (2008a) Prevalence of
gastrointestinal bacterial pathogens in a population of zoo
animals. Zoonoses Public Health 55: 166–172.
Stirling J, Griffith M, Dooley JSG et al. (2008b) Zoonoses
associated with petting farms and open zoos. Vector-Borne
Zoonotic Dis 8: 85–92.
Strahilevitz J, Jacoby GA, Hooper DC & Robicsek A (2009)
Plasmid-mediated quinolone resistance: a multifaceted
threat. Clin Microbiol Rev 22: 664–689.
Wang Y, He T, Han J, Wang J, Foley SL, Yang GY, Wan
SX, Shen JZ & Wu CM (2012) Prevalence of ESBLs and
PMQR genes in fecal Escherichia coli isolated from the
non-human primates in six zoos in China. Vet Microbiol
159: 53–59.
Wirth T, Falush D, Lan RT et al. (2006) Sex and virulence in
Escherichia coli: an evolutionary perspective. Mol Microbiol
60: 1136–1151.
Supporting Information
Additional Supporting Information may be found in the
online version of this article:
Table S1. List of primers for antibiotic resistance genes
and mobile genetic elements used in the study.
FEMS Microbiol Ecol 85 (2013) 604–611 ª 2013 Federation of European Microbiological Societies
Published by John Wiley & Sons Ltd. All rights reserved
Multiresistant E. coli among zoo animals 611
Příloha 21
VILLA, L., CAPONE, A., FORTINI, D., DOLEJSKA, M., RODRÍGUEZ, I., TAGLIETTI, F., DE PAOLIS, P.,
PETROSILLO, N., CARATTOLI, A., 2013, Reversion to susceptibility of a carbapenem resistant
clinical isolate of Klebsiella pneumoniae producing KPC-3: Journal of Antimicrobial
Chemotherapy, v. 68, p. 2482-2486.
Souhrn
V této studii byla stanovena primární nukleotidová sekvence plazmidů nesených dvěma rezistentními izoláty
K. pneumoniae ST258 získané z jednoho pacienta. Jeden izolát pocházel z infikované rány a vykazoval rezistenci
ke karbapenemům v důsledku produkce KPC-3. Druhý izolát byl získán z krve téhož pacienta po léčbě
tigecyklinem a narozdíl od prvního izolátu byl citlivý ke karbapenemům. U citlivého izolátu byl zjištěn plazmid
příbuzný s IncF plazmidem rezistentního izolátu. V důsledku přeskupení genů a fúze s malým ColE plazmidem
však plazmid citlivého izolátu ztrátil gen pro karbapenemázu. Studie ukazuje na vysokou plasticitu plazmidů
K. pneumoniae nesoucích karbapenemázy.
Reversion to susceptibility of a carbapenem-resistant clinical isolate
of Klebsiella pneumoniae producing KPC-3
Laura Villa1†, Alessandro Capone2†, Daniela Fortini1, Monika Dolejska1,3, Irene Rodrı´guez1, Fabrizio Taglietti2,
Paolo De Paolis4, Nicola Petrosillo2 and Alessandra Carattoli1*
1
Istituto Superiore di Sanita`, Rome, Italy; 2
National Institute of Infectious Diseases ‘Lazzaro Spallanzani’, Rome, Italy; 3
Department of
Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences Brno, Brno,
Czech Republic; 4
San Camillo-Forlanini Hospital, Rome, Italy
*Corresponding author. Tel: +39-06-4990-3128; Fax: +39-06-4938-7112; E-mail: alecara@iss.it
†L. V. and A. C. equally contributed to the work.
Received 1 March 2013; returned 3 May 2013; revised 15 May 2013; accepted 21 May 2013
Objectives: We report the case of a kidney-transplant patient, suffering an intra-abdominal abscess at the surgical
site caused by a carbapenem-resistant ST258 Klebsiella pneumoniae clone, producing the KPC-3 carbapenemase.
Under tigecycline treatment, the patient developed a sepsis caused by a carbapenem-susceptible ST258 K. pneumoniae
strain. Complete DNA sequences of the plasmids carried by the resistant and susceptible strains from this
patient were determined.
Methods: The complete DNA sequences of plasmids were obtained by applying the 454 Genome Sequencer FLX-
PLUSprocedureonalibraryconstructedoftotalplasmidDNApurifiedfromthecarbapenem-resistantand-susceptible
strains.
Results: In the carbapenem-resistant strain, four plasmids encoding 24 resistance genes, including blaKPC-3, and
two putative virulence clusters were detected. In the susceptible strain, large rearrangements occurred in the
KPC-carrying plasmid, causing the deletion of the entire Tn4401::blaKPC-3 transposon, with the consequent reversion
of the strain to carbapenem susceptibility. The patient was successfully treated with carbapenems and fully
recovered.
Conclusions:Thedescriptionofthe plasmidcontentinthesetwo strainsgivesinterestinginsights intotheplasticity
of KPC-carrying plasmids in K. pneumoniae.
Keywords: transplant, plasmids, sequence type 258
Introduction
Solid organ transplant patients are at risk of infections caused by
multidrug-resistant bacteria. In recent years, carbapenemresistant
Klebsiella pneumoniae emerged as one of the most relevant
pathogens causing healthcare-associated infections that in
the immediate post-operative period have resulted in poor clinical
outcomes after transplantation.1
The mortality rate and the
limited antimicrobial options for treatment adversely affect transplanted
patient outcomes.2,3
The K. pneumoniae clone designated
by multilocus sequence typing (MLST) as sequence type 258
(ST258),producingtheKPCcarbapenemase,hascausedepidemics
of national and international proportions, with particularly high
prevalence in Israel, Greece, Italy and the USA.4 –6
The genome of
this clone has been recently determined, identifying 50 proteins
that were unique to ST258, 30 of them located on various
plasmids.7
In a previous work, we characterized the plasmid
content of a K. pneumoniae ST258 strain isolated in Italy, identifying
four plasmids that were also described in other ST258 strains:
pKpQIL-IT, carrying the blaKPC-3 gene in the Tn4401 transposon;
pKPN-IT, conferring arsenic, copper, silver, trimethoprim, streptomycin,
chloramphenicol and macrolide resistance; IncXST258;
and the ColEST258 plasmid, conferring gentamicin resistance.8 –12
Here we describe the clinical course and successful outcome of a
patient who underwent kidney transplantation, followed by an
intra-abdominal abscess caused by a KPC-3-producing K. pneumoniae
ST258 strain. Under tigecycline therapy, this strain developed
reduced susceptibility to tigecycline, but also reverted the carbapenem
resistance. This change in the antimicrobial susceptibility
profile of the infectious strain allowed the successful recovery of the
patient with a combined carbapenem and colistin treatment and
was due to major rearrangements of the KPC-3-carrying plasmid.
# The Author 2013. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: journals.permissions@oup.com
J Antimicrob Chemother 2013; 68: 2482–2486
doi:10.1093/jac/dkt235 Advance Access publication 25 June 2013
2482
atNewCopenhagenUniversityonFebruary10,2014http://jac.oxfordjournals.org/Downloadedfrom
Methods
Bacterial typing
The identification and susceptibility of the K. pneumoniae strains were
determined by the Vitek 2 system (AST-N089 cards, bioMe´rieux, Marcy
l’E´toile, France), except for colistin, fosfomycin and tigecycline susceptibilities,
which were determined by disc diffusion assays and Etests (AB
Biodisk, Solna, Sweden and bioMe´rieux SA, Chemin de l’Orme, France, respectively),
following EUCAST guidelines.13
K.pneumoniae strainswereassignedtosequencetypesbyMLST, carried
out as previously described.14
PCR amplification of the blaKPC gene and sequencing of the amplicon
was performed using previously described primers and conditions.15
Plasmid sequencing
The complete DNA sequences of plasmids were obtained by applying the
454 Genome Sequencer FLX-PLUS procedure (http://454.com/applications/
whole-genome-sequencing/) on a library constructed of total plasmid DNA
purified from the LS6 carbapenem-resistant and SC29 carbapenemsusceptible
K. pneumoniae strains by using the Invitrogen PureLinkTM
HiPure Plasmid Filter Midiprep Kit (Invitrogen, Milan, Italy), according to
the manufacturer’s procedure.
De novo assembly of DNA reads and gap closure
Seventy-three and 109 contigs, ranging from 77869 to 73 bp, with
25-fold coverage were obtained from strains LS6 and SC29, respectively,
using the GS-FLX gsAssembler software. Contigs were firstly assembled in
silicobythe454ReadStatusoutputfile, generatedbythegsAssemblersoftware,
identifying reads overlapping adjacent contigs. Contig assembly and
predicted gaps were confirmed by PCR-based gap closure, by Sanger DNA
sequencing of the amplicons (Applied Biosystems, Foster City, CA, USA).
Annotation
Gene prediction was performed by the Artemis version 8 software (Sanger
Institute). Pairwise alignments were performed by BLASTN and BLASTP
(http://blast.ncbi.nlm.nih.gov/Blast.cgi).
Nucleotide accession numbers
Plasmids from the LS6 and SC29 strains were submitted to the
EMBL GenBank and assigned to the following accession numbers:
ColE-LS6, JX442973; pKPN3-LS6, JX442974; pKpQIL-LS6, JX442975;
A/C-LS6, JX442976; and pKpQIL-SC29, JX442977.
Ethics
The patient gave informed consent to publication after complete and comprehensive
reading of the manuscript.
Results and discussion
Case report
In February 2011, a Caucasian patient, HIV negative, underwent
kidney transplantation for end-stage kidney disease due to diabetic
and hypertensive nephropathy. A ureteric stent was inserted during
the surgical procedure and left in place. Six weeks after transplantation,
the patient was readmitted to the hospital because of a
subcutaneous abscess at the surgical wound site and a deep
abscess close to the transplanted kidney and to the pancreas.
Percutaneous CT scan-guided abdominal abscess drainage was
performed and a K. pneumoniae strain (identified as strain LS6)
was isolated from the infected site. The LS6 strain was assigned to
ST258 by MLST, showed resistance to carbapenems by the presence
of the blaKPC-3 gene (imipenem MIC .32 mg/L; meropenem
MIC .32 mg/L) and was fully susceptible to fosfomycin
(MIC¼16 mg/L), while the tigecycline MIC was at the upper limit
of susceptibility (MIC¼2 mg/L). Intravenous tigecycline (100 mg
initial loading dose, then 50 mg twice daily) plus fosfomycin (2 g
once daily) were administered to treat the severe intra-abdominal
infection, considering the optimal tigecycline pharmacokinetic
and pharmacodynamic profile in combination with fosfomycin in
abdominal tissues. After 20 days of this treatment, the patient
experienced a new febrile episode. A carbapenem-susceptible
K. pneumoniae strain (identified as strain SC29) was isolated from
blood and showed resistance to tigecycline (MIC¼4 mg/L), while
carbapenems and colistin were in the susceptible range (imipenem
MIC¼0.38 mg/L; meropenem MIC¼0.75 mg/L). The SC29 strain
was assigned to ST258 by MLST and was negative for the blaKPC-3
gene. The ureteric stent was removed and tigecycline plus fosfomycin
treatment was halted. Meropenem (1000 mg, in prolonged 4 h
intravenous infusion, thrice daily) plus colistin (240 mg twice daily
after a loading dose of 720 mg) treatment was continued for
18 days. The patient remained afebrile and the abdominal and subcutaneous
abscesses disappeared. The patient fully recovered and
was finally discharged 43 days after admission.
Plasmids and resistance genes in the LS6 carbapenemresistant
K. pneumoniae strain
Theentireplasmidcontentofthecarbapenem-resistantstrainwas
determined. The LS6 strain contained four plasmids with a total of
500 kb of plasmid DNA, encoding 24 resistance genes and two
putative virulence clusters.
The 78227 bp pKpQIL-LS6 plasmid (JX442975) carried the
blaKPC-3 gene in the Tn4401 transposon, conferring carbapenem
resistance, and the mer operon, conferring resistance to mercuric
ions (Figure 1). It was highly related to plasmid pKpQIL-IT
(JN233705), but showed a deletion of the FIIK2 replicon, part of
the tra locus and the aphA1a gene.8 –10
The pKPN-LS6 plasmid (245869 bp; JX442974), related to
pKPN-IT (JN233704), conferred resistance to arsenic, copper,
silver, chloramphenicol, macrolides, trimethoprim and streptomycin
by the ars, copper and silver loci and catA1, mph(A), dfrA12 and
aadA2 genes, respectively.8
pKPN-LS6 also encoded the Fec
iron(III) dicitrate transport system, probably involved in the capacity
of the bacterium to acquire iron in the human host, and a
completely novel region, whose functions are still unknown,
which was highly related to the Salmonella enteric phage epsilon
15 (Figure 2).16
The plasmid A/C-LS6 (178130 bp; JX442976) showed a backbone
similar to other IncA/C plasmids (Figure 2). In detail,
A/C-LS6 carried the same array of resistance genes previously
described in an IncA/C plasmid from Providencia stuartii from
Tunisia, including the plasmid-mediated quinolone resistance
qnrA6 gene, an ISCR1 class 1 integron conferring streptomycin,
b-lactam, chloramphenicol, rifampicin and trimethoprim
resistance by the aadA1, blaOXA-10, cmlA7, arr2 and dfrA16
gene cassettes, and a region encoding aminoglycoside, chloramphenicol/florfenicol
and tetracycline resistance by the
Reversion in carbapenem-resistant Klebsiella
2483
JAC
atNewCopenhagenUniversityonFebruary10,2014http://jac.oxfordjournals.org/Downloadedfrom
aphA6, aphA1, aacA4, strA, strB, floR and tet(A) genes.17
On this
plasmid, the mer locus and the ISEcp1-blaCMY-6 module were
also found, conferring resistance to mercuric ions and amoxicillin/clavulanic
acid, respectively.18
Finally, the ColE-LS6 plasmid (14709 bp; JX442973), carried the
aac(6′
)-Ib gene, encoding gentamicin resistance, as previously
described in other ST258 strains (Figure 1).8
With regard to the number and diversity of plasmids and resist-
ancegenes,theplasmidcontentoftheLS6strainisoneofthemost
interesting described in K. pneumoniae so far, showing a formidable
set of resistance genes against toxic compounds, metals
and all antimicrobial classes, but also containing phage-related
and virulence genes, whose function and relevance remain to be
ascertained.
Plasmids and resistance genes in the SC29 carbapenemsusceptible
K. pneumoniae strain
Three plasmids were identified in the SC29 carbapenemsusceptible
strain: pKPN-SC29 and A/C-SC29 were identical to
pKPN-LS6 and A/C-LS6, respectively, while the 48790 bp pKpQILSC29
plasmid (JX442977) was a derivative of pKpQIL-LS6
showing important rearrangements. pKpQIL-SC29 derived from a
fusion of pKpQIL and the ColE plasmid, probably by an
IS26-mediated recombination event in the region adjacent to the
ardA gene (Figure 1). Furthermore, pKpQIL-SC29 showed the deletion
of the entire Tn4401::blaKPC-3 transposon, with the consequent
reversion of the strain to carbapenem susceptibility. The deletion
also involved the entire transfer locus and the blaTEM-1 gene. This
deletion was probably caused by an IS26-mediated looping out,
probably associated with the IS26-mediated fusion of the pKpQIL
and ColE plasmids (Figure 1).
The excision of the blaKPC-3 gene from the Tn4401 transposon
reported here is not a rare event; partial deletions of this element
were previously observed in K. pneumoniae and Escherichia coli isolates
of different genetic backgrounds in the USA, highlighting the
notion that Tn4401 is itself heterogeneous and highly plastic.17
It
is plausible that by removing the selective pressure exerted by the
therapy with carbapenems, plasmid plasticity may favour the loss
of the KPC resistance determinant in the ST258 K. pneumoniae
clone. The presence of many homologous regions represented by
the IS26 elements scattered on multiple plasmids, simultaneously
resident within the same bacterial cell, can cause major rearrangements
of the plasmid scaffolds. In this study, plasmid fusion and
recombination events favoured by IS26 elements led to the restoration
of carbapenem susceptibility in the infectious strain, allowing
Figure1. MajorstructuralfeaturesofpKpQIL-typeplasmidsidentifiedinthecarbapenem-resistantand-susceptibleK.pneumoniaeST258strains.Plasmid
pKpQIL-IT(JN233705)identifiedinK.pneumoniaeST258inItalyin2011iscomparedwithplasmidspKpQIL-LS6(JX442975)andpKpQIL-SC29(JX442977),
identified in strains LS6 and SC29, respectively. The conserved regions among the three plasmids are shaded, including the small ColE-LS6 plasmid
(JX442973) fused with pKpQIL-SC29. The deletions observed in pKpQIL-LS6 and pKpQIL-SC29 with respect to the pKpQIL-IT plasmid sequence are
indicated by broken lines under the plasmid maps. Coloured boxes represent different functions/loci: white, plasmid scaffold regions (in the locus tra
the white boxes include capital letters indicating the respective tra genes, i.e. J, traJ; D, traD; I, traI etc.); black, blaKPC-3 gene; orange, other resistance
determinants; blue, transposon-related genes (tnpA, tnpR, tnpM), class 1 integrase and insertion sequences; and purple, replicons of the plasmids.
Villa et al.
2484
atNewCopenhagenUniversityonFebruary10,2014http://jac.oxfordjournals.org/Downloadedfrom
the successful recovery of the patient when treated with
carbapenems.
Funding
This work was supported by The Italian FLAGSHIP ‘InterOmics’ Project
(PB.P05; Grant B81J12000980001) funded by the Italian Ministryof University
and Scientific Research (MIUR) and coordinated by the Italian National
Council of Research (CNR), and by a grant for Ricerca Corrente Istituti di
Ricovero e Cura a Carattere Scientifico (IRCCS). I. R. and M. D. were recipients
of FEMS Research Fellowships.
Transparency declarations
N.P.hasreceivedspeakerfeesfromNovartis,GlaxoSmithKline,MerckSharp&
Dohme, Astellas, Johnson & Johnson, Carefusion, Bristol-Myers Squibb,
Gilead, Pfizer and Janssen-Cilag. A. Carattoli has received a project grant
from Pfizer (ASPIRE 2012). All other authors: none to declare.
References
1 Kalpoe JS, Sonnenberg E, Factor SH et al. Mortality associated with
carbapenem-resistant Klebsiella pneumoniae infections in liver transplant
recipients. Liver Transpl 2012; 18: 468–74.
2 Patel G, Huprikar S, Factor SH et al. Outcomes of carbapenem-resistant
Klebsiella pneumoniae infection and the impact of antimicrobial
and adjunctive therapies. Infect Control Hosp Epidemiol 2008; 29:
1099–106.
3 Mathers AJ, Cox HL, Bonatti H et al. Fatal cross infection by
carbapenem-resistant Klebsiella in two liver transplant recipients. Transpl
Infect Dis 2009; 11: 257–65.
4 Cuzon G, Naas T, Truong H et al. Worldwide diversity of Klebsiella
pneumoniae that produce b-lactamase blaKPC-2 gene. Emerg Infect Dis
2010; 16: 1349–56.
5 Kitchel B, Rasheed JK, Patel JB et al. Molecular epidemiology of
KPC-producing Klebsiella pneumoniae isolates in the United States: clonal
expansion of multilocus sequence type 258. Antimicrob Agents
Chemother 2009; 53: 3365–70.
Figure 2. Major structural features of pKPN- and IncA/C-type plasmids identified in the carbapenem-resistant and -susceptible K. pneumoniae ST258
strains. Plasmid pKPN-IT (JN233704) identified in K. pneumoniae ST258 in Italy in 2011 is compared with pKPN plasmids, identically identified in strains
LS6 and SC29, here indicated as pKPN-LS6-SC29. Plasmid A/C pAR060302 (FJ621588) identified in the USA is compared with A/C plasmids, identically
identified in strains LS6 and SC29, here indicated as A/C-LS6-SC29. The conserved regions among the two plasmids are shaded. Coloured boxes
represent different functions/loci: white, plasmid scaffold regions (in the locus tra the white boxes include capital letters indicating the respective tra
genes, i.e. J, traJ; D, traD; I, traI etc.); orange, other resistance determinants; blue, transposon-related genes (tnpA, tnpR, tnpM), class 1 integrase and
insertion sequences; purple, replicons of the plasmids; pale green, putative virulence genes [Fec iron(III), ABC transporter, prophage-related genes];
and grey, methyl-transferase genes.
Reversion in carbapenem-resistant Klebsiella
2485
JAC
atNewCopenhagenUniversityonFebruary10,2014http://jac.oxfordjournals.org/Downloadedfrom
6 Adler A, Paikin S, Sterlin Y et al. A swordless knight: epidemiology and
molecular characteristics of the blaKPC-negative sequence type 258
Klebsiella pneumoniae clone. J Clin Microbiol 2012; 50: 3180–5.
7 Chmelnitsky I, Shklyar M, Hermesh O et al. Unique genes identified in the
epidemic extremely drug-resistant KPC-producing Klebsiella pneumoniae
sequence type 258. J Antimicrob Chemother 2013; 68: 74–83.
8 Garcı´a-Ferna´ndez A, Villa L, Carta C et al. A Klebsiella pneumoniae ST258
producing KPC-3 identified in Italy carries novel plasmids and OmpK36/
OmpK35 porin variants. Antimicrob Agents Chemother 2012; 56: 2143–5.
9 Leavitt A, Chmelnitsky I, Ofek I et al. Plasmid pKpQILencoding KPC-3 and
TEM-1 confers carbapenem resistance in an extremely drug-resistant
epidemic Klebsiella pneumoniae strain. J Antimicrob Chemother 2010; 65:
243–8.
10 Leavitt A,Chmelnitsky I,Carmeli Yet al. Completenucleotidesequenceof
KPC-3-encoding plasmid pKpQIL in the epidemic Klebsiella pneumoniae
sequence type 258. Antimicrob Agents Chemother 2010; 54: 4493–6.
11 Cuzon G, Naas T, Nordmann P. Functional characterization of Tn4401, a
Tn3-based transposon involved in blaKPC gene mobilization. Antimicrob
Agents Chemother 2011; 55: 5370–3.
12 Chen L, Chavda KD, Melano RG et al. Complete sequence of a
blaKPC-2-harboring IncFIIK1 plasmid from a Klebsiella pneumoniae
sequencetype 258 strain. Antimicrob AgentsChemother 2013; 57: 1542–5.
13 EUCAST. Breakpoint Tables for Interpretation of MICs and Zone Diameters,
Version 3.1. 2013. http://www.eucast.org/fileadmin/src/media/PDFs/
EUCAST_files/Breakpoint_tables/Breakpoint_table_v_3.1.pdf (15 May 2013,
date last accessed).
14 Diancourt L, Passet V, Verhoef J et al. Multilocus sequence typing of
Klebsiella pneumoniae nosocomial isolates. J Clin Microbiol 2005; 43:
4178–82.
15 NordmannP,GniadkowskiM,GiskeCGetal.Identificationandscreening
of carbapenemase-producing Enterobacteriaceae. Clin Microbiol Infect
2012; 18: 432–8.
16 McConnell M, Walker B, Middleton P et al. Restriction endonuclease and
genetic mapping studies indicate that the vegetative genome of the
temperate, Salmonella-specific bacteriophage, epsilon 15, is circularlypermuted.
Arch Virol 1992; 123: 215–21.
17 Chen L, Chavda KD, Mediavilla JR et al. Partial excision of blaKPC from
Tn4401 in carbapenem-resistant Klebsiella pneumoniae. Antimicrob
Agents Chemother 2012; 56: 1635–8.
18 Arpin C, Thabet L, Yassine H et al. Evolution of an incompatibility
group IncA/C plasmid harboring blaCMY-16 and qnrA6 genes and its
transfer through three clones of Providencia stuartii during a
two-year outbreak in a Tunisian burn unit. Antimicrob Agents Chemother
2012; 56: 1342–9.
Villa et al.
2486
atNewCopenhagenUniversityonFebruary10,2014http://jac.oxfordjournals.org/Downloadedfrom
Příloha 22
ALBRECHTOVA, K., PAPOUSEK, I., DE NYS, H., PAULY, M., ANOH, E., MOSSOUN, A., DOLEJSKA, M.,
MASARIKOVA, M., METZGER, S., COUACY-HYMANN, E., AKOUA-KOFFI, C., WITTIG, R.M., KLIMES,
J., CIZEK, A., LEENDERTZ, F.H., LITERAK, I., 2014, Low rates of antimicrobial-resistant
Enterobacteriaceae in wildlife in Taï National Park, Côte d'Ivoire, surrounded by villages with high
prevalence of multiresistant ESBL-producing Escherichia coli in people and domestic animals:
PLoS One, v. 9, e113548.
Souhrn
Cílem studie bylo zjistit výskyt rezistentních bakterií v odlehlých oblastech s minimálním selekčním tlakem
antibiotik. V Pobřeží Slonoviny byly v Národním parku Taï, který slouží jako rezervace šimpanzů, a v přilehlých
vesnicích vyšetřeny fekální vzorky volně žijících drobných savců, primátů, lidí a domestikovaných zvířat
na přítomnost rezistentních bakterií. Kmeny E. coli s produkcí ESBL nebo nesoucí geny PMQR pro rezistenci
k fluorochinolonům byly zjištěny ve 27-42 % vzorků z lidí a domestikovaných zvířat. Naopak u volně žijících
zvířat v národním parku nebyly žádné takové izoláty zjištěny. Studie poukazuje, že přísná opatření
pro návštěvníky národního parku omezují přenos rezistentních bakterií k volně žijícím živočichům.
RESEARCH ARTICLE
Low Rates of Antimicrobial-Resistant
Enterobacteriaceae in Wildlife in Taı¨
National Park, Coˆte d’Ivoire, Surrounded
by Villages with High Prevalence of
Multiresistant ESBL-Producing Escherichia
coli in People and Domestic Animals
Katerina Albrechtova1
*, Ivo Papousek1
, Helene De Nys2,3
, Maude Pauly3
,
Etile Anoh4
, Arsene Mossoun5
, Monika Dolejska1,6
, Martina Masarikova6,7
,
Sonya Metzger2,3
, Emmanuel Couacy-Hymann5
, Chantal Akoua-Koffi4
,
Roman M. Wittig3,8
, Jiri Klimes1
, Alois Cizek6,7
, Fabian H. Leendertz2
*,
Ivan Literak1,6
1. Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of
Veterinary and Pharmaceutical Sciences, Brno, Czech Republic, 2. Project Group ‘‘Epidemiology of Highly
Pathogenic Microorganisms’’, Robert Koch Institute, Berlin, Germany, 3. Department of Primatology, MaxPlanck-Institute
for Evolutionary Anthropology, Leipzig, Germany, 4. Research Center for Development Alassane
Ouattara University, University Teaching Hospital Bouake´, Bouake´, Coˆte d’Ivoire, 5. LANADA,
Laboratoire Nationale de la Pathologie Animale, Bingerville, Coˆte d’Ivoire, 6. CEITEC VFU, University of
Veterinary and Pharmaceutical Sciences, Brno, Czech Republic, 7. Institute of Microbiology and Infectious
Diseases, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences, Brno, Czech
Republic, 8. Centre Suisse de Recherches Scientifiques, Abidjan, Coˆte d’Ivoire
*albkat@seznam.cz (KA); leendertzf@rki.de (FHL)
Abstract
Antimicrobial resistance genes can be found in all ecosystems, including those
where antibiotic selective pressure has never been exerted. We investigated
resistance genes in a collection of faecal samples of wildlife (non-human primates,
mice), people and domestic animals (dogs, cats) in Coˆte d’Ivoire; in the
chimpanzee research area of Taı¨ National Park (TNP) and adjacent villages. Single
bacteria isolates were collected from antibiotic-containing agar plates and
subjected to molecular analysis to detect Enterobacteriaceae isolates with plasmidmediated
genes of extended-spectrum beta-lactamases (ESBLs) and plasmidmediated
quinolone resistance (PMQR). While the prevalence of ESBL-producing
E. coli in the villages was 27% in people (n577) and 32% in dogs (n538), no ESBLproducer
was found in wildlife of TNP (n575). PMQR genes, mainly represented by
qnrS1, were also present in human- and dog-originating isolates from the villages
(36% and 42% in people and dogs, respectively), but no qnrS has been found in the
OPEN ACCESS
Citation: Albrechtova K, Papousek I, De Nys H,
Pauly M, Anoh E, et al. (2014) Low Rates of
Antimicrobial-Resistant Enterobacteriaceae in
Wildlife in Taı¨ National Park, Coˆte d’Ivoire,
Surrounded by Villages with High Prevalence of
Multiresistant ESBL-Producing Escherichia coli in
People and Domestic Animals. PLoS ONE 9(12):
e113548. doi:10.1371/journal.pone.0113548
Editor: Gireesh Rajashekara, The Ohio State
University, United States of America
Received: June 13, 2014
Accepted: October 29, 2014
Published: December 4, 2014
Copyright: ß 2014 Albrechtova et al. This is an
open-access article distributed under the terms of
the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction
in any medium, provided the original author
and source are credited.
Data Availability: The authors confirm that all data
underlying the findings are fully available without
restriction. All relevant data are within the paper.
Funding: This study was funded by the project
‘CEITEC - Central European Institute of
Technology’ (CZ.1.05/1.1.00/02.0068) from the
European Regional Development Fund. MD and IP
were supported by the Operational Programme
‘‘Education for Competitiveness’’ (CZ.1.07/2.3.00/
30.0014) from the European Social Fund. The
funders had no role in study design, data collection
and analysis, decision to publish, or preparation of
the manuscript.
Competing Interests: The authors have declared
that no competing interests exist.
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 1 / 19
park. In TNP, different variants of qnrB were detected in Citrobacter freundii isolates
originating non-human primates and mice. In conclusion, ESBL and PMQR genes
frequently found in humans and domestic animals in the villages were rather
exceptional in wildlife living in the protected area. Although people enter the park,
the strict biosecurity levels they are obliged to follow probably impede transmission
of bacteria between them and wildlife.
Introduction
Antimicrobial resistance (AMR) is a serious problem that affects the dynamics of
microbial populations worldwide, pathogens as well as commensals [1]. Evolution
of AMR is swift, owing to plethora of mobile genetic elements, short generation
periods and adaptability inherent to many bacterial species [2]. It is presumed
that the majority of the resistance gene pool co-evolves with the emergence of
natural antibiotic traits. However, certain resistance alleles are given advantage by
the use of antibiotics in medicine and agriculture [3]. Unfortunately, it is difficult
to estimate which alleles of the naturally evolving resistome will become clinically
relevant in future [4]. While some AMR genes have been dispersed globally, owing
to successful bacterial clones or conjugative plasmids, other are typically found in
particular continents, localities or hospital wards. The public health risk of
resistance genes varies according to their genetic vehicle (plasmid, transposon,
adjacent insertion sequence etc.) and bacterial species carrying the genes [5].
Monitoring of resistance genes occurring at the interface of pristine and humaninfluenced
ecosystems helps us to estimate the frequency of gene exchange in
microbial populations of people, domestic animals and wildlife and thereby to
better understand the AMR epidemiology.
Extended-spectrum beta-lactamases (ESBL) confer resistance to wide spectrum
of beta-lactams, up to third-generation cephalosporins [6]. Their increasing
occurrence and diversity, documented since the 1980s [7–8], is intertwined with
the use of these drugs in human and veterinary medicine. ESBL genes are often
transferred on multiresistant conjugative plasmids, which facilitated their global
emergence; these are not limited to hospitals but also abundant in community
settings [8]. One of the most promiscuous and most widespread among the ESBLs
is the CTX-M family [9]. AmpC-type beta-lactamases occur as inherent
chromosome-mediated enzymes in several classes of non-pathogenic bacteria and
they are being detected with an increasing frequency as plasmid-encoded enzymes
in clinically relevant Enterobacteriaceae [10]. Plasmid-mediated quinolone
resistance (PMQR) is represented by a heterogeneous group of genes qnr, aac(69)Ib-cr,
oqxAB and qepA. Different types of genes qnr and the cr-mutation of
aac(69)-Ib gene have low ability to inactivate quinolones and therefore their
presence usually does not generate resistance above the clinical breakpoints. Still,
these genes play an important role in the multifactorial process of fluoroquinoAntimicrobial
Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 2 / 19
lone resistance generation and monitoring of their prevalence is important to our
understanding to fluoroquinolone resistance epidemiology [11]. Although
different alleles of qnr (specifically qnrB and qnrS) occur naturally as a part of
intrinsic resistance in Citrobacter sp. and Vibrio sp., their mobilisation to E. coli is
supposedly a human-influenced phenomenon, driven mainly by the use of
fluoroquinolones in human and animal medicine and agriculture [11]. The global
increase of Enterobacteriaceae with plasmid-mediated genes aac(69)-Ib-cr, oqxAB
and qepA is also considered a consequence of quinolone use [12].
ESBLs, AmpCs and PMQR represent a serious public health problem in Africa,
where the pressure of infectious diseases is high and the use of antibiotics is often
inappropriate [13]. Many studies have investigated resistance and its genetic
background in clinical or agricultural settings, but less data have been collected in
ecosystems where the human impact is limited to minimum, e.g. nature reserves
and other protected areas [14–16]. Taı¨ National Park (TNP) in Coˆte d’Ivoire (CI)
is one of the last remaining forest blocks in west Africa, its protection was
established in 1970s to conserve endangered population of the western
chimpanzee (Pan troglodytes verus), the pygmy hippopotamus (Choeropsis
liberiensis) and other wildlife. Access of people is limited to researchers and local
assistants in the northern part of the park. Nevertheless, even with such level of
protection, microbial exchange between people and wildlife is not impossible, as
demonstrated by the transmission of human respiratory viruses to the
chimpanzees [17–18].
In this study we aimed to identify the spectrum of resistance genes in
gastrointestinal flora of primates living in Taı¨ National Park and inhabitants of
villages surrounding the protected area. We were looking at possible overlaps in
the spectrum of resistant bacteria in these two ecosystems, adjacent one to the
other but totally different in terms of human impact. We address the prevalence of
resistant bacteria in NHPs in TNP, as well as people and domestic animals living
in its proximity. When discussing these issues, the presence of ESBL-producing
Enterobacteriaceae is considered as a result of human-originating microbial
pollution [19–20]. Indisputably, part of PMQR genes (aac-69-Ib-cr, qepA, oqxAB
and qnr in E. coli) can also be regarded as human-originating pollution, yet
another part (qnrB in Citrobacter sp. or sole oqxA in Klebsiella sp.) probably
represent evolving intrinsic resistance. [21–22]. The latter group of PMQR is
noteworthy for their potential of transfer to human pathogens.
Materials and Methods
Study area
TNP, located at the western border of Coˆte d’Ivoire (geographic coordinates of
the main research camp: lat.5.86767554/long.–7.33968803) represents the largest
remaining tropical rainforest in West Africa (435,000 ha) [23]. It is covered with
dense primary forest and lined by less dense secondary forest at the borders. Three
groups of habituated chimpanzees dwell in the park; northern group (18
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 3 / 19
individuals in 2012), southern group (24 individuals) and eastern group (31
individuals). Additionally, unhabituated chimpanzees have been observed in the
park; their total number is not known. While overlaps of ranging areas of the
three groups are minimal and chimpanzees from different groups rarely meet face
to face, immigration of females from neighbouring groups can occur. In 2004,
2007 and 2011, the chimpanzees of the South group and in 2007 the individuals of
the East group were treated by a single shot of Extencilline (Benzathine
Benzylpenicillin 2,400,000 IU; Sanofi-Aventis, France; 3–5 ml intramuscular
injection per individual) due to severe respiratory outbreaks.
Four research camps have been built within the park – one in the middle of the
range of each group (North, East, and South camp) and an additional quarantine
camp in the northern area. Chimpanzees are followed daily by one to three
researchers or assistants. Access of tourists and visitors is not possible to the park.
For the Taı¨ Chimpanzee Project (TCP), where this study has been carried out,
only a small number of scientists (less than 10 in average) and local assistants (less
than 30) have access to the camps and forest. Strict hygiene rules are in place to
prevent transmission of any pathogens from people to animals [18, 24]. Persons
who are about to approach the animals must be clinically healthy and have to go
through 5 days quarantine after entering the park from outside. Face masks must
be worn all the time in the presence of the chimpanzees and observers have to
keep at least 7 m distance from them. Free defecation in the forest is not allowed;
if necessary, faeces have to be collected immediately into plastic bags and
transported to latrines at the camps (these are closed and not accessible to
animals). Details of the hygienic protocol are available online [25].
The villages of Daobly, Ponan, Taı¨, Paule´ola and Goule´ako (with populations
ranging from 1000 to 7000 inhabitants) are situated along the northern access
road to TNP. People in the villages keep domestic animals such as dogs, cats,
goats, cattle, poultry and pigs. The majority of assistants working in the park are
residents of these villages; they come to work in the forest on four week rotations.
There is no veterinarian operating in the region. According to questionnaire
administered to participants of the study in the villages (M.P., unpublished data),
dogs in the sampling area are not receiving antibiotics. People in the villages can
acquire antibiotics from local hospitals or at local shops. Researchers working in
the forest occasionally use doxycycline for malaria prophylaxis (for a period up to
two months), however, treatment by beta-lactams or quinolones did not occur in
the forest during the last five years.
Sampling
Collection of faecal samples took place within and around the park from January
2012 to September 2012 (wildlife was sampled in January and February, people,
dogs and cats from March to September). Chimpanzees of the three groups can be
recognized individually, so individual faecal samples (n543) were taken. Faecal
samples were collected into plastic bags immediately after defecation had been
observed, without disturbing the natural behaviour [24]. A swab was made from
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 4 / 19
the central part of the faeces. Additionally, fresh faeces of Diana monkey
(Cercopithecus diana, n59), soothy mangabeys (Cercocebus agilis, n59), upper
Guinea red colobus (Pilocolobus badius, n59) and King colobus (Colobus
polykomos, n55) were sampled in a similar manner, but those cannot be
considered as individual samples.
Within the quarantine camp, the latrine was sampled four times within a week
interval (n54 in total) by a swab attached to a bamboo pole. Faeces were collected
from nests of house mice (n54) in the camp. All swabs were preserved in Amies
medium and kept refrigerated (the longest storage period was 8 weeks) until
transported to the University of Veterinary and Pharmaceutical Sciences Brno,
Czech Republic. In the villages samples were collected from 38 domestic dogs (12
in Daobly, 12 in Taı¨, 5 in Ponan, 9 in Paule´ola) and 3 cats (all in Taı¨). Stool
samples were also collected from 77 inhabitants of the villages (19 in Daobly, 39 in
Ponan, 14 in Taı¨, 5 in Goule´ako), stored in cryotubes in liquid nitrogen and
transported on dry ice to Robert Koch Institute, Berlin, Germany and then stored
at 280˚C.
Ethics statement
Sampling of humans was approved by the Ministe`re de la sante´ et de la lutte
contre le SIDA, comite´ national d’e´thique et de la recherche de la Re´publique de
Coˆte d’Ivoire N˚011-/MSHP/CNER-P. Before sampling, the aim of the study and
the possibility to quit the study at any point, was explained individually in the
local language. An individual study number was assigned to every participant to
protect the privacy of the participant. Written informed consent was obtained
from every study participant and sampling was performed according to the
declaration of Helsinki. Sampling of domestic animals was done according to the
Directive 86/609/EEC on the Protection of Animals Used for Experimental and
Other Scientific Purposes. The permit for sampling of domestic animals was
issued by LANADA, Laboratoire Nationale de la Pathologie Animale, Bingerville,
CI. Sampling of wildlife in TNP was done non-invasively, according to permit
issued by Office Ivoirien des Parcs et Re´serves (OIPR), Abidjan, CI.
Microbiological techniques
Each swab was plated in parallel on plain MacConkey agar (MCA) (Oxoid, UK),
MCA with cefotaxime (2 mg/l) and MCA with ciprofloxacin (0.05 mg/l). The
human samples were swabbed directly from the frozen material in vials and plated
on MCA with cefotaxime and MCA with ciprofloxacin. The swabs originating
from the park were plated additionally on MCA with cefoxitin (16 mg/l). One
lactose-fermenting colony was isolated from each plate. All isolates grown on
MCA with cefotaxime were tested by double.disc synergy test (DDST) for
production of ESBL [26]. Selected isolates were tested by disc-diffusion method
[26] for sensitivity to 12 antibiotics – ampicillin (10 mg), cephalotin (30 mg),
amoxicillin-clavulanate (20+10 mg), ceftazidime (30 mg), trimethoprim-sulfaAntimicrobial
Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 5 / 19
methoxazole (1.25+23.7 mg), sulphonamides compounds (300 mg), gentamicin
(10 mg), nalidixic acid (30 mg), ciprofloxacin (5 mg), streptomycin (30 mg),
tetracycline (30 mg) and chloramphenicol (30 mg). Isolates with resistance to all
beta-lactams tested were additionally examined for sensitivity to aztreonam
(30 mg), cefpodoxime (10 mg), cefepime (30 mg), imipenem (10 mg), meropenem
(10 mg) and ertapenem (10 mg).
Molecular typing
All isolates positive in DDST were tested by PCR for ESBL-encoding genes
(blaTEM, blaCTX-M, blaSHV, blaOXA) as described previously [27–28]. Multiplex
PCR [29] was used to search for genes of plasmid-mediated AmpC betalactamases
in all isolates grown on plates containing cefoxitin and in isolates
grown on media with cefotaxime but negative in the DDST. The PMQR genes
(aac(69)-Ib-cr, qepA, qnrA, qnrB, qnrC, qnrD, qnrS and oqxAB) were searched in
isolates obtained on media with ciprofloxacin by PCRs as summarized elsewhere
[30]. Forward primer psp2 was used in combination with reverse primers sc3, ds2
and ds3 [22] to investigate the flanking sequences of the qnrB genes. PMQR, ESBL
and AmpC genes were sequenced to specify the type of the allele (EZ-seq service
performed at Macrogen Europe). According to their resistance phenotype, isolates
were tested for additional antibiotic resistance genes and integrons as described
before [27].
All isolates with resistance were identified to species level by MALDI-TOF
(matrix-assisted laser desorption/ionisation time-off-flight mass spectrometry;
Microflex LT, Bruker Daltonics, Brehmen, Germany). E. coli isolates were tested
for phylogroup by multiplex PCR [31]. All the ESBL-, AmpC- or PMQR- positive
isolates were typed by XbaI pulsed-field gel electrophoresis (PFGE) [32]. The
profiles obtained were analysed using the unweighed pair group method with
arithmetic mean (UPGMA) in Bionumerics 6.6 software (Applied Maths, SintMartens-Latem,
Belgium). Cluster analysis of the Dice similarity indices was
conducted to generate a dendrogram describing the relationships among PFGE
profiles.
Transferability of resistance genes and plasmid characterization
Conjugation transfer of ESBL genes was made to plasmid-free, rifampin- and
azid-resistant E. coli MT102RN and Salmonella Typhimurium SL5325 [33].
Plasmid DNA from ESBL-producing and PMQR-harbouring isolates was
extracted by rapid alkaline method [34] and introduced into competent E. coli
DH5a (Invitrogen, USA) by chemical transformation. Transformants were
selected on LB agar (Difco, USA) supplemented with 2 mg/l cefotaxime or
0.05 mg/l ciprofloxacin, according to the genes of donor isolates. Transformants
and transconjugants were tested for the number of plasmids gained and their size
using S1-PFGE [35]. Single plasmid-harbouring and ESBL-producing transformants
and transconjugants were screened for transferred resistance genes by PCR
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 6 / 19
as described above. Plasmids extracted from these transformants and transconjugants
by the Birnboim-Doly method were replicon typed [36–37] and their
resistance genes were tested by PCR as described above [27, 30].
Results
Resistant isolates obtained from humans and domestic animals of
the villages
The most common bacterial species obtained by cultivation of human- and dogoriginating
faecal samples on plates with ciprofloxacin and cefotaxime was E. coli
(73/76; 96% isolates). All four phylogenetic groups were present; the most
frequent group A (52/76; 68%) was followed in frequency by group B1 (14/76;
18%), D (12/76; 16%) and B2 (3/76; 0.4%). Based on the results of DDST (i.e.
ESBL phenotype) and molecular methods, a total of 35 ESBL-producing E. coli
isolates (Table 1) were obtained by cultivation of samples from dogs (12/38 dogs;
32%), cats (2/3 cats) and humans (21/77 humans; 27%). All the DDST-positive
isolates produced the CTX-M-15 type beta-lactamase and were multiresistant;
besides the resistance to beta-lactams, they showed resistance to other groups of
antibiotics, including tetracyclines, sulphonamides, aminoglycosides, chloramphenicol
and fluoroquinolones. Six of the ESBL-producing isolates have shown
decreased sensitivity to ceftazidime. Among these, none was resistant to imipenem
or meropenem, but all were uniformly resistant to cefepime, aztreonam and
cefpodoxime. As revealed by transformation and conjugation experiments, the
blaCTX-M-15 gene was localized on various conjugative plasmids ranging in size
from 60 to 90 kb, of incompatibility group FIB or N, together with different
combinations of other resistance genes (Table 2). Some plasmids were not typable
by any of replicon-typing primers available. In total, transformation experiments
were successful in 6 ESBL-producing isolates and conjugation was successful in 8
ESBL-producing isolates.
By cultivation on MCA with ciprofloxacin, a total of 44 PMQR isolates was
obtained from samples collected in the villages (Table 3). Of these, 14 dogoriginating
isolates of E. coli and 20 human-originating isolates of E. coli possessed
the gene qnrS1. The gene qnrB was found in E. coli from three people and one C.
freundii isolate from a dog, the aac-(69)-Ib-cr was detected in two humanoriginating
E. coli isolates and one human-originating K. pneumoniae. The aac(69)-Ib-cr
gene was also present in four of the ESBL-producing isolates. One E. coli
isolate had the oqxAB efflux pump. Similarly to the ESBL-producing isolates, the
PMQR isolates were multiresistant; three to eight of the antibiotics tested have
shown decreased sensitivity in the disc-diffusion test.
According to the PFGE analysis, the ESBL- and PMQR- resistant isolates
grouped into 15 clusters of .80% similarity irrespective of their host (dogs versus
humans) and sampling site (village). No clone seemed to be characteristic of a
given locality. Isolates with identical PFGE profile were detected in humans and
animals living in the same villages (Figure 1).
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 7 / 19
Table 1. Characteristics of ESBL-producing isolates from villages.
Locality Source Species, PG Resistance genes Resistance phenotype
Daobly D 866 ctx E. coli, A blaCTX-M-15, blaOXA1,
strA, aadA5, tet(B),
aac-(69)-Ib-cr, sul2
AmpCefNalCipTetSxtSptSul
D 868 ctx E. coli, D blaCTX-M-15 (C), blaOXA1,
strA, aadA5, tet(B),
aac-(69)-Ib-cr, sul1, sul2
AmpCefNalCipTetSxtChlSptSul
D 878 ctx E. coli, A blaCTX-M-15, strA,
intI1 (dfr1-sat-aadA1),
sul2
AmpCefNalSxtSul
D 879 ctx E. coli, A blaCTX-M-15 (C),
blaTEM-1, strA, tet(A), sul2
AmpCefTetSxtSptSul
H 260 ctx E. coli, A blaCTX-M-15, tet(A) AmpCefTet
H 267 ctx E. coli, A blaCTX-M-15, tet(A),
sul2, aadA2
AmpCefNalGenTetSxtSptSul
H 268 ctx E. coli, A blaCTX-M-15 (T, C),
blaTEM-1, tet(B), sul2
AmpCefCazTetSxtSptSul
H 271 ctx E. coli, B2 blaCTX-M-15, blaTEM-1,
strA, tet(A), sul1,
sul, aadA5
AmpCefCazNalCipGenTetSxtSptSul
H 285 ctx E. coli, B1 blaCTX-M-15, strA,
tet(A), sul2, aadA2
AmpCefNalTetSxtSptSul
H 298 ctx E. coli, D blaCTX-M-15, strA,
tet(A), aac-(69)-Ib-cr,
aac(3)II, sul2
AmpCefAmcNalCipGenTetSxtSptSul
H 324 ctx E. coli, B1 blaCTX-M-15,
tet(A), sul2
AmpCefTetSxtSptSul
H 332 ctx E. coli, B1 blaCTX-M-15 (T),
blaTEM-1, tet(A), sul2
AmpCefTetSxtSptSul
Ponan H 106 ctx E. coli, A blaCTX-M-15, strA,
tet(B), aac-(69)-Ib-cr,
sul1, sul2, aadA5
AmpCefCazNalCipTetSxtSptSul
H 110 ctx E. coli, A blaCTX-M-15, blaTEM-1,
strA, tet(A), sul2, aadA2
AmpCefTetSxtSptSul
H 115 ctx E. coli, A blaCTX-M-15, blaTEM-1,
strA, tet(A), sul2,
sul3, aadA2
AmpCefCpdTetSxtSptSul
H 127 ctx E. coli, D blaCTX-M-15, blaTEM-1,
aac(3)II, aadA2, aadA5
AmpCefCazAmcNalCipGenTetSxtSptSul
H 149 ctx E. coli, D blaCTX-M-15, strA, sul2, sul3 AmpCefCazNalTetSxtChlSptSul
H 154 ctx E. coli, A blaCTX-M-15, tet(B), aadA5 AmpCefAmcNalCipTetSxtChlSptSul
H 167 ctx E. coli, A blaCTX-M-15, tet(A),
sul2, aadA2
AmpCefNalTetSxtSptSul
Taı¨ D 856 ctx E. coli, A blaCTX-M-15, blaTEM-1,
strA, tet(A)
AmpCefCipTetSxtSptSul
D 860 ctx E. coli, A blaCTX-M-15, blaTEM-1,
strA, tet(B), sul2
AmpCefTetSxtSptSul
D 872 ctx E. coli, A blaCTX-M-15 (T),
blaTEM-1, sul2
AmpCefTetSxtSptSul
C 881 ctx E. coli, A blaCTX-M-15 (C),
blaTEM-1, strA, tet(A), sul2
AmpCefTetSxtChlSptSul
C 882 ctx E. coli, B1 blaCTX-M-15, strA,
tet(A), qnrS1
AmpCefNalCipTetSxtSptSul
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 8 / 19
Resistant isolates found in NHPs and research camps in the forest
No lactose-fermenting colonies were obtained by cultivation of the 76 samples
obtained within TNP (NHPs, mice, the latrine in the research camp) on plates
with cefotaxime. A total of 25 lactose-fermenting colonies were obtained on MCA
with ciprofloxacin (Table 4). Among those, four isolates originating from
chimpanzees and three originating from monkeys were identified as Citrobacter
freundii and carried variants of qnrB, one chimpanzee harboured a qnrB13producing
Klebsiella pneumoniae. A qnrB-harbouring C. freundii was found also in
one house mouse in the North camp. The allele qnrB13 was found exclusively in
chimpanzees, qnrB9 occurred only in monkeys and qnrB28 was detected in
chimpanzees, monkeys, house mouse and also in a dog living in Paule´ola village.
Besides the qnrB-harboring isolates, the cultivation on MCA with ciprofloxacin
Table 1. Cont.
Locality Source Species, PG Resistance genes Resistance phenotype
D 884 ctx E. coli, B1 blaCTX-M-15, blaOXA1,
blaTEM-1, strA, intI2
(dfr1-sat-aadA1),
aac-(69)-Ib-cr, sul2
AmpCefNalCipTetSxtSptSul
H 215 ctx E. coli, B1 blaCTX-M-15 (T),
blaTEM-1, strA,
tet(A), aadA2
AmpCefTetSxtSptSul
H 217 ctx E. coli, A blaCTX-M-15 strA,
tet(A), aadA5
AmpCefNalTetSxtSptSul
H 234 ctx E. coli, A blaCTX-M-15, strA,
tet(A), aadA5
AmpCefTetSxtSptSul
H 241 ctx E. coli, A blaOXA1, blaTEM-1 AmpCefCazAmcNalCipGenTetSxtChlSptSul
H 244 ctx E. coli, B1 blaCTX-M-15 (C),
strA, tet(A), aadA2
AmpCefNalTetSxtSptSul
Paule´ola D 855 ctx E. coli, A blaCTX-M-15 (C),
blaTEM-1, strA, tet(B), sul2
AmpCefNalCipGenTetSxtSptSul
D 858 ctx E. coli, A blaCTX-M-15 (C),
blaOXA1, strA, aadA5,
tet(B), aac-(69)-Ib-cr, sul2
AmpCefNalCipTetSxtSptSul
D 859 ctx E. coli, A blaCTX-M-15,
blaTEM-1, strA,
tet(A), sul2
AmpCefTetSxtChlSptSul
D 886 ctx E. coli, B1 blaCTX-M-15, strA,
aadA5, intI2
(dfr1-sat1), sul2
AmpCefNalCipGenTetSxtChlSptSul
Goule´ako H 344 ctx E. coli, B1 blaCTX-M-15 (C),
blaTEM-1, tet(A),
aac(3)II, sul2, aadA2
AmpCefTetSxtSptSul
All isolates were obtained on MCA-cefotaxime.
‘‘D’’ – isolate from dog, ‘‘H’’ – isolates from human, ‘‘C’’ – isolate from cat. ‘‘T’’ in brackets means that the resistance gene was successfully transformed into
competent cells, ‘‘C’’ in brackets means that the gene was conjugated. Plasmids were isolated and characterized from isolates in bold font. See Table 2 for
plasmid characteristics.
PG5phylogroup, Amp5ampicillin, Cef5cephalotin, Caz5ceftazidime, Amc5amoxycilin-clavulanate, Nal5nalidixic acid, Cip5ciprofloxacin,
Tet5tetracycline, Sxt5trimethoprim-sulfamethoxazole, Spt5streptomycin, Sul5sulfonamides compounds, Gen5gentamicin, Chl5chloramphenicol,
Cpd5cefpodoxime.
doi:10.1371/journal.pone.0113548.t001
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 9 / 19
generated five wildlife-originating K. pneumoniae with oqxA gene (not shown in
tables) and one multiresistant E. coli originating from the camp latrine (Table 4).
Cefoxitin-resistant isolates of Enterobacter asburiae or C. freundii were obtained
by cultivation of the chimpanzee, mouse and mangabey samples on MCAcefoxitin
and showed to harbour blaDHA, blaCMY, blaEBC and blaACT genes (
Table 4). Cultivability of E. coli from the wildlife-originating swabs was checked
by their growth on MCA without antibiotics; E. coli was successfully obtained
from all samples. Of the non-selectively cultivated isolates, two, originating from
chimpanzees (821 and 842 – North and East group individuals, respectively), have
shown resistance to multiple antibiotics (phenotypes AmpCefAmcSulSxt and
AmpSulSpt; not shown in tables). Within other isolates obtained on the nonselective
medium, five had decreased sensitivity to ampicillin, while the rest were
sensitive to all 12 antibiotics.
Discussion
Resistance found in the villages
Multiresistant E. coli with the CTX-M-15 beta-lactamase were detected in 32% of
people and 27% of dogs living in the investigated villages. Similar prevalence has
been recently recorded in other rural communities in Africa [38–41]. CTX-M
Table 2. Characteristics of plasmids obtained by transformation.
Isolate ID
Donor isolate
species
Locality of
donor isolate
Inc
group Size (kb)
Resistance genes
co-transferred
on the plasmid
H 115 cip E. coli Ponan NT 35 qnrS1
D 854 cip E. coli Taı¨ FIB 75 qnrS1, tet(A), sul2, strA, blaTEM-1
D 855 cip E. coli Paule´ola FIB 75 qnrS1, tet(A), sul2, strA, blaTEM-1
D 866 cip E. coli Daobly NT 33 qnrS1, sul3
D 867 cip E. cloacae Daobly R 75 qnrS1, sul2, strA
D 871 cip E. coli Taı¨ NT 40 qnrS1, strA, blaTEM-1
D 877 cip E. coli Paule´ola NT 35 qnrS1, tet(A)
D 879 cip E. coli Daobly NT 90 qnrS1, blaTEM-1
H 215 ctx E. coli Taı¨ NT 70 blaCTX-M-15, blaTEM-1, tet(A), sul2, strA
H 244 ctx E. coli Taı¨ NT 70 blaCTX-M-15, sul2, strA
H 268 ctx E. coli Daobly NT 70 blaCTX-M-15, sul2
H 332 ctx E. coli Daobly NT 70 blaCTX-M-15, blaTEM-1, tet(A), sul2, strA
H 344 ctx E. coli Goule´ako NT 65 blaCTX-M-15, tet(A)
D 859 ctx E. coli Paule´ola N 75 qnrS1, blaTEM-1, tet(A), sul2, strA
D 860 ctx E. coli Taı¨ NT 60 blaCTX-M-15, blaTEM-1, sul2, strA
D 872 ctx E. coli Taı¨ FIB 75 blaCTX-M-15, tet(A), sul2, strA
D 879 ctx E. coli Daobly FIB 90 blaCTX-M-15, blaTEM-1, tet(A), sul2, strA
‘‘NT’’–not typable. Note: transconjugants obtained in this study contained more than one plasmid and therefore were not used for plasmid characterization.
doi:10.1371/journal.pone.0113548.t002
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 10 / 19
Table 3. Characteristics of isolates with PMQR genes.
Locality Source, ID Species, PG Resistance genes Resistance phenotype
Daobly D 862 cip E. coli, A qnrS1, tet(A),
strA, blaTEM-1, sul2
AmpTetSxtSulSpt
D 863 cip E. coli, A qnrS1, tet(A),
blaTEM-1, sul2
AmpTetSxtSulSpt
D 864 cip E. coli, A qnrS1, tet(A),
strA
AmpTetSxtSulSpt
D 866 cip E. coli, A qnrS1(T),
blaTEM-1, sul3
AmpCefTetSxt
D 867 cip E. cloacae qnrS1 (T), tet(A),
strA, blaTEM-1, sul2
AmpCefAmcTetSxtSulSpt
D 878 cip E. coli, D qnrS1, tet(A),
strA, blaTEM-1, sul2
AmpCefAmcTetSxtSulSpt
D 879 cip E. coli, A qnrS1 (T), blaTEM-1 AmpSulSxt
D 883 cip E. coli, A qnrS1, tet(A),
strA, sul2
AmpTetSulSxtSpt
H 270 cip K. pneumoniae aac-(69)-Ib-cr, oqxB,
tet(A), aadA5
AmpCefTet
H 298 cip E. coli, D aac-(69)-Ib-cr,
tet(A), tet(B)
AmpNalCipGenTetSxtSul
H 285 cip E. coli, A qnrS1, tet(A) AmpTetSxtSul
H 295 cip E. coli, B1 qnrS1, tet(A) AmpTetSxtSulSpt
H 324 cip E. coli, A qnrB1, tet(A) SulSxtTet
H 336 cip E. coli, A qnrS1, tet(A),
intI1 (dfrA1-aadA1)
AmpTetSulSxt
Ponan H 103 cip E. coli, A qnrS1, oqxA, tet(A),
intI1 (dfrA1-aadA1),
aadA2
AmpTetSxtSul
H 109 cip E. coli, A qnrS1, sul1 AmpNalTetSxtSul
H 110 cip E. coli, A qnrS1, tet(A),
strA, intI2 (dfrA1-sat-aadA1),
sul2, aadA2
AmpCefTetSxtSul
H 111 cip E. coli, A aac-(69)-Ib-cr,
tet(A), strA, sul1, sul2
AmpNalCipTetSxtSul
H 112 cip E. coli, B2 qnrS1, oqxA AmpTetNal
H 115 cip E. coli, A qnrS1 (T, C), tet(A) AmpSulTet
H 120 cip E. coli, A qnrS1, tet(A) AmpSulTetChl
H 125 cip E. coli, A oqxAB, aac-(69)-Ib-cr,
tet(A), sul1
SxtSulTetNalCip
H 127 cip E. coli, D qnrB1, aac-(69)-Ib-cr,
intI1 (aadA1), aac(3)II, aadA2
AmpCefSulSxtChlGen
H 151 cip E. coli, A qnrS1, tet(A) AmpSulTetSxt
H 158 cip E. coli, A qnrS1, tet(A) AmpSulTetSxt
H 159 cip E. coli, A qnrB19, tet(A), strA, sul3 AmpSulTetSxt
H 167 cip E. coli, A qnrS1, oqxA, tet(A),
strA, intI2
(dfrA1-sat-aadA1), sul2
AmpTetSxtSulSptCfa
Taı¨ H 212 cip E. coli, A qnrS1, tet(A) AmpTetSxtSul
H 217 cip E. coli, A qnrS1, tet(A) AmpTetSxtSul
H 220 cip E coli, A qnrS1, tet(A),
strA, sul2, aadA2
AmpCipTetSxtSulSpt
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 11 / 19
actually represents a pandemic type of extended-spectrum beta-lactamase with
faecal carriage prevalence reaching up to 66% [42]. The particular success of the
allele blaCTX-M-15 in human population has not been satisfactorily clarified, but its
selection by use of ceftazidime and other third-generation cephalosporins is the
very likely initial step [43]. In Africa, the use of third-generation cefalosporins is
often warranted as a second-line alternative to treat multiresistant cholera,
pneumonia, typhoid fever and other serious but frequent infections [44]. CTX-M-
15 is known to occur on conjugative multiresistance-encoding plasmids, which
was the case also in our study. Such plasmids can facilitate the process of coselection
[45] so that the beta-lactamase can be spread even under selective
pressure of more common and cheaper antibiotics like sulfonamides, tetracyclines
or aminoglycosides. Frequent need of antimicrobial treatment, together with poor
sanitary conditions and warm climate, make ideal conditions for a widespread
ESBL colonisation of people and animals in rural communities [13]. Although
dogs are not directly subjected to the selective pressure exerted by antibiotic
therapy, they often scavenge for food and water in human refuse (including the
‘‘free defecation zones’’; [46]) and thus get easily colonized by human-originating
bacteria from the environment.
The PMQR isolates, obtained by cultivation on ciprofloxacin, were dominated
by qnrS1-harboring E. coli. This gene probably originates from Salmonella sp. and
Table 3. Cont.
Locality Source, ID Species, PG Resistance genes Resistance phenotype
H 224 cip E. coli, B1 qnrS1, tet(A), sul2 AmpTetSxtSulSpt
H 227 cip E. coli, A qnrS1, tet(A), strA, sul2 AmpTetSxtSul
H 228 cip E. coli, A qnrS1, tet(A) AmpTetSxtSulSpt
H 234 cip E. coli, A qnrS1, tet(A), sul2, aadA2 AmpTetSxtSulChlSpt
D 854 cip E. coli, B1 qnrS1 (T), tet(A), strA, blaTEM-1, sul2 AmpCefTetSxtSulSpt
D 871 cip E. coli, A qnrS1 (T), tet(A),
strA, blaTEM-1
AmpCefCipTetSulSxtSpt
D 872 cip E. coli, A qnrS1, tet(A), strA,
blaTEM-1, sul2
AmpNalCipTetSulSxtSpt
Goule´ako H 344 cip E. coli, A qnrS1, tet(A), strA,
sul2, aadA5
AmpTetSxtSul
H 346 cip E. coli, A aac-(69)-Ib-cr, tet(B),
strA, sul2
AmpNalCipGenTetSulSxtSpt
Paule´ola D 855 cip E. coli, B1 qnrS1 (T), tet(A),
strA, blaTEM-1, sul2
AmpCefTetSxtSulSpt
D 858 cip E. coli, B1 qepA, tet(B),
blaTEM-1, intI1 (dfr2d), sul1
AmpCefAmcNalCipTetSxtSul
D 859 cip E. coli, A qnrS1 (T), tet(A),
strA, blaTEM-1, sul2
AmpTetSxtSulSpt
D 869 cip C. freundii qnrB28 Amp
D 877 cip E. coli, D qnrS1 (T), tet(A), blaTEM-1 AmpNalTetSul
Isolates were obtained on MCA-ciprofloxacin.
For legend see table 1.
doi:10.1371/journal.pone.0113548.t003
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 12 / 19
Figure 1. Dendrogram of resistant E. coli isolates’ PFGE profiles. Generated by cluster analysis of the
Dice similarity indices in the BioNumerics fingerprinting software (optimization 1%, band matching tolerance
1%, tolerance change 1%). Isolates marked with ‘‘cip’’ were obtained by cultivation on ciprofloxacin and
harbored PMQR genes, isolates with ‘‘ctx’’ represent the CTX-M-15 producing E. coli. ‘‘H’’ isolate from human,
‘‘D’’ isolate from dog, ‘‘C’’ isolate from cat.
doi:10.1371/journal.pone.0113548.g001
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 13 / 19
its spread to other Enterobacteriaceae is associated with the increased use of
fluoroquinolones [12]. The genes qnrB or oqxAB represented a minority within
human-originating PMQR. Some of the PMQR isolates were sensitive to clinical
levels of fluoroquinolones, as shown by the disc-diffusion method. This is a
commonly observed phenomenon and does not decrease the epidemiological
significance of PMQR genes in a given ecosystem [11]. As shown by PFGE-based
dendrogram (Figure 1), the genes blaCTX-M-15 and qnrS1 were not spread across
the community by one or several clones, but were present in many different
clonally unrelated isolates. This fact highlights the epidemiological importance of
plasmid-mediated resistance genes, which can cause fast spreading of resistance in
a particular area. The PFGE analysis revealed another interesting phenomenon:
although dogs and people were sampled three months apart, isolates with identical
PFGE profile were revealed in dogs and people living in the same place or in
neighbouring villages (Figure 1). This finding corroborates the general
presumption that, once established in an ecosystem, resistant bacterial clones can
persist for a long time.
All four phylogroups have been detected among the ESBL and PMQR E. coli
isolates obtained from people and domestic carnivores. While closely related
Table 4. Isolates with PMQR or AmpC genes originating from TNP (wildlife and camps).
Territory
sample
origin
bacterial
species
resistance
genes
resistance
phenotype
North latrine, quarantine
camp 789 cip
E. coli oqxA AmpNalCipTetSxtSulChlSpt
house mouse 785 cip C. freundii qnrB28 sensitive
house mouse 786 fox E. asburiae blaEBC AmpCef
King colobus 794 cip C. freundii qnrB28, oqxA AmpAmc
Diana monkey 792 cip C. freundii qnrB9 sensitive
upper Guinea
red colobus 803 cip
C. freundii qnrB9 (C), oqxA Amc
soothy mangabey
796 fox
C. freundii blaEBC AmpCef
western chimpanzee
820 cip
C. freundii qnrB13, oqxA AmpAmc
western chimpanzee
833 cip
K. pneumoniae qnrB13 (C), oqxA AmcCip
western chimpanzee
809 fox
E. asburiae blaCMY AmpCef
western chimpanzee
809 cip
C. freundii qnrB13 AmpAmc
South western chimpanzee
826 fox
E. asburiae blaACT, blaDHA, blaCMY AmpCef
East western chimpanzee
846 cip
C. freundii qnrB28 sensitive
western chimpanzee
849 cip
C. freundii qnrB13 sensitive
Isolates with suffix ‘‘cip’’ were obtained on MCA-ciprofloxacin, isolates with suffix ‘‘fox’’ were obtained on MCA-cefoxitin.
doi:10.1371/journal.pone.0113548.t004
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 14 / 19
groups A and B1 are usually regarded as non-pathogenic, more virulence factors
are found in E.coli isolates of groups B2 and D [47]. Determination of
pathogenicity of the investigated samples would undoubtedly be interesting,
however it was not possible within the scope this study. The predominance of
phylogroup A is in accordance with findings of Carlos et al. [48], who concluded
that group A is more prevalent in omnivorous hosts, while group B1 is typical for
herbivorous hosts.
Resistance found in the forest
In TNP the overall prevalence of resistant bacteria in chimpanzees and monkeys
was very low and most of it actually could have been attributed to the naturally
evolving resistome, especially because the monkeys have never been treated with
antibiotics. The only E. coli isolates with resistance to more than two antibiotics
(however with no ESBL or PMQR genes) within the park were found in two
chimpanzees from northern and eastern group, however, none was found in the
southern group, that had been recently treated for the respiratory outbreak by
benzylpenicillin. Other isolates with resistance were Citrobacter or Enterobacter
isolates with AmpC or qnr genes. It should be pointed out that Enterobacters are
considered the natural reservoir of AmpC alleles, which are typically localized on
their chromosomes and make part of their intrinsic resistance [10]. As such, the
AmpC-harbouring Enterobacter isolated from wildlife animals can be considered a
part of their innate microflora. Likewise, Citrobacter sp. is supposed to play the
role of natural reservoir and ‘‘evolutionary cradle’’ of qnrB alleles [22]. These
genes occur on chromosomes (their original function is not known) from where
they are often mobilized by insertion sequences to plasmids and later can
disseminate to other bacterial species, including human pathogens [49]. The
qnrB–carrying plasmids are often conjugative, facilitating such spread [22].
No evidence of MDR-Enterobacteriace transmission from humans
to NHPs
The hygiene rules employed by TCP include changing of clothes, washing of
hands and boots at hygiene barriers before leaving the camps and entering the
forest, prohibition of any defecation in the forest (stool is carried back to camps)
and leaving any food or other remains in the forest. This study gave an
opportunity to test the efficiency of the rules in place. Despite the presence of
multiresistant E. coli with the CTX-M-15 beta-lactamase or/and qnrS1 plasmidmediated
quinolone resistance genes in the villages around TNP, no such isolate
was detected in NHPs living in the park. Considering the fact that all assistants
working in the forest are residents in the sampled villages and most of the food
supplies delivered to the research camps also originate in these villages, our
comparison indicates that the hygienic rules employed in TNP are efficient to
protect Taı¨ NHPs against acquisition of human-originating MDREnterobacteriaceae.
Absence of evidence however, is not evidence of absence and
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 15 / 19
more longitudinal data are necessary to test this case further. It is also worth
considering that the microbiota might be host-adapted, so exposure might occur
without following colonization. Similar studies were conducted in primates living
in Lope´ National Park, Gabon [14] and Bwindi Impenetrable National Park,
Uganda [16]. Direct transmission of resistant bacteria from human to great apes
has not been demonstrated in either case. However, none of these studies
investigated the resistance carrying plasmids and therefore they might disregard
the aspect of horizontal gene flow between microbial populations.
Possible transfer of bacteria from wildlife to people
We found qnrB28-harboring Citrobacter freundii in a chimpanzee, a King colobus,
a research camp-dwelling house mouse and also in a dog living in Paule´ola, a
village very close to the entry to the park. A consumption chain might exist among
these animals, because dogs are often used for hunting and are in contact with
remnants of meat and organs of wildlife through bushmeat hunting. Handling
and consumption of bushmeat represents a risk of transmission of wildlifeoriginating
bacteria (including isolates with naturally evolving resistance genes)
also to people, similarly to what was shown before for various retroviruses [50–
51].
Conclusion and Study Limitations
In conclusion, we found no significant overlap between the resistant
Enterobacteriaceae in people and animals living around the park and wildlife
dwelling in the park. While multiresistant E. coli with ESBL genes carried on
conjugative plasmids were detected among people and dogs, no such bacteria were
found in wildlife within the park. PMQR genes found outside the park were
different from those detected in TNP-dwelling wildlife, the only exception
represented by qnrB28 in Citrobacter freundii. This study was limited in time and
size of the sample set; further sampling and investigation of other resistance genes
groups would be necessary to determine the extent of overlap between the
commensal microbiota of people and wildlife in the area.
Acknowledgments
We thank the Ivorian authorities, especially the Ministry of the Environment and
Forests as well as the Ministry of Research, the directorship of the Taı¨ National
Park, Office Ivoirien des Parcs et Re´serves (OIPR) and the Swiss Research Center
in Abidjan. We are indebted to all laboratory and field assistants in CI (Roger,
Louis, Charlie, Gnimeon and others) as well as in the Czech Republic (Eva, Marie
and others) for their excellent cooperation.
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 16 / 19
Author Contributions
Conceived and designed the experiments: KA IP HDN MD MM JK AC FHL IL.
Performed the experiments: KA HDN MP EA AM MM SM FHL. Analyzed the
data: KA IP MD MM FHL IL. Contributed to the writing of the manuscript: KA
IP HDN MP MD MM CHAK RMW JK AC FHL IL. Obtained permissions for
sampling: ECH RMW.
References
1. Gala´n JC, Gonza´les-Candelas F, Rolain JM, Canton R (2013) Antibiotics as selectors and
accelerators of diversity in the mechanisms of resistance: from the resistome to genetic plasticity in
the beta-lactamases world. Front Microbiol 4: 9.
2. Baquero F (2012) Metagenomic epidemiology: a public health need for the control of antimicrobial
resistance. Clin Microbiol Infect 18: 67–73.
3. Davies J, Davies D (2010) Origins and evolution of antibiotic resistance. Microbiol Mol Biol Rev 74: 417–
430.
4. Novais A, Comas I, Baquero F, Canto´n R, Coque TM, et al. (2010) Evolutionary trajectories of betalactamase
CTX-M-1 cluster enzymes: predicting antibiotic resistance. PloS Pathog 6(1): e1000735.
5. Aarestrup F (Ed) (2008) Antimicrobial resistance in bacteria of animal origin. ASM Press, Washington
DC, USA. 443 pp.
6. Bradford P (2001) Extended-spectrum beta-lactamases in the 21st century: Characterization,
epidemiology, and detection of this important resistance threat. Clini Microbiol Rev 14: 933–951.
7. Kliebe C, Nies BA, Meyer JJF, Tolxdorff-Neutzling RM, Wiedemann B (1985) Evolution of plasmidcoded
resistance to broad-spectrum cephalosporins. Antimicrob Agents Chemother 28: 302–307.
8. Bush K (2010) Bench-to-bedside review: The role of beta-lactamases in antibiotic-resistant Gramnegative
infections. Crit Care 14: 224.
9. Canto´n R, Gonza´les-Alba JM, Gala´n JC (2012) CTX-M-enzymes: origin and diffusion. Front Microbiol
3: 110.
10. Jacoby GA (2009) AmpC beta-lactamases. Clin Microbiol Rev 22: 161–182.
11. Strahilewitz J, Jacoby GA, Hooper DC, Robicsek A (2009) Plasmid-mediated quinolone resistance: a
multifaceted threat. Clin Microbiol Rev 22: 664–689.
12. Hernandez A, Sanchez MB, Martinez JL (2011) Quinolone resistance: much more than predicted.
Front Microbiol 2: 22.
13. Okeke IN, Laxminarayan R, Bhutta ZA, Duse AG, Jenkins P, et al. (2005) Antimicobial resistance in
developing countries. Part I: recent trends and current status. Lancet Infect Dis. 5: 481–493.
14. Benavides JA, Godreuil S, Bodenham R, Ratiarison S, Devos C, et al. (2012) No evidence for
transmission of antibiotic-resistant Escherichia coli strains from humans to wild western lowland gorillas
in Lope´ National Park, Gabon. Appl Environ Microbiol 78: 4281–7.
15. Pesapane R, Ponder M, Alexander KA (2013) Tracking pathogen transmission at the human-wildlife
interface: banded mongoose and Escherichia coli. Ecohealth 10: 115–28.
16. Rwego IB, Isabirye-Basuta G, Gillespie TR, Goldberg TL (2008) Gastrointestinal bacterial
transmission among humans, mountain gorillas, and livestock in Bwindi Impenetrable National Park,
Uganda. Conserv Biol 22: 1600–1607.
17. Ko¨ndgen S, Ku¨hl H, N’Goran PK, Walsh PD, Schenk S, et al. (2008) Pandemic human viruses cause
decline of endangered great apes. Current Biol 18: 260–264.
18. Ko¨ndgen S, Schenk S, Pauli G, Boesch C, Leendertz FH (2010) Noninvasive monitoring of respiratory
viruses in wild chimpanzees. Ecohealth 7: 332–41.
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 17 / 19
19. Allen HK, Donato J, Wang HH, Cloud-Hansen KA, Davies J, et al. (2010) Call of the wild: antibiotic
resistance genes in natural environments. Nat Rev Microbiol 8: 251–259.
20. Guenther S, Ewers C, Wieler LH (2011) Extended-spectrum beta-lactamases producing E. coli in
wildlife, yet another form of environmental pollution? Front Microbiol 2: 246.
21. Perez F, Rudin SD, Marshall SH, Coakley P, Chen L, et al. (2013) OqxAB, a quinolone and olaquindox
efflux pump, is widely distributed among multidrug-resistant Klebsiella pneumoniae isolates of human
origin. Antimicrob Agents Chemother 57: 4602–4603.
22. Jacoby GA, Griffin CM, Hooper DC (2011) Citrobacter spp. as a source of qnrB alleles. Antimicrob
Agents Chemother 55: 4979.
23. Boesch C, Boesch-Achermann H (2000) The Chimpanzees of the Taı¨ Forest: Behavioural Ecology and
Evolution, Oxford/New York: Oxford University Press.
24. Leendertz FH, Lankester F, Guislain P, Ne´el C, Drori O, et al. (2006). Anthrax in Western and Central
African great apes. Am j Primatol 68(9): 928–33.
25. Great Ape Health Monitoring Unit (GAHMU) website, Max-Planck Institute for Evolutionary Anthropology.
Available: http://www.eva.mpg.de/primat/GAHMU/pdf/hygienic_and_health_rules_tai_national_park.pdf.
Accessed 2014 November 11.
26. CLSI (2008) Performance standards for antimicrobial susceptibility testing. Clinical and Laboratory
Standards Institute, Wayne, PA.
27. Literak I, Dolejska M, Radimersky T, Klimes J, Friedman M, et al. (2010) Antimicrobial resistant faecal
Escherichia coli in wild mammals in central Europe: multiresistant Escherichia coli producing extendedspectrum
beta-lactamases in wildboars. J Appl Microbiol 108: 1702–1711.
28. Ma L, Ishii Y, Ishiguro M, Matsuzawa H, Yamaguchi K (1998) Cloning and sequencing of the gene
encoding Toho-2, a class A beta-lactamase preferentially inhibited by tazobactam. Antimicrob Agents
Chemother. 42: 1181–6.
29. Pe´rez-Pe´rez FJ, Hanson ND (2002) Detection of plasmid-mediated AmpC beta-lactamase genes in
clinical isolates by using multiplex PCR. J Clin Microbiol 40: 2153–2162.
30. Literak I, Micudova M, Tausova D, Cizek A, Dolejska M, et al. (2012) Plasmid-mediated quinolone
resistance genes in faecal bacteria from rooks commonly wintering throughout Europe. Microb Drug
Resist 18: 567–573.
31. Clermont O, Bonacorsi S, Bingen E (2000) Rapid and simple determination of the Escherichia coli
phylogenetic group. Appl Environ Microbiol 66: 4555–58.
32. Centers for Disease Control (2004) Standardized molecular subtyping of foodborne bacterial pathogens
by pulse-field gel electrophoresis. CDC, Atlanta, GA: National Molecular Network for Foodborne Disease
Surveillance.
33. Olesen I, Hasman H, Aarestrup FM (2004) Prevalence of beta-lactamases among ampicillin-resistant
Escherichia coli and Salmonella isolated from food animals in Denmark. Microb. Drug Resist. 10: 334–
340.
34. Birnboim HC, Doly J (1979) A rapid alkaline extraction procedure for screening recombinant plasmid
DNA. Nucleic Acids Res 7: 1513–1523.
35. Barton BM, Harding GP, Zuccarelli AJ (1995) A general method for detecting and sizing large
plasmids. Anal Biochem 226: 235–240.
36. Caratolli A, Bertini A, Villa L, Falbo V, Hopkins KL, et al. (2005) Identification of plasmids by PCRbased
replicon typing. J Mirobiol Methods 63: 219–228.
37. Johnson TJ, Bielak EM, Fortini D, Hansen LH, Hasman H, et al. (2012) Expansion of the Inc X
plasmid family for improved identification and typing of novel plasmids in drug-resisstant
Enterobacteriaceae. Plasmid 68: 43–50.
38. Albrechtova K, Dolejska M, Cizek A, Tausova D, Klimes J, et al. (2012) Dogs of nomadic pastoralists
in northern Kenya are reservoirs of plasmid-mediated cephalosporin- and quinolone-resistant
Escherichia coli, including pandemic clone B2-O25-ST131. Antimicrob Agents Chemother. 56: 4013–7.
39. Kiiru J, Kariuki S, Goddeeris BM, Butaye P (2012) Analysis of beta-lactamase phenotypes and
carriage of selected beta-lactamase genes among Escherichia coli strains obtained from Kenyan
patients during an 18-year period. BMC Microbiol 12: 155.
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 18 / 19
40. Isendahl J, Turlej-Rogacka A, Manjuba C, Rodrigues A, Giske CG, et al. (2012). Faecal Carriage of
ESBL-producing E. coli and K. Pneumoniae in children in Guinea-Bissau: a hospital-based corsssectional
study. PlosOne 7: 5e1981.
41. Lonchel CM, Meex C, Gengoue´-Pie´boji J, Boreux R, Okomo Assoumou MC, et al. (2012) Proportion
of extended-spectrum beta-lactamase producing Enterobacteriaceae in community setting in
Ngaoundere, Cameroon. BMC Infect Dis 12: 53.
42. Luvsansharav UO, Hirai I, Nakata A, Imura K, Yamauchi K, et al. (2012) Prevalence and risk factors
associated with faecal carriage of CTX-M beta-lactamase-producing Enterobacteriaceae in rural Thai
communities. J Antimicrob Chemother 67: 1769–1774.
43. Poirel L, Gniadkowski M, Nordmann P (2002) Biochemical analysis of ceftazidime-hydrolyzing
extended-spectrum beta-lactamase CTX-M-15 and of its structurally related beta-lactamase CTX-M-3.
J Antimicrob Chemother 50: 1031–1034.
44. Kariuki S (Ed) (2011) Situation Analysis: Antibiotic use and resistance in Kenya. The GARP-Kenya
National Working Group, Kenya Medical Research Institute, Nairobi, Kenya, 84 pp.
45. Canto´n R, Ruiz-Garbajosa P (2011) Co-resistance: an opportunity for the bacteria and resistance
genes. Curr Opin Pharmacol 11: 477–485.
46. Macpherson CNL, Meslin FX, Wandeler AI (2000) Dogs, Zoonoses and Public Health. Wallingford, UK:
CABI Publishing.
47. Li B, Sun JY, Han LZ, Huang XH, Fu Q, et al. (2010) Phylogenetic groups and pathogenicity island
markers in fedal Escherichia coli isolates from asymptomatic humans in China. Appl Environ Microbiol
76: 6680–700.
48. Carlos C, Pires MM, Stoppe NC, Hachich EM, Sato MI, et al. (2010). Escherichia coli phylogenetic
group determination and its application in the identification fo the major animal source of fecal
contamination. BMC Microbiol 10: 161.
49. Jacoby GA, Walsh KE, Mills DM, Walker VJ, Oh H, et al. (2006) qnrB, another plasmid-mediated gene
for quinolone resistance. Antimicrobial Agents Chemother 50: 1178–82.
50. Calvignac-Spencer S, Leendertz SA, Gillespie TR, Leendertz FH (2012) Wild great apes as sentinels
and sources of infectious disease. Clin microbial Infect 18: 521–527.
51. Ayouba A, Akoua-Koffi C, Calvignac-Spencer S, Esteban A, Locatelli S, et al. (2013) Evidence for
continuing cross-species transmission of SIVsmm to humans: characterization of a new HIV-2 lineage in
rural Coˆte d’Ivoire. AIDS 27: 2488–91.
Antimicrobial Resistance Genes in Wildlife in Tropical Rainforest
PLOS ONE | DOI:10.1371/journal.pone.0113548 December 4, 2014 19 / 19
Příloha 23
JANATOVA, M., ALBRECHTOVA, K., PETRZELKOVA, K. J., DOLEJSKA, M., PAPOUSEK, I.,
MASARIKOVA, M., CIZEK, A., TODD, A., SHUTT, K., KALOUSOVA, B., PROFOUSOVA, I., MODRY, D.,
LITERAK, I., 2014, Antimicrobial-resistant Enterobacteriaceae from humans and wildlife in
Dzanga-Sangha Protected Area, Central African Republic: Veterinary Microbiology, v. 171, p.
422-431.
Souhrn
Cílem této studie bylo zjistit výskyt rezistentních bakterií v chráněných územích na africkém kontinentu.
V oblasti Dzangha-Sangha ve Středoafrické republice byly u lidí a různých druhů volně žijících zvířat včetně
habituovaných a nehabituovaných goril izolovány enterobakterie s rezistencí k antibiotikům. V 10-31 % vzorků
rektálních výtěrů z lidí byly zjištěny bakterie produkující ESBL nebo nesoucí plazmidově kódovanou rezistenci
k fluorochinolonům. U volně žijících zvířat byly bakterie s těmito klinicky významnými mechanizmy rezistence
prokázány pouze ojediněle.
Author's personal copy
Antimicrobial-resistant Enterobacteriaceae from humans
and wildlife in Dzanga-Sangha Protected Area,
Central African Republic
Martina Janatova a,b,1
, Katerina Albrechtova a,1,
*, Klara Judita Petrzelkova c,d,e,f
,
Monika Dolejska a,g
, Ivo Papousek a,g
, Martina Masarikova b,g
, Alois Cizek b,g
,
Anguelique Todd h
, Kathryn Shutt i
, Bara Kalousova f
,
Ilona Profousova-Psenkova f
, David Modry e,f,g
, Ivan Literak a,g
a
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical
Sciences Brno, Palackeho 1-3, 61242 Brno, Czech Republic
b
Institute of Infectious Diseases and Microbiology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences
Brno, Palackeho 1-3, 61242 Brno, Czech Republic
c
Institute of Vertebrate Biology, Academy of Sciences of the Czech Republic, v.v.i., Kvetna 8, 60365 Brno, Czech Republic
d
Liberec Zoo, Masarykova 1347/31, 46001 Liberec, Czech Republic
e
Institute of Parasitology, Biology Centre of the Academy of Sciences of the Czech Republic, v.v.i., Branisovska 31, 37005 Ceske Budejovice,
Czech Republic
f
Department of Pathology and Parasitology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences,
Palackeho 1-3, 61242 Brno, Czech Republic
g
CEITEC VFU, University of Veterinary and Pharmaceutical Sciences Brno, Palackeho 1-3, 61242 Brno, Czech Republic
h
WWF, Dzanga Sangha Protected Areas, Bangui, Central African Republic
i
Department of Anthropology, Durham University, Dawson Building, South Road, Durham, DH1 3LE, United Kingdom
Veterinary Microbiology 171 (2014) 422–431
A R T I C L E I N F O
Keywords:
ESBL
PMQR
Enterobacteriaceae
Resistance
Gorilla
Africa
A B S T R A C T
Antimicrobial resistance is a worldwide concern of public health. Unfortunately, resistant
bacteria are spreading to all ecosystems, including the strictly protected ones. We
investigated antimicrobial resistance in gastrointestinal Enterobacteriaceae of wild
mammals and people living within Dzangha-Sangha Protected Areas, Central African
Republic, with an emphasis on extended-spectrum b-lactamase (ESBL) and plasmidmediated
quinolone resistance (PMQR) genes. We compare resistance genes found in
microbiota of humans, gorillas habituated and unhabituated to humans and other wildlife.
In gorillas, we additionally investigate the presence of ESBL resistant isolates after
treatment by ceftiofur. We found a considerable prevalence of multiresistant Enterobacteriaceae
isolates with ESBL and PMQR genes in humans (10% and 31%, respectively).
Among wildlife the most significant findings were CTX-M-15-producing Klebsiella
pneumoniae in a habituated gorilla and a multiresistant Escherichia coli isolate with
gene qepA in an unhabituated gorilla. Other isolates from wildlife were mostly represented
by qnrB-harboring Citrobacter spp. The relatedness of resistant E. coli was investigated in a
Abbreviations: CLSI, Clinical and Laboratory Standards Institute; DDST, double-disc synergy test; DSPA, Dzangha-Sangha Protected Area; ABS-P > ESBL,
extended-spectrum b-lactamase; ABS-P > MCA, MacConkey agar; MLST, multi-locus sequence typing; MIC, minimal inhibitory concentration; PHP,
Primate Habituation Program; PMQR, plasmid-mediated quinolone resistance; ST, sequence type.
* Corresponding author. Tel.: +420 776890848.
E-mail address: albrechtovakaterina@gmail.com (K. Albrechtova).
1
First authorship shared.
Contents lists available at ScienceDirect
Veterinary Microbiology
journal homepage: www.elsevier.com/locate/vetmic
http://dx.doi.org/10.1016/j.vetmic.2014.02.014
0378-1135/ß 2014 Elsevier B.V. All rights reserved.
Author's personal copy
1. Introduction
Occurrence of multiresistant bacteria is no longer
constrained to sites where antimicrobials are handled on
a daily basis, such as hospitals, livestock breeding or
pharmaceutical industries. With an increasing frequency,
resistant microbiota is found colonizing wildlife or people
living in remote areas (Benavides et al., 2012; Pallecchi
et al., 2012). Antimicrobial resistance is of particular
concern on the African continent, where occurrence of
bacterial infections is relatively high. Warm and humid
climate in the continent makes favorable conditions for the
persistence of environmental bacterial contamination and
many countries lack regulations on antimicrobial prescription
and use (Okeke et al., 2005).
Extended-spectrum b-lactamase (ESBL), plasmidmediated
AmpC b-lactamase (AmpC) and plasmidmediated
quinolone (PMQR) resistance genes rank among
the most important and widespread mechanisms of
antimicrobial resistance in Enterobacteriaceae in recent
years, rendering resistance to the vast majority of
cephalosporins and fluoroquinolones, respectively (Livermore,
2012). ESBL-, AmpC- and PMQR-encoding genes are
found on various types of plasmids, often together in
combinations and surrounded by genes of resistance to
other groups of antimicrobials such as tetracyclines,
aminoglycosides, and sulphonamides. Such plasmids are
often conjugative to other bacteria and can therefore
spread across different bacterial species, from commensals
to pathogens and vice versa (Livermore, 2012).
Human-originating resistant microbiota can be introduced
to natural ecosystems not only by people who visit
them, but also indirectly by water or wild birds (Guenther
et al., 2011). Several studies have documented the
occurrence of resistant or multiresistant bacteria in
wildlife kept in zoos or sanctuaries (Schaumburg et al.,
2012; Dobiasova et al., 2013), but less is known about
animals living in nature reserves and protected areas
(Benavides et al., 2012; Rwego et al., 2008). Antimicrobialresistant
microbiota in wildlife in protected areas represents
an intriguing topic for eco-epidemiology for at least
three reasons. Firstly, certain resistant bacteria can serve as
indicators of human-originating bacterial contamination
of the environment and bacterial transmission from
humans to wildlife and vice versa (Rwego et al., 2008;
Benavides et al., 2012). Secondly, the knowledge of local
and host-specific resistance patterns can enhance our
preparedness for a population-saving veterinary intervention
in case of epidemics. And lastly, wild animals could
represent a reservoir of naturally evolving resistance
genes, carried by bacteria which are transferable to
humans.
In this study we investigate antimicrobial-resistant
Enterobacteriaceae found in wild mammals and people
inhabiting Dzanga-Sangha Protected Areas (DSPA) in
Central African Republic. Special emphasis is given to
the population of western lowland gorillas (Gorilla gorilla
gorilla), which are a focus of conservation efforts in this
area. We studied several groups of gorillas at different
levels of habituation including a fully habituated group
which is in daily contact with humans. Our aim was to
compare the genetic background of resistant Enterobacteriaceae
bacteria found in people living in DSPA, gorillas in
different levels of habituation to people and other wild
mammals. Additionally, we tested isolates obtained from
gorillas 5 months after treatment by ceftiofur, to check for
presence of ESBL.
2. Materials and methods
2.1. Study area and animals
DSPA incorporates the strictly protected Dzanga Ndoki
National Park (1222 km2
) and the Dzanga Sangha Dense
Forest Special Reserve (3159 km2
). The access of people to
the National Park (NP) is limited; there are no permanent
inhabitants, however there is continuous presence of
researchers and their assistants, local gorilla trackers and
ecoguards, especially in the surroundings of research
camps (Fig. 1). Tourists can visit the NP, but they do not
stay overnight. The Special Reserve is a multiple-use zone
with permanent residents. Human activities such as
fishing, gathering, hunting and logging are controlled in
the Special Reserve. DSPA was created in 1990; the area
was selectively logged (including the areas of NP) in 1970s
and 1980s.
High densities of western lowland gorillas have been
reported in DSPA while densities of central chimpanzees
(Pan troglodytes troglodytes) in this area are low (Blom
et al., 2001). A program of habituation of gorillas to
humans has been launched in the area in 1997 and
currently there are animals at three different levels of
habituation; habituated, unhabituated and animals under
habituation. While habituated animals are followed on a
daily basis, animals under habituation are approached only
several times per month and unhabituated individuals are
encountered only accidentally (Sak et al., 2013).
2.2. Sampling
We sampled animals in Dzanga Sector of the Dzanga
Ndoki NP nearby the permanent research camps Bai Hokou
and Mongambe (Fig. 1) between June 2011 and September
2011. We obtained faecal samples from 63 western
PFGE-based dendrogram; isolates from gorillas showed less than 80% similarity to each
other and less than 80% similarity to human isolates. No ESBL-producing isolates were
found in animals treated by ceftiofur. Although we did not detect any bacterial clone
common to wildlife and humans, we detected an intersection in the spectrum of resistance
genes found in humans and gorillas, represented by blaCTX-M-15 and qepA.
ß 2014 Elsevier B.V. All rights reserved.
M. Janatova et al. / Veterinary Microbiology 171 (2014) 422–431 423
Author's personal copy
lowland gorillas with different levels of human contact,
namely from two fully habituated gorilla groups Makumba
and Mayele (24 samples in total), two groups under
habituation (n = 12 individuals) and several unhabituated
groups (n = 22 individuals). Members of Makumba group
can be individually recognized, so individual samples were
taken during follows. The remaining gorilla samples were
collected from night nests (one sample per nest, representing
one individual). Samples from other animals were
collected from faeces accidentally encountered in the
forest during following gorilla groups and species identification
was based on typical dung morphology, consulting
experienced trackers. We also collected fecal samples from
nine habituated agile mangabeys (Cercocebus agilis), seven
unhabituated central chimpanzees, four African buffalos
(Syncerus caffer), four forest elephants (Loxodonta cyclotis),
two red river hogs (Potamochoerus porcus), two Peter’s
duikers (Cephalophus callypigus), two lowland bongos
(Tragelaphus eurycerus eurycerus), two sitatunga (Tragelaphus
spekeii), and two blue duikers (Philantomba monticola).
Swabs were made from the central part of fresh
faeces to avoid potential effects of contamination from the
environment. The swab was immediately stored in Amies
medium (Oxoid, UK).
An additional collection of gorilla samples was made 1
year later to check for ESBL and other resistance
determinants in members of habituated Makumba group,
who received antibiotic treatment. In March 2012, there
was an aggressive outbreak of respiratory disease in eight
out of nine members of the Makumba group. All
symptomatic individuals (excepting one infant) were
treated by a single shot of long-acting ceftiofur formulation
(Excede(R), Pfizer Inc., NY, approx. 7 mg/kg injected
intramuscularly). In August 2012 individuals of Makumba
group were re-sampled (two samples per animal, 2–7 days
apart).
Fig. 1. Map of study site in Dzanga-Sangha Protected Areas, Central African Republic. Dark grey – Dzanga and Ndoki Sectors of the protected Dzanga Ndoki
National Park; light grey – Dzanga Sangha Dense Forest Special Reserve; 1 – location of villages Bayanga, Mossapoula and Yandumbe´; M – research camp
Mongambe; B – research camp Bai Hokou.
M. Janatova et al. / Veterinary Microbiology 171 (2014) 422–431424
Author's personal copy
Human samples were obtained during regular health
checks from local inhabitants; the PHP employees who
follow the gorillas (trackers and assistants, n = 16) and
their family members residing in the Special Reserve
villages Bayanga, Yandoumbe´ and Mossapoula (n = 14;
Fig. 1). Two European researchers working with the
gorillas also provided samples. Faecal samples were taken
individually with cotton swabs and put into Eppendorf
tubes with Amies transport medium (Oxoid, UK) and were
transported to the laboratory at the University of
Veterinary and Pharmaceutical Sciences Brno, Czech
Republic for analysis.
All sample collection was conducted according to the
Convention on Human Rights and Biomedicine of the
Council of Europe and Directive 86/609/EEC on the
Protection of Animals Used for Experimental and Other
Scientific Purposes. Prior permission to examine stool
samples was obtained from all examined persons. The
study was approved by local authorities and the Ethical
Committee of Durham University, UK (K.S.); importation of
the samples to the EU was approved by the State
Veterinary Authority of the Czech Republic.
2.3. Microbiological techniques and molecular typing of
isolates and resistance genes
To select for lactose-fermenting gram-negative bacteria
(i.e. Enterobacteriaceae) each swab was plated in parallel
on plain MacConkey agar (MCA) (Oxoid, UK), MCA with
cefotaxime (2 mg/l) and MCA with ciprofloxacin (0.05 mg/
l). ESBL genes were expected in colonies cultivated on MCA
with cefotaxime and PMQR genes were expected in
isolates obtained on MCA with low concentration of
ciprofloxacin. One randomly selected lactose-fermenting
colony was isolated from each plate, so that up to three
colonies were obtained from each sample (those originating
from MCA without antibiotics are assigned with ‘‘n’’,
from MCA with ciprofloxacin are assigned ‘‘cip’’ and from
MCA with cefotaxime are assigned with ‘‘ctx’’). Within the
selected isolates, all originating from MCA with cefotaxime
were tested by the double-disc synergy test (DDST) for
production of ESBL (CLSI, 2008) and if positive, they were
tested by PCR for ESBL-encoding genes (blaTEM, blaCTX-M,
blaSHV, blaOXA) as described previously (Literak et al., 2010;
Dobiasova et al., 2013). In isolates grown on MCA with
cefotaxime but negative in the DDST, plasmid-mediated
genes for AmpC b-lactamases were looked for by multiplex
PCR as described elsewhere (Pe´rez-Pe´rez and Hanson,
2002). PMQR genes (aac(60
)-Ib-cr, qepA, qnrA, qnrB, qnrC,
qnrD, qnrS and oqxAB) were searched for by PCR (Literak
et al., 2012) in isolates obtained on MCA with ciprofloxacin.
PMQR and ESBL genes were sequenced to specify the type
of allele. Where qnrB alleles were detected, forward primer
psp2 was used in combination with reverse primers sc3,
ds2 and ds3 as described by Jacoby et al. (2011), to explore
their genetic environment. Insertion sequences flanking
the qnrB and oqxA genes, specifically ISCR1, ISEcp1 and IS26,
were searched for by PCR as described previously (Jacoby
et al., 2011; Norman et al., 2008; Zhao et al., 2010).
One isolate per sample grown on MCA without
antibiotic and all isolates positive for ESBL, AmpC or
PMQR genes were tested by disc-diffusion method (CLSI,
2008) for susceptibility to ampicillin (10 mg), cephalotin
(30 mg), amoxicillin-clavulanic acid (20 + 10 mg), ceftazidime
(30 mg), trimethoprim-sulfamethoxazole
(1.25 + 23.75 mg), sulphonamides compounds (300 mg),
gentamicin (10 mg), nalidixic acid (30 mg), ciprofloxacin
(5 mg), streptomycin (30 mg), tetracycline (30 mg) and
chloramphenicol (30 mg). According to their resistance
phenotypes, isolates were tested for additional antimicrobial-resistance
genes and integrons (Literak et al., 2010;
Machado et al., 2005). Isolates with PMQR genes were
tested for minimal inhibitory concentration of nalidixic
acid and ciprofloxacin by agar-dilution method (CLSI,
2008). All isolates with resistance were identified to
species level by Matrix-assisted laser desorption/ionization
(MALDI; Microflex LT, Bruker Daltonics, Brehmen,
Germany). Escherichia coli isolates were tested for their
phylogroup by multiplex PCR and sequence type by multilocus
sequence typing (MLST) (Wirth et al., 2006). The
sequence types of Klebsiella pneumoniae were examined by
MLST (Diancourt et al., 2005). All the ESBL-, AmpC- or
PMQR- positive isolates were typed by XbaI pulsed-field
gel electrophoresis (PFGE) (CDC, 2004). The profiles
obtained were analyzed using the unweighted pair group
method with arithmetic mean (UPGMA) in Bionumerics
6.6 software (Applied Maths, Sint-Martens-Latem, Belgium).
Cluster analysis of the Dice similarity indices was
conducted to generate a dendrogram describing the
relationships among PFGE profiles. The profiles were
considered related when having more than 85% similarity
(Goering et al., 2010).
2.4. Transferability of resistance genes and plasmid
characterization
Conjugation transfer of ESBL and PMQR genes was
carried out using plasmid-free, rifampin- and azid-resistant
E. coli MT102RN and Salmonella Typhimurium SL5325
(Olesen et al., 2004). Plasmid DNA was extracted by rapid
alkaline method (Birnboim and Doly, 1979) and introduced
into competent E. coli DH5a (Invitrogen, USA) by chemical
transformation. Transformants were selected on LuriaBertani
agar (LB; Difco, USA) supplemented with 2 mg/l
cefotaxime or LB with 0.05 mg/l ciprofloxacin, according to
the genes of donor. Isolates in which conjugation or
chemical transformation was not successful were tested
by electrotransformation, using the ECM 399 electro cell
manipulator according to the manufacturer’s instructions
(BTX Harvard Apparatus, Holliston, MA). Presence of
resistance genes in transformants/tranconjugants was
tested by PCR as stated above. Transformants and transconjugants
were tested for the number of plasmids acquired
and their size using S1-PFGE (Barton et al., 1995).
3. Results
3.1. Antimicrobial resistance and plasmid-mediated
resistance genes in Enterobacteriaceae in humans and wildlife
By isolation on MCA without antibiotics a total of 121
lactose-fermenting colonies were obtained. Resistance to
M. Janatova et al. / Veterinary Microbiology 171 (2014) 422–431 425
Author's personal copy
2–8 antimicrobials and the presence of relevant plasmidmediated
antimicrobial-resistance genes and integrons
were found in 16 isolates (n = 9 humans, n = 6 gorillas and
n = 1 forest elephant). Selective isolation on media with
ciprofloxacin resulted in 33 isolates with decreased
susceptibility to fluoroquinolones (n = 19 humans, n = 7
gorillas and n = 7 other wildlife); of these, 20 harbored
PMQR genes. A wide spectrum of PMQR genes (qnrS, qnrB,
qepA, oqxA, oqxB, aac(60
)-Ib-cr) was found in 13 humans
and seven wild mammals (Table 2). The genes qnrS1 and
oqx (oqxA or oqxB) were predominant and identified in six
isolates of E. coli, K. pneumoniae and Enterobacter kobei.
Different variants of qnrB gene were identified mainly in
Citrobacter spp. All isolates harboring gene qnrB were
tested negative in PCR for insertion sequences ISCR1 and
ISEcp1. Isolates possessing oqxA were tested negative for
ISEcp1. IS26 was found in only one isolate (36-cip), but
subsequent PCR with IS2650
forward primer and oqxAreverse
primer was negative.
Five ESBL-producing isolates were obtained on plates
with cefotaxime (n = 2 in wildlife, n = 2 in people; Table 1).
Four ESBL-producing isolates, identified as E. coli or K.
pneumoniae, harbored blaCTX-M-15 along with other blactam
resistance genes (blaOXA-1, blaTEM-1, blaSHV-2a,
blaSHV-62; Table 2). One isolate of Kluyvera ascorbata was
found to harbor a CTX-M-2 variant of ESBL (blaKLUA) gene.
No plasmid-mediated gene of AmpC type was detected in
any of the resistant isolates.
3.2. Comparison of plasmid-mediated resistance genes in
people and wildlife and in gorillas under different level of
habituation
Plasmid-mediated ESBL gene blaCTX-M-15 was detected
in E. coli originating from humans (villager and researcher)
and K. pneumoniae originating from one tracker and a
gorilla under habituation (Table 2). Plasmid-mediated
gene qnrS1 was detected in E. coli originating from six
trackers, but none was detected in wildlife. Different
variants of genes qnrB were detected in E. coli from one
villager (qnrB1), in Citrobacter freundii from a habituated
gorilla (qnrB33) and in C. freundii from a sitatunga (qnrB17).
Another isolate of C. freundii, originating from a mangabey,
was found to have gene qnrB28, but location of the gene on
plasmid could not be stated since the transformation and
conjugation experiments with these isolates were not
successful. The gene qepA was detected in E. coli from a
nonhabituated gorilla and in two E. coli isolates from two
villagers. While the PFGE profiles of the qepA-harboring
isolates from villagers were identical, the profile of the
qepA-harboring E. coli isolate originating from gorilla was
unrelated to them (less than 80% similarity). Genes blaTEM1,
tet(A), tet(B), sul1, sul2, strA, catA1 and integrons with
variable gene contents were found in Enterobacteriaceae
originating from people, habituated, non-habituated and
under-habituation gorillas as well as in isolates from other
wildlife (Table 2). CTX-M-15-producing K. pneumoniae was
found in a gorilla under habituation as well as in one
tracker. These isolates represented different sequence
types and their PFGE profiles were unrelated.
3.3. Clonal relatedness of resistant E. coli from people and
wildlife
XbaI-PFGE-derived clonal analysis was performed on
14 antimicrobial-resistant isolates of E. coli harbored by
people and gorillas (Fig. 2). High variability in XbaImacrorestriction
profiles of the isolates was demonstrated.
Ten human isolates grouped in seven different
PFGE clusters. Identical or closely related isolates were
found in humans. Four E. coli isolates from gorillas showed
less than 80% similarity to each other and less than 80%
similarity to the human isolates. XbaI-PFGE profiles of
samples 45-cip, 51-cip, 125-cip and 109-n were not
considered for clonal analysis because they resulted in
fuzzy smears.
Table 1
Occurrence of ESBL, PMQR and other resistance genes in different hosts.
Host Swabs
examined
PMQR**
-harboring
isolates
ESBL-producing
isolates
Samples with other
genes of resistance
Unhabituated gorillas 22 1 0 3
Gorillas under habituation 12 0 1 0
Habituated gorillas 24 2 1 3
Habituated gorillas after antibiotic treatment 14*
0 0 3
Agile mangabeys 9 1 0 0
Chimpanzees 7 0 0 0
African buffalos 4 2 0 0
Forest elephants 4 0 0 1
Red River hogs 2 0 0 0
Peter’s duikers 2 1 0 0
Lowland bongos 1 0 0 0
Sitatunga 1 1 0 0
Blue duiker 1 0 0 0
PHP employees (trackers, assistants) 16 10 0 4
Villagers (Bayanga, Yandounmbe´, Mossapoula) 14 2 1 3
Researchers coming from Europe 2 0 1 1
* Repetitive sampling occurred in this subset; two samples were obtained from each individual.
** Includes also isolated where PMQR genes were present, but their localization on plasmid was not determined; specifically one isolate of C. freundii
(102-cip), where the gene qnrB28 might be chromosomally mediated and two isolates of E. coli (51-cip and 125-cip) where genes oqxA and oqxB,
respectively, might be chromosomally mediated.
M. Janatova et al. / Veterinary Microbiology 171 (2014) 422–431426
Author's personal copy
Table 2
Resistance phenotypes and genotypes of characterized isolates. Amp – ampicillin, Cef – cephalotin, Amc – amoxycilin-clavulanic acid, Caz – ceftazidime, Sul – sulphonamides compounds, Str – streptomycin, Sxt –
trimethoprim-sulphonamide, Tet – tetracycline, Chl – chloramphenicol, Gen – gentamicin, Cip – ciprofloxacin, Nal – nalidixic acid. MIC is in mg/l, plasmid size is in kb. ‘‘intI1’’ means presence of integron (gene
cassettes are in brackets), ‘‘int1’’ means presence of integrase gene only (not the presence of an integron). In the last column, plasmids assigned with asterisk were conjugative.
Isolation agar plate Bacterial species
(biotype and sequence
type in E. coli)
Resistance phenotype
(MIC for ciprofloxacin and nalidixic acid)
Resistance genes (PMQR and ESBL in bold) Size of plasmids detected in
transformation/conjugation
experiments
Isolates obtained on MCA with ciprofloxacin
Habituated gorilla (70-cip) C. freundii AmpCefCip(0,06)Nal(32) qnrB33 100*
and 20*
Sitatunga (89-cip) C. freundii AmpSulStrSxtTetChlCip(0,06)Nal(256) qnrB17, sul2, tet(B), catA1, int1 120* and 90*
Agile mangabey (102-cip) C. freundii CefAmcCip(0,06)Nal(16) qnrB28 –
African buffalo (91-cip) K. pneumoniae (ST 1209) AmpAmcCip(0,03)Nal(64) oqxA, int1 –
Peter’s duiker (115-cip) K. pneumoniae (ST 1210) Cip(0,06)Nal(16) oqxA, intI1 (dfrA17-aadA5) –
African buffalo (81-cip) K. pneumoniae (ST 1208) AmpCip(0,06)Nal(256) oqxA –
Unhabituated gorilla (19-cip) E. coli (B1, ST 424) AmpCefSulStrSxtTetCip(>8)Nal(>256) qepA, strA, sul1, sul2, tet(A), intI1 (dfr12-orf-aadA2) –
Tracker (123-cip) E. kobei AmpCefAmcSulStrSxtTetChlGenCip
(0,06)Nal(32)
qnrS1, oqxA, blaTEM-1, aadA1, sul1, tet(A), int1 20* and 100*
Tracker (129-cip) Enterobacter asburiae AmpCefAmcSulStrSxtTet qnrS1, blaTEM-1, strA-B, sul2, tet(A), int1 20* and 160*
Villager (36-cip) K. pneumoniae (ST 1234) AmpSulStrSxtTetChlCip(1)Nal(> 256) oqxA, strA, sul1, sul2, tet(D), int1 –
Tracker (124-cip) K. pneumoniae (ST 20) AmpTetCip(>8)Nal(>256) oqxB, blaTEM-1, aadA1, sul1, sul2, tet(A), tet(B), int1, int2 –
Tracker (37-cip) E. coli (A, ST 3476) AmpStrSulTetCip(0,5)Nal(>256) qnrS1, sul2, sul3, tet(A), int1 90* and 100*
Tracker (47-cip) E. coli (A, ST 3476) AmpSulSxtTetCip(4)Nal(>256) qnrS1, sul3, tet(A), int1 15* and 130*
Tracker (49-cip) E. coli (A, ST 3476) AmpCefSulStrSxtTetCip(0,5)Nal(>256) qnrS1, blaTEM-1,sul2, sul3, tet(A), int1 15* and 130*
Tracker (56-cip) E. coli (A, ST 3476) AmpSulSxtTetCip(4)Nal(>256) qnrS1, sul2, sul3, tet(A), tet(B), intI1 (dfrA7) 40 and 160
Villager (44-cip) E. coli (A, ST 156) AmpCefSulSxtCip(>8)Nal(>256) qepA, blaTEM1, sul1, sul2, intI1 (dfr12-orf-aadA2) –
Villager (45-cip) E. coli (A, ST 156) AmpCefSulSxtTetCip(>8)Nal(>256) qepA, blaTEM-1, sul1, sul2, sul3, tet(A), tet(B), catA1, intI1 (dfrA7) –
Villager (51-cip) E. coli (B1, ST 156) AmpSulSxtTetCamCip(>8)Nal(>256) qepA, blaTEM-1, sul1, sul2, tet(B), catA1, intI1 (dfr12-orf-aadA2) –
Tracker (125-cip) E. coli (B1, ST 69) AmpSulStrSxtTetCip(0,06)Nal(128) oqxB, strA-B, aadA5, sul1, sul1, intI2 (dfr1-sat-aadA1) –
Isolates obtained on MCA with cefotaxime
Villager (40-ctx/cip) E. coli (A, ST 218) AmpCefAmcSulStrSxtTetChlCip(0,15)Nal(32) qnrB1, aac(60
)Ib-cr, blaCTX-M-15, blaTEM-1, blaOXA-1, strA, sul2,
sul3, tet(A), catA1, intI1 (aadA1)
20*, 85* and 300
Researcher (59-ctx) E. coli (A, ST 148) AmpCefSulStrTetChl blaCTX-M-15, blaTEM-1, strA, sul1, sul2, sul3, tet(B), catA1, int1 15*, 95* and 330*
Tracker (129-ctx) K. pneumoniae (ST 1212) AmpCefAmcCazSulStrSxtTetChl blaCTX-M-15, blaSHV-2a, aadA1, sul1, tet(A), intI1 (dfrA17-aadA5) 80* and 140*
Habituated gorilla (64-ctx) K. ascorbata AmpCefAmcSulStr blaCTX-M variant2, sul1, sul2, strA-B –
Gorilla under habituation (95-ctx) K. pneumoniae (ST1211) AmpCefAmcCazSulTetGen blaCTX-M-15, blaSHV-62, blaTEM-1, sul1, sul2, tet(A), intI1 (aadA1) 70, 130*, 310* and 340*
Isolates obtained on MCA with no antibiotic
Unhabituated gorilla (18-n) E. coli (B2, ST 538) AmpTet tet(B) –
Habituated gorilla (66-n) E. coli (B2, ST 3840) AmpCefTet tet(B) –
Unhabituated gorilla (73-n) C. freundii AmpAmc blaTEM-1 –
Forest elephant (86-n) K. pneumoniae Amp blaTEM-1 –
Gorilla under habituation (95-n) E. coli (B2, ST155) AmpTet blaTEM-1, tet(A), tet(B), int1 –
Unhabituated gorilla (109-n) E. coli (B2, ST 3654) AmpCefSulStrSxtTet blaTEM-1, strA, sul1, sul2, tet(A), tet(B), intI1 (dfrA7) –
Tracker (38-n) Citrobacter amalonaticus AmpSulSxtTet blaTEM-1, sul2, tet(A), tet(B), int1 –
Villager (42-n) E. coli (B2, ST 10) TetNal tet(A), tet(B), int1 –
Villager (53-n) E. coli (B2, ST 101) AmpTet blaTEM-1, tet(A), tet(B), intI1 (aadA1) –
Villager (54-n) E. coli (B2; ST 209) AmpCefSulStrSxtTetChlNal blaTEM-1, strA, sul1, sul2, tet(A), tet(B), catA1, intI1 (dfrA7) –
Researcher (59-n) K. pneumoniae AmpCefSulSxtTetChl sul1, tet(A), intI1 (dfrA17-aadA5) –
2012 re-sampling
Habituated gorilla E. coli SulSxt – –
Habituated gorilla E. coli Sul – –
Habituated gorilla E. coli AmpAmcCef – –
M.Janatovaetal./VeterinaryMicrobiology171(2014)422–431427
Author's personal copy
The sequence types of E. coli and K. pneumoniae were
also highly variable. ST 3654 and ST 3476 E. coli, detected in
one gorilla and four people, respectively, were new in the
MLST database at the ERI, University College Cork (http://
mlst.ucc.ie/mlst/) and did not belong to a known ST
complex. Of seven K. pneumoniae isolates found in the area,
one human-originating isolate was ST20 and the other six
represented sequence types new to the database of Pasteur
Institute, Paris (http://pasteur.fr/mlst). There were no ST of
E. coli or K. pneumoniae shared by people and animals.
3.4. Plasmid characteristics and plasmid mobility
Transconjugants were obtained from isolates harboring
genes qnrB33 (C. freundii from a habituated gorilla),
qnrB1 (E. coli, human origin), qnrS1 (E. coli and K.
pneumoniae human origin) and blaCTX-M-15 (E. coli and K.
pneumoniae; human and gorilla origin). Transformants to
E. coli MT102RN and Salmonella Typhimurium SL5325
were obtained from qnrS1- and blaCTX-M-15-harboring
isolates of human origin. Plasmid sizes detected in
transformants and transconjugants are summarized in
Table 2. Neither transformation nor electrotransformation
or conjugation was successful in isolates with genes
oqxA or oqxB. Transformation experiments were also
unsuccessful in the case of CTX-M-2 (KLUA), harbored by
K. ascorbata.
4. Discussion
4.1. Antimicrobial resistance in DSPA and relatedness of
resistant isolates from animals and humans
Antimicrobial-resistance genes present in gene-transfer
platforms are regarded as human-originating pollutants
and nobody is certain about their complex effect on
natural microbiosphere (Martinez, 2009). Multiresistant
bacteria are known to occur in African rural communities
(Albrechtova et al., 2012; Bercion et al., 2009), but less is
known about their expansion from community to wildlife.
This study brings first data on resistance in microbiota of
wildlife occurring in strictly protected in Dzanga Ndoki NP
and compares them with data obtained from people
residing in the adjacent Dzangha-Sangha Special Dense
Forest Reserve, but temporarily entering the Park. Resistance
to quinolones and b-lactams was detected both in
people- and wildlife- originating microbiota and in some
cases it had identical genetic background.
At first we analyzed genomic DNA of the resistant E. coli
and K. pneumoniae isolates found in people and wildlife, to
check for possible presence of a clone shared by the two
groups of hosts. The variability of PFGE profiles and
sequence types of investigated isolates was high (Fig. 2).
We found no ST of E. coli or K. pneumoniae present in both
humans and animals. According to their PFGE profiles, the
human- and gorilla- originating E. coli isolates were less
than 85% similar, meaning that they are epidemiologically
unrelated (Goering, 2010). The only highly similar PFGE
profiles and identical sequence types were found in
isolates originating from humans. We could conclude that
in frame of our sample set we did not detect any
multiresistant clone transmitted between people and
wildlife. However, since we know that horizontal transfer
of resistance genes is independent of clonal bacterial
spread, it was important to thoroughly investigate the
genetic background of the resistant isolates.
Epidemiological significance of the resistance genes
found varies with respect to the bacterial species, to their
plasmid or chromosome location and the genetic environment
of the genes. All the investigated isolates belong to
commensal intestinal microbiota of mammals, however all
of them can also act as opportunistic pathogens in extraintestinal
locations, especially in immune-compromised
hosts.
PFGE
100
90
80
70
60
PFGE
tracker (56-cip) ST3476
tracker (37-cip) ST3476
tracker (49-cip) ST3476
tracker (47-cip) ST3476
villager (40-cip/ctx) ST218
gorilla under habituation (95-n) ST155
villager (44-cip) ST156
researcher (59-ctx) ST148
villager (53-n) ST101
unhabituated gorilla (19-cip) ST424
villager (42-n) ST10
villager (54-n) ST209
unhabituated gorilla (18-n) ST538
habituated gorilla (66-n) ST3840
Fig. 2. Dendrogram of resistant E. coli isolates’ Xba-I-PFGE profiles. Generated by cluster analysis of the Dice similarity indices in the BioNumerics
fingerprinting software (optimization 1%, band matching tolerance 1%, tolerance change 1%). Isolates 45-cip, 51-cip, 125-cip and 109-n were not considered
for the analysis because they (repeatedly) did not provide a clear macrorestriction profile when digested by XbaI.
M. Janatova et al. / Veterinary Microbiology 171 (2014) 422–431428
Author's personal copy
4.2. PMQR genes
The finding of qepA-harboring E. coli in an unhabituated
gorilla was probably the most significant among PMQR
genes findings. A human or livestock origin of the gorilla
isolate is very likely, since qepA-carrying multiresistant
plasmids are known mostly to occur under selective
antimicrobial pressure (Strahilewitz et al., 2009). Supportive
to this assumption is the finding of two E. coli isolates
with qepA in people living in investigated villages.
As for the occurrence of qnr- genes, there was no
apparent overlap between animals and humans; whilst
qnrB was found in C. freundii of wild mammal origin, qnrS
was predominant in the human-originating isolates of E.
coli. The finding of C. freundii with different variants of qnrB
is probably an example of naturally occurring resistance,
independent of antimicrobial pressure or introduction of
human bacteria into the forest. C. freundii is presumed to be
the evolutionary origin of qnrB alleles, most of which are
actually chromosomally mediated, but can be mobilized on
plasmids in the presence of specific insertion sequences
(Jacoby et al., 2011). At the same time it was suggested
(Ewers et al., 2011) that animals including wildlife can act
as reservoirs of resistant Citrobacter spp. Up to date more
than 70 variants of the qnrB gene have been described
(http://www.lahey.org/qnrStudies/). Wildlife could actually
represent one of the reservoirs of these rapidly
evolving resistance genes.
Another group of PMQR genes, oqxA and oqxB, was
found in wildlife and humans in our study. OqxAB gene
cassette encodes a multidrug efflux-pump of RND family
(Hansen et al., 2004). This gene complex has probably
evolved in K. pneumoniae, where it occurs on chromosomes
(Norman et al., 2008) and recently was mobilized to
plasmids of pOLA52 type which contributed towards its
pandemic horizontal spread across populations of E. coli
(Hansen et al., 2004). None of our isolates had the complex
of both oqxA and oqxB; we detected oqxA alone in isolates
of Klebsiella and oqxB alone in isolates of E. coli. Due to the
absence of any typical surrounding insertion sequences
(namely IS26 or ISEcp1; Norman et al., 2008) and the
failure in all attempts to gain tranformants or transconjugants
we concluded that oqxA was located on chromosomes
in Klebsiella isolates. Chromosomal oqxA in Klebsiella
probably represents an intrinsic system of resistance
(Fouts et al., 2008) and as such it cannot serve as a marker
of selective antimicrobial pressure or human-originating
environmental contamination.
4.3. ESBL genes
We detected five ESBL-producing isolates; two in
human-originating E. coli, one in human-originating
Klebsiella and two in Klebsiella and Kluyvera from gorillas
(Table 2). Kluyvera sp. is one of the natural sources of CTXM
enzymes, designated KLUA in K. ascorbata (Bonnet,
2004). We assume that the blaKLUA gene in Kluyvera was
chromosome-mediated and can be considered as part of a
naturally evolving resistome. However, the occurrence of
ESBL-producing K. pneumoniae is significant; such a finding
can be regarded as an indicator of bacterial spill-overs from
human-influenced settings. The blaCTX-M-15 is probably the
most widespread type of ESBL across the globe and it is the
most prevalent ESBL gene in humans (Canto´ n et al., 2012).
4.4. Resistance rates in habituated and non-habituated
gorillas and after treatment by ceftiofur
Epidemiologically significant plasmid-mediated resistance
genes (specifically blaCTX-M-15 and qepA) and multiresistant
isolates were detected both in habituated and
unhabituated gorillas. This finding suggests that frequent
proximity of people (trackers, researchers) is not the only
factor contributing to colonization of gorillas by resistant
bacteria. It seems likely that range overlap is more
important for transmission of gastrointestinal microbiota
than close contact with people. One of the possible ways of
resistance genes dissemination from villages in the Special
Reserve to the Park is passive transport by birds. On the
other hand, spreading by water is not very likely since the
Sangha River, the most important water source in the
Special Reserve, does not enter the Dzanga Sector of the
Park where sampling took place.
When examining the samples obtained from the
gorillas of Makumba group 5 months after the ceftiofur
treatment, we detected no isolates with PMQR or ESBL
genes. Thus we could not show any effect of the
antimicrobial treatment in this limited sample set. Both
issues (habituated versus unhabituated individuals and a
follow up after antimicrobial treatment) are very pertinent
and would require analysis of larger datasets than could
have been realized in this study.
5. Conclusion
Based on the spectra of resistance genes, sequence
types and PFGE profiles of the investigated isolates, we
infer that transmissions of resistant gastrointestinal
microbiota between wildlife and humans in DSPA are
not frequent. Resistant microorganisms were observed
both in habituated and unhabituated gorillas, as well as in
other wild mammals, their genetic background was very
variable, but in most cases it differed from the genetic
background of resistance in people. Occurrence of certain
resistance genes, such as qnrB in Citrobacter, oqxA in K.
pneumoniae or KLUA-like ESBL gene in Kluyvera can be
considered as a natural phenomenon. Other genes found in
microbiota of wildlife, namely the qepA and blaCTX-M-15
(both found in gorillas), indicate that these animals have
been in contact with human-contaminated environments.
It is obvious that a long-term continuation of resistance
genes monitoring in the area would help us to understand
the impact of human-originating microbial contamination
in the forest and to estimate the risk of transmission of
newly evolved resistance genes from wildlife to humans.
Acknowledgments
This study was funded by the project ‘CEITEC – Central
European Institute of Technology’ (CZ.1.05/1.1.00/
02.0068) from the European Regional Development Fund
M. Janatova et al. / Veterinary Microbiology 171 (2014) 422–431 429
Author's personal copy
and the Operational Programme ‘‘Education for Competitiveness’’
(CZ.1.07/2.3.00/30.0014) from the European
Social Fund. Field work was supported by the Grant
Agency of the Czech Republic (grant No 475 206/09/0927)
and by institutional support of Institute of Vertebrate
Biology, Academy of Sciences of the Czech Republic (grant
No RVO: 68081766) and by OPVK 2.3 project Development
of Scientific Team and Laboratory for Infectious Diseases
Common to Humans and Great Apes (CZ.1.07/2.3.00/
20.0300). K.J.P. was also supported by the Praemium
Academiae award to Julius Lukes. We would like to thank
the government of the Central African Republic and the
World Wildlife Fund for granting permission to conduct
our research in the Central African Republic; the Ministe`re
de l’Education Nationale, de l’Alphabetisation, de
l’Enseignement Superieur, et de la Recherche and the
Ministe`re de l’Environment, des Eaux et Foˆrets, de la
Chasse et de la Peˆche for providing research permits; and
the Primate Habituation Programme for providing logistical
support in the field. We are indebted to Christopher A.
Whittier for information concerning the antimicrobial
treatment of the habituated gorillas. We would like also to
acknowledge Eva Suchanova, Marie Slavikova and Marie
Hofirkova for their laboratory work. We thank George
Jacoby (Lahey Clinic, Inc., Burlington, MA), Lina Cavaco and
Henrik Hasman (National Food Institute, Copenhagen, DK),
Ming-Gui Wang (Huashan Hospital, Shanghai, China),
Sebastian Guenther (Free University Berlin, G), and Surbhi
Malhotra-Kumar (University of Antwerp, B) for positivecontrol
strains. We thank the team of the curators of the
Institut Pasteur MLST system (Paris, France) for importing
novel alleles, profiles and/or isolates at http://www.
pasteur.fr/mlst.
References
Albrechtova, K., Dolejska, M., Cizek, A., Tausova, D., Klimes, J., Bebora, L.,
Literak, I., 2012. Dogs of nomadic pastoralists in northern Kenya are
reservoirs of plasmid-mediated cephalosporin- and quinolone-resistant
Escherichia coli, including pandemic clone B2-O25-ST131. Antimicrob.
Agents. Chemother. 56, 4013–4017.
Barton, B.M., Harding, G.P., Zuccarelli, A.J., 1995. A general method for
detecting and sizing large plasmids. Anal. Biochem. 226, 235–240.
Benavides, J.A., Godreuil, S., Bodenham, R., Ratiarison, S., Devos, C., Petretto,
M.O., Raymond, M., Escobar-Pa´ramo, P., 2012. No evidence for
transmission of antibiotic-resistant Escherichia coli strains from
humans to wild western lowland gorillas in Lope´ National Park,
Gabon. Appl. Environ. Microbiol. 78, 4281–4287.
Bercion, R., Mossoro-Kpinde, D., Manirakize, A., LeFaou, A., 2009. Increasing
prevalence of antimicrobial resistence among Enterobacteriaceae
uropathogens in Bangui, Central African Republic. J. Infect. Dev.
Countries 3, 187–190.
Birnboim, H.C., Doly, J., 1979. A rapid alkaline extraction procedure for
screening recombinant plasmid DNA. Nucleic Acids Res. 7, 1513–
1523.
Blom, A., Almasi, A., Heitkonig, I.M.A., Kpanou, J.B., Prins, H.H.T., 2001. A
survey of the apes in the Dzanga-Ndoki National Park, Central African
Republic: a comparison between the census and survey methods of
estimating the gorilla (Gorilla gorilla gorilla) and chimpanzee (Pan
troglodytes) nest group density. Afr. J. Ecol. 39, 98–105.
Bonnet, R., 2004. Growing group of extended-spectrum b-lactamases: the
CTX-M enzymes. Antimicrob. Agents Chemother. 48, 1–14.
Canto´n, R., Gonza´les-Alba, J.M., Gala´n, J.C., 2012. CTX-M-enzymes: origin
and diffusion. Front. Microbiol. 3, 110.
CDC, 2004. Standardized molecular subtyping of foodborne bacterial
pathogens by pulse-field gel electrophoresis. In: National Molecular
Network for Foodborne Disease Surveillance. Centre for Disease
Control, Atlanta, GA.
CLSI, 2008. Performance Standards for Antimicrobial Susceptibility Testing.
Clinical and Laboratory Standards Institute, Wayne, PA.
Diancourt, L., Passet, V., Verhoef, J., Grimont, P.A., Brisse, S., 2005. Multilocus
sequence typing of Klebsiella pneumoniae nosocomial isolates. J.
Clin. Microbiol. 43, 5811–5813.
Dobiasova, H., Dolejska, M., Jamborova, I., Brhelova, E., Blazkova, L.,
Papousek, I., Kozlova, M., Klimes, J., Cizek, A., Literak, I., 2013.
Extended spektrum b-lactamase and fluoroquinolone resistence
genes and plasmids among Escherichia coli isolates from zoo animals,
Czech Republic. FEMS Microbiol. Ecol. 85, 604–611.
Ewers, C., Bethe, A., Wieler, L.H., Guenther, S., 2011. Companion animals:
a relevant source of extended-spectrum b-lactamase fluoroquinolone-resistant
Citrobacter freundii. Int. J. Antimicrob. Agents
37, 86–87.
Fouts, D.E., Tyler, H.L., DeBoy, R.T., Daugherty, S., Ren, Q., Badger, J.H.,
Durkin, A.S., Huot, H., Shrivastava, S., Kothari, S., Dodson, R.J., Mohamoud,
Y., Khouri, H., Roesch, L.F., Krogfelt, K.A., Struve, C., Triplett,
E.W., Methe´, B.A., 2008. Complete genome sequence of the 2-fixing
broad host range endophyte Klebsiella pneumoniae 342 and virulence
predictions verified in mice. PloS Genet. 4, e1000141.
Goering, R.V., 2010. Pulsed field gel electrophoresis: a review of application
and interpretation in the molecular epidemiology of infectious
disease. Infect. Genet. Evol. 10, 866–875.
Guenther, S., Ewers, C., Wieler, L.H., 2011. Extended-spectrum b-lactamases
producing Escherichia coli in wildlife, yet another form of
environmental pollution? Front. Microbiol. 2, 246.
Hansen, L.H., Johannesen, E., Burmolle, M., Sorensen, A.H., Sorensen, S.J.,
2004. Plasmid-encoded multidrug efflux pump conferring resistance
to olaquindox in Escherichia coli. Antimicrob. Agents Chemother. 48,
3332–3337.
Jacoby, G.A., Griffin, C., Hooper, D.C., 2011. Citrobacter spp. As a source of
qnrB alleles. Antimicrob. Agents Chemother. 55, 4979–4984.
Literak, I., Dolejska, M., Radimersky, T., Klimes, J., Friedman, M., Aarestrup,
F.M., Hasman, H., Cizek, A., 2010. Antimicrobial resistant faecal
Escherichia coli in wild mammals in central Europe: multiresistant
Escherichia coli producing extended-spectrum b-lactamases in wildboars.
J. Appl. Microbiol. 108, 1702–1711.
Literak, I., Micudova, M., Tausova, D., Cizek, A., Dolejska, M., Papousek, I.,
Prochazka, J., Vojtech, J., Borleis, F., Guardone, L., Guenther, S., Hordowski,
J., Lejas, C., Meissner, W., Marcos, B.F., Tucakov, M., 2012.
Plasmid-mediated quinolone resistance genes in fecal bacteria from
rooks commonly wintering throughout Europe. Microb. Drug Resist.
18, 567–573.
Livermore, D.M., 2012. Current epidemiology and growing resistence
of gram-negative pathogens. Korean J. Intern. Med. 27, 123–
142.
Machado, E., Canto´ n, R., Baquero, F., Gala´n, J.C., Rolla´n, A., Peixe, L., Coque,
T.M., 2005. Integron content of extended-spectrum-beta-lactamaseproducing
Escherichia coli strains in a single hospital in Madrid, Spain.
Antimicrob. Agents Chemother. 49, 1823–1829.
Martinez, J.L., 2009. Environmental pollution by antibiotics and by antibiotic
resistance determinants. Environ. Pollut. 157, 2893–2902.
Norman, A., Hansen, L.H., She, Q., Sørensen, S.J., 2008. Nucleotide
sequence of pOLA52; A conjugative IncX1 plasmid from Escherichia
coli which enables biofilm formation and multidrug efflux. Plasmid
60, 59–74.
Okeke, I.N., Laxminarayan, R., Bhutta, Z.A., Duse, A.G., Jenkins, P., O’Brien,
T.F., Pabloz-Mendez, A., Klugman, K.P., 2005. Antimicobial resistance
in developing countries. Part I: recent trends and current status.
Lancet Infect. Dis. 5, 481–493.
Olesen, I., Hasman, H., Aarestrup, F.M., 2004. Prevalence of b-lactamases
among ampicillin-resistant Escherichia coli and Salmonella
isolated from food animals in Denmark. Microb. Drug Resist. 10,
334–340.
Pallecchi, L., Bartoloni, A., Riccobono, E., Fernandez, C., Mantila, A.,
Mgnelli, D., Mannini, D., Strohmeyer, M., Bartalesi, F., Rodriguez, H.,
Gotuzzo, E., Rossolini, G.M., 2012. Quinolone resistence in absence of
selective pressure: the experience of a very remote community in the
Amazon forest. PLoS Negl. Trop. Dis. 6, e1790.
Pe´rez-Pe´rez, F.J., Hanson, N.D., 2002. Detection of plasmid-mediated
AmpC b-lactamase genes in clinical isolates by using multiplex
PCR. J. Clin. Microbiol. 40, 2153–2162.
Rwego, I.B., Isabirye-Basuta, G., Gillespie, T.R., Goldberg, T.L., 2008. Gastrointestinal
bacterial transmission among humans, mountain gorillas,
and livestock in Bwindi Impenetrable National Park, Uganda.
Conserv. Biol. 22, 1600–1607.
Sak, B., Petrzelkova, K.J., Kvetonova, D., Mynarova, A., Shutt, K.A., Pomajbikova,
K., Kalousova, B., Modry, D., Benavides, J., Todd, A., Kvac, M.,
2013. Long-term monitoring of microsporidia, Cryptosporidium and
Giardia infections in western Lowland Gorillas (Gorilla gorilla gorilla)
M. Janatova et al. / Veterinary Microbiology 171 (2014) 422–431430
Author's personal copy
at different stages of habituation in Dzanga Sangha Protected Areas,
Central African Republic. PLoS One 8, e71840.
Schaumburg, F., Mugisha, L., Peck, B., Becker, K., Gillespie, T.R., Peters, G.,
Leendertz, F.H., 2012. Drug-resistant human Staphylococcus aureus in
sanctuary apes pose a threat to endangered wild ape populations. Am.
J. Primatol. 74, 1071–1075.
Strahilewitz, J., Jacoby, G.A., Hooper, D.C., Robicsek, A., 2009. Plasmidmediated
quinolone resistance: a multifaceted threat. Clin. Microbiol.
Rev. 22, 664–689.
Wirth, T., Falush, D., Lan, R., Colles, F., Mensa, P., Wieler, L.H., Karch, H.,
Reeves, P.R., Maiden, M.C., Ochman, H., Achtman, M., 2006. Sex and
virulence in Escherichia coli: an evolutionary perspective. Mol. Microbiol.
60, 1136–1151.
Zhao, J., Chen, Z., Chen, S., Deng, Y., Liu, Y., Tian, W., Huang, X., Wu, C., Sun,
Y., Sun, Y., Zeng, Z., Liu, J.H., 2010. Prevalence and dissemination of
oqxAB in Escherichia coli isolates from animals, farmworkers, and the
environment. Antimicrob. Agents Chemother. 54, 4219–4224.
M. Janatova et al. / Veterinary Microbiology 171 (2014) 422–431 431
Příloha 24
DOLEJSKA, M., VILLA, L., MINOIA, M., GUARDABASSI, L., CARATTOLI, A., 2014, Complete
sequences of IncHI1 plasmids carrying blaCTX-M-1 and qnrS1 in equine Escherichia coli provide new
insights into plasmid evolution: Journal of Antimicrobial Chemotherapy, v. 69, p. 2388-2393.
Souhrn
Práce popisuje primární nukleotidovou sekvenci dvou multirezistentních IncHI1 plazmidů z izolátů E. coli
s beta-laktamázou CTX-M-1 rozšířených u koní a v prostředí Kliniky chorob koní VFU Brno. Kromě
multirezistentní oblasti nesoucí geny rezistence k několika antibiotickým skupinám byl do primární kostry
plazmidů včleněn úsek o velikosti 24 kb nesoucí geny pro metabolizmus krátkých fruktooligosacharidů. Studie
ukazuje na možný význam genů pro metabolizmus cukrů v šíření a perzistenci rezistentních plazmidů ve střevní
mikroflóře koní.
Complete sequences of IncHI1 plasmids carrying blaCTX-M-1
and qnrS1 in equine Escherichia coli provide new insights
into plasmid evolution
Monika Dolejska1,2*, Laura Villa3, Marco Minoia4, Luca Guardabassi4 and Alessandra Carattoli3
1
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical
Sciences Brno, Palackeho tr. 1/3, 612 42 Brno, Czech Republic; 2
CEITEC VFU, University of Veterinary and Pharmaceutical Sciences Brno,
Palackeho tr. 1/3, 612 42 Brno, Czech Republic; 3
Department of Infectious, Parasitic and Immune-Mediated Diseases, Istituto Superiore di
Sanita`, Viale Regina Elena 299, 00161 Rome, Italy; 4
Department of Veterinary Disease Biology, University of Copenhagen, Stigbøjlen 4,
1870 Frederiksberg C, Denmark
*Corresponding author. Tel: +420-541-562-643; Fax: +420-541-562-631; E-mail: m.dolejska@centrum.cz
Received 22 January 2014; returned 16 February 2014; revised 15 April 2014; accepted 21 April 2014
Objectives: To determine the structure of two multidrug-resistant IncHI1 plasmids carrying blaCTX-M-1 in
Escherichia coli isolates disseminated in an equine clinic in the Czech Republic.
Methods: A complete nucleotide sequencing of 239 kb IncHI1 (pEQ1) and 287 kb IncHI1/X1 (pEQ2) plasmids was
performed using the 454-Genome Sequencer FLX system. The sequences were compared using bioinformatic tools
with other sequenced IncHI1 plasmids.
Results: A comparative analysis of pEQ1 and pEQ2 identified high nucleotide identity with the IncHI1 type 2
plasmids. A novel 24 kb module containing an operon involved in short-chain fructooligosaccharide uptake
and metabolism was found in the pEQ backbones. The role of the pEQ plasmids in the metabolism of shortchain
fructooligosaccharides was demonstrated by studying the growth of E. coli cells in the presence of
these sugars. The module containing the blaCTX-M-1 gene was formed by a truncated macrolide resistance
cluster and flanked by IS26 as previously observed in IncI1 and IncN plasmids. The IncHI1 plasmid changed
size and gained the quinolone resistance gene qnrS1 as a result of IS26-mediated fusion with an IncX1
plasmid.
Conclusions: Our data highlight the structure and evolution of IncHI1 from equine E. coli. A plasmidmediated
sugar metabolic element could play a key role in strain fitness, contributing to the successful dissemination
and maintenance of these plasmids in the intestinal microflora of horses.
Keywords: CTX-M-1, IncHI1, IncX1, horses, fructooligosaccharides
Introduction
Plasmids of incompatibility group HI1 are important vectors
of antibiotic resistance in Salmonella Typhi and Salmonella
Paratyphi A, the major causal agents of enteric fever.1 – 3
They
pose a major threat to the effective treatment of enteric fever
in many countries. The complete nucleotide sequences of six
IncHI1 plasmids [R27 (GenBank accession no. AF250878),
pHCM1 (AL513383), pMAK1 (AB366440), pAKU1 (AM412236),
pO111_1 (AP010961) and pP-stx-12 (CP003279)] have been
determined. They share a common backbone of 164.4 kb;3
however,
a number of specific DNA segments that have been lost or
gained in these plasmids reveal two distinct evolutionary lineages
within the IncHI1 family.3 – 5
IncHI1 plasmids have been shown to carry a set of resistance
genes inserted in a complex multiple antibiotic resistance region
(MARR). Several transposons carrying antibiotic resistance genes
are shared by most IncHI1 plasmids, such as Tn10 with the tetracycline
resistance gene tetA(B), Tn6029 carrying the b-lactamase
resistance gene blaTEM-1, sulphonamide and streptomycin
resistance genes (sul2, strA-strB) or the Tn9 transposon with the
chloramphenicol resistance gene catA1 that carries the Tn21associated
mercury resistance cluster within it.3
Differences in
the structure of the MARR have been identified, highlighting
the ongoing evolution of IncHI1 plasmids as a result of various
genetic events reshaping the MARR in situ.3 – 6
We previously described IncHI1 plasmids carrying the
blaCTX-M-1 gene in Escherichia coli disseminated in an equine clinic
# The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: journals.permissions@oup.com
J Antimicrob Chemother 2014; 69: 2388–2393
doi:10.1093/jac/dku172 Advance Access publication 26 May 2014
2388
byguestonFebruary11,2015http://jac.oxfordjournals.org/Downloadedfrom
in the Czech Republic, giving the first evidence of the carriage
of extended-spectrum b-lactamase (ESBL) genes on IncHI1
plasmids.7
IncHI1 plasmids associated with ESBL genes have so
far been documented only in E. coli isolates of animal origin.
Recently, IncHI1 plasmids carrying blaCTX-M-2 have also been
observed in E. coli from horses in Belgium and cattle in
Germany.8,9
The aim of this study was to elucidate the structure
and evolution of blaCTX-M-1-positive IncHI1 plasmids of equine
origin by sequencing and bioinformatic analysis.
Materials and methods
Plasmids
Multiresistant E. coli strains were isolated at the Clinic of Equine Diseases at
the University of Veterinary and Pharmaceutical Sciences Brno, Czech
Republic, between 2007 and 2010;7
these contained conjugative IncHI1
plasmids ranging from 220 to 285 kb in size and carrying the blaCTX-M-1
gene. Two plasmids, pEQ1 and pEQ2, from E. coli transconjugants were
chosen for plasmid multilocus sequence typing (pMLST)3
(www.pubmlst.
org/plasmid/) and complete sequence analysis. pEQ1 was an IncHI1
plasmid harbouring blaCTX-M-1 and originating from E. coli strain T23 from
the faeces of a healthy horse, while pEQ2 was positive for both HI1 and X1
replicons, carried blaCTX-M-1, blaTEM-1 and the plasmid-mediated quinolone
resistance gene qnrS1 and was identified in E. coli strain 63743 from an
infected wound on a horse.
Plasmid sequencing and sequence assembly
A procedure using the 454 Genome Sequencer FLX system (Roche
Diagnostic, Monza, Milan) was applied on libraries obtained using plasmid
DNA from E. coli transconjugants purified by the Invitrogen PureLinkTM
HiPure Plasmid Filter Midiprep Kit (Invitrogen, Milan, Italy), according to
the manufacturer’s instructions. Plasmid libraries were sequenced using
the GS FLX standard sequencing kit. Twenty-eight and 29 contigs for the
pEQ1 and pEQ2 plasmids, respectively, ranging from 97308 to 63 bp in
size, with at least a 35-fold coverage, were obtained using GS De Novo
Assembler v2.6 software. Contigs were first assembled in silico using the
454 ReadStatus output file generated by GS De Novo Assembler software,
identifying reads overlapping adjacent contigs. Contig assembly and
predicted gaps were then confirmed and filled by PCR-based gap closure
followed by Sanger DNA sequencing of the amplicons (Applied Biosystems,
Foster City, CA, USA).
Bioinformatic analysis
Open reading frames (ORFs) were predicted and annotated using Artemis
software (Wellcome Trust Sanger Institute, UK). Each predicted protein
was compared against an all-protein database using BLASTp (http://
blast.ncbi.nlm.nih.gov/Blast.cgi) with a minimum cut-off of 30% identity
over an 80% length coverage. Gene sequences were further compared
and aligned with GenBank data using BLAST (http://blast.ncbi.nlm.nih.
gov/Blast.cgi) and ClustalW (http://www.ebi.ac.uk/clustalw). IncHI1 plasmids
pHCM1 (AL513383) and R27 (AF250878) were used as reference
plasmids for annotating the pEQ1 and pEQ2 plasmids.
Nucleotide sequence accession numbers
The complete nucleotide sequences of plasmids pEQ1 and pEQ2 have
been submitted to the GenBank database under accession numbers
KF362121 and KF362122.
Growth curves
Growth experiments were performed using oCelloScope (Unisensor Ltd,
Denmark) to prove the function of a sugar metabolic cluster detected
in the plasmids under study. Growth in the presence of short-chain fructooligosaccharides
(scFOSs) as the only source of carbon was compared
between E. coli TOP10 (InvitrogenTM
Life Technologies, USA) carrying plasmid
pEQ1 introduced by electroporation (E. coli TOP10/pEQ1) and plasmidfree
E. coli TOP10. Overnight cultures of both strains were washed twice in
AB minimal medium10
and bacterial concentrations were determined by
OD600 measurements performed on a UV-3100 PC Spectrophotometer
(VWR, Herlev, Denmark). A final concentration of 105
bacteria/mL of
either E. coli TOP10 or E. coli TOP10/pEQ1 was then inoculated in 100 mL
of AB minimal medium supplemented with 5 mM kestose (Wako
Chemicals GmbH, Germany), 5 mM nystose (Wako Chemicals GmbH) or
0.2% scFOSs (Digest Plus prebiotic supplement for horses; Bailey’s, UK)
and loaded into an F-base 96 microtitre plate (TPP; Sigma Aldrich). AB
medium with 0.2% D-glucose (Sigma Aldrich) and without a carbon source
was used as a positive and a negative control, respectively. Growth values
are expressed as TA¼log10(Full light – I), where ‘TA’ is total absorption, ‘Full
light’ is the intensity of an entirely white image and ‘I’ is the mean of the
light intensity of an acquired image. Values were recorded for 45 h at
20 min intervals. All experiments were done in triplicate, and data were
expressed as means+SD.
Results and discussion
pEQ1 and pEQ2 are IncHI1 type 2 plasmids
Both pEQ1 (239151 bp) and pEQ2 (287616 bp) showed the
new ST9 pMLST profile, contained the typical IncHI1 backbone
(≥99.9% identity with ST1 pMAK1, pO111_1 pHCM1 plasmids)
encoding replication, maintenance and conjugative transfer,
and showed all the features of IncHI1 type 2 plasmids (regions
A–E).4,5
Limited to pEQ2, a 48.5 kb fragment was inserted into
the MARR.
MARR of pEQ1 and pEQ2
The 42.9 kb MARR of the pEQ1 and pEQ2 plasmids was inserted in
the same position of the IncHI1 backbone as seen in pHCM1-like
plasmids (Figure 1), and bracketed between IS10 on the left and
IS1a on the right. With respect to the pO111_1 plasmid identified
in E. coli in Japan, an IS26-flanked module containing the mph(A),
blaCTX-M-1 and aac(3)-IId genes was acquired in the region flanking
the Tn6029 right boundary.
The macrolide resistance operon [mph(A)-mrx-mphR(A)] was
flanked by IS6100, which was followed by a 123 bp sequence identical
to the end of Tn402/Tn169611
and a 58 bp duplicated fragment
of IS26 (the solid black vertical arrow in Figure 1). A similar
macrolide resistance segment was found in the IncHI1 plasmid
pMAK1 (Figure 1) and also other plasmid families (e.g. JX101693,
JN233704). However, in these latter plasmids, a region with the
chromate resistance gene chrA and class 1 integron was present
adjacent to the Tn402/Tn1696, but was not found in pEQ plasmids.
A gentamicin resistance module was formed by IS10 followed
by aac(3)-IId and three hypothetical proteins, and showed
100% identity to a region found in the IncF plasmid pK245 recovered
from a human Klebsiella pneumoniae isolate in Taiwan
(DQ449578) and the chromosome of Klebsiella oxytoca E718 producing
metallo-b-lactamase NDM-1 (CP003683). A similar structure
has been recently identified in the MARR of pSRC27-H, the
IncHI1 plasmids in Escherichia coli from horses
2389
JAC
byguestonFebruary11,2015http://jac.oxfordjournals.org/Downloadedfrom
IncHI1type 2 plasmid from equine Salmonella Typhimurium from
Australia (Figure 1).6
The region carrying blaCTX-M-1 contained a second partial copy
of the macrolide cluster [mrx-mph(A)] and was flanked by two
IS26 sequences. This segment has not yet been observed in
other IncHI1 plasmids but has been recently identified in IncN
and IncI1 plasmids from both animal and human E. coli, including
the epidemic ST131 clone from humans and pigs in Germany and
Denmark.12 –14
As in other IncHI1 plasmids, a Tn21 partial sequence was
inserted inside Tn9 carrying the catA1 gene.3
pEQ2 was generated by plasmid fusion between pEQ1
and a qnrS1-harbouring IncX1
pEQ2 contained an IncX1 plasmid harbouring the qnrS1 and
blaTEM-1 genes integrated between positions 119866 and 168370.
The inserted plasmid had the typical IncX1 backbone15
and
showed high nucleotide identity to pRPEC180_47 (JN935898)
and pE001 (JF776874; Figure S1a, available as Supplementary
data at JAC Online). The qnrS1 and Tn2-blaTEM-1 regions in pEQ2
showed a high similarity to those previously described for
pAH3076 from Shigella flexneri 2b16
and pINF5 from Salmonella
Infantis plasmids17
(Figure S1b, available as Supplementary
data at JAC Online). The model of formation of pEQ2 is shown in
Figure S1c (available as Supplementary data at JAC Online). The
pEQ2 has arisen via IS26-mediated homologous recombination
between the IncX1 replicon and the IncH1 pEQ1 plasmid, resulting
in separation of the tnpA and tnpR of Tn2.
pEQ plasmids carry an operon for scFOS metabolism
Both pEQ1 and pEQ2 contained a 24 kb element flanked by 7 bp
direct repeats, providing evidence of acquisition via transposition
(Figure 2a). The inner 9253 bp part of this element showed
93–99% nucleotide identity with the genomes of the fully
sequenced avian extraintestinal pathogenic E. coli BEN2908
(AY857617),18
E. coli M718 (NZ_GL884131) and Enterobacter
cloacae EcWSU1 (CP002886) strains (Figure 2a). In the E. coli
genomes this element contained seven fos genes organized as
an operon, which was flanked by various insertion sequences
that were likely to play a role in mobilization of this element
(Figure 2a). In the pEQ1 and pEQ2 plasmids, this cluster was
flanked by two directly repeated putative IS903-like elements.
The first IS903-like element was preceded by an IS5 element,
Figure 1. Structure of pEQ1 MARR and its comparison with other IncHI1 type 2 plasmids. The diagrams are drawn to scale and were drawn from
the IncHI1 plasmid sequences in the GenBank database (plasmid names, their origin and their accession numbers are given). The grey dotted lines
in the MARR of pO111_1, pHCM1, pSRC27-H and pMAK1 indicate regions with .99% identity to pEQ1. The white, light grey and dark grey boxes
flanking the MARR on both sides show the location inside the IncHI1 backbone; the colour of the box represents the same integration site shared by
the IncHI1 plasmids. The reading frames are shown as horizontal arrows with the arrowhead indicating the direction of transcription and the names of
the genes shown below. Antibiotic resistance genes are shown in red. The arrows without a mark indicate a hypothetical protein with unknown function.
The boxes represent insertion sequences (ISs) with the number of the IS inside and an arrow below the box indicating the direction of transcription; IS26
is shown in yellow. The black boxes indicate inverted repeats at the end of transposons. The mercury resistance region is a part of Tn21 formed by six mer
genes highlighted by grey shading. Brackets with names above the regions show the extent of the transposons. The asterisk in pHCM1 on the left of IS1b
shows an extra 356 bp segment of Tn10 that has been removed from the other IncHI1 plasmids. The vertical arrows in pEQ1 show the following: the big
white arrow pointing to the third IS26 in pEQ1 indicates the integration site of the IncX1 plasmid resulting in formation of pEQ2; the small black arrow
pointing to the end of the third IS26 indicates the 58 bp duplicated fragment of IS26; the small grey arrow after the first mph(A) gene shows the 24 bp
deletion; and the small white arrow adjacent to IS1a indicates the 187 bp deletion of the pHCM1.203 gene. This figure appears in colour in the online
version of JAC and in black and white in the print version of JAC.
Dolejska et al.
2390
byguestonFebruary11,2015http://jac.oxfordjournals.org/Downloadedfrom
(a)
(b)
scFOSs
scFOSs
Figure 2. Structure and function of the fos operon in the pEQ plasmids. (a) Comparative analysis of the genetic element for scFOS metabolism in pEQ1 and
pEQ2 and its genetic environment with the related elements found in the genomic region AGI-3 of avian pathogenic E. coli strain BEN2908 (AY857617) and
chromosomes of E. coli strain M718 (NZ_GL884131) and onion-pathogenic E. cloacae EcWSU1 (CP002886). The reading frames are shown as arrows with
the arrowhead indicating the direction of transcription. Grey-shaded areas indicate the nucleotide identity of the pEQ plasmids to the related sequences,
with percentages representing the nucleotide identity of each sequence with respect to the pEQ plasmids given above. The genes of the fos operon in the
pEQ plasmids and the reference sequence of avian pathogenic E. coli strain BEN2908 are indicated by green arrows as follows: fosK, encoding fructokinase;
fosY, encoding a conserved hypothetical protein; fosGH2, encoding glycosyl hydrolase; fosX, encoding a conserved hypothetical protein; fosGH1, encoding
glycosyl hydrolase; fosT, encoding the sugar transporter FruP/phosphotransferase system; and fosR, encoding specific transcriptional regulator of the LacI
family. Transposon-related genes and insertion sequences (ISs) are indicated by grey arrows. Other genes and ORFs are indicated by white arrows. The
genes orfX and orfY, indicated by yellow arrows, encode hypothetical proteins of the IncHI1 backbone. Vertical bars indicate 7 bp direct repeats of the
insertion site inside the pEQ backbone with the sequence shown above. (b) Growth curves of E. coli TOP10 transformants carrying the pEQ1 plasmid (E.
coli TOP10/pEQ1; continuous lines) and the E. coli recipient TOP10 (broken lines) in AB minimal medium with kestose (5 mM), nystose (5 mM) and scFOSs
(0.2%). This figure appears in colour in the online version of JAC and in black and white in the print version of JAC.
IncHI1 plasmids in Escherichia coli from horses
2391
JAC
byguestonFebruary11,2015http://jac.oxfordjournals.org/Downloadedfrom
while a Tn7-like transposon was located downstream of the
second IS903 (Figure 2a).
The fos operon has been previously described as being involved
in the metabolism of scFOSs and the increased colonization abilities
of avian pathogenic E. coli strains in the chicken intestine.19,20
However, these elements were associated with pathogenicity
islands within the chromosome and were not plasmid mediated.
The role of the pEQ1 plasmid in the metabolism of scFOSs was
demonstrated by a growth experiment involving E. coli cells in
the presence of scFOSs (Figure 2b). E. coli transformants carrying
the pEQ1 plasmid (E. coli TOP10/pEQ1) were able to growth in minimal
medium supplemented with various types of scFOS as the
sole carbon source while no growth was observed for the plasmidfree
E. coli TOP10 recipients. To the best of our knowledge, this is
the first evidence of a functional sugar metabolic cluster associated
with a multidrug resistance conjugative plasmid. This
plasmid-mediated metabolic function could play a key role in
the adaptation of IncHI1 plasmids among equine E. coli since
horses eat a diet rich in carbohydrates.21
As such, the fos operon
may contribute to strain fitness in the intestinal tract of these animals.
Moreover, it may also contribute to co-selection and persistence
of the array of antimicrobial resistance genes harboured by
IncHI1 plasmids in the absence of antimicrobial selective pressure.
Conclusions
In conclusion, the observed differences in organization of the
MARR in the pEQ plasmids in comparison with other IncHI1 plasmids
were attributed to independent insertions of transposable
elements from other genomes and their further rearrangements
within this plasmid lineage. The IncHI1 plasmid-mediated genetic
element involved in scFOS metabolism could play a role in strain
fitness in the equine intestinal tract, contributing to the successful
dissemination and maintenance of these plasmids and their antimicrobial
gene content in the intestinal microflora of horses.
Acknowledgements
We thank Alois Cizek (University of Veterinary and Pharmaceutical Sciences
Brno) for providing E. coli strains harbouring IncHI1 plasmids analysed in
this study and Ivana Jamborova, Hana Dobiasova, Marie Slavikova
(University of Veterinary and Pharmaceutical Sciences Brno) and Claudia
Feudi (Istituto Superiore di Sanita`) for excellent laboratory assistance.
Funding
The project was supported by the Czech Science Foundation (GPP502/10/
P083) and CEITEC (CZ.1.05/1.1.00/02.0068) (to M. D.) and by the Italian
FLAGSHIP ‘InterOmics’ project (PB.P05) funded by MIUR and coordinated
by the Italian Council of National Research (CNR) (to A. C.). M. D. was supported
by a ‘FEMS Advanced Fellowship 2011’ Award from the Federation
of European Microbiological Societies and by The Operational Programme
‘Education for Competitiveness’ (CZ.1.07/2.3.00/30.0014) from the
European Social Fund. The work performed at the University of
Copenhagen was supported by the EU grant HEALTH-F3-2011-282004
(EvoTAR).
Transparency declarations
None to declare.
Supplementary data
Figure S1 is available as Supplementary data at JAC Online (http://jac.
oxfordjournals.org/).
References
1 Taylor DE, Chumpitaz JC, Goldstein F. Variability of IncHI1 plasmids from
Salmonella typhi with special reference to Peruvian plasmids encoding
resistance to trimethoprim and other antibiotics. Antimicrob Agents
Chemother 1985; 28: 452–5.
2 Hasan R, Cooke FJ, Nair S et al. Typhoid and paratyphoid fever. Lancet
2005; 366: 1603–4.
3 Holt KE, Thomson NR, Wain J et al. Multidrug-resistant Salmonella
enterica serovar Paratyphi A harbors IncHI1 plasmids similar to those
found in serovar Typhi. J Bacteriol 2007; 189: 4257–64.
4 Phan MD, Kidgell C, Nair S et al. Variation in Salmonella enterica serovar
Typhi IncHI1 plasmids during the global spread of resistant typhoid fever.
Antimicrob Agents Chemother 2009; 53: 716–27.
5 Cain AK, Hall RM. Evolution of IncHI1 plasmids: two distinct lineages.
Plasmid 2013; 70: 201–8.
6 Cain AK, Hall RM. Evolution of a multiple antibiotic resistance region in
IncHI1 plasmids: reshaping resistance regions in situ. J Antimicrob
Chemother 2012; 67: 2848–53.
7 Dolejska M, Duskova E, Rybarikova J et al. Plasmids carrying blaCTX-M-1
and qnr genes in Escherichia coli isolates from an equine clinic and a
horseback riding centre. J Antimicrob Chemother 2011; 66: 757–64.
8 Smet A, Boyen F, Flahou B et al. Emergence of CTX-M-2-producing
Escherichia coli in diseased horses: evidence of genetic exchanges of
blaCTX-M-2 linked to ISCR1. J Antimicrob Chemother 2012; 67: 1289–91.
9 Schink AK, Kadlec K, Kaspar H et al. Analysis of extended-spectrumb-lactamase-producing
Escherichia coli isolates collected in the GERM-Vet
monitoring programme. J Antimicrob Chemother 2013; 68: 1741–9.
10 Clark DJ, Maaløe O. DNA replication and the division cycle in Escherichia
coli. J Mol Biol 1967; 23: 99–112.
11 Partridge SR, Brown HJ, Stokes HW et al. Transposons Tn1696 and Tn21
and their integrons In4 and In2 have independent origins. Antimicrob
Agents Chemother 2001; 45: 1263–70.
12 Cullik A, Pfeifer Y, Prager R et al. A novel IS26 structure surrounds
blaCTX-M genes in different plasmids from German clinical Escherichia coli
isolates. J Med Microbiol 2010; 59: 580–7.
13 Schink AK, Kadlec K, Schwarz S. Analysis of blaCTX-M-carrying plasmids
from Escherichia coli isolates collected in the BfT-GermVet study. Appl
Environ Microbiol 2011; 77: 7142–6.
14 Dolejska M, Villa L, Hasman H et al. IncN plasmids disseminating
blaCTX-M-1 and qnr genes in Escherichia coli and Salmonella from
animals, environment and humans. J Antimicrob Chemother 2012;
68: 333–9.
15 Norman A, Hansen LH, She Q et al. Nucleotide sequence of pOLA52: a
conjugative IncX1 plasmid from Escherichia coli which enables biofilm
formation and multidrug efflux. Plasmid 2008; 60: 59–74.
16 Hata M, Suzuki M, Matsumoto M et al. Cloning of a novel gene for
quinolone resistance from a transferable plasmid in Shigella flexneri 2b.
Antimicrob Agents Chemother 2005; 49: 801–3.
17 Kehrenberg C, Friederichs S, de Jong A et al. Identification of the
plasmid-borne quinolone resistance gene qnrS in Salmonella enterica
serovar Infantis. J Antimicrob Chemother 2006; 58: 18–22.
18 Chouikha I, Germon P, Bre´e A et al. A selC-associated genomic island of
the extraintestinal avian pathogenic Escherichia coli strain BEN2908 is
Dolejska et al.
2392
byguestonFebruary11,2015http://jac.oxfordjournals.org/Downloadedfrom
involved in carbohydrate uptake and virulence. J Bacteriol 2006; 188:
977–87.
19 Schouler C, Taki A, Chouikha I et al. A genomic island of an
extraintestinal pathogenic Escherichia coli strain enables the metabolism
of fructooligosaccharides, which improves intestinal colonization.
J Bacteriol 2009; 191: 388–93.
20 Porcheron G, Chanteloup NK, Trotereau A et al. Effect of
fructooligosaccharide metabolism on chicken colonization by an
extra-intestinal pathogenic Escherichia coli strain. PLoS One 2012; 7:
e35475.
21 Pagan JD. ed. Advances in Equine Nutrition III. Nottingham, UK:
Nottingham University Press, 2005.
IncHI1 plasmids in Escherichia coli from horses
2393
JAC
byguestonFebruary11,2015http://jac.oxfordjournals.org/Downloadedfrom
Příloha 25
ALBRECHTOVA, K., KUBELOVA, M., MAZANCOVA, J., DOLEJSKA, M., LITERAK, I., CIZEK, A., 2014,
High prevalence and variability of CTX-M-15-producing and fluoroquinolone resistant
Escherichia coli observed in stray dogs in rural Angola: Microbial Drug Resistance, v. 20, p. 372-
375.
Souhrn
Tato studie dokumentuje vysokou prevalenci bakterií s klinicky významnou rezistencí u pouličních psů
v Angole. Izoláty E. coli s ESBL nebo plazmidy determinovanou rezistencí k fluorochinolonům byly zjištěny
v 56­75 % rektálních výtěrů. ESBL fenotyp byl u všech izolátů spojen s beta-laktamázou CTX-M-15.
High Prevalence and Variability of CTX-M-15-Producing
and Fluoroquinolone-Resistant Escherichia coli Observed
in Stray Dogs in Rural Angola
Katerina Albrechtova,1
Michaela Kubelova,1
Jana Mazancova,2
Monika Dolejska,1,3
Ivan Literak,1,3
and Alois Cizek3,4
Antimicrobial resistance (AMR) represents a serious problem globally, but it is especially pronounced in the
tropics, where pressure of infectious diseases is high. We examined resistance in Escherichia coli colonizing
gastrointestinal tracts of 17 dogs which have never received antimicrobial treatment, living in central rural
Angola. Emphasis was placed on extended-spectrum beta-lactamases (ESBL) and plasmid-mediated quinolone
resistance (PMQR). Resistance-carrying plasmids were characterized in size, group of incompatibility and
ability to conjugate. Isolates were compared by their pulsed-field gel electrophoresis (PFGE) profiles. Detailed
description of 19 E. coli isolates with either ESBL or PMQR genes carried on multiresistant plasmids of
different groups of incompatibility indicates that dogs, despite never being treated by antibiotics, are important
reservoirs and transmitters of AMR in the study area.
Introduction
Multidrug-resistant Enterobacteriaceae have
invaded diverse ecosystems world over, causing
serious problems in human and veterinary medicine. Resistance
genes can easily spread from people to animals and
vice versa, taking advantage of several means of horizontal
and vertical gene transfer.1
Plasmid-mediated extendedspectrum
beta-lactamases (ESBL) and genes resistant to
fluoroquinolones (PMQR) are epidemiologically significant,
since they are easily spread in microbial populations and
confer resistance to vital antimicrobials, such as third generation
cephalosporins and fluoroquinolones.
Surveillance is the cornerstone of our understanding to
the epidemiology of antimicrobial resistance and a starting
point for intervention design.15
Dogs living in tropical
developing countries have repeatedly been recognized as
relevant indicator organisms for microbial pathogens, since
they share environment and water sources with human
communities whilst at the same time often scavenging for
food in human waste areas, including free defecation
zones.12
In a warm and humid tropical climate, which is
conductive for the survival and spread of bacteria, such
behavior can lead to an accumulation of resistance genes
within the normal gastrointestinal microflora of these domestic
animals. High rates of resistance, including the ESBL
and PMQR determinants, have previously been reported in
Escherichia coli obtained from dogs of nomadic pastoralists
in Northern Kenya.2
This short communication aims to
describe phenotypic and genotypic characteristics of gastrointestinal
E. coli with ESBL and/or PMQR genes found in
dogs in rural central Angola.
Material and Methods
Rectal swabs from 17 stray dogs (assigned IDs 20 to 36)
were obtained in and around the town of Catabola (Bie´,
Central Angola; 18,000 inhabitants). Animals were handled
by an instructed assistant, according to the Directive 86/609/
EEC on the Protection of Animals Used for Experimental
and Other Scientific Purposes. Dogs were chosen randomly
in the town center. The overall population of stray dogs in
the town is not known, but is estimated to be several hundred.
Previous antibiotic therapy in these dogs is highly
unlikely. All samples were preserved in Amies medium
until delivered to the laboratory. Swabs were cultivated on
MacConkey agar with cefotaxime (2 mg/L) and in parallel
on MacConkey agar with ciprofloxacin (0.05 mg/L) to detect
1
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology; 3
CEITEC VFU Brno; 4
Department of
Infectious Diseases and Microbiology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno, Brno,
Czech Republic.
2
Department of Sustainable Technologies, Faculty of Tropical AgriSciences, Czech University of Life Sciences Prague, Prague, Czech
Republic.
MICROBIAL DRUG RESISTANCE
Volume 20, Number 4, 2014
ª Mary Ann Liebert, Inc.
DOI: 10.1089/mdr.2013.0177
372
FIG.1.PhenotypicandgenotypiccharacteristicsofanalyzedE.colistrains.DogswereassignedIDs20–36.Isolateswiththesuffix‘‘cfx’’wereobtainedonMCA-cefotaxime;
isolateswiththesuffix‘‘cip’’weregrownonMCA-ciprofloxacin.IsolateswithanidenticalArabicnumberoriginatefromthesameanimal.Leftcolumn:dendrogramofanalyzed
E.coliisolates’PFGEprofilesgeneratedbyclusteranalysisoftheDicesimilarityindicesintheBioNumericsfingerprintingsoftware.Am,ampicillin;St,streptomycin;Su,
sulfonamidescompounds;Na,nalidixicacid;Te,tetracycline;Sx,trimethoprim–sulfomethoxazole;Cm,chloramphenicol;Cf,cefalotin;Cp,ciprofloxacin;Ac,amoxicillin–
clavulanate;Gn,gentamicin;Cz,ceftazidime;ID,identificationnumber;PG,phylogeneticgroup;ST,sequencetype;Conj.,conjugationtoE.coliorSalmonellaBraedenrup;
Trf.,transformationtoDH5acells;Inc.,plasmidincompatibilitygroup.Plasmids(inbold)werecharacterized(asforthesizeandInc.group)insingle-plasmidharboring
transformantsortransconjugants;resistancegenesfoundononeplasmidareinsquarebrackets,plasmidsizefollowsthehyphen.IntI1,class1integron;IntI2,class2integron.
Genecassettesdetectedononeintegronarewithinparentheses,withintegronsizefollowingthehyphen.
373
ESBL-producing E. coli and E. coli possessing PMQR genes
respectively. Biochemical identification of E. coli colonies
was performed by API20S (Biomerieux). A single colony
was isolated from each plate. Obtained isolates were characterized
as described previously.2
In brief, the isolates were
tested for susceptibility to 12 antibiotics by disc-diffusion
method: ampicillin (10mg), cephalotin (30mg), amoxicillin–
clavulanate (20 +10mg), ceftazidime (30mg), trimethoprim–
sulfamethoxazole (1.25+23.75 mg),sulphonamidescompounds
(300 mg), gentamicin (10 mg), nalidixic acid (30 mg), ciprofloxacin
(5 mg), streptomycin (30 mg), tetracycline (30 mg),
and chloramphenicol (30 mg).8
Production of ESBL was
tested by a double-disc synergy test. 8
Phylogroups, resistance
genes, and integrons were searched by PCR as summarized
elsewhere.11
Clonal relatedness of the isolates with
ESBL or PMQR genes was assessed by XbaI pulse-field
gel electrophoresis (PFGE)-generated dendrogram.7
Sequence
types were determined by multilocus sequence typing.16
Conjugation transfer of ESBL and PMQR genes was made to
plasmid-free, rifampin- and azid-resistant E. coli MT102RN,
and Salmonella Typhimurium SL5325.13
Plasmid DNA from
ESBL-producing and PMQR-harboring isolates was extracted
by rapid alkaline method4
and introduced into competent
E. coli DH5a (Invitrogen) by heat-shock transformation (42°C
for 45 sec). Transformants were selected on Luria-Bertani agar
with 0.05 mg ciprofloxacin or 2 mg cefotaxime, according to
the genes expected. Plasmids carrying the ESBL/PMQR genes
were characterized in size by S1 nuclease PFGE and replicon
typed.5,10
Results
Coliform colonies were obtained from 16 out of 17 swabs
cultivated. One coliform colony obtained on MCA-ciprofloxacin
(34cip) was identified as Citrobacter freundii, and
one grown on MCA-cefotaxime (35cfx) turned out to be
Enterobacter cloacae. These non-E. coli isolates were not
characterized further. ESBL-producing E. coli was detected
in 12 (75%) samples, and E. coli with PMQR genes was
obtained from nine (56%) samples. Cultivation of 7 out of
17 samples (numbers 20, 23, 25, 27, 28, 29, and 33) resulted
in two E. coli isolates, of which one had an ESBL gene and
the other had PMQR gene (discriminated as 20cfx/20cip).
By means of sequencing, all ESBLs were characterized as
type CTX-M-15, while PMQR genes were represented by
qepA, qnrS1, qnrB19, or aac(6¢)-Ib-cr. All except one of the
examined strains were multiresistant, with 2–10 resistance
genes detected. Resistance-carrying plasmids (characterized
where single plasmid-harboring transformants or tranconjugants
were obtained) varied in size, incompatibility group,
and combinations of resistance genes carried (Fig. 1). The
CTX-M-15 beta-lactamase was detected on large plasmids
of the FIB, Y, N, I1 incompatibility groups. Four samples
had the gene qepA carried on plasmids of the FIB incompatibility
group. Some of the investigated plasmids were not
typable by primers described previously.5,10
Plasmids of
seven isolates carrying the blaCTX-M-15 gene or the qepA
gene were conjugative to recipient cells. The variability of
PFGE patterns was high, showing more than 95% relatedness
only in one pair of all examined strains (Fig. 1). The 19
investigated isolates represented 12 different sequence types
with six of them (ST 3653, ST 3687, ST 3690, ST 3694, and
ST 3726) new in the MLST database at the ERI, University
College Cork (http://mlst.ucc.ie/mlst/). The majority of the
isolates belonged to phylogenetic group A, with two exceptions
in group B1.
Discussion
Although the size of the sample set examined was limited,
the prevalence of highly resistant isolates found in the stray
dogs is worrisome. The high diversity of phenotypic and
genotypic profiles of the investigated isolates indicates that
high resistance rates in the study area do not represent the
success of a single multiresistant bacterial clone, but have
evolved by dissemination of various bacterial strains. The
genetic diversity of plasmids also implies that resistance in
the studied isolates has been acquired in multiple ways.
The majority of plasmids carrying the CTX-M-15 betalactamase
belonged to the FIB group of incompatibility.
However, even less common plasmids with Y replicon were
detected. Six ESBL- or PMQR-carrying plasmids showed
the ability to conjugate to recipient E. coli and S. typhimurium.
Considering their putative ability to conjugate to
pathogenic bacterial species, these plasmids are of high
epidemiological importance.
Several studies have described occurrence of communityor
hospital-associated multiresistant bacterial isolates
(mainly of Vibrio sp.) in people in Angola.6,9,14
However, to
our knowledge, this is the first report about ESBL in the
country. Since administration of antibiotics, especially
costly ones such as fluoroquinolones or third-generation
cephalosporins, to dogs in rural Angola is unlikely, colonization
of them by ESBL- and PMQR-harboring bacteria
could be indirect evidence of their occurrence in humans.
Quantitative data on the consumption of antimicrobial
agents by humans in Angola are not available, but fluoroquinolone
ciprofloxacin and third-generation cephalosporin
ceftriaxone are available in the country.3,14
Although these
two antibiotics are costly and might not be accessible to the
public, their use in hospitals can lead to the selection of
bacteria with ESBL- and/or PMQR-carrying plasmids.
Plasmids described in this study carried genes coding for
resistance to widely available drugs such as sulfonamides,
tetracyclines, or gentamicin. It is likely that, once introduced
to an area, the spread of such plasmids is also perpetuated
by antibiotics less costly than fluoroquinolones or thirdgeneration
cephalosporins. Poor hygienic conditions, lack of
sanitary facilities, and dogs scavenging for food in waste are
the major factors contributing to bacterial exchange between
humans and dogs. As stray dogs move around freely and
travel relatively long distances, they can play an important
role in resistance epidemiology as reservoirs and vectors
of multiresistant bacteria acquired from and transferable to
humans. A similar situation was observed in Northern
Kenya2
and could be applied to other African rural regions.
Acknowledgments
We thank the team of the Czech University of Life Sciences
Prague in Angola, implementing the project Support
of Agricultural Vocational Training School in Catabola,
Angola, financed within Czech Development Cooperation,
for assistance with sample collection, and to the project
management for allowing this study to happen. The study
374 ALBRECHTOVA ET AL.
was supported by project CEITEC—Central European Institute
of Technology (CZ.1.05/1.1.00/02.0068) from the
European Regional Development Fund. M.D. was supported
by the Operational Program Education for Competitiveness
(CZ.1.07/2.3.00/30.0014) from the European Social Fund.
Disclosure Statement
No competing financial interests exist.
References
1. Aarestrup, F.M. 2006. Antimicrobial Resistance in Bacteria
of Animal Origin. ASM Press, Washington, DC.
2. Albrechtova, K., M. Dolejska, A. Cizek, D. Tausova, J.
Klimes, L. Bebora, and I. Literak. 2012. Dogs of nomadic
pastoralists in northern Kenya are reservoirs of
plasmid-mediated cephalosporin- and quinolone-resistant
Escherichia coli, including pandemic clone B2-O25ST131.
Antimicrob. Agents Chemother. 56:4013–4017.
3. Bar, W., S. Rusch-Gerdes, E. Richter, G. Marquez de
Bar, C. Dittmer, H. Papsdorf, P. Stosiek, P.B. de Rijk,
W.M. Meyers, and F. Portaels. 1998. Mycobacterium
ulcerans infection in a child from Angola: diagnosis by
direct detection and culture. Trop. Med. Int. Health 3:189–
196.
4. Birnboim, H.C., and J. Doly. 1979. A rapid alkaline extraction
procedure for screening recombinant plasmid
DNA. Nucleic Acids Res. 7:1513–1523.
5. Caratolli, A., A. Bertini, L. Villa, V. Falbo, K.L.
Hopkins, and E.J. Threlfall. 2005. Identification of plasmids
by PCR-based replicon typing. J. Microbiol. Methods
63:219–228.
6. Ceccarelli, D., A.M. Salvia, J. Sami, P. Cappuccinelli, and
M.M. Colombo. 2006. New cluster of plasmid-located class
1 integrons in Vibrio cholerae O1 and a dfrA15 cassettecontaining
integron in Vibrio parahaemolyticus isolated in
Angola. Antimicrob. Agents Chemother. 50:2493–2499.
7. Centers for Disease Control. 2004. Standardized Molecular
Subtyping of Foodborne Bacterial Pathogens by
Pulse-Field Gel Electrophoresis. National Molecular Network
for Foodborne Disease Surveillance, Atlanta, GA.
8. CLSI. 2008. Performance Standards for Antimicrobial
Susceptibility Testing. Clinical and Laboratory Standards
Institute, Wayne, PA.
9. Eggert, W., S. Eggert, L. Ferreira, and L. Bernardino.
1992. The pathogen spectrum and its resistance behavior in
children with urinary tract infections in Angola. Kinderartztl.
Prax. 60:46–48.
10. Johnson, T.J., E.M. Bielak, D. Fortini, L.H. Hansen, H.
Hasman, C. Debroy, L.K. Nolan, and A. Carattoli. 2012.
Expansion of the Inc X plasmid family for improved
identification and typing of novel plasmids in drugresisstant
Enterobacteriaceae. Plasmid 68:43–50.
11. Literak, I., M. Dolejska, T. Radimersky, J. Klimes, M.
Friedman, F.M. Aarestrup, H. Hasman, A. Cizek. 2010.
Antimicrobial resistant faecal Escherichia coli in wild
mammals in central Europe: multiresistant Escherichia coli
producing extended-spectrum beta-lactamases in wild
boars. J. Appl. Microbiol. 108:1702–1711.
12. MacPherson, C.L.M., F.X. Meslin, and A.L. Wandeler.
2000. Dogs, Zoonoses, and Public Health. CABI, Wallingford,
UK.
13. Olesen, I., H. Hasman, and F.M. Aarestrup. 2004. Prevalence
of beta-lactamases among ampicillin-resistant
Escherichia coli and Salmonella isolated from food animals
in Denmark. Microb. Drug Resist. 10:334–340.
14. Pelkonen, T., I. Roine, L. Monteiro, M. Correia, A.
Pitkaranta, L. Bernardino, and H. Peltola. 2009. Risk
factors for death and severe neurological sequelae in
childhood bacterial meningitis in sub-Saharan Africa. Clin.
Infect. Dis. 48:1107–1110.
15. WHO. 2012. The Evolving Threat of Antimicrobial Resistance:
Options for Action. World Health Organization,
Geneva, Switzerland.
16. Wirth, T., D. Falush, R. Lan, F. Colles, P. Mensa,
L.H. Wieler, H. Karch, P.R. Reeves, M.C. Maiden, H.
Ochman, and M. Achtman. 2006. Sex and virulence
in Escherichia coli: an evolutionary perspective. Mol. Microbiol.
60:1136–1151.
Address correspondence to:
Katerina Albrechtova, DVM, PhD
University of Veterinary
and Pharmaceutical Sciences Brno
Palackeho 1–3
61242 Brno
Czech Republic
E-mail: albkat@seznam.cz
MULTIDRUG RESISTANT E. COLI IN DOGS IN ANGOLA 375
Příloha 26
JAMBOROVA, I., DOLEJSKA, M., VOJTECH, J., GUENTHER, S., URICARIU, R., DROZDOWSKA, J.,
PAPOUSEK, I., PASEKOVA, K., MEISSNER, W., HORDOWSKI, J., CIZEK, A., LITERAK, I., 2015,
Plasmid-mediated resistance to cephalosporins and fluoroquinolones in various Escherichia coli
sequence types isolated from rooks wintering in Europe: Applied and Environmental
Microbiology, v. 81, p. 648-657.
Souhrn
V této studii bylo sledováno rozšíření ESBL, AmpC a plazmidově determinované rezistence k fluorochinolonům
u E. coli z havranů polních v devíti zimovištích v Evropě. Selektivní izolací na půdách s antibiotiky byly získány
izoláty s ESBL nebo AmpC ve 12 % vzorků trusu, zatímco PMQR geny byly identifikovány v 6 % vzorků.
Rezistence byla spojena převážně s obecně rozšířenými geny blaCTX-M-1, blaCTX-M-15, blaCMY-2 a qnrS1. V trusu
havranů byly prokázány významné multirezistentní sekvenční linie s patogenním potenciálem.
Plasmid-Mediated Resistance to Cephalosporins and Fluoroquinolones
in Various Escherichia coli Sequence Types Isolated from Rooks
Wintering in Europe
Ivana Jamborova,a
Monika Dolejska,a,b
Jiri Vojtech,a,b
Sebastian Guenther,c
Raluca Uricariu,a
Joanna Drozdowska,a,d
Ivo Papousek,a
Katerina Pasekova,a
Wlodzimierz Meissner,d
Jozef Hordowski,e
Alois Cizek,b,f
Ivan Literaka,b
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech
Republica
; CEITEC, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republicb
; Institute of Microbiology and Epizootics, Veterinary Faculty, Free
University Berlin, Berlin, Germanyc
; Avian Ecophysiology Unit, Department of Vertebrate Ecology and Zoology, University of Gdan´sk, Gdan´sk, Polandd
; Arboretum i Zaklad
Fizjografii w Bolestraszycach, Przemysl, Polande
; Department of Infectious Diseases and Microbiology, Faculty of Veterinary Medicine, University of Veterinary and
Pharmaceutical Sciences Brno, Brno, Czech Republicf
Extended-spectrum-beta-lactamase (ESBL)-producing, AmpC beta-lactamase-producing, and plasmid-mediated quinolone resistance
(PMQR) gene-positive strains of Escherichia coli were investigated in wintering rooks (Corvus frugilegus) from eight
European countries. Fecal samples (n ‫؍‬ 1,073) from rooks wintering in the Czech Republic, France, Germany, Italy, Poland, Serbia,
Spain, and Switzerland were examined. Resistant isolates obtained from selective cultivation were screened for ESBL, AmpC,
and PMQR genes by PCR and sequencing. Pulsed-field gel electrophoresis and multilocus sequence typing were performed to
reveal their clonal relatedness. In total, from the 1,073 samples, 152 (14%) cefotaxime-resistant E. coli isolates and 355 (33%) E.
coli isolates with reduced susceptibility to ciprofloxacin were found. Eighty-two (54%) of these cefotaxime-resistant E. coli isolates
carried the following ESBL genes: blaCTX-M-1 (n ‫؍‬ 39 isolates), blaCTX-M-15 (n ‫؍‬ 25), blaCTX-M-24 (n ‫؍‬ 4), blaTEM-52 (n ‫؍‬ 4),
blaCTX-M-14 (n ‫؍‬ 2), blaCTX-M-55 (n ‫؍‬ 2), blaSHV-12 (n ‫؍‬ 2), blaCTX-M-8 (n ‫؍‬ 1), blaCTX-M-25 (n ‫؍‬ 1), blaCTX-M-28 (n ‫؍‬ 1), and an unspecified
gene (n ‫؍‬ 1). Forty-seven (31%) cefotaxime-resistant E. coli isolates carried the blaCMY-2 AmpC beta-lactamase gene.
Sixty-two (17%) of the E. coli isolates with reduced susceptibility to ciprofloxacin were positive for the PMQR genes qnrS1 (n ‫؍‬
54), qnrB19 (n ‫؍‬ 4), qnrS1 and qnrB19 (n ‫؍‬ 2), qnrS2 (n ‫؍‬ 1), and aac(6=)-Ib-cr (n ‫؍‬ 1). Eleven isolates from the Czech Republic
(n ‫؍‬ 8) and Serbia (n ‫؍‬ 3) were identified to be CTX-M-15-producing E. coli clone B2-O25b-ST131 isolates. Ninety-one different
sequence types (STs) among 191 ESBL-producing, AmpC-producing, and PMQR gene-positive E. coli isolates were determined,
with ST58 (n ‫؍‬ 15), ST10 (n ‫؍‬ 14), and ST131 (n ‫؍‬ 12) predominating. The widespread occurrence of highly diverse ESBL- and
AmpC-producing and PMQR gene-positive E. coli isolates, including the clinically important multiresistant ST69, ST95, ST117,
ST131, and ST405 clones, was demonstrated in rooks wintering in various European countries.
The incidence of bacteria resistant to cephalosporins and fluoroquinolones
is growing steadily and constitutes a serious risk
for human and animal health. The major mechanism conferring
resistance to cephalosporins is mediated by extended-spectrum
beta-lactamases (ESBLs) and AmpC beta-lactamases (1). Although
plasmid-mediated quinolone resistance (PMQR) genes
confer only a low level of resistance to fluoroquinolones and resistance
is mainly caused by point mutations of the quinolone
resistance-determining region (QRDR), coding for gyrase and topoisomerase
(2), the interaction between mutations in the QRDR
and PMQR genes leads to higher levels of resistance to fluoroquinolones
(3).
Wild animals that do not come directly into contact with antibiotics
are affected by their use in human and veterinary medicine.
The close proximity of wild animals with humans and domestic
animals plays an important role in the transmission of pathogens
to wildlife, thus potentially creating an additional environmental
reservoir of antibiotic-resistant bacteria (4). Wild birds, especially
corvids, feeding on garbage dumps near urban agglomerations are
at high risk of being colonized by multidrug-resistant Escherichia
coli isolates. They have been identified to be significant carriers
and vectors of commensal and pathogenic bacteria with various
mechanisms of resistance (4, 5). The probable origin of the majority
of wintering rooks in both the central and western parts of
continental Europe is mainly in Eastern Europe, including Russia,
Belarus, and Ukraine. However, wintering rooks are rare in Italy
and Spain nowadays (6).
With the implementation of multilocus sequence typing
(MLST) to characterize E. coli strains and our deeper understanding
of microevolution in the core bacterial genome, certain genetic
lineages with special features supporting their pandemicity have
been described (7, 8). The most studied phylogenetic lineage today
in terms of antibiotic resistance is E. coli sequence type (ST)
Received 29 July 2014 Accepted 5 November 2014
Accepted manuscript posted online 7 November 2014
Citation Jamborova I, Dolejska M, Vojtech J, Guenther S, Uricariu R, Drozdowska J,
Papousek I, Pasekova K, Meissner W, Hordowski J, Cizek A, Literak I. 2015. Plasmidmediated
resistance to cephalosporins and fluoroquinolones in various
Escherichia coli sequence types isolated from rooks wintering in Europe. Appl
Environ Microbiol 81:648–657. doi:10.1128/AEM.02459-14.
Editor: H. Nojiri
Address correspondence to Ivana Jamborova, jamborovai@vfu.cz.
Supplemental material for this article may be found at http://dx.doi.org/10.1128
/AEM.02459-14.
Copyright © 2015, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AEM.02459-14
648 aem.asm.org January 2015 Volume 81 Number 2Applied and Environmental Microbiology
onAugust18,2015byguesthttp://aem.asm.org/Downloadedfrom
131 (ST131). This lineage harbors a wide range of virulence genes
and various plasmid-mediated resistance genes, and it is involved
in the global spread of the CTX-M-15 beta-lactamase. Its high
level of virulence combined with carriage of transferable elements
encoding multidrug resistance is likely responsible for the pandemic
success of ST131 strains (9). Even as the ST131 clone is
known to cause community-onset infections in humans, including
urinary tract infections, bacteremia, and neonatal sepsis, it has
also been identified in companion animals, poultry, livestock,
wild animals, and food (10–12). Other lineages with high proportions
of multidrug-resistant strains responsible for communityonset
and hospital-acquired infections, such as ST69, ST95,
ST117, and ST405 (phylogenetic group D), ST10 (phylogenetic
group A), and ST23 (phylogenetic group B1), have been described
(13, 14).
The finding of particular E. coli lineages in food, water, environmental,
and nonhuman sources indicates the entirely unexplored
complexity of transmission routes (13), whereby migrating
birds may play an important role in the circulation of epidemiologically
important E. coli clones and may pose a risk of environmental
contamination. In the study described in this paper, rooks
(Corvus frugilegus; which are medium-sized corvids) commonly
wintering in central and western parts of continental Europe were
examined for the presence of ESBL- and AmpC-producing E. coli
isolates and/or isolates carrying PMQR genes. Pulsed-field gel
electrophoresis (PFGE) and MLST, including eBURST analysis,
were used to reveal the clonal relatedness of these E. coli isolates.
This study follows a recent study in European rooks by Literak et
al. (6), where PMQR genes in pooled samples of members of the
Enterobacteriaceae family were investigated, regardless of bacterial
species.
MATERIALS AND METHODS
Collection of rook feces. Feces of rooks was collected in nine roosting
places in eight European countries during the winter (December to February)
of 2010-2011. An exception was France, where the samples were
collected in April 2011. Fresh feces were picked up individually from
plastic film exposed overnight on the ground beneath the roosting place
using a sterile cotton swab, dipped in Amies transport medium (Dispolab,
Czech Republic), and then transported to the laboratory at room temperature
(6). All fecal samples were obtained from one sampling site per
country except for Germany and Poland. A total of 1,073 fecal samples
from the Czech Republic (n ϭ 150 fecal samples), France (n ϭ 31), three
sampling sites in Germany (Schortens-Heidmühle [53°23=N, 7°58=E; n ϭ
54 samples], Wilhelmshaven [53°32=N, 8°04=E; n ϭ 33 samples], Schortens-Heidmühle,
Huntsteert [53°32=N, 7°55=E; n ϭ 13 samples]), Italy
(n ϭ 145), two locations in Poland (Gdynia, n ϭ 150 samples; Jaroslaw,
n ϭ 148 samples), Serbia (n ϭ 150), Spain (n ϭ 150), and Switzerland (n ϭ
49) were collected. Descriptions of the location and exact time of sampling
have been described in our previous study (6).
Isolation and determination of E. coli strains producing ESBLs or
AmpC or carrying PMQR genes. Fecal samples were transferred from
Amies transport medium to buffered peptone water (Oxoid, United Kingdom)
and cultivated overnight. Subsequently, samples were subcultivated
on MacConkey agar (MCA) containing cefotaxime (2 mg/liter) and in
parallel on MCA with ciprofloxacin (0.05 mg/liter). Isolated coliform colonies
were identified by matrix-assisted laser desorption ionization
(MALDI)–time of flight (TOF) mass spectrometry (MALDI biotyper;
Bruker Daltonics, USA). The colonies grown on MCA supplemented with
cefotaxime were tested for the production of ESBLs using a double-disk
synergy (DDS) test (15). Simultaneously, the isolates were screened for
AmpC using a cefoxitin (30-␮g) disk; those a showing cutoff value of Յ18
mm were confirmed to be AmpC producers by the cefoxitin-cloxacillin
(CC)-DDS method (16), where cloxacillin was adequately replaced by
oxacillin (128 mg/liter) (17). The AmpC production phenotype of isolates
positive by the CC-DDS method but negative for all AmpC genes tested
was confirmed using a MASTDISCS ID AmpC and ESBL test (Mast Diagnostics,
Merseyside, United Kingdom). Each ESBL-producing isolate
was screened by PCR for the following resistance genes responsible for the
ESBL-producing phenotype: blaCTX-M, blaTEM, blaOXA, and blaSHV (18).
Specific primers for determination of CTX-M subgroups were used (19,
20). AmpC genes blaDHA, blaACC-1, blaACC-2, blaMOX, blaCMY, and blaFOX
were identified by PCR (21). The sequence type of the blaCMY gene was
determined using forward primer CMY 2/F (5=-AACACACTGATTGCG
TCT-3=) and reverse primer CMY 2/R (5=-CTGGGCCTCATCGTCAGT-
3=), based on the reference sequence with GenBank accession number
HQ680723. The colonies grown on MCA with ciprofloxacin were investigated
for PMQR genes qnrA, qnrB, qnrC, qnrD, qnrS, aac(6=)-Ib-cr, qepA,
and oqxAB (18). All PCR products of the ESBL, AmpC, and PMQR genes
were analyzed by sequencing.
Antibiotic susceptibility testing. ESBL-producing and PMQR genepositive
E. coli isolates were tested, using the disk diffusion method, for
susceptibility to the following 13 antimicrobial agents according to
CLSI guidelines (15, 22): amoxicillin-clavulanic acid (30 ␮g), ampicillin
(10 ␮g), cephalothin (30 ␮g), ceftazidime (30 ␮g), chloramphenicol
(30 ␮g), ciprofloxacin (5 ␮g), gentamicin (10 ␮g), nalidixic acid
(30 ␮g), streptomycin (10 ␮g), sulfamethoxazole-trimethoprim (25
␮g), sulfonamide compounds (300 ␮g), tetracycline (30 ␮g), and imipenem
(10 ␮g).
Molecular typing methods. The epidemiological relatedness of the E.
coli isolates was detected by XbaI PFGE and MLST with an MSTree (23).
Macrorestriction patterns and sequence type complexes in the MSTree
were calculated using BioNumerics (version 6.6) software (Applied
Maths, Ghent, Belgium). Cluster analysis of the Dice similarity indices was
done to generate a dendrogram describing the relationships among the
PFGE profiles. The minimum level for similarity between patterns was
defined to be 85% (24).
PCR for MLST was based on seven housekeeping genes (adk, fumC,
gyrB, icd, mdh, purA, and recA). Different sequences of a given locus were
assigned allele numbers on the basis of the entries in the E. coli MLST
database (http://mlst.warwick.ac.uk/mlst/), and each unique combination
of alleles (the allelic profile) was determined to be a sequence type
(ST) (7). The eBURST (http://eburst.mlst.net/) algorithm was used for
determining clonal complexes of STs (STCs), whereby STs sharing six
or more loci were assigned to defined STCs (25). The phylogenetic type
affiliation was determined using Structure software analysis based on
seven housekeeping genes (http://pritch.bsd.uchicago.edu/structure)
and for six isolates was determined by a multiplex PCR assay (26).
RESULTS
ESBL, AmpC, and PMQR genes in E. coli isolates. A total of 152
(14%) cefotaxime-resistant E. coli isolates were found in the 1,073
samples tested. Eighty-two (54%) of these 152 cefotaxime-resistant
E. coli isolates carried an ESBL gene, and none of them harbored
an AmpC gene. The blaCTX-M-1 gene was predominant (n ϭ
39), followed by blaCTX-M-15 (n ϭ 25). The other ESBL genes were
rare and more locally distributed (Tables 1 and 2). The 82 ESBLproducing
isolates belonged to phylogenetic groups A (n ϭ 32
isolates, 39%), B1 (n ϭ 2, 2%), B2 (n ϭ 12, 15%), A ϫ B1 (n ϭ 20,
24%), and ABD (n ϭ 16, 20%). The genetic background of hybrid
group A ϫ B1 is more likely from ancestor groups A and B1, while
ABD is a more diverse group with multiple sources of ancestry.
Due to extensive recombination within these two hybrid groups,
higher proportions of pathogens were assigned to these groups
(7). Twenty-two isolates (27% of 82 ESBL-producing isolates)
with the ESBL phenotype also carried the aac(6=)-Ib-cr gene, reResistance
in Various E. coli STs from Rooks in Europe
January 2015 Volume 81 Number 2 aem.asm.org 649Applied and Environmental Microbiology
onAugust18,2015byguesthttp://aem.asm.org/Downloadedfrom
sponsible for resistance to fluoroquinolones and aminoglycosides.
Thirty-one (38%) and 17 isolates (21%) also carried blaTEM-1 and
blaOXA-1, respectively. In Germany, two SHV-12-producing isolates
also carried the qnrS1 gene (see Table S1 in the supplemental
material).
Fifty-six (37%) of 152 cefotaxime-resistant E. coli isolates displayed
the AmpC phenotype. The blaCMY-2 gene was the only
AmpC gene identified in 47 (31%) of the 152 cefotaxime-resistant
E. coli isolates (Tables 1 and 3). The 47 CMY-2-producing E. coli
isolates were members of phylogenetic groups A (n ϭ 9 isolates,
19%), B1 (n ϭ 3, 6%), B2 (n ϭ 5, 11%), D (n ϭ 6, 13%), A ϫ B1
(n ϭ 8, 17%), and ABD (n ϭ 15, 32%); and the phylogenetic
group of 1 isolate was not specified. Ten isolates (21%, n ϭ 47)
also carried blaTEM-1, and the qnrB19-like gene was found in
one isolate. One isolate from Gdynia, Poland, carried the qnrS1
and blaTEM-135 genes (see Table S2 in the supplemental mate-
rial).
A total of 355 (33%) of the 1,073 E. coli isolates evaluated were
obtained by selective cultivation on medium with ciprofloxacin.
Sixty-two (17%) of these 355 isolates carried PMQR genes, with
the qnrS1 gene being the most frequently detected (being found in
54 isolates from 5 countries). Other isolates carried the qnrB19 or
aac(6=)-Ib-cr gene (Tables 1 and 4). Isolates with PMQR genes
(total n ϭ 62) belonged to phylogenetic groups A (n ϭ 25 isolates,
40%), B1 (n ϭ 9, 15%), A ϫ B1 (n ϭ 18, 29%) and ABD (n ϭ 10,
16%). Forty-six isolates (74%) also carried blaTEM-1, and 7 isolates
(11%) from a Polish locality contained blaTEM-32 (see Table S3 in
the supplemental material).
Antibiotic resistance phenotypes. Almost all (66 of 82) ESBLproducing
isolates (80%) were multiresistant (resistant to three or
more antibiotic groups) (see Table S1 in the supplemental material).
ESBL-positiveE. coli isolatesshowedresistancetosulfonamides
(76%), tetracycline (61%), trimethoprim-sulfamethoxazole (57%),
nalidixic acid (52%), ciprofloxacin (44%), streptomycin (27%),
gentamicin (23%), amoxicillin-clavulanic acid (16%), ceftazidime
(16%),andchloramphenicol(7%).Highlevelsofresistanceto7to11
antimicrobial agents were observed in the isolates from Czech and
Serbian localities due to the presence of multidrug-resistant ESBLproducing
E. coli clones and clonal complexes ST131 (n ϭ 11),
STC10 (n ϭ 7), ST3014 (n ϭ 2), and ST405 (n ϭ 1). In the other
localities,isolateswithhighratesofresistanceto7to10antimicrobial
agents were distributed among the predominant clonal complexes
found in this study, i.e., STC10 (n ϭ 5), STC155 (n ϭ 2), and STC23
(n ϭ 1); and isolates with high rates of resistance to 7 to 10 antimi-
crobialagentswerefoundonlysporadicallyamongotherminorcomplexes
or STs (the number of multidrug-resistant isolates in each
complex or ST does not exceed 1).
All AmpC-positive isolates were multiresistant (see Table S2 in
the supplemental material) and showed resistance to ceftazidime
(79%), nalidixic acid (51%), sulfonamides (36%), tetracycline
(34%), streptomycin (30%), trimethoprim-sulfamethoxazole
(28%), ciprofloxacin (23%), chloramphenicol (15%), and gentamicin
(6%). Eleven of 18 AmpC-producing E. coli isolates in
Gdynia, Poland, showed high levels of resistance to 7 to 11
antimicrobial agents and mainly belonged to complexes STC86
(n ϭ 3), STC10 (n ϭ 2), and STC155 (n ϭ 2). In the Czech
Republic, only 5 of 27 AmpC-producing isolates were highly
multiresistant (7 to 11 antimicrobial agents) and showed various
STs.
A total of 27 (44%) PMQR gene-positive isolates were multiresistant
(see Table S3 in the supplemental material). PMQR gene-positiveE.
coli isolatesshowedresistancetoampicillin(85%),tetracycline
(52%), nalidixic acid (35%), streptomycin (32%), sulfonamides
(24%), trimethoprim-sulfamethoxazole (21%), amoxicillin-clavulanic
acid (13%), ciprofloxacin (8%), chloramphenicol (6%), and
gentamicin (2%). The isolates showing resistance to up to 7 to 9
antimicrobial agents belonged to three dominant clonal complexes
found in this study: STC10 (n ϭ 2), STC23 (n ϭ 2), and
TABLE 1 Distribution and percentage of ESBL, AmpC, and PMQR genes
Gene
No. (%) of isolates
Czech Republic France Germany Italy Gdynia, Poland Jaroslaw, Poland Serbia Spain Switzerland Total
ESBL genes 82 (100)
CTX-M-1 17 8 13 1 39 (48)
CTX-M-8 1 1 (1)
CTX-M-14 1 1 2 (2)
CTX-M-15 13 6 2 4 25 (30)
CTX-M-24 3 1 4 (5)
CTX-M-25 1 1 (1)
CTX-M-28 1 1 (1)
CTX-M-55 2 2 (2)
TEM-52 3 1 4 (5)
SHV-12 2 2 (2)
NDa
1 1 (1)
AmpC CMY-2 27 18 2 47 (100)
PMQR genes 62 (100)
qnrS1 25 11 12 1 5 54 (87)
qnrS2 1 1 (2)
qnrB19 4 4 (6)
aac(6=)-Ib-cr 1 1 (2)
qnrS1 and qnrB19 1 1 2 (3)
a
ND, not detected.
Jamborova et al.
650 aem.asm.org January 2015 Volume 81 Number 2Applied and Environmental Microbiology
onAugust18,2015byguesthttp://aem.asm.org/Downloadedfrom
TABLE 2 Distribution of STs related to ESBL types in eight European countries
ESBL gene ST STC
Phylogenetic
groupc
No. (%) of isolates
Czech Republic Germany Gdynia, Poland Jaroslaw, Poland Serbia Spain Total
blaCTX-M-1 ST10a
STC10 A 1 2 1 4
ST48a
STC10 A 2 1 3
ST58a
STC155 A ϫ B1 7 7
ST101 STC101 B1 1 1
ST106 STC69 ABD 1 1
ST115 STC38 ABD 4 4
ST154 STC155 A ϫ B1 1 1
ST206a
STC10 A ϫ B1 1 1
ST351a
STC351 ABD 1 1
ST394 STC69 ABD 1 1
ST398a
STC10 A ϫ B1 1 1
ST542a
STC542 ABD 1 1
ST609 STC10 A ϫ B1 1 1
ST617a
STC10 A 1 1
ST641a
STC86 ABD 1 1
ST669 STC10 A 1 1
ST746a
STC10 A 1 1 2
ST1011 STC1011 ABD 1 1
ST1141 STC10 A 1 1
ST1725 STC23 A ϫ B1 1 1
ST1832 STC1832 ABD 2 2
ST2226 STC10 A 1 1
ST3017b
STC155 A ϫ B1 1 1
blaCTX-M-8 ST58a
STC155 A ϫ B1 1 1
blaCTX-M-14 ST1642 STC155 A ϫ B1 1 1
ST3056b
None ABD 1 1
blaCTX-M-15 ST10a
STC10 A 1 1
ST131a
STC131 B2 8 3 11
ST167a
STC10 A 1 1 2
ST361a
STC361 A ϫ B1 1 1
ST398a
STC10 A ϫ B1 1 1
ST405 STC405 ABD 1 1
ST448a
STC155 A ϫ B1 1 1
ST617a
STC10 A 4 4
ST1249 None A ϫ B1 1 1
ST3015a,b
STC10 A 1 1
ST3018b
None ABD 1 1
blaCTX-M-24 ST3014b
None A 2 1 3
ST3020b
STC10 A 1 1
blaCTX-M-25 ST155a
STC155 A ϫ B1 1 1
blaCTX-M-28 ST167a
STC10 A 1 1
blaCTX-M-55 ST10a
STC10 A 2 2
blaTEM-52 ST88 STC23 B1 1 1
ST1638 STC10 A 2 2
ST3019b
None ABD 1 1
blaSHV-12 ST746a
STC10 A 2 2
NDd
ST3223b
STC131 B2 1 1
Total prevalence 38 (25.3) 19 (19) 17 (11.3) 3 (2) 4 (2.7) 1 (0.7) 82 (7.6)
a
STs capable of carrying different plasmid-mediated resistance genes (ESBL, AmpC, PMQR genes) in our study.
b
A novel ST.
c
Phylogenetic groups were calculated using the Structure program. A ϫ B1 and ABD are hybrid groups that were likely derived from ancestor groups A and B1 (A ϫ B1) or
multiple sources of ancestry (ABD) (7).
d
ND, not detected.
Resistance in Various E. coli STs from Rooks in Europe
January 2015 Volume 81 Number 2 aem.asm.org 651Applied and Environmental Microbiology
onAugust18,2015byguesthttp://aem.asm.org/Downloadedfrom
STC155 (n ϭ 2). None of the PMQR gene-positive E. coli isolates
selected on medium with ciprofloxacin were ESBL or AmpC
producers.
Clonal similarity and MLST of E. coli isolates carrying ESBL,
AmpC, or PMQR genes. Overall, all isolates tested by PFGE, except
ESBL-producing strains in the Czech Republic, showed very
high variability in all localities (see Fig. S1 to S3 in the supplemental
material). Significant clonal similarity was demonstrated in the
Czech Republic, where 3 of 16 clusters of 38 ESBL-producing
strains represented by STs ST131 (n ϭ 8, 21%), ST58 (n ϭ 7,
18%), and ST617 (n ϭ 5, 13%) were the most frequently identified.
ST131 isolates were assigned to one cluster on the basis of a
less stringent criterion (a Dice similarity index of their macrorestriction
profiles of Ն79.6%). The multilocus sequence types in
Germany and Gdynia, Poland, were more variable. ST10 in Germany
and ST115 forming one cluster in Gdynia, Poland, were
predominant (see Fig. S1 in the supplemental material). Eight
novel E. coli STs (Table 2) producing an ESBL were identified in
our study. No significant clonal similarity between isolates carrying
AmpC or PMQR genes was found in any location (see Fig.
S2 and S3 in the supplemental material). In the Czech Republic,
a cluster represented by ST351 (n ϭ 4) isolates carrying
blaCMY-2 and ST48 (n ϭ 4) isolates harboring the qnrS1 gene
was predominant. Identical pulsotypes were found in each locality,
but only in minimal amounts (not exceeding four).
Three and six novel E. coli STs (Tables 3 and 4) with AmpC and
PMQR genes, respectively, were identified. Six E. coli isolates
were nontypeable by XbaI PFGE (see Fig. S1 and S3 in the
supplemental material).
Overall, 91 different STs were determined among 191 ESBL- and
AmpC-producing and PMQR gene-positive E. coli strains from 9
rook roosting places in 8 European countries, with ST58 (n ϭ 15),
ST10 (n ϭ 14), and ST131 (n ϭ 12) being the predominant types
(Tables 2 to 4). Thirty-seven percent (71 of 191) of the ESBL- and
AmpC-producing and PMQR gene-positive E. coli strains belonged
to clonal complex STC10. STC155 was the second-largest complex
detectedandincluded33isolates(17%).STC23consistedof8isolates
(4%). Genetic relatedness within each clonal complex can be seen in
Fig. 1 (based on data from the MLST database [http://mlst.warwick
.ac.uk/mlst/, accessed 23 July 2014]).
Twelve isolates from the Czech Republic (n ϭ 8), Serbia (n ϭ
3), and Jaroslaw, Poland (n ϭ 1), were identified to be pandemic
multiresistant E. coli clone B2-O25b-ST131. Eleven ST131 isolates
were positive for the blaCTX-M-15 gene and showed closely related
TABLE 3 Distribution of STs related to the blaCMY-2 AmpC gene in eight European countries
ST STC Phylogenetic groupc
No. (%) of isolates
Czech Republic Gdynia, Poland Jaroslaw, Poland Total
ST10a
STC10 A 3 3
ST23a
STC23 B1 1 1
ST57 STC57 ABD 1 1
ST58a
STC155 A ϫ B1 2 2 4
ST69a
STC69 ABD 2 2
ST93a
STC10 A 2 2
ST95 STC95 B2 1 1
ST117 STC117 ABD 1 2 3
ST131a
STC131 B2 1 1
ST351a
STC351 ABD 4 4
ST354 STC354 ABD 1 1
ST429 STC429 B2 3 3
ST453 STC86 ABD 3 3
ST615 STC10 A ϫ B1 2 2
ST665 None ABD 1 1
ST770 STC770 D 1 1
ST963 STC38 D 3 3
ST1056 STC155 B1 1 1
ST1167 STC155 A ϫ B1 2 2
ST1431 STC1431 B1 1 1
ST3274 STC10 Ad
1 1
ST3568 None Ad
1 1
ST3778 STC117 Dd
1 1
ST4274b
STC57 Dd
1 1
ST4275b
STC10 Ad
1 1
ST4276b
STC10 Ad
1 1
NTe
1 1
Total prevalence 27 (18) 18 (12) 2 (1.4) 47 (4.4)
a
STs capable of carrying different plasmid-mediated resistance genes (ESBL, AmpC, PMQR genes) in our study.
b
A novel ST.
c
Phylogenetic groups were calculated using the Structure program. A ϫ B1 and ABD are hybrid groups that were likely derived from ancestor groups A and B1 (A ϫ B1) or
multiple sources of ancestry (ABD) (7).
d
Tested by multiplex PCR assay (26).
e
NT, nontypeable.
Jamborova et al.
652 aem.asm.org January 2015 Volume 81 Number 2Applied and Environmental Microbiology
onAugust18,2015byguesthttp://aem.asm.org/Downloadedfrom
PFGE profiles (defined by a 79.6% band similarity). Six isolates
carried all three resistance genes (blaTEM-1, blaOXA-1, aac(6=)-Ib-cr)
typical for this pandemic clone; moreover, the plasmid-mediated
quinolone resistance gene qnrB1 was detected in two isolates. The
remaining six ST131 isolates carried the blaOXA-1 and aac(6=)-Ib-cr
genes. One ST131 isolate from Jaroslaw, Poland, carried the
blaCMY-2 gene.
According to MLST, other important sequence types were
found in our study. Four ST69 isolates from the Czech Republic
(n ϭ 3) and Jaroslaw, Poland (n ϭ 1), carried blaCMY-2 (n ϭ 2) and
qnrS1 (n ϭ 2) genes (Tables 3 and 4). An ST95 strain (n ϭ 1)
from Jaroslaw, Poland, and ST117 strains (n ϭ 3) from the
Czech Republic (n ϭ 1) and Gdynia, Poland (n ϭ 2), carried
AmpC beta-lactamase CMY-2 (Table 3). One blaCTX-M-15-proTABLE
4 Distribution of STs related to PMQR gene type in eight European countries
PMQR gene ST STC
Phylogenetic
groupc
No. (%) of isolates
Czech Republic
Gdynia,
Poland
Jaroslaw,
Poland Serbia Spain Total
qnrS1 ST10a
STC10 A 1 1 1 3
ST23a
STC23 B1 2 2
ST34 STC10 A 1 1
ST46 STC10 A 1 1
ST48a
STC10 A 4 4
ST58a
STC155 A ϫ B1 2 1 3
ST69a
STC69 ABD 1 1 2
ST93a
STC10 A 1 1
ST155a
STC155 A ϫ B1 1 1 2
ST162 STC155 A ϫ B1 1 1
ST206a
STC10 A ϫ B1 1 1
ST224 STC155 A ϫ B1 1 1
ST345 STC23 B1 1 1
ST351a
STC351 ABD 1 1
ST398a
STC10 A ϫ B1 1 1 2
ST399 STC399 A ϫ B1 1 1
ST442 STC155 B1 1 1
ST450 STC4358 A 1 1
ST542a
STC542 ABD 2 1 3
ST762 STC10 A 1 1
ST767 STC155 A ϫ B1 1 1
ST1137 STC10 A 2 2
ST1251 STC10 A 1 1
ST1433 None A ϫ B1 1 1
ST1582 STC155 A ϫ B1 1 1
ST1720 ST86 ABD 1 1
ST1882 None ABD 1 1
ST2179 None A ϫ B1 1 1
ST2526 None B1 1 1
ST2705 STC10 A 1 1
ST2722 STC155 B1 3 3
ST3270b
STC10 A 3 3
ST3271b
STC542 ABD 1 1
ST3273b
STC10 A ϫ B1 1 1
ST3309b
STC4358 A 1 1
ST3310b
STC23 B1 1 1
qnrS2 ST10a
STC10 A 1 1
qnrB19 ST2491 STC10 A 2 2
ST3107 STC10 A ϫ B1 1 1
ST3272b
STC10 A 1 1
aac(6=)-Ib-cr ST90 STC23 A ϫ B1 1 1
qnrS1-qnrB19 ST641a
STC86 ABD 1 1
ST3272b
STC10 A 1 1
Total prevalence 27 (18) 16 (10.7) 12 (8.1) 2 (1.3) 5 (3.3) 62 (5.8)
a
STs capable of carrying different plasmid-mediated resistance genes (ESBL, AmpC, PMQR genes) in our study.
b
A novel ST.
c
Phylogenetic groups were calculated using the Structure program. A ϫ B1 and ABD are hybrid groups that were likely derived from ancestor groups A and B1 (A ϫ B1) or
multiple sources of ancestry (ABD) (7).
Resistance in Various E. coli STs from Rooks in Europe
January 2015 Volume 81 Number 2 aem.asm.org 653Applied and Environmental Microbiology
onAugust18,2015byguesthttp://aem.asm.org/Downloadedfrom
ducing isolate from the Czech Republic belonged to ST405
(Table 2).
DISCUSSION
The most predominant ESBL gene in our study was blaCTX-M-1
(n ϭ 39; 48%), followed by blaCTX-M-15 (n ϭ 25; 30%). The distribution
of the other ESBLs was rare and local. We assume that
both humans and domestic animals are the likely sources of the
ESBL genes found in the rook E. coli isolates. CTX-M-14 and
CTX-M-15 are the major ESBL types in human strains worldwide
(11, 13). On the other hand, the most frequently reported ESBL in
European animal isolates is CTX-M-1, followed by CTX-M-14,
TEM-52, and SHV-12 (1). CTX-M-1 is the most predominant
ESBL type in isolates from companion and food-producing animals
and occurs to a lesser extent in humans (11). The presence of
CTX-M-24 in rook isolates from the Czech Republic and Poland
constitutes an interesting finding, since this ESBL type is generally
restricted to Asia (27) and reported only sporadically in other
parts of the world (28). The highest prevalence of rooks colonized
by ESBL producers (n ϭ 38, 25.3%) was in the Czech Republic.
The sampling site in the Czech Republic was located in the National
Nature Reserve, which is surrounded by fields, agricultural
production areas, and urban agglomerations and which has a
wastewater treatment plant and garbage dumps nearby. The distribution
of ESBL genes closely corresponded to that previously
described in hospital facilities (29, 30), domestic animals (31), and
the environment, including wild birds and wastewater treatment
plant effluent (5, 32, 33), within that country. In Germany, the
highest distribution of ESBL-producing E. coli strains was found at
two sampling sites. In a rural area with high level of agriculture,
the blaCTX-M-1 gene was predominant (60%), while the second
location, an urban area near a hospital clinic, showed high proportions
of isolates carrying blaCTX-M-15 (50%) and blaSHV-12
(25%). On the other hand, E. coli strains from rooks in localities in
Spain, Italy, and France with known high percentages of ESBLproducing
strains in humans (34) showed a very low (0.0 to 0.3%)
prevalence of ESBLs. Our results likely reflect the lower levels of
environmental contamination by ESBL-producing bacteria in the
specific localities near the roosting places examined.
The only AmpC beta-lactamase detected in our study was
CMY-2, found in E. coli isolates from the Czech Republic and
Poland. CMY-2 is the most common type of AmpC enzymes
FIG 1 eBURST diagram showing the clustering of E. coli STs belonging to the three main complexes (STC10, STC23, and STC155) that were isolated from the
feces of European rooks. Each ST is represented as a node. Single-locus variants are connected with a line. The STs found in our study are displayed as numbered
STs in a pink circle. Blue, predicted founders; yellow, subgroup founders. Clonal complex designations are based on the STs which originally constituted the
respective clonal complexes. Designations of complexes constituted by merging of two or more former complexes are based on the designation of the oldest such
(sub)complex (25).
Jamborova et al.
654 aem.asm.org January 2015 Volume 81 Number 2Applied and Environmental Microbiology
onAugust18,2015byguesthttp://aem.asm.org/Downloadedfrom
among Enterobacteriaceae in farm and companion animals, food
products, as well as humans. Other types of AmpC beta-lactamases
are scarcely reported (1, 11). It has been suggested that poultry
can be an important reservoir of CMY-2 AmpC beta-lactamases
(1).
The most predominant PMQR gene found among E. coli isolates
in our study was qnrS1. Other PMQR genes, qnrS2, qnrB19,
and aac(6=)-Ib-cr, were less frequently detected and showed a local
distribution. The locations most affected by a noticeable colonization
of rooks by PMQR gene-harboring E. coli isolates were the
roosting places in the Czech Republic and Poland. The occurrence
of qnrS genes in E. coli isolates from wild water birds has been
previously described in the Czech Republic and on the Baltic Sea
coast of Poland (5). A high prevalence of the qnrS1 gene among
Salmonella spp. and E. coli isolates from domestic animals, food,
and the environment has been reported in Germany, Italy, Poland,
and Spain (35). On the basis of the findings of a recent study
from the Czech Republic, broilers could be considered a source of
qnrS1- and qnrB19-harboring E. coli isolates (36). The roosting
place examined in the Czech Republic is surrounded by poultry
farms that spread the bedding material onto the fields as fertilizer,
and this material likely serves as a source of PMQR gene-positive
bacteria in the environment where the rooks seek food. Rooks
from night roosts in Gdynia, Poland, use both urbanized areas and
the municipal rubbish dump as foraging sites. Hence, these birds
may have been in contact with different sources of these genes
from the human environment.
PFGE analysis and MLST demonstrated a significant clonal
similarity among the ESBL-producing isolates only in the Czech
location. Notably, more than one-third of all ESBL- and AmpCproducing
isolates belonged to extraintestinal pathogenic E. coli
(ExPEC)-linked phylogenetic groups B2 and ABD, a hybrid group
which contains, among others, internationally successful STs,
such as ST69, ST95, ST117, and ST405 (7, 8, 14). It seems that
these two hybrid groups, A ϫ B1 and ABD, comprise isolates with
a high frequency of recombination and therefore more frequently
contain pathogens (7). Antibiotic-resistant ST69 is a lineage
highly associated with urinary tract infections (UTIs) that is disseminated
worldwide (13, 14). Isolates of ST95 are prominent,
highly invasive, and virulent pathogens responsible for human
and avian infections (12, 14). ST405 has been described to be a
producer of various CTX-M types worldwide and is also associated
with New Delhi metallo-␤-lactamases (NDM-␤-lactamases)
and OXA-48 (8). The main representative of phylogroup B2 in our
collection was an internationally disseminated uropathogenic
clone (clone O25:H4-ST131) producing CTX-M-15. In the Czech
Republic and Serbia, high proportions of the rook isolates belonged
to ST131. In the Czech Republic, the ST131 clone has been
recorded in hospital-onset infections and wastewaters (29, 30, 32).
On the other hand, PMQR gene-positive strains belonged almost
exclusively to phylogenetic groups A, B1, and A ϫ B1 (84%) and
only sporadically to other groups.
Although the STs identified in our study were diverse, with 91
different STs being found among 191 ESBL- and AmpC-producing
and PMQR gene-positive E. coli strains, 37% of the E. coli
strains belonged to or were closely related to STC10, followed by
STC155 and STC23. STC10 includes pathogenic heterogeneous
enteroaggregative E. coli (EAEC), enterotoxigenic E. coli (ETEC),
ExPEC, as well as commensal E. coli strains found in humans and
food-producing animals (14, 37, 38). STC10 members contributing
to the spread of various ESBL and AmpC genes are widely
described in relation to hospital-onset infections (39, 40), but they
have also been reported in food animals in the Netherlands, the
United Kingdom, and France (41–43). The two main representatives
of STC155 in our study were ST58 and ST155. CTX-M-producing
STC155 is closely linked to UTIs (44), and it has recently
been reported from Italy, Spain, and Israel (40). Moreover, the
STC155 members were associated with various infections in livestock
in Europe (42, 43). ESBL-producing STC23 is commonly
isolated in hospitals in Spain and France (45, 46), but this clonal
complex has also been detected in samples obtained from foodproducing
animals and chicken meat (38, 41, 42).
Our study demonstrates the high rate of occurrence of common
STs or their single- and double-locus variants known to be
EAEC, ExPEC, and ETEC isolates or isolates previously associated
with UTIs. Identical ESBL and/or PMQR genes and E. coli clonal
lineages such as those found in rooks have been previously reported
in humans and domestic animals, thus indicating the plausible
sources of the antibiotic-resistant bacteria for rooks. The
finding of these bacteria in wildlife likely reflects the presence of
such isolates in the birds’ food and water sources as a result of
inadequate decontamination procedures for wastes of various origins.
On the basis of the data in the MLST database (http://mlst
.warwick.ac.uk/mlst/), most STs found in rooks are important
human and animal pathogens; their common presence in the environment,
including wildlife, is alarming and should be taken as
a serious environmental health risk. Wintering rooks inhabiting
urban, suburban, and agricultural areas may contribute to the
further dissemination of clinically important multiresistant E. coli
clones.
ACKNOWLEDGMENTS
This work was supported by grant no. NT/14398 from the Ministry of
Health of the Czech Republic and a project of CEITEC (Central European
Institute of Technology) (CZ.1.05/1.1.00/02.0068) from the European
Regional Development Fund. M.D. and I.P. were supported by the operational
programme Education for Competitiveness (CZ.1.07/2.3.00/
30.0014) from the European Social Fund.
We thank Frank Borleis, Francisco de la Calzada, Lisa Guardone, Dragan
Fabijan, Sebastian Franco, Susanne Homma, Ruben Gonzales Janez,
Jiri Klimes, Adam Konecny, Cyrille Lejas, Benito Fuertes Marcos, Veronika
Oravcova, Jakub Prochazka, Tomas Lang, Simona Krepelova, Zuzana
Markova, Hana Dobiasova, Radim Petro, Marko Sciban, Marie Slavikova,
Eva Suchanova, and Marko Tucakov for excellent cooperation in
the field or in the laboratory. Our special thanks go to Lars Hansen (University
of Copenhagen, Copenhagen, Denmark), Lina Cavaco and Henrik
Hasman (National Food Institute, Copenhagen, Denmark), and Lothar
H. Wieler and Torsten Semmler (Free University Berlin, Berlin, Germany)
for control strains and for advice on methodologies.
REFERENCES
1. EFSA Panel on Biological Hazards (BIOHAZ). 2011. Scientific opinion
on the public health risks of bacterial strains producing extendedspectrum
beta-lactamases and/or AmpC beta-lactamases in food and
food-producing animals. EFSA J 9:2322. http://www.efsa.europa.eu/en
/publications/efsajournal.htm. Accessed 1 January 2014. http://dx.doi.org
/10.2903/j.efsa.2011.2322.
2. Hopkins KL, Davies RH, Threlfall EJ. 2005. Mechanisms of quinolone
resistance in Escherichia coli and Salmonella: recent developments. Int J
Antimicrob Agents 25:358–373. http://dx.doi.org/10.1016/j.ijantimicag
.2005.02.006.
3. Luo YP, Li JY, Meng Y, Ma Y, Hu CQ, Jin SH, Zhang QS, Ding H, Cui
SH. 2011. Joint effects of topoisomerase alterations and plasmidResistance
in Various E. coli STs from Rooks in Europe
January 2015 Volume 81 Number 2 aem.asm.org 655Applied and Environmental Microbiology
onAugust18,2015byguesthttp://aem.asm.org/Downloadedfrom
mediated quinolone-resistant determinants in Salmonella enterica Typhimurium.
Microb Drug Resist 17:1–5. http://dx.doi.org/10.1089/mdr.2010
.0074.
4. Guenther S, Ewers C, Wieler LH. 2011. Extended-spectrum betalactamases
producing E. coli in wildlife, yet another form of environmental
pollution? Front Microbiol 2:246. http://dx.doi.org/10.3389/fmicb
.2011.00246.
5. Literak I, Dolejska M, Janoszowska D, Hrusakova J, Meissner W,
Rzyska H, Bzoma S, Cizek A. 2010. Antibiotic-resistant Escherichia coli
bacteria, including strains with genes encoding the extended-spectrum
beta-lactamase and QnrS, in waterbirds on the Baltic Sea Coast of Poland.
Appl Environ Microbiol 76:8126–8134. http://dx.doi.org/10.1128/AEM
.01446-10.
6. Literak I, Micudova M, Tausova D, Cizek A, Dolejska M, Papousek I,
Prochazka J, Vojtech J, Borleis F, Guardone L, Guenther S, Hordowski
J, Lejas C, Meissner W, Marcos BF, Tucakov M. 2012. Plasmidmediated
quinolone resistance genes in fecal bacteria from rooks commonly
wintering throughout Europe. Microb Drug Resist 18:567–573.
http://dx.doi.org/10.1089/mdr.2012.0075.
7. Wirth T, Falush D, Lan RT, Colles F, Mensa P, Wieler LH, Karch H,
Reeves PR, Maiden MCJ, Ochman H, Achtman M. 2006. Sex and
virulence in Escherichia coli: an evolutionary perspective. Mol Microbiol
60:1136–1151. http://dx.doi.org/10.1111/j.1365-2958.2006.05172.x.
8. Pitout JD. 2012. Extraintestinal pathogenic Escherichia coli: a combination
of virulence with antibiotic resistance. Front Microbiol 3:9. http://dx
.doi.org/10.3389/fmicb.2012.00009.
9. Johnson JR, Johnston B, Clabots C, Kuskowski MA, Castanheira M.
2010. Escherichia coli sequence type ST131 as the major cause of serious
multidrug-resistant E. coli infections in the United States. Clin Infect Dis
51:286–294. http://dx.doi.org/10.1086/653932.
10. Platell JL, Johnson JR, Cobbold RN, Trott DJ. 2011. Multidrug-resistant
extraintestinal pathogenic Escherichia coli of sequence type ST131 in animals
and foods. Vet Microbiol 153:99–108. http://dx.doi.org/10.1016/j
.vetmic.2011.05.007.
11. Ewers C, Bethe A, Semmler T, Guenther S, Wieler LH. 2012. Extendedspectrum
beta-lactamase-producing and AmpC-producing Escherichia
coli from livestock and companion animals, and their putative impact on
public health: a global perspective. Clin Microbiol Infect 18:646–655.
http://dx.doi.org/10.1111/j.1469-0691.2012.03850.x.
12. Guenther S, Grobbel M, Beutlich J, Guerra B, Ulrich RG, Wieler LH,
Ewers C. 2010. Detection of pandemic B2-O25-ST131 Escherichia coli
harbouring the CTX-M-9 extended-spectrum beta-lactamase type in a
feral urban brown rat (Rattus norvegicus). J Antimicrob Chemother 65:
582–584. http://dx.doi.org/10.1093/jac/dkp496.
13. Woodford N, Turton JF, Livermore DM. 2011. Multiresistant Gramnegative
bacteria: the role of high-risk clones in the dissemination of antibiotic
resistance. FEMS Microbiol Rev 35:736–755. http://dx.doi.org/10
.1111/j.1574-6976.2011.00268.x.
14. Manges AR, Johnson JR. 2012. Food-borne origins of Escherichia coli
causing extraintestinal infections. Clin Infect Dis 55:712–719. http://dx
.doi.org/10.1093/cid/cis502.
15. Clinical and Laboratory Standards Institute. 2008. Performance standards
for antimicrobial disk and dilution susceptibility tests for bacteria
isolated from animals, 3rd ed. Approved standard. Document M31-A3.
Clinical and Laboratory Standards Institute, Wayne, PA.
16. Polsfuss S, Bloemberg GV, Giger J, Meyer V, Boettger EC, Hombach M.
2011. Practical approach for reliable detection of AmpC beta-lactamaseproducing
Enterobacteriaceae. J Clin Microbiol 49:2798–2803. http://dx
.doi.org/10.1128/JCM.00404-11.
17. Drieux L, Brossier F, Sougakoff W, Jarlier V. 2008. Phenotypic detection
of extended-spectrum beta-lactamase production in Enterobacteriaceae:
review and bench guide. Clin Microbiol Infect 14:90–103. http://dx.doi
.org/10.1111/j.1469-0691.2007.01846.x.
18. Dobiasova H, Dolejska M, Jamborova I, Brhelova E, Blazkova L, Papousek
I, Kozlova M, Klimes J, Cizek A, Literak I. 2013. Extended
spectrum beta-lactamase and fluoroquinolone resistance genes and plasmids
among Escherichia coli isolates from zoo animals, Czech Republic.
FEMS Microbiol Ecol 85:604–611. http://dx.doi.org/10.1111/1574-6941
.12149.
19. Galas M, Decousser J-W, Breton N, Godard T, Allouch PY, Pina P,
Collège de Bactériologie Virologie Hygiène (ColBVH) Study Group..
2008. Nationwide study of the prevalence, characteristics, and molecular
epidemiology of extended-spectrum-␤-lactamase-producing Enterobacteriaceae
in France. Antimicrob Agents Chemother 52:786–789. http://dx
.doi.org/10.1128/AAC.00906-07.
20. Jeong SH, Bae IK, Kwon SB, Lee JH, Song JS, Jung HI, Sung KH, Jang
SJ, Lee SH. 2005. Dissemination of transferable CTX-M-type extendedspectrum
␤-lactamase-producing Escherichia coli in Korea. J Appl Microbiol
98:921–927. http://dx.doi.org/10.1111/j.1365-2672.2004.02526.x.
21. Perez-Perez FJ, Hanson ND. 2002. Detection of plasmid-mediated
AmpC ␤-lactamase genes in clinical isolates by using multiplex PCR. J
Clin Microbiol 40:2153–2162. http://dx.doi.org/10.1128/JCM.40.6.2153
-2162.2002.
22. Clinical and Laboratory Standards Institute. 2011. Performance standards
for antimicrobial susceptibility testing; 21st informational supplement.
M100-S21. Clinical and Laboratory Standards Institute, Wayne, PA.
23. Centers for Disease Control and Prevention. 2004. Standardized molecular
subtyping of foodborne bacterial pathogens by pulse-field gel electrophoresis.
Centers for Disease Control and Prevention, Atlanta, GA.
24. Carrico JA, Pinto FR, Simas C, Nunes S, Sousa NG, Frazao N, de
Lencastre H, Almeida JS. 2005. Assessment of band-based similarity
coefficients for automatic type and subtype classification of microbial isolates
analyzed by pulsed-field gel electrophoresis. J Clin Microbiol 43:
5483–5490. http://dx.doi.org/10.1128/JCM.43.11.5483-5490.2005.
25. Feil EJ, Li BC, Aanensen DM, Hanage WP, Spratt BG. 2004. eBURST:
inferring patterns of evolutionary descent among clusters of related bacterial
genotypes from multilocus sequence typing data. J Bacteriol 186:
1518–1530. http://dx.doi.org/10.1128/JB.186.5.1518-1530.2004.
26. Clermont O, Bonacorsi S, Bingen E. 2000. Rapid and simple determination
of the Escherichia coli phylogenetic group. Appl Environ Microbiol
66:4555–4558. http://dx.doi.org/10.1128/AEM.66.10.4555-4558.2000.
27. Nguyen TKN, Ha V, Tran VTN, Stabler R, Pham TD, Le TMV, van
Doorn HR, Cerdeno-Tarraga A, Thomson N, Campbell J, Nguyen
VMH, Tran TTN, Pham VM, Cao TT, Wren B, Farrar J, Baker S. 2010.
The sudden dominance of blaCTX-M harbouring plasmids in Shigella spp.
circulating in Southern Vietnam. PLoS Negl Trop Dis 4:e702. http://dx
.doi.org/10.1371/journal.pntd.0000702.
28. Pitout JDD, Gregson DB, Campbell L, Laupland KB. 2009. Molecular
characteristics of extended-spectrum-beta-lactamase-producing Escherichia
coli isolates causing bacteremia in the Calgary Health Region from
2000 to 2007: emergence of clone ST131 as a cause of communityacquired
infections. Antimicrob Agents Chemother 53:2846–2851. http:
//dx.doi.org/10.1128/AAC.00247-09.
29. Dolejska M, Brhelova E, Dobiasova H, Krivdova J, Jurankova J, Sevcikova
A, Dubska L, Literak I, Cizek A, Vavrina M, Kutnikova L, Sterba
J. 2012. Dissemination of IncFII(K)-type plasmids in multiresistant CTXM-15-producing
Enterobacteriaceae isolates from children in hospital paediatric
oncology wards. Int J Antimicrob Agents 40:510–515. http://dx
.doi.org/10.1016/j.ijantimicag.2012.07.016.
30. Hrabak J, Empel J, Bergerova T, Fajfrlik K, Urbaskova P, KernZdanowicz
I, Hryniewicz W, Gniadkowski M. 2009. International clones
of Klebsiella pneumoniae and Escherichia coli with extended-spectrum beta-lactamases
in a Czech hospital. J Clin Microbiol 47:3353–3357. http:
//dx.doi.org/10.1128/JCM.00901-09.
31. Dolejska M, Matulova M, Kohoutova L, Literak I, Bardon J, Cizek A.
2011. Extended-spectrum beta-lactamase-producing Escherichia coli in
turkey meat production farms in the Czech Republic: national survey
reveals widespread isolates with blaSHV-12 genes on IncFII plasmids. Lett
Appl Microbiol 53:271–277. http://dx.doi.org/10.1111/j.1472-765X.2011
.03099.x.
32. Dolejska M, Frolkova P, Florek M, Jamborova I, Purgertova M, Kutilova
I, Cizek A, Guenther S, Literak I. 2011. CTX-M-15-producing
Escherichia coli clone B2-O25b-ST131 and Klebsiella spp. isolates in municipal
wastewater treatment plant effluents. J Antimicrob Chemother
66:2784–2790. http://dx.doi.org/10.1093/jac/dkr363.
33. Tausova D, Dolejska M, Cizek A, Hanusova L, Hrusakova J, Svoboda
O, Camlik G, Literak I. 2012. Escherichia coli with extended-spectrum
beta-lactamase and plasmid-mediated quinolone resistance genes in great
cormorants and mallards in Central Europe. J Antimicrob Chemother
67:1103–1107. http://dx.doi.org/10.1093/jac/dks017.
34. European Centre for Disease Prevention and Control. 2013. Annual
epidemiological report 2013. Reporting on 2011 surveillance data and
2012 epidemic intelligence data. European Centre for Disease Prevention
and Control, Stockholm, Sweden. http://www.ecdc.europa.eu/en/
publications/_layouts/forms/Publication_DispForm.aspx?Listϭ4f55ad51-4aed
-4d32-b960-af70113dbb90&IDϭ989. http://dx.doi.org/10.2900/13174.
Jamborova et al.
656 aem.asm.org January 2015 Volume 81 Number 2Applied and Environmental Microbiology
onAugust18,2015byguesthttp://aem.asm.org/Downloadedfrom
35. Veldman K, Cavaco LM, Mevius D, Battisti A, Franco A, Botteldoorn
N, Bruneau M, Perrin-Guyomard A, Cerny T, Escobar CD, Guerra B,
Schroeter A, Gutierrez M, Hopkins K, Myllyniemi AL, Sunde M, Wasyl
D, Aarestrup FM. 2011. International collaborative study on the occurrence
of plasmid-mediated quinolone resistance in Salmonella enterica
and Escherichia coli isolated from animals, humans, food and the environment
in 13 European countries. J Antimicrob Chemother 66:1278–1286.
http://dx.doi.org/10.1093/jac/dkr084.
36. Literak I, Reitschmied T, Bujnakova D, Dolejska M, Cizek A, Bardon J,
Pokludova L, Alexa P, Halova D, Jamborova I. 2013. Broilers as a source
of quinolone-resistant and extraintestinal pathogenic Escherichia coli in
the Czech Republic. Microb Drug Resist 19:57–63. http://dx.doi.org/10
.1089/mdr.2012.0124.
37. Olesen B, Scheutz F, Andersen RL, Menard M, Boisen N, Johnston B,
Hansen DS, Krogfelt KA, Nataro JP, Johnson JR. 2012. Enteroaggregative
Escherichia coli O78: H10, the cause of an outbreak of urinary tract
infection. J Clin Microbiol 50:3703–3711. http://dx.doi.org/10.1128/JCM
.01909-12.
38. Shepard SM, Danzeisen JL, Isaacson RE, Seemann T, Achtman M,
Johnson TJ. 2012. Genome sequences and phylogenetic analysis of K88and
F18-positive porcine enterotoxigenic Escherichia coli. J Bacteriol 194:
395–405. http://dx.doi.org/10.1128/JB.06225-11.
39. Peirano G, van der Bij AK, Gregson DB, Pitout JDD. 2012. Molecular
epidemiology over an 11-year period (2000 to 2010) of extendedspectrum
beta-lactamase-producing Escherichia coli causing bacteremia in
a centralized Canadian region. J Clin Microbiol 50:294–299. http://dx.doi
.org/10.1128/JCM.06025-11.
40. Izdebski R, Baraniak A, Fiett J, Adler A, Kazma M, Salomon J, Lawrence
C, Rossini A, Salvia A, Samso JV, Fierro J, Paul M, Lerman Y, MalhotraKumar
S, Lammens C, Goossens H, Hryniewicz W, Brun-Buisson C,
Carmeli Y, Gniadkowski M, MOSAR WP2 and WP5 Study Groups. 2013.
Clonal structure, extended-spectrum beta-lactamases, and acquired AmpCtype
cephalosporinases of Escherichia coli populations colonizing patients
in rehabilitation centers in four countries. Antimicrob Agents Chemother
57:309–316. http://dx.doi.org/10.1128/AAC.01656-12.
41. Cohen Stuart J, van den Munckhof T, Voets G, Scharringa J, Fluit A,
Leverstein-Van Hall M. 2012. Comparison of ESBL contamination in
organic and conventional retail chicken meat. Int J Food Microbiol 154:
212–214. http://dx.doi.org/10.1016/j.ijfoodmicro.2011.12.034.
42. Wu GH, Ehricht R, Mafura M, Stokes M, Smith N, Pritchard GC,
Woodward MJ. 2012. Escherichia coli isolates from extraintestinal organs
of livestock animals harbour diverse virulence genes and belong to multiple
genetic lineages. Vet Microbiol 160:197–206. http://dx.doi.org/10
.1016/j.vetmic.2012.05.029.
43. Dahmen S, Metayer V, Gay E, Madec JY, Haenni M. 2013. Characterization
of extended-spectrum beta-lactamase (ESBL)-carrying plasmids
and clones of Enterobacteriaceae causing cattle mastitis in France. Vet Microbiol
162:793–799. http://dx.doi.org/10.1016/j.vetmic.2012.10.015.
44. Valverde A, Canton R, Garcillan-Barcia MP, Novais A, Galan JC,
Alvarado A, de la Cruz F, Baquero F, Coque TM. 2009. Spread of
blaCTX-M-14 is driven mainly by IncK plasmids disseminated among Escherichia
coli phylogroups A, B1, and D in Spain. Antimicrob Agents Chemother
53:5204–5212. http://dx.doi.org/10.1128/AAC.01706-08.
45. Oteo J, Cercenado E, Fernandez-Romero S, Saez D, Padilla B, Zamora
E, Cuevas O, Bautista V, Campos J. 2012. Extended-spectrum-betalactamase-producing
Escherichia coli as a cause of pediatric infections:
report of a neonatal intensive care unit outbreak due to a CTX-M-14producing
strain. Antimicrob Agents Chemother 56:54–58. http://dx.doi
.org/10.1128/AAC.05103-11.
46. Cremet L, Caroff N, Giraudeau C, Dauvergne S, Lepelletier D, Reynaud
A, Corvec S. 2010. Occurrence of ST23 complex phylogroup A Escherichia
coli isolates producing extended-spectrum AmpC beta-lactamase in a
French hospital. Antimicrob Agents Chemother 54:2216–2218. http://dx
.doi.org/10.1128/AAC.01580-09.
Resistance in Various E. coli STs from Rooks in Europe
January 2015 Volume 81 Number 2 aem.asm.org 657Applied and Environmental Microbiology
onAugust18,2015byguesthttp://aem.asm.org/Downloadedfrom
Příloha 27
STUDENTOVA, V., DOBIASOVA, H., HEDLOVA, D., DOLEJSKA, M., PAPAGIANNITSIS, C.C., HRABAK,
J., 2015, Complete nucleotide sequence of two NDM-1-encoding plasmids characterized from
the same Sequence type 11 Klebsiella pneumoniae: Antimicrobial Agents Chemotherapy, v. 59,
p. 1325-1358.
Souhrn
U kmene K. pneumoniae náležící k epidemickému klonu ST11 byly nalezeny dva plazmidy nesoucí gen
pro karbapenemázu NDM-1. Jednalo se o první případ izolace této karbapenemázy v ČR. Cílem této studie bylo
metodou nové generace sekvenování stanovit primární nukleotidovou sekvenci obou plazmidů. Kmen
obsahoval dva (73 a 97 kb) plazmidy s primární sekvencí odvozenou od pKPX-1. Oba plazmidy sdílely oblast
o velikosti 40 kb nesoucí mimo jiné platformu s blaNDM-1. Studie ukazuje na výměnu dlouhých
multirezistenntích úseků mezi různými plazmidy jako nástroj podporující šíření determinant rezistence
k antibiotikům.
Complete Nucleotide Sequences of Two NDM-1-Encoding Plasmids
from the Same Sequence Type 11 Klebsiella pneumoniae Strain
V. Studentova,a
H. Dobiasova,b,c
D. Hedlova,d
M. Dolejska,b,c
C. C. Papagiannitsis,a,e
J. Hrabaka,e
Department of Microbiology, Faculty of Medicine and University Hospital in Plzen, Charles University in Prague, Plzen, Czech Republica
; Department of Biology and
Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republicb
; CEITEC VFU, University of
Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republicc
; Department of Hospital Epidemiology, Central Military Hospital, Prague, Czech Republicd
;
Biomedical Center, Faculty of Medicine in Plzen, Charles University in Prague, Plzen, Czech Republice
The sequence type 11 Klebsiella pneumoniae strain Kpn-3002cz was confirmed to harbor two NDM-1-encoding plasmids,
pB-3002cz and pS-3002cz. pB-3002cz (97,649 bp) displayed extensive sequence similarity with the blaNDM-1-carrying plasmid
pKPX-1. pS-3002cz (73,581 bp) was found to consist of an IncR-related sequence (13,535 bp) and a mosaic region (60,046 bp). A
40,233-bp sequence of pS-3002cz was identical to the mosaic region of pB-3002cz, indicating the en bloc acquisition of the NDM-
1-encoding region from one plasmid by the other.
The emergence and spread of carbapenemase-producing Enterobacteriaceae
(CPE) have caused a public health crisis of global
dimensions (1). One of the carbapenemase groups observed in
CPE is metallo-␤-lactamases (M␤Ls), mainly of the VIM, IMP,
and NDM types. An NDM-1 enzyme was first described in Klebsiella
pneumoniae and Escherichia coli isolated in Sweden in 2008
from an Indian patient transferred from a New Delhi hospital (2).
Since then, NDM-1-producing bacteria, including clinical isolates
of Enterobacteriaceae and Acinetobacter baumannii, have been reported
from the Indian subcontinent but also worldwide (1). The
aim of the present study was to describe the first case of an NDM-
1-producing K. pneumoniae isolate (Kpn-3002cz) identified in the
Czech Republic. We also describe the sequences of two blaNDM-1carrying
plasmids harbored by Kpn-3002cz.
In March 2013, a 61-year-old female was admitted to the Central
Military Hospital in Prague, Czech Republic. Since the patient
was previously hospitalized (November to December 2012) in Kosice’s
hospital (Slovak Republic), routine screening for CPE was
performed according to the recommendation published by the
Ministry of Health of the Czech Republic. K. pneumoniae Kpn-
3002cz, which was nonsusceptible to carbapenems, as determined
by the broth dilution method (3) and interpreted according to the
EUCAST criteria (http://www.eucast.org/), was isolated from a
urine sample. Of all the drugs tested, Kpn-3002cz was susceptible
to gentamicin only (Table 1).
Carbapenemase production was hypothesized to exist because
of a positive result in the matrix-assisted laser desorption ionization–time
of flight mass spectrometry (MALDI-TOF MS) meropenem
hydrolysis assay (4). Kpn-3002cz was M␤L positive with
the meropenem-EDTA combined-disk test (5). PCR screening for
various M␤L genes (2, 6) and sequencing revealed the presence of
blaNDM-1. Isoelectric focusing of ␤-lactamase extracts showed that
Kpn-3002cz also produces ␤-lactamases, with pIs of 7.6 (most
likely the species-specific penicillinase) and 9.0 (a highly basic
␤-lactamase, as is common among AmpC enzymes). PCR screening
for various ampC genes (7) and sequencing revealed the presence
of blaCMY-4 that was in accordance with production of the
␤-lactamase, with a pI of 9.0. Multilocus sequence typing (MLST)
(8) assigned Kpn-3002cz to sequence type 11 (ST11), which belongs
to clonal complex 258 (CC258) (9).
Attempts to transfer ␤-lactam resistance to the E. coli A15 laboratory
strain by conjugation in mixed broth cultures were unsuccessful.
Next, plasmid DNA of Kpn-3002cz was extracted using a
Nucleobond AX midi kit (Macherey-Nagel, Düren, Germany)
and used to transform E. coli strain DH5␣ cells. ␤-Lactam-resistant
transformants were obtained on Luria-Bertani agar plates
with ampicillin (50 mg/liter) (Table 1) and confirmed to be NDM
producers by PCR (2) and MALDI-TOF MS hydrolysis assay (4).
Plasmid content analysis was carried out by pulsed-field gel electrophoresis
of the total DNA digested with S1 nuclease (10). Then,
the DNA was transferred to Hybond-Nϩ
nylon membrane (Amersham
Biosciences, Buckingham, United Kingdom) and hybridized
with a digoxigenin-labeled blaNDM-specific probe. The results
revealed the presence of multiple plasmids in Kpn-3002cz, including
molecules of ϳ80 kb, ϳ100 kb, ϳ160 kb, and ϳ200 kb. Moreover,
plasmid analysis showed two types of transformants carrying
either the ϳ80-kb plasmid pS-3002cz or the ϳ100-kb plasmid
pB-3002cz. Both plasmids hybridized with the blaNDM probe (not
shown).
Plasmid DNAs extracted from E. coli DH5␣ transformants
were sequenced using the 454 Genome Sequencer Junior system
(Roche, Prague, Czech Republic) on a standard DNA fragment
library. The reads were assembled using the GS de novo Assembler
software. The sequence gaps on the plasmids were filled by sequencing
of the PCR-produced fragments. The BLAST algorithm
(www.ncbi.nlm.nih.gov/BLAST), IS Finder (www-is.biotoul.fr/),
Received 15 August 2014 Returned for modification 21 September 2014
Accepted 12 November 2014
Accepted manuscript posted online 24 November 2014
Citation Studentova V, Dobiasova H, Hedlova D, Dolejska M, Papagiannitsis CC,
Hrabak J. 2015. Complete nucleotide sequences of two NDM-1-encoding
plasmids from the same sequence type 11 Klebsiella pneumoniae strain.
Antimicrob Agents Chemother 59:1325–1328. doi:10.1128/AAC.04095-14.
Address correspondence to C. C. Papagiannitsis, c.papagiannitsis@gmail.com.
Copyright © 2015, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AAC.04095-14
February 2015 Volume 59 Number 2 aac.asm.org 1325Antimicrobial Agents and Chemotherapy
onJanuary28,2015byguesthttp://aac.asm.org/Downloadedfrom
and ORF Finder (www.bioinformatics.org/sms/) were used for
data analysis.
Plasmid pB-3002cz was found to be 97,649 bp in size, with an
average GϩC content of 53.2%. The sequencing data indicate that
pB-3002cz is a derivative of the NDM-1-encoding plasmid
pKPX-1 (90% coverage, 99% identity). pKPX-1 was characterized
from an ST11 K. pneumoniae strain isolated in Taiwan from a
patient previously hospitalized in a New Delhi (India) medical
center (11). The similarities between pB-3002cz and pKPX-1 were
localized in two main segments (Fig. 1). The first segment is composed
of a contiguous 70,412-bp sequence (nucleotides [nt] 1 to
6065 and 33303 to 97649) containing a part of the plasmidic backbone
and the NDM-1-encoding region. The plasmidic scaffold of
pB-3002cz possesses a conjugative transfer region (tra-trb), the
mobABC, ccdAB, vagCD, and umuDC operons, and two repA
genes. Similarly to pKPX-1, none of the repA genes were assigned
to any of the known incompatibility (Inc) groups by the PCRbased
replicon typing (PBRT) method (12). The NDM-1-encoding
region is composed of bleMBL, trpF, blaNDM-1, and a 259-bp
fragment of ISAba125 (⌬ISAba125). ISAba125 is disrupted by an
IS3000 element, as has also been found in the IncH plasmid
pNDM-MAR (13). The remaining sequence of pB-3002cz, including
the second pKPX-1-like segment (nt 21402 to 31550),
comprises a mosaic structure containing intact insertion sequences
(n ϭ 5) and fragments of various transposons (n ϭ 4).
Furthermore, pB-3002cz showed a deletion of two big fragments
of pKPX-1 being responsible for resistance to several antibiotics
and for plasmid maintenance.
TABLE 1 Antibiotic susceptibilities of the K. pneumoniae Kpn-3002cz isolate producing NDM-1 and CMY-4 and its E. coli DH5␣ transformants
producing NDM-1
Isolate (plasmid)
MIC (mg/liter) fora
:
Pip Tzp Ctx Caz Fep Atm Imp Mem Ert Gen An Cml Sxt Col Cip
K. pneumoniae Kpn-3002cz Ͼ64 Ͼ64 Ͼ8 Ͼ32 Ͼ16 8 32 8 32 1 32 32 Ͼ32 4 Ͼ8
E. coli DH5␣ (pB-3002cz) 64 64 Ͼ8 Ͼ32 Ͼ16 0.094 2 0.75 1 0.5 8 2 1 0.25 Յ0.06
E. coli DH5␣ (pS-3002cz) 64 64 Ͼ8 Ͼ32 8 0.032 1.5 0.19 1 Յ0.12 4 2 1 0.25 Յ0.06
E. coli DH5␣ (recipient) Յ0.5 1 Յ0.06 Յ0.25 Յ0.125 0.047 0.19 0.032 0.008 Յ0.12 Յ0.5 Յ1 1 Յ0.5 Յ0.06
a
Pip, piperacillin; Tzp, piperacillin-tazobactam (inhibitor fixed at 4 ␮g/ml); Ctx, cefotaxime; Caz, ceftazidime; Fep, cefepime; Atm, aztreonam; Imp, imipenem; Mem, meropenem;
Ert, ertapenem; Gen, gentamicin; An, amikacin; Cml, chloramphenicol; Sxt, trimethoprim-sulfamethoxazole; Col, colistin; Cip, ciprofloxacin.
FIG 1 Linear maps of two NDM-encoding plasmids, pB-3002cz and pS-3002cz. Open reading frames (ORFs) are shown as rectangles (arrows within the
rectangles indicate the direction of transcription). Intact insertion sequences (ISs) are represented by arrows, while truncated ISs appear as rectangles. The
replicons of the plasmids are indicated by purple rectangles. blaNDM-1 genes, resistance genes, and transposases are shown in blue, orange, and green, respectively.
The black arrows indicate IS26 elements; the other IS elements are shown in red. The remaining genes, including plasmidic scaffold regions, are indicated by white
rectangles. The blue lines above the map of pB-3002cz correspond to highly similar sequences from plasmid pKPX-1, while the green line below the map of
pS-3002cz corresponds to highly similar sequences from plasmid pKpn2146b. The gray shading shows the presence of the same NDM-1-encoding mosaic region
on both pB-3002cz and pS-3002cz. Homologous regions, which might have been involved in a recombination event leading to the shaping of pS-3002cz, are
indicated by pink shading. IRL, left inverted repeat; IRR, right inverted repeat.
Studentova et al.
1326 aac.asm.org February 2015 Volume 59 Number 2Antimicrobial Agents and Chemotherapy
onJanuary28,2015byguesthttp://aac.asm.org/Downloadedfrom
The second plasmid, pS-3002cz, is 73,581 bp in size, with an
average GϩC content of 53.9%. Sequence analysis showed that
pS-3002cz is a fusion derivative of pB-3002cz and pKpn2146b.
pKpn2146b is one of the four plasmids harbored by K. pneumoniae
strain ATCC BAA-2146 (Kpn2146), the first NDM-1-producing
isolate from the United States (14). Kpn2146, which also
belongs to ST11, was recovered from a patient who had received
medical care in India. Of note is that pKpn2146b was not found
to harbor blaNDM-1, which was carried by the IncA/C plasmid
pNDM-US (14). pS-3002cz contains a 40,233-bp sequence (nt
10402 to 50634) encoding the NDM-1, which was identical to the
entire mosaic region of pB-3002cz (100% coverage, 99% identity)
(Fig. 1). The remaining 33,348-bp sequence of pS-3002cz consists
of two segments sharing extensive similarities with sequences carried
by pKpn2146b (100% coverage, 99% identity). The first segment,
a contiguous 20,721-bp sequence (nt 1 to 10401 and 63262
to 73581), is composed of an IncR-derived fragment, which includes
a repB gene (nt 6909 to 7775) being 100% identical to that
found in the IncR plasmid pKP1780 (15), and a truncated Tn6187
transposon (⌬Tn6187) (14). The second segment is an 11,807-bp
sequence (nt 50635 to 62441) containing the repE gene (nt 51498
to 52253). repE showed limited nucleotide similarity (86%) with
the replication region of the IncFIA plasmid pmk115 (12), which
explains the failure of the PBRT method to classify pS-3002cz.
However, pS-3002cz was found to be positive in an IncR-specific
PCR assay (16).
In conclusion, this study presents the first NDM-1-producing
K. pneumoniae strain in the Czech Republic. However, the clinical
data of the patient indicate that the isolate was probably imported
from Slovakia, a country with a currently unknown epidemiological
situation regarding CPE (17). The production of NDM-1 occurs
in ST11, which has been associated with NDM-1-producing
isolates having an epidemiological link to the Indian subcontinent
(18) and which has recently caused outbreaks in Greece (19).
Of note is that in Kpn-3002cz, blaNDM-1 is carried on two plasmids,
pB-3002cz and pS-3002cz, sharing the same NDM-1-encoding
mosaic region (Fig. 1). Sequencing data suggest that the
progenitor of pB-3002cz is a pKPX-1-like plasmid. Considering
that pKPX-1-like plasmids are not common, the presence of
pB-3002cz and pKPX-1 in two K. pneumoniae strains of the same
ST underlines the importance of pKPX-1-like plasmids in the dissemination
of the blaNDM-1 gene in different parts of the world.
Furthermore, sequencing data indicate that en bloc acquisition of
the NDM-1-encoding mosaic region from pB-3002cz by an IncRtype
plasmid is a plausible hypothesis regarding the formation
of pS-3002cz. At a certain step of the evolution of pS-3002cz,
pKPX-1 and an IncR pKpn2146b-like plasmid may have formed a
fusion structure via a recombination event between a homologous
region (nt 6033 to 10111 in pB-3002cz; Fig. 1) upstream of the
resD gene. After the resolution of the fusion structure, pS-3002cz
evolved further through rearrangements facilitated by ISs. These
findings underscore the spreading potential of large segments carrying
resistance determinants, such as blaNDM-1, through the reshuffling
of enterobacterial plasmids.
Nucleotide sequence accession numbers. The nucleotide sequences
of the plasmids pB-3002cz and pS-3002cz have been assigned
the GenBank accession numbers KJ958926 and KJ958927,
respectively.
ACKNOWLEDGMENTS
This work was supported by research project grant NT11032-6/2010 from
the Ministry of Health of the Czech Republic and by the Charles University
Research Fund (project no. P36) and CEITEC (grant CZ.1.05/1.1.00/
02.0068). C. C. Papagiannitsis was supported by the project “Support of
establishment, development, and mobility of quality research teams at the
Charles University” (registration no. CZ.1.07/2.3.00/30.0022), and M.
Dolejska was supported by the project “Molecular biology as a tool for
integrating biomedical disciplines at VFU Brno” (registration no.
CZ.1.07/2.3.00/30.0014), financed by The Education for Competitiveness
Operational Programme (ECOP), funded by the European Social Fund
(ESF) and the government budget of the Czech Republic.
REFERENCES
1. Nordmann P, Poirel L, Walsh TR, Livermore DM. 2011. The emerging
NDM carbapenemases. Trends Microbiol 19:588–595. http://dx.doi.org
/10.1016/j.tim.2011.09.005.
2. Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, Walsh TR.
2009. Characterization of a new metallo-␤-lactamase gene, blaNDM-1, and a
novel erythromycin esterase gene carried on a unique genetic structure in
Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents
Chemother 53:5046–5054. http://dx.doi.org/10.1128/AAC.00774-09.
3. European Committee on Antimicrobial Susceptibility Testing. 2003.
Determination of minimum inhibitory concentrations (MICs) of antibacterial
agents by broth dilution. Clin Microbiol Infect 9:1–7. http://dx.doi
.org/10.1046/j.1469-0691.2003.00790.x.
4. Hrabák J, Studentová V, Walková R, Zemlicková H, Jakubu V,
Chudácková E, Gniadkowski M, Pfeifer Y, Perry JD, Wilkison K,
Bergerová T. 2012. Detection of NDM-1, VIM-1, KPC, OXA-48, and
OXA-162 carbapnemases by matrix-assisted laser desorption ionization–
time of flight mass spectrometry. J Clin Microbiol 50:2441–2443. http://dx
.doi.org/10.1128/JCM.01002-12.
5. Hrabák J, Chudácˇková E, Papagiannitsis CC. 2014. Detection of carbapenems
in Enterobacteriaceae: a challenge for diagnostic microbiological laboratories.
Clin Microbiol Infect, 20:839–853. http://dx.doi.org/10.1111
/1469-0691.12678.
6. Ellington MJ, Kistler J, Livermore DM, Woodford N. 2007. Multiplex PCR
for rapid detection of genes encoding acquired metallo-␤-lactamases. J Antimicrob
Chemother 59:321–322. http://dx.doi.org/10.1093/jac/dkl481.
7. Pérez-Pérez FJ, Hanson ND. 2002. Detection of plasmid-mediated AmpC
beta-lactamasegenesinclinicalisolatesbyusingmultiplexPCR.JClinMicrobiol
40:2153–2162. http://dx.doi.org/10.1128/JCM.40.6.2153-2162.2002.
8. Diancourt L, Passet V, Verhoef J, Grimont PAD, Brisse S. 2005. Multilocus
sequence typing of Klebsiella pneumoniae nosocomial isolate. J
Clin Microbiol 43:4178–4182. http://dx.doi.org/10.1128/JCM.43.8.4178
-4182.2005.
9. Woodford N, Turton JF, Livermore DM. 2011. Multiresistant Gramnegative
bacteria: the role of high-risk clones in the dissemination of antibiotic
resistance. FEMS Microbiol Rev 35:736–755. http://dx.doi.org/10
.1111/j.1574-6976.2011.00268.x.
10. Barton BM, Harding GP, Zuccarelli AJ. 1995. A general method for the
detecting and sizing large plasmids. Anal Biochem 226:235–240. http://dx
.doi.org/10.1006/abio.1995.1220.
11. Huang TW, Chen TL, Chen YT, Lauderdale TL, Liao TL, Lee YT, Chen CP,
Liu YM, Lin AC, Chang YH, Wu KM, Kirby R, Lai JF, Tan MC, Siu LK,
Chang CM, Fung CP, Tsai SF. 2013. Copy number change of the NDM-1
sequence in a multidrug-resistant Klebsiella pneumoniae clinical isolate.
PLoS One 8:e62774. http://dx.doi.org/10.1371/journal.pone.0062774.
12. Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threfall EJ. 2005.
Identification of plasmids by PCR-based replicon typing. J Microbiol
Methods 63:219–228. http://dx.doi.org/10.1016/j.mimet.2005.03.018.
13. Hudson CM, Bent ZW, Meagher RJ, Williams KP. 2014. Resistance
determinants and mobile genetic elements of an NDM-1-encoding Klebsiella
pneumoniae strain. PLoS One 9:e99209. http://dx.doi.org/10.1371
/journal.pone.0099209.
14. Villa L, Poirel L, Nordmann P, Carta C, Carattoli A. 2012. Complete
sequencing of an IncH plasmid carrying the blaNDM-1, blaCTX-M-15, and
qnrB1 genes. J Antimicrob Chemother 67:1645–1650. http://dx.doi.org
/10.1093/jac/dks114.
15. Papagiannitsis CC, Miriagou V, Giakkoupi P, Tzouvelekis LS, Vatopoulos
AC. 2013. Characterization of pKP1780, a novel IncR plasmid
Sequences of Two NDM-1-Encoding Plasmids
February 2015 Volume 59 Number 2 aac.asm.org 1327Antimicrobial Agents and Chemotherapy
onJanuary28,2015byguesthttp://aac.asm.org/Downloadedfrom
from the emerging Klebsiella pneumoniae ST147, encoding the VIM-1
metallo-␤-lactamsase. J Antimicrob Chemother 68:2259–2262. http://dx
.doi.org/10.1093/jac/dkt196.
16. García-Fernández A, Fortini D, Veldman K, Mevius D, Carattoli A.
2009. Characterization of plasmids harbouring qnrS1, qnrB2 and qnrB19
genes in Salmonella. J Antimicrob Chemother 63:274–281. http://dx.doi
.org/10.1093/jac/dkn470.
17. Glasner C, Albiger B, Buist G, Tambic´ Andraševic´ A, Canton R,
Carmeli Y, Friedrich AW, Giske CG, Glupczynski Y, Gniadkowski
M, Livermore DM, Nordmann P, Poirel L, Rossolini GM, Seifert H,
Vatopoulos AC, Walsh T, Woodford N, Donker T, Monnet DL,
Grundmann H, European Survey on Carbapenemase-Producing Enterobacteriaceae
(EuSCAPE) Working Group. 2013. Carbapenemaseproducing
Enterobacteriaceae in Europe: a survey among national experts
from 39 countries, February 2013. Euro Surveill 18:piiϭ20525. http:
//www.eurosurveillance.org/ViewArticle.aspx?ArticleIdϭ20525.
18. Giske CG, Fröding I, Hasan CM, Turlej-Rogacka A, Toleman M,
Livermore D, Woodford N, Walsh TR. 2012. Diverse sequence types of
Klebsiella pneumoniae contribute to the dissemination of blaNDM-1 in India,
Sweden, and the United Kingdom. Antimicrob Agents Chemother
56:2735–2738. http://dx.doi.org/10.1128/AAC.06142-11.
19. Voulgari E, Gartzonika C, Vrioni G, Politi L, Priavali E, LevidiotouStefanou
S, Tsakris A. 2014. The Balkan region: NDM-1-producing
Klebsiella pneumoniae ST11 clonal strain causing outbreaks in Greece. J
Antimicrob Chemother 69:2091–2099. http://dx.doi.org/10.1093/jac
/dku105.
Studentova et al.
1328 aac.asm.org February 2015 Volume 59 Number 2Antimicrobial Agents and Chemotherapy
onJanuary28,2015byguesthttp://aac.asm.org/Downloadedfrom
Příloha 28
PAPAGIANNITSIS C.C., DOLEJSKA, M., IZDEBSKI, R., DOBIASOVA H., STUDENTOVA, V., ESTEVES,
F.J., DERDE, L.P.G., BONTEN, M.J.M., HRABAK, J., GNIADKOWSKI, M., 2015, Characterization of
pKP-M1144, a Novel ColE1-Like , Characterization of pKP-M1144, a novel ColE1-like plasmid
encoding IMP-8, GES-5, and BEL-1 ß-lactamases, from a Klebsiella pneumoniae sequence type
252 isolate: Antimicrobial Agents and Chemotherapy, v. 59, p. 5065-5068.
Souhrn
Byla stanovena primární nukleotidová sekvence ColE plazmidu z nosokomiálního izolátu K. pneumoniae ST252
s metalo-beta-laktamázou IMP-8 z Portugalska. Gen blaIMP-8 byl součástí integronu třídy 3. V práci je diskutován
možný původ a scénář evoluce tohoto plazmidu.
Characterization of pKP-M1144, a Novel ColE1-Like Plasmid Encoding
IMP-8, GES-5, and BEL-1 ␤-Lactamases, from a Klebsiella pneumoniae
Sequence Type 252 Isolate
Costas C. Papagiannitsis,a,b
Monika Dolejska,c,d
Radoslaw Izdebski,b
Hana Dobiasova,c,d
Vendula Studentova,a
Francisco J. Esteves,e
Lennie P. G. Derde,f
Marc J. M. Bonten,f
Jaroslav Hrabák,a,g
Marek Gniadkowskib
Faculty of Medicine and University Hospital in Plzen, Charles University in Prague, Plzen, Czech Republica
; National Medicines Institute, Warsaw, Polandb
; Department of
Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republicc
; CEITEC VFU,
University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republicd
; Centro Hospitalar, Trás-os-Montes e Alto Douro, Vila Real, Portugale
; University Medical
Center Utrecht, Utrecht, The Netherlandsf
; Biomedical Center, Faculty of Medicine in Plzen, Charles University in Prague, Plzen, Czech Republicg
IMP-8 metallo-␤-lactamase was identified in Klebsiella pneumoniae sequence type 252 (ST252), isolated in a Portuguese hospital
in 2009. blaIMP-8 was the first gene cassette of a novel class 3 integron, In1144, also carrying the blaGES-5, blaBEL-1, and aacA4 cassettes.
In1144 was located on a ColE1-like plasmid, pKP-M1144 (12,029 bp), with a replication region of limited nucleotide similarity
to those of other RNA-priming plasmids, such as pJHCMW1. In1144 and pKP-M1144 represent an interesting case of evolution
of resistance determinants in Gram-negative bacteria.
Acquired carbapenem-hydrolyzing metallo-␤-lactamases
(MBLs) are resistance determinants of increasing clinical
importance in Gram-negative pathogens. Of these, enzymes
mainly of the VIM, IMP, and NDM types have been encountered
in Klebsiella pneumoniae and other Enterobacteriaceae. In
contrast to blaNDM genes, blaVIM and blaIMP occur as gene cassettes
in class 1 integrons or, more rarely, integrons of class 2 or 3 (1–3).
Here, we report on a novel class 3 integron, In1144, identified in a
K. pneumoniae sequence type 252 (ST252) isolate from Portugal.
In1144 codes for IMP-8 (4) and two other ␤-lactamases, GES-5
and BEL-1 (5, 6). It is located on a new ColE1-like plasmid, pKPM1144,
which was entirely sequenced in the study.
In 2009, K. pneumoniae strain Kpn-1144 was recovered from a
patient in a Portuguese intensive care unit (ICU) of a hospital
participating in the European Union (EU)-funded project
MOSAR (7). During MOSAR, 17,945 patients in 18 clinical sites in
Europe and Israel were screened for rectal carriage of expandedspectrum
cephalosporin-resistant Enterobacteriaceae and were
tested also for carbapenem susceptibility (7, 8). Kpn-1144 was
extended-spectrum ␤-lactamase (ESBL) positive by the doubledisk
synergy test (9) and showed reduced susceptibility to carbapenems,
according to the EUCAST screening cutoffs (10). The isolate
was positive in the MBL EDTA double-disk synergy test (11),
and carbapenemase production was confirmed by matrix-assisted
laser desorption ionization–time of flight mass spectrometry
(MALDI-TOF MS) (12). Table 1 presents the antimicrobial susceptibility
data for Kpn-1144 determined by broth microdilution
(13) and interpreted using the EUCAST criteria (http://www
.eucast.org/). Of note, the MICs of carbapenems were relatively
low (0.75 to 1 ␮g/ml).
PCR screening for various MBL genes (14, 15) followed by
sequencing revealed the presence of the blaIMP-8 gene (4) in Kpn-
1144. The multilocus sequence typing (MLST) analysis (16) classified
the isolate into ST252. K. pneumoniae ST252 was originally
identified in the United States in 2007 (http://bigsdb.web.pasteur
.fr/klebsiella/klebsiella.html), but recently, it was also found among
VIM-1-producing isolates from different health care institutions in
Barcelona, Spain (8, 17).
Attempts to transfer ␤-lactam resistance from Kpn-1144 to
rifampin-resistant (Rifr
) Escherichia coli strain A15 by conjugation
were unsuccessful, in contrast to electroporation of E. coli strain
DH5␣ with purified plasmid DNA of Kpn-1144 (Qiagen maxi
kit; Qiagen, Hilden, Germany). Transformants were selected on
Luria-Bertani agar plates with ampicillin (50 ␮g/ml), confirmed
to be IMP producers by PCR (14), and tested for antimicrobial
susceptibility (Table 1). The plasmid location of the blaIMP-8 gene
was demonstrated by the S1 nuclease analysis of Kpn-1144 and its
transformant (18), followed by hybridization with a digoxigeninlabeled
blaIMP probe. S1 profiling revealed multiple plasmids in
Kpn-1144 comprising molecules of ϳ15 kb, ϳ100 kb, ϳ170 kb,
ϳ230 kb, and ϳ340 kb, of which only the ϳ15-kb plasmid was
also in the transformant and hybridized with the blaIMP probe
(results not shown). This plasmid, designated pKP-M1144, was
nontypeable by PCR-based replicon typing (PBRT) (19), and its
whole nucleotide sequence was determined. Sequencing, assembling
of the reads, filling of sequence gaps, and analysis and annotation
of the plasmid sequence were performed as described previously
(20).
Plasmid pKP-M1144 is 12,029 bp in size, with an average GϩC
content of 51.5%. Analysis of the sequence revealed that blaIMP-8 is
the first gene cassette of a unique class 3 integron structure, In1144
(Fig. 1), composed of 4,679 bp (nucleotides [nt] 1 to 4679). Upstream
of blaIMP-8, the intI3 gene encoding the class 3 integrase was
Received 20 April 2015 Returned for modification 13 May 2015
Accepted 29 May 2015
Accepted manuscript posted online 1 June 2015
Citation Papagiannitsis CC, Dolejska M, Izdebski R, Dobiasova H, Studentova V,
Esteves FJ, Derde LPG, Bonten MJM, Hrabák J, Gniadkowski M. 2015.
Characterization of pKP-M1144, a novel ColE1-like plasmid encoding IMP-8, GES-5,
and BEL-1 ␤-lactamases, from a Klebsiella pneumoniae sequence type 252 isolate.
Antimicrob Agents Chemother 59:5065–5068. doi:10.1128/AAC.00937-15.
Address correspondence to Costas C. Papagiannitsis, c.papagiannitsis@gmail.com.
Copyright © 2015, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AAC.00937-15
August 2015 Volume 59 Number 8 aac.asm.org 5065Antimicrobial Agents and Chemotherapy
onAugust13,2015byguesthttp://aac.asm.org/Downloadedfrom
identified (21). The pKP-M1144 intI3 exhibited 100% sequence
identity to the intI3 associated with blaGES-1 in the IncQ-type plasmid
pQ7 from E. coli strain TB7 from Switzerland (22) and 99%
identity to that with blaIMP-1 from Serratia marcescens strain
AK9373 from Japan (23). Downstream of blaIMP-8, three other
cassettes were found. The second one was blaGES-5, encoding the
ESBL GES-5 that exhibits weak carbapenemase activity (5). This
was followed by blaBEL-1, specifying the prototype enzyme of the
ESBL family BEL, observed only in Pseudomonas aeruginosa so far
(6). The last cassette was aacA4, encoding the acetyltransferase
AAC(6=)-Ib, which confers resistance to tobramycin, netilmicin,
and amikacin (24). A putative promoter (TAGACA-N17-TAG
GAT) was located within intI3 and significantly differed from
common and relatively strong class 1 integron promoters (25).
In1144 was inserted into a ColE1-like backbone of 2,737 bp
(Fig. 1; nt 9293 to 12029). A DNA comparison showed that its
704-bp sequence (nt 9838 to 10541) had limited nucleotide
similarity to replication regions of several RNA-priming plasmids
(26–29). pKP-M1144 exhibited the highest similarity score with
the replicon of pJHCMW1 (100% coverage, 75% identity) from K.
pneumoniae strain JHCK1 from Argentina (28). A consensus sequence
for the ColE1 replication origin (oriV) (30) was located at
positions 10414 to 10416. Additionally, putative regions containing
the RNA transcripts RNA II and RNA I that control the initiation
of DNA replication and the plasmid copy number (31) were
identified (Fig. 1). RNA II (nt 9882 to 10417) acts as a primer for
the initiation of replication, while RNA I (nt 9984 to 9883) is an
antisense molecule that controls replication initiation by binding
to RNA II and preventing primer formation. The RNA II and RNA
I of pKP-M1144 were 78% and 68% identical, respectively, to the
corresponding transcripts from pJHCMW1 (28). Downstream of
oriV, a 192-bp sequence resembling the rom gene (96% identity)
of pNBL63 from Klebsiella oxytoca strain NBL63 (29) was present
(nt 10589 to 10780). The Rom (or Rop) protein enhances the
interaction of the RNA I inhibitor with its target, thus resulting in
a reduction of the replication initiation frequency (32). Just next
to rom, an exc1-like sequence of 423 bp, exhibiting 95% identity
with that of pNE1280 from Enterobacter cloacae strain 1623 (33),
was identified (nt 10780 to 11202). The Exc1 protein (entry exclusion
protein 1) may reduce the formation of stable mating pairs
(26). Of note is that an exc1-like gene, whose putative product
showed low amino acid similarity (41%) with the putative Exc1 of
pKP-M1144, has also been found downstream of the rom gene in
pNBL63 (29). In the remaining part of pKP-M1144 (nt 4680 to
9292), a 37-bp segment similar to the replication region of IncQ
plasmids (⌬repC) (22) was found at the boundary of In1144, 258
bp downstream of aacA4. The repC gene at a similar position was
identified in the IncQ plasmid pQ7 with the blaGES-1-carrying class
3 integron (22). Upstream of ⌬repC, the intact transposon Tn5403
was found (34).
Although no origin-of-transfer (oriT) and ColE1 mob genes
(35) were identified in pKP-M1144, the mobilization capability of
the plasmid was tested. pKP-M1144 was introduced into E. coli
strain XL1-Blue that harbors the fertility factor F=, being an IncFIA-type
conjugative plasmid. The resulting transformants were
used in mating experiments with E. coli A15 Rifr
(8). Transconjugants
were selected on MacConkey agar plates with rifampin (150
␮g/ml) and ampicillin (50 ␮g/ml) and confirmed to carry the
ϳ15-kb plasmid pKP-M1144. The transfer of pKP-M1144 was
achieved at a relatively high frequency (2 ϫ 10Ϫ5
blaIMP-positive
recombinants per donor cell), indicating its capability to be mobilized
by plasmids with apparently different conjugation systems.
This finding might be explained by the presence of a sequence
with limited identity with the ColE1 oriT (28); however, a furTABLE
1 Antimicrobial susceptibility of K. pneumoniae Kp-1144 and the E. coli DH5␣ transformant harboring the IMP-8-encoding plasmid pKP-
M1144
Strain
MIC (␮g/ml) ofa
:
AMX AMC PIP TZP CTX CAZ FEP ATM IPM MEM ETP GEN AMK CHL CST SXT CIP
K. pneumoniae
Kpn-1144
Ͼ256 24 Ͼ64 32 Ͼ8 Ͼ32 16 48 0.75 1 0.5 4 8 Ͼ32 0.25 8 0.5
E. coli DH5␣
(pKP-M1144)
Ͼ256 24 64 8 Ͼ8 Ͼ32 16 2 0.5 0.5 0.25 0.5 1 2 0.25 1 Յ0.12
E. coli DH5␣ 4 2 2 0.5 Յ0.12 Յ0.25 Յ0.12 Յ0.12 Յ0.12 Յ0.12 Յ0.12 0.12 0.5 Յ1 Յ0.12 1 Յ0.12
a
AMX, amoxicillin; AMC, amoxicillin-clavulanate (inhibitor fixed at 2 ␮g/ml); PIP, piperacillin; TZP, piperacillin-tazobactam (inhibitor fixed at 4 ␮g/ml); CTX, cefotaxime; CAZ,
ceftazidime; FEP, cefepime; ATM, aztreonam; IPM, imipenem; MEM, meropenem; ETP, ertapenem; GEN, gentamicin; AMK, amikacin; CHL, chloramphenicol; CST, colistin; SXT,
trimethoprim-sulfamethoxazole; CIP, ciprofloxacin.
FIG 1 Circular genetic map of pKP-M1144. Arrows show directions of transcription
of open reading frames and regulatory elements. Sequences characteristic
of the ColE1-like plasmid backbone are indicated by black arrows. The
intI3 gene and transposases are shaded gray. White arrows indicate the resistance
genes. Position 1 is indicated by a vertical black arrow on strand ruler.
Papagiannitsis et al.
5066 aac.asm.org August 2015 Volume 59 Number 8Antimicrobial Agents and Chemotherapy
onAugust13,2015byguesthttp://aac.asm.org/Downloadedfrom
ther study is necessary to prove this hypothesis and characterize
the putative oriT.
To our knowledge, this is the first description of a blaIMP-carrying
class 3 integron identified in Europe. In1144 also carries the
blaGES-5, blaBEL-1, and aacA4 gene cassettes. Of note was that Kpn-
1144 showed only reduced susceptibility to carbapenems, even
though it produced IMP-8 and GES-5 carbapenemases. It might
be due to lower expression driven by a weaker promoter (25), low
plasmid copy number, and/or good permeability of the outer
membrane of the strain for antibiotics.
In general, IMP-like MBLs have been much more common in
the Far East than in Europe (3), and class 3 integrons with MBL
genes, exclusively blaIMP, have occurred rarely and only in Japan
so far (23, 36). In 2010, the blaIMP-8 cassette was reported in K.
oxytoca in Spain and Pseudomonas mendocina in Portugal, but it
was located in class 1 integrons (37, 38); moreover, the cassettes
blaGES-5 and blaBEL-1 have been found exclusively in such elements
so far (5, 6). All these observations suggest that In1144 emerged by
the exchange of resistance cassettes between class 1 and class 3
integrons. Moreover, the presence of blaBEL-1 in Kpn-1144 is the
first report on a BEL-type ESBL in Enterobacteriaceae, suggesting
its acquisition from P. aeruginosa. In1144 is carried by a new
ColE1-like plasmid, pKP-M1144, but the presence of the IncQderived
⌬repC next to the integron suggests that it may have originated
from an IncQ-like plasmid with a class 3 integron, like pQ7
(22). A plausible hypothesis is that this class 3 integron was acquired
by a ColE1-like replicon from an IncQ-type plasmid at a
certain step in pKP-M1144 evolution; however, it is not known
whether this was In1144 already or any of its possible progenitors.
This work confirms the significant role of ColE1-like plasmids in
resistance dissemination (29, 39–41) and documents an interesting
case of evolution of mobile genetic elements with resistance
determinants in Gram-negative bacteria.
The nucleotide sequence of the plasmid pKP-M1144 has been
assigned the GenBank accession no. KF745070.
ACKNOWLEDGMENTS
We thank A. Baraniak and J. Fiett for their assistance, and the curator team
of the Institute Pasteur in Paris, France, for curating the MLST data of K.
pneumoniae and making them publicly available.
This work was supported by funding from the European Community
(MOSAR network contract LSHP-CT-2007-037941). It was also financed
in part by grant NT11032-6/2010 from the Ministry of Health of the Czech
Republic and grant P36 by the Charles University Research Fund.
We declare no conflicts of interest.
REFERENCES
1. Bebrone C. 2007. Metallo-␤-lactamases (classification, activity, genetic
organization, structure, zinc coordination) and their superfamily.
Biochem Pharmacol 74:1686–1701. http://dx.doi.org/10.1016/j.bcp.2007
.05.021.
2. Cornaglia G, Giamarellou H, Rossolini GM. 2011. Metallo-␤lactamases:
a last frontier for ␤-lactams? Lancet Infect Dis 11:381–393.
http://dx.doi.org/10.1016/S1473-3099(11)70056-1.
3. Tzouvelekis LS, Markogiannakis A, Psichogiou M, Tassios PT, Daikos
GL. 2012. Carbapenemases in Klebsiella pneumoniae and other Enterobacteriaceae:
an evolving crisis of global dimensions. Clin Microbiol Rev 25:
682–707. http://dx.doi.org/10.1128/CMR.05035-11.
4. Yan JJ, Ko WC, Wu JJ. 2001. Identification of a plasmid encoding SHV-12,
TEM-1, and a variant of IMP-2 metallo-␤-lactamase, IMP-8, from a clinical
isolate of Klebsiella pneumoniae. Antimicrob Agents Chemother 45:2368–
2371. http://dx.doi.org/10.1128/AAC.45.8.2368-2371.2001.
5. Vourli S, Giakkoupi P, Miriagou V, Tzelepi E, Vatopoulos AC, Tzouvelekis
LS. 2004. Novel GES/IBC extended-spectrum ␤-lactamase variants with car-
bapenemaseactivityinclinicalenterobacteria.FEMSMicrobiolLett234:209–
213. http://dx.doi.org/10.1016/j.femsle.2004.03.028.
6. Poirel L, Brinas L, Verlinde A, Ide L, Nordmann P. 2005. BEL-1, a novel
clavulanic acid-inhibited extended-spectrum ␤-lactamase, and the class 1 integron
In120 in Pseudomonas aeruginosa. Antimicrob Agents Chemother
49:3743–3748. http://dx.doi.org/10.1128/AAC.49.9.3743-3748.2005.
7. Derde LP, Cooper BS, Goossens H, Malhotra-Kumar S, Willems RJ,
Gniadkowski M, Hryniewicz W, Empel J, Daurzenberg MJ, Annane D,
Aragão I, Chalfine A, Dumpis U, Esteves F, Giamarellou H, Muzlovic
I, Nardi G, Petrikkos GL, Tomic V, Martí AT, Stammet P, BrunBuisson
C, Bonten MJ; MOSAR WP3 Study Team. 2013. Interventions
to reduce colonization and transmission of antimicrobial-resistant bacteria
in intensive care units: an interrupted time series study and cluster
randomised trial. Lancet Infect Dis 14:31–39.
8. Papagiannitsis CC, Izdebski R, Baraniak A, Fiett J, Herda M, Hrabak J,
Derde LPG, Bonten MJM, Carmeli Y, Goossens H, Hryniewicz W,
Brun-Buisson C, Gniadkowski M; MOSAR WP2, WP3, and WP5 Study
Groups. 2015. Survey of metallo-␤-lactamase-producing Enterobacteriaceae
colonizing patients in European ICUs and rehabilitation units, 2008–
11. J Antimicrob Chemother, in press.
9. Drieux L, Brossier F, Sougakoff W, Jarlier V. 2008. Phenotypic detection
of extended-spectrum beta-lactamase production in Enterobacteriaceae.
Clin Microbiol Infect 14(Suppl 1):90–103.
10. European Committee on Antimicrobial Susceptibility Testing (EUCAST).
2013. EUCAST guideline for the detection of resistance mechanisms and specific
resistances of clinical and/or epidemiological importance. European So-
cietyofClinicalMicrobiologyandInfectiousDiseases(EUCAST),Basel,Switzerland.
http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files
/Resistance_mechanisms/EUCAST_detection_of_resistance_mechanisms
_v1.0_20131211.pdf.
11. Lee K, Lim YS, Yong D, Yum JH, Chong Y. 2003. Evaluation of the
Hodge test and the imipenem-EDTA double-disk synergy test for differentiating
metallo-␤-lactamase producing isolates of Pseudomonas spp.
and Acinetobacter spp. J Clin Microbiol 41:4623–4629. http://dx.doi.org
/10.1128/JCM.41.10.4623-4629.2003.
12. Papagiannitsis CC, Študentova V, Izdebski R, Oikonomou O, Pfeifer Y,
Petinaki E, Hrabak J. 2015. Matrix-assisted laser desorption ionization–
time of flight mass spectrometry meropenem hydrolysis assay with
NH4HCO3, a reliable tool for the direct detection of carbapenemase activity.
J Clin Microbiol 53:1731–1735.
13. European Committee on Antimicrobial Susceptibility Testing. 2003.
Determination of minimum inhibitory concentrations (MICs) of antibacterial
agents by broth dilution. Clin Microbiol Infect 9:1–7. http://dx.doi
.org/10.1046/j.1469-0691.2003.00790.
14. Ellington MJ, Kistler J, Livermore DM, Woodford N. 2007. Multiplex
PCR for rapid detection of genes encoding acquired metallo-␤lactamases.
J Antimicrob Chemother 59:321–322.
15. Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, Walsh TR.
2009. Characterization of a new metallo-␤-lactamase gene, blaNDM-1, and a
novel erythromycin esterase gene carried on a unique genetic structure in
Klebsiella pneumoniae sequence type 12 from India. Antimicrob Agents
Chemother 53:5046–5054. http://dx.doi.org/10.1128/AAC.00774-09.
16. Diancourt L, Passet V, Verhoef J, Grimont A, Brisse S. 2005. Multilocus
sequence typing of Klebsiella pneumoniae nosocomial isolate. J Clin Microbiol
43:4178–4182. http://dx.doi.org/10.1128/JCM.43.8.4178-4182.2005.
17. Coelho A, Piedra-Carrasco N, Bartolome R, Quintero-Zarate JN, Larrosa
N, Conejo-Sanchez T, Prats G, Garcillan-Barcia MP, de la Cruz F,
Gonzalez-Lopez JJ. 2012. Role of IncHI2 plasmids harbouring blaVIM-1,
blaCTX-M-9, aac(6=)-Ib and qnrA genes in the spread of multiresistant Enterobacter
cloacae and Klebsiella pneumoniae strains in different units at
Hospital Vall d’Hebron, Barcelona, Spain. Int J Antimicrob Agents 39:
514–517 http://dx.doi.org/10.1016/j.ijantimicag.2012.01.006.
18. Barton BM, Harding GP, Zuccarelli AJ. 1995. A general method for the
detecting and sizing large plasmids. Anal Biochem 226:235–240.
19. Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ. 2005.
Identification of plasmids by PCR-based replicon typing. J Microbiol
Methods 63:219–228. http://dx.doi.org/10.1016/j.mimet.2005.03.018.
20. Studentova V, Dobiasova H, Hedlova D, Dolejska M, Papagiannitsis
CC, Hrabak J. 2015. Complete nucleotide sequences of two NDM-1encoding
plasmids from the same sequence type 11 Klebsiella pneumoniae
strain. Antimicrob Agents Chemother 59:1325–1328. http://dx.doi.org/10
.1128/AAC.04095-14.
ColE1-Like Plasmid Carrying blaIMP-8
August 2015 Volume 59 Number 8 aac.asm.org 5067Antimicrobial Agents and Chemotherapy
onAugust13,2015byguesthttp://aac.asm.org/Downloadedfrom
21. Collis CM, Kim MJ, Patridge SR, Stokes HW, Hall RM. 2002. Characterization
of the class 3 integron and the site-specific recombination system
it determines. J Bacteriol 184:3017–3026. http://dx.doi.org/10.1128
/JB.184.11.3017-3026.2002.
22. Poirel L, Carattoli A, Bernabeu S, Bruderer T, Frei R, Nordmann P.
2010. A novel IncQ plasmid type harbouring a class 3 integron from Escherichia
coli. J Antimicrob Chemother 65:1594–1598. http://dx.doi.org/10
.1093/jac/dkq166.
23. Arakawa Y, Murakami M, Suzuki K, Ito H, Wacharotayankin R,
Ohsuka S, Kato N, Ohta M. 1995. A novel integron-like element carrying
the metallo-␤-lactamase gene blaIMP. Antimicrob Agents Chemother 39:
1612–1615. http://dx.doi.org/10.1128/AAC.39.7.1612.
24. Shaw KJ, Rather PN, Hare RS, Miller GH. 1993. Molecular genetics of
aminoglycoside resistance genes and familial relationships of the aminoglycoside-modifying
enzymes. Microbiol Rev 57:138–163.
25. Papagiannisis CC, Tzouvelekis LS, Miriagou V. 2009. Relative strengths
of the class 1 integron promoter hybrid 2 and the combinations of strong
and hybrid 1 with an active P2 promoter. Antimicrob Agents Chemother
53:277–280. http://dx.doi.org/10.1128/AAC.00912-08.
26. Chan PT, Ohmori H, Tomizawa J, Lebowitz J. 1985. Nucleotide sequence
and gene organization of ColE1 DNA. J Biol Chem 260:8925–
8935.
27. Nomura N, Murooka Y. 1994. Characterization and sequencing of the
region required for replication of a non-selftransmissible plasmid pEC3
isolated from Erwinia carotovora subsp. carotovora. J Ferment Bioeng 78:
250–254. http://dx.doi.org/10.1016/0922-338X(94)90299-2.
28. Dery KJ, Chavideh R, Waters V, Chamoro R, Tomalsky LS, Tomalsky
ME. 1997. Characterization of the replication and mobilization regions of
the multiresistance Klebsiella pneumoniae plasmid pJHCMW1. Plasmid
38:97–105. http://dx.doi.org/10.1006/plas.1997.1303.
29. Wu SW, Dornbusch K, Kronvall G, Norgen M. 1999. Characterization
and nucleotide sequence of a Klebsiella oxytoca cryptic plasmid encoding a
CMY-type beta-lactamase: confirmation that the plasmid-mediated
cephamycinase originated from the Citrobacter freundii AmpC betalactamase.
Antimicrob Agents Chemother 43:1350–1357.
30. Tomizawa JI, Ohmori H, Bird RE. 1977. Origin of replication of colicin
E1 plasmid DNA. Proc Natl Acad Sci U S A 74:1865–1869. http://dx.doi
.org/10.1073/pnas.74.5.1865.
31. Polisky B. 1988. ColE1 replication control circuitry: sense from antisense.
Cell 55:929–932. http://dx.doi.org/10.1016/0092-8674(88)90235-8.
32. Cesareni G, Helmer-Citterich M, Castagnoli L. 1991. Control of ColE1
plasmid replication by antisense RNA. Trends Genet 7:230–235. http://dx
.doi.org/10.1016/0168-9525(91)90370-6.
33. Bryant KA, Van Schooneveld TC, Thapa I, Bastola D, Williams LO,
Safranek TJ, Hinrichs SH, Rupp ME, Fey FD. 2013. KPC-4 is encoded
within a truncated Tn4401 in an IncL/M plasmid, pNE1280, isolated from
Enterobacter cloacae and Serratia marcescens. Antimicrob Agents Chemother
57:37–41. http://dx.doi.org/10.1128/AAC.01062-12.
34. Rinkel M, Hubert JC, Roux B, Lett MC. 1994. Identification of a new
transposon Tn5403 in a Klebsiella pneumoniae strain isolated from a polluted
aquatic environment. Curr Microbiol 29:249–154. http://dx.doi.org
/10.1007/BF01577436.
35. Warren GJ, Saul MW, Sherratt DJ. 1979. ColE1 plasmid mobility: essential
and conditional functions. Mol Gen Genet 170:103–107.
36. Senda K, Arakawa Y, Ichiyama S, Nakashima K, Ito H, Ohsuka S,
Shimokata K, Kato N, Ohta M. 1996. PCR detection of metallo-␤lactamase
gene (blaIMP) in Gram-negative rods resistant to broadspectrum
␤-lactams. J Clin Microbiol 34:2909–2913.
37. Conejo MC, Dominguez MC, López-Cerero L, Serano L, RodríguezBaño
J, Pascual A. 2010. Isolation of multidrug-resistant Klebsiella oxytoca
carrying blaIMP-8, associated with OXY hyperproduction in the intensive
care unit of a community hospital in Spain. J Antimicrob Chemother
65:1071–1073. http://dx.doi.org/10.1093/jac/dkq063.
38. Santos C, Caetano T, Ferreira S, Mendo S. 2010. First description of
blaIMP-8 in a Pseudomonas mendocina isolated at the Hospital Infante D.
Pedro, Aveiro, Portugal. Res Microbiol 161:305–307.
39. Cao V, Lambert T, Courvalin P. 2002. ColE1-like plasmid pIP843 of
Klebsiella pneumoniae encoding extended-spectrum beta-lactamase CTXM-17.
Antimicrob Agents Chemother 46:1212–1217. http://dx.doi.org/10
.1128/AAC.46.5.1212-1217.2002.
40. Sarno R, McGillivary G, Sherratt DJ, Actis LA, Tomalsky ME. 2002.
Complete nucleotide sequence of Klebsiella pneumoniae multiresistance
plasmid pJHCMW1. Antimicrob Agents Chemother 46:3422–3427. http:
//dx.doi.org/10.1128/AAC.46.11.3422-3427.2002.
41. Zioga A, Whichard JM, Kotsakis SD, Tzouvelekis LS, Tzelepi E, Miriagou
V. 2009. CMY-31 and CMY-36 cephalosporinases encoded by
ColE1-like plasmids. Antimicrob Agents Chemother 53:1256–1259. http:
//dx.doi.org/10.1128/AAC.01284-08.
Papagiannitsis et al.
5068 aac.asm.org August 2015 Volume 59 Number 8Antimicrobial Agents and Chemotherapy
onAugust13,2015byguesthttp://aac.asm.org/Downloadedfrom
Příloha 29
DOBIASOVA, H., VIDENSKA, P., DOLEJSKA, M., 2015, Complete sequences of IncU plasmids
harboring quinolone resistance genes qnrS2 and aac(6')-Ib-cr in Aeromonas spp. from
ornamental fish: Antimicrobial Agents and Chemotherapy, v. 60, p. 653-657.
Souhrn
Technologií nové generace sekvenování byla stanovena primární nukleotidová sekvence tří IncU plazmidů
získaných z izolátů Aeromonas spp. z okrasných ryb, které nesou geny rezistence k fluorochinolonům qnrS2 a
aac(6')-Ib-cr. Plazmidy obsahovaly kostru typickou pro IncU skupinu a gen qnrS2 byl včleněn do mpR ve formě
mobilní inzerční kazety. V rámci plazmidů byly zjištěny významné evoluční přestavby dokumentující vysokou
plasticitu IncU plazmidů. V jejich sekvencích byly dále nalezeny nové geny, které se mohou podílet
na perzistenci a stabilitě plazmidů ve vodním prostředí.
Complete Sequences of IncU Plasmids Harboring Quinolone
Resistance Genes qnrS2 and aac(6=)-Ib-cr in Aeromonas spp. from
Ornamental Fish
Hana Dobiasova,a,b
Petra Videnska,c
Monika Dolejskaa,b
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech
Republica
; Central European Institute of Technology, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republicb
; Veterinary Research Institute,
Brno, Czech Republicc
The nucleotide sequences of three IncU plasmids from Aeromonas spp. isolated from ornamental fish are described. They had a
typical IncU backbone for plasmid replication and maintenance functions, but conjugative transfer modules were disrupted.
The gene qnrS2 was inserted into mpR as a mobile insertion cassette. Novel Tn3 family transposons carrying putative toxin-antitoxin
and plasmid stability genes were identified. The study demonstrates high plasticity of IncU plasmids from aquatic
environments.
Aeromonas is a ubiquitous microorganism distributed in water
ecosystems and includes species causing various kinds of infections
in fish and humans. Antibiotic resistance in Aeromonas in
aquatic environments is associated especially with plasmids of
the IncU family. Most IncU plasmids described in this genus to
date share a highly conserved backbone represented by genes
for plasmid replication, stability, and conjugative transfer and
one variable region for resistance genes to antibiotics, such as
tetracyclines, sulfonamides, trimethoprim, streptomycin, and
chloramphenicol (1–6). Quinolones are broad-spectrum antimicrobial
agents widely used in human and veterinary medicine,
and they are among the most widely used antibiotics in
aquacultures (7). Aeromonas isolates harboring quinolone resistance
(PMQR) genes on IncU plasmids have been recently reported
in river water, lake water, and fish (2, 3, 6, 8), highlighting
the role of this plasmid family in dissemination of clinically relevant
resistance mechanisms in a wide range of aquatic environ-
ments.
In our previous study, IncU plasmids carrying qnrS2 and
aac(6=)-Ib-cr genes in Aeromonas spp. from ornamental fish originating
from various geographic locations were identified (8). The
aim of this study was to elucidate the structure and features of
three representative IncU plasmids carrying PMQR genes by sequencing
and bioinformatic analysis. At present, complete nucleotide
sequences of nine IncU plasmids are available in the GenBank
database. Four of them, plasmids pRA3 (GenBank accession
no. DQ401103), pFBAOT6 (GenBank accession no. CR376602),
pAC3 (GenBank accession no. KM204147), and pP2G1 (GenBank
accession no. HE616910), originate from Aeromonas spp., and
only the last two plasmids carry PMQR genes (updated on 22 July
2015).
The three sequenced IncU plasmids pAH6, pAH227, and
pASCH21 were nonconjugative and varied in size (20 to 40 kb).
Plasmid pAH6 (ϳ20 kb) originated from Aeromonas hydrophila
from a koi carp bred in the Czech Republic. It has been identified
as a highly diffused plasmid in isolates of A. hydrophila and Aeromonas
sobria from Czech koi carps and tropical fish imported
from Asia (8). The other two plasmids, pAH227 (ϳ40 kb) and
pASCH21 (ϳ35 kb), carrying qnrS2, originated from A. hydrophila
from a koi carp from the Czech Republic and A. sobria from
a tropical fish from Thailand, respectively. Plasmids were transferred
to chemically competent Escherichia coli DH5␣ cells by
transformation followed by selection of the transformants on
Luria-Bertani agar with ciprofloxacin (0.05 mg/liter) as described
previously (8). Plasmid DNAs were extracted from transformants
using the PureLink HiPure plasmid filter midiprep kit (Invitrogen,
Life Technologies, Germany) and sequenced using the 454
Genome Sequencer Junior system (Roche, Prague, Czech Republic)
on a standard DNA fragment library following the manufacturer’s
protocol. One, one, and three contigs for plasmids
pAH6, pAH227, and pASCH21, respectively, ranging from 250 to
41,761 bp in size with at least a 444-fold coverage, were obtained
using GS De Novo Assembler v2.6 software. Gaps between contigs
were filled by PCR, and the obtained amplicons were sequenced
using the Sanger method to link the contigs (Applied Biosystems,
Foster City, CA, USA). Geneious 7.0.6 software (Biomatters,
Auckland, New Zealand) was used to combine the data from the
454 Genome Sequencer Junior system and Sanger sequencing.
The BLAST algorithm (www.ncbi.nlm.nih.gov/BLAST) was used
for further data analysis. The plasmids were mapped against IncU
plasmids pRA3 and pFBAOT6 to verify the obtained sequences.
pRA3 and pFBAOT6 were used as reference plasmids to annotate
the plasmid sequences.
All three sequenced plasmids showed a highly conserved backbone.
Genes involved in plasmid replication and maintenance
showed significant sequence identity with the corresponding regions
of other plasmids in the IncU family. The replication module
was represented by the genes repA and repB and repetitive
sequences (Fig. 1). RepB showed 99.8% and 100% sequence idenReceived
22 July 2015 Returned for modification 25 August 2015
Accepted 25 October 2015
Accepted manuscript posted online 2 November 2015
Citation Dobiasova H, Videnska P, Dolejska M. 2016. Complete sequences of IncU
plasmids harboring quinolone resistance genes qnrS2 and aac(6=)-Ib-cr in
Aeromonas spp. from ornamental fish. Antimicrob Agents Chemother
60:653–657. doi:10.1128/AAC.01773-15.
Address correspondence to Monika Dolejska, monika.dolejska@gmail.com.
Copyright © 2015, American Society for Microbiology. All Rights Reserved.
crossmark
January 2016 Volume 60 Number 1 aac.asm.org 653Antimicrobial Agents and Chemotherapy
onJanuary5,2016byguesthttp://aac.asm.org/Downloadedfrom
tity with the replication protein in pRA3 and pFBAOT6, respectively.
RepA was 100% identical with the transcriptional repressor
protein of IncU archetypes. The complete set of plasmid maintenance
genes, found adjacent to the replication module, was disrupted
by insertion of qnrS2 into the gene mpR coding for a putative
zinc-metalloprotease as observed in other qnrS2-carrying
IncU plasmids (2, 3, 6). Significant differences between the three
sequenced plasmids were observed in the transfer modules involved
in plasmid conjugation and in plasmid variable regions
containing various antibiotic resistance genes and mobile ele-
ments.
Plasmid pAH227 was 36,559 bp in size and had 52.3% GϩC
content. It carried qnrS2 and showed significant similarity to
pFBAOT6 and pRA3 (92% coverage, 99% identity). The majority
of the plasmid sequence (33,947 bp) was composed of conserved
IncU plasmid backbone. It contained a complete transfer region as
seen in pRA3. However, the transfer region in pAH227 was disrupted
by the insertion sequence ISAs1 inserted into the gene coding
for conjugal transfer protein VirD4, likely resulting in the loss
of conjugative abilities of the plasmid, as demonstrated in vitro
(8). The ISAs1 was flanked by imperfect 22-bp inverted repeats
(IRs) and showed 100% nucleotide identity to a transposase gene
found in A. salmonicida (GenBank accession no. CP000645) and
Aeromonas media (GenBank accession no. CP007567) genomes.
Target site duplication of 10 bp (ACTGCATACC) at the ISAs1
boundaries indicated the insertion via transposition. In contrast
to other IncU plasmids described in Aeromonas spp. to date, no
accessory genes apart from qnrS2 were found on pAH227. However,
plasmids pMBUI3 (KC170281) and pMBUI7 (KC170284)
from an unknown bacterial species recently isolated from freshwaters
in the United States show great similarity (91% to 92%
coverage, 93% to 95% identity) to pAH227 and consist entirely of
IncU plasmid backbone with no known accessory genes (9). These
plasmids may represent IncU archetypes before the acquisition of
resistance genes.
Plasmid pASCH21 contained qnrS2 and was 44,649 bp in size,
with an average GϩC content of 56.5%. It was composed of a
17,694-bp IncU plasmid backbone and a 26,955-bp accessory region.
The plasmid backbone was disrupted within the gene coding
for VirD4 conjugal transfer protein by a continuous highly mosaic
variable region, consisting of sets of resistance genes, transposable
elements, and integrons. The sequencing data indicated that
pASCH21 was a derivate of pFBAOT6 (65% coverage, 99% identity).
Both plasmids contained plasmid backbone sharing 99%
FIG 1 Linear maps of PMQR-carrying IncU plasmids pAH227, pASCH21, and pAH6 from Aeromonas. Open reading frames (ORFs) are shown as arrows,
indicating the direction of transcription. Plasmid scaffold, including the plasmid replicons, maintenance genes, and transfer region, are shown in violet, green,
and yellow, respectively. PMQR genes are shown in blue, while other resistance genes are indicated in orange. IS, intI1, tnpA, and tnpR are shown in red. Other
genes are shown in white or pink. Dark gray boxes represent repetitive regions adjacent to rep genes. Inverted repeats (IRL, left inverted repeat; IRR, right inverted
repeat) and direct repeats (DR) are shown in purple and black lines, respectively. The extent of transposons is indicated below the plasmid map. The green lines
below the maps correspond to highly similar sequences from other fully and partially (p37) sequenced IncU plasmids. Homologous regions are indicated by gray
shading.
Dobiasova et al.
654 aac.asm.org January 2016 Volume 60 Number 1Antimicrobial Agents and Chemotherapy
onJanuary5,2016byguesthttp://aac.asm.org/Downloadedfrom
sequence similarity and a related genetic load represented by an
In4-like class 1 integron and a Tn21-like unit transposon, Tn1721.
In both plasmids, Tn1721 was separated into left (Tn1721-L,
i.e., truncated region corresponding to Tn1722) and right
[Tn1721-R, harboring tetA(A) resistance gene] ends.
pFBAOT6 had a complete Tn1721 surrounded by direct repeats
(DRs) at both ends, suggesting its acquisition by a single transposition
event. On the other hand, the left end of Tn1721-L in
pASCH21, including DR, IRLTn1721-L, and part of mcp (previously
designated orfI) encoding methyl-accepting chemotaxis protein,
has been removed, likely by insertion of the integron. Both plasmids
contained insertion sequence IS6100 upstream of the class 1
integron, a typical feature of In4-like integrons. However, the integrons
of pASCH21 and pFBAOT6 differed. pASCH21 contained
a dfrA22d cassette coding for resistance to trimethoprim, while
pFBAOT6 had the streptomycin resistance gene cassette aadA2. In
addition, the integron of pFBAOT6 was inserted at the left end of
an intact sequence of Tn1721-L, while in pASCH21, the integron
was truncated Tn1721-L in mcp. Furthermore, the sequence of a
remnant tni402 and a terminal IR typical for In4-like integrons
were missing in pASCH21, likely as a result of insertion of IS26
adjacent to IS6100. Two Tn3 family transposons were found between
Tn1721-L and Tn1721-R. Tn5501-like was inserted immediately
downstream of ⌬Tn1721-L, truncating the gene tnpA of
the transposon. This novel transposon is flanked by typical 38-bp
left IRs and exhibits 90% to 91% identity at the amino acid level
with Tn3 family transposons identified in IncP1 plasmids pGNB1
(10) and pB8 (11) isolated from unknown bacteria collected from
activated sludge from wastewater treatment plants. Compared to
the IncP1 plasmids, Tn5501-like in pASCH21 carried four genes,
two of them coding for putative plasmid stabilization proteins
showing significant similarity to proteins identified in plant-associated
Pseudomonas savastanoi (12, 13). Insertion of another
4,717-bp Tn3 transposon downstream of Tn5501-like likely reFIG
2 Mobile insertion cassette (mic) carrying qnrS2 gene and the insertion site on various plasmid backbones. Open reading frames (ORFs) are shown as
arrows, indicating the direction of transcription. Plasmid scaffolds, including the plasmid replicons, maintenance genes, and transfer region, are shown in violet,
green, and yellow, respectively. The gene qnrS2 is shown in blue. Inverted repeats (IRL, left inverted repeat; IRR, right inverted repeat) are shown in boxes, with
a black arrow indicating the direction; their length and sequence are shown below the structures, and nucleotides that differed among the plasmids are
underlined. Direct repeats (DR) flanking the mic are shown above the map. Homologous regions are indicated by gray shading.
Sequences of IncU Plasmids in Aeromonas from Fish
January 2016 Volume 60 Number 1 aac.asm.org 655Antimicrobial Agents and Chemotherapy
onJanuary5,2016byguesthttp://aac.asm.org/Downloadedfrom
moved parts of Tn5501-like and Tn1721-R, including their corresponding
IRs. This Tn3 transposon was flanked by 38-bp IRs;
however, the insertion has not generated target site duplications;
thus, it is unlikely that it has been acquired by transposition. The
transposon carried toxin-antitoxin gene pairs, probably ensuring
plasmid stability. These putative plasmid stability proteins exhibited
86% and 96% identity at the amino acid level with RelE and
RelB proteins, respectively, encoded by small cryptic ColE2-type
plasmids in A. salmonicida (14).
pAH6 plasmid harbored qnrS2 and aac(6=)-Ib-cr genes and was
found to be 15,886 bp in size, with an average GϩC content of
54.9%. It shared extensive similarities with IncU plasmids
pFBAOT6 (88% coverage, 100% identity) and pRA3 (87% coverage,
99% identity). The sequence is highly related to PMQR-carrying
IncU plasmid pAC3 from Aeromonas sp. from a wastewater
treatment plant in South Korea (99% coverage, 100% identity).
pAH6 is one of the smallest IncU plasmids described so far. Recently,
8-kb IncU plasmid pPA-2 harboring blaKPC-2 and lacking
genes involved in plasmid transfer and partitioning was identified
in a clinical isolate of Pseudomonas aeruginosa (15), highlighting
the ability of IncU plasmids to form smaller molecules. In pAH6,
the conjugative transfer region was disrupted inside the gene nic
encoding VirD2 relaxase by a class 1 integron harboring the gene
cassette aac(6=)-Ib-cr. The 3= part of the integron was removed,
likely as a result of subsequent rearrangements after the integron
acquisition. A complete In2 family integron with an aac(6=)-Ibcr–blaOXA-1–catB3–arr-3
cassette array is present in other PMQRcarrying
IncU plasmids in Aeromonas spp. isolated from river water
in Spain and France (3, 6). Adjacent to the integron, pAH6
contained a 1,025-bp ISPa15-like element separated by a 114-bp
sequence from the integron, as observed in IncU plasmid
pFBAOT6 and IncP-6 plasmid Rms149 (4, 16). The In2-like integron
and ISPa15-like element were suggested to form a composite
transposon whose complete structure appears to be present in
pFBAOT6 (4).
All three sequenced plasmids contained the qnrS2 gene inserted
in the same position of the plasmid maintenance region
into the gene mpR in the form of a mobile insertion cassette (mic).
pAH227 and pASCH21 contained the intact 1,370-bp mic bracketed
by 22-bp imperfect IRs and a 5-bp duplication of the target
site (Fig. 2), suggesting the acquisition of the structure by transposition.
The same insertion site of qnrS2 and structure of mic
have been observed in other IncU plasmids (2, 3), highlighting
the gene mpR as a hot spot for qnrS2 insertion in this plasmid
group. The identical structure of mic seen in pCH21 and pAH227
was found in IncU plasmid p37 in Aeromonas punctata from
river water in France (2) and in plasmids of other incompatibility
groups, such as IncQ2 plasmid pAHIB101-pBF7.8 in A.
hydrophila from a fish isolate in China (GenBank accession no.
KM245123) and ColE-type plasmids pAQ2-1 and pAQ2-2 in A.
sobria from fish in South Korea (17). This suggests that this qnrS2carrying
mic represents a promiscuous element moving between
different replicons. In IncQ and ColE-type plasmids, the mic was
inserted in plasmid backbones between genes encoding replication
and mobilization proteins, generating target site duplication
of 5 bp (Fig. 2). Other qnrS2-carrying IncU plasmids from Aeromonas
spp. described so far contain various insertions of extra
sequences inside the mic. Plasmid pP2G1 from river water in
Spain carries ISKpn9 inserted at the 5= end of qnrS2, while pAC3
and p42 from China and France, respectively, contain a 106-bp
insert at the 3= end of qnrS2 (6). In pAH6, IRLs and DRs of mic
upstream of qnrS2 were missing, likely due to subsequent plasmid
rearrangements after the acquisition of the qnrS2-carrying mic.
This resulted in the loss of mobilization abilities of the gene.
Our study described complete sequences of IncU plasmids carrying
PMQR determinants from A. hydrophila and A. sobria
recovered from ornamental fish from distant geographic areas.
pAH6-like IncU plasmids carrying qnrS2 and aac(6=)-Ib-cr genes
have been found in various Aeromonas isolates from the Czech
Republic, Thailand, Vietnam, and South Korea, suggesting the
importance of this plasmid lineage in dissemination of PMQR
genes among aquatic animals and the environment. None of the
plasmids could be transferred to recipient bacteria by conjugation,
most likely because of disruption of the conjugative transfer region.
A general ability of Aeromonas environmental isolates to
acquire free DNA was recently described (18), highlighting the
role of transformation in the gene flow in natural environments,
including water. Despite the loss of conjugative abilities, the IncU
plasmids may be efficiently transferred in aquatic environments,
most likely by the transformation of free plasmid DNA to naturally
competent bacteria. IncU plasmids formed smaller molecules
and acquired novel stability genes, which may give them the
ability to pose a lower biological burden for host cells and to be
maintained in antibiotic-free environments. Our study demonstrated
higher variability in this plasmid family than previously
anticipated, its rapid evolution, and an important role in the circulation
of fluoroquinolone resistance in the environment.
Nucleotide sequence accession numbers. The nucleotide sequences
of plasmids pAH6, pAH227, and pASCH21 have been
assigned the GenBank accession numbers KT315927, KT315926,
and KT315928, respectively.
ACKNOWLEDGMENTS
This work was supported by a research project grant from the Czech
Ministry of Agriculture (NAZV QJ1210237), Czech Science Foundation
(15-14683Y/P502), CEITEC-Central European Institute of Technology
(CZ.1.05/1.1.00/02.0068) from European Regional Development Fund
and AdmireVet project (CZ.1.05/2.1.00/01.0006-ED0006/01/01) from
the Czech Ministry of Education.
We thank Alois Cizek, Marie Slavikova, and Iva Kutilova from University
of Veterinary and Pharmaceutical Sciences Brno for their assis-
tance.
FUNDING INFORMATION
Czech Ministry of Education provided funding to Petra Videnska under
grant number CZ.1.05/2.1.00/01.0006. European Regional Development
Fund provided funding to Monika Dolejska and Hana Dobiasova under
grant number CZ.1.05/1.1.00/02.0068. Czech Science Foundation provided
funding to Monika Dolejska under grant number 15-14683Y/P502.
Czech Ministry of Agriculture provided funding to Monika Dolejska and
Hana Dobiasova under grant number NAZV QJ1210237.
The funders had no role in study design, data collection and interpretation,
or the decision to submit the work for publication.
REFERENCES
1. Aoki T, Egusa S, Kimura T, Watanabe T. 1971. Detection of R factors in
naturally occurring Aeromonas salmonicida strains. Appl Microbiol 22:
716–717.
2. Cattoir V, Poirel L, Aubert C, Soussy CJ, Nordmann P. 2008. Unexpected
occurrence of plasmid-mediated quinolone resistance determinants
in environmental Aeromonas spp. Emerg Infect Dis 14:231–237.
http://dx.doi.org/10.3201/eid1402.070677.
Dobiasova et al.
656 aac.asm.org January 2016 Volume 60 Number 1Antimicrobial Agents and Chemotherapy
onJanuary5,2016byguesthttp://aac.asm.org/Downloadedfrom
3. Picao RC, Poirel L, Demarta A, Silva CS, Corvaglia AR, Petrini O,
Nordmann P. 2008. Plasmid-mediated quinolone resistance in Aeromonas
allosaccharophila recovered from a Swiss lake. J Antimicrob Chemother
62:948–950. http://dx.doi.org/10.1093/jac/dkn341.
4. Rhodes G, Parkhill J, Bird C, Ambrose K, Jones MC, Huys G, Swings J,
Pickup RW. 2004. Complete nucleotide sequence of the conjugative tetracycline
resistance plasmid pFBAOT6, a member of a group of IncU
plasmids with global ubiquity. Appl Environ Microbiol 70:7497–7510.
http://dx.doi.org/10.1128/AEM.70.12.7497-7510.2004.
5. Sorum H, L’Abee-Lund TM, Solberg A, Wold A. 2003. Integroncontaining
IncU R plasmids pRAS1 and pAr-32 from the fish pathogen
Aeromonas salmonicida. Antimicrob Agents Chemother 47:1285–1290.
http://dx.doi.org/10.1128/AAC.47.4.1285-1290.2003.
6. Marti E, Balcazar JL. 2012. Multidrug resistance-encoding plasmid from
Aeromonas sp. strain P2G1. Clin Microbiol Infect 18:E366–E368. http:
//dx.doi.org/10.1111/j.1469-0691.2012.03935.x.
7. Quesada SP, Paschoal JA, Reyes FG. 2013. Considerations on the aquaculture
development and on the use of veterinary drugs: special issue for
fluoroquinolones–a review. J Food Sci 78:R1321–R1333. http://dx.doi.org
/10.1111/1750-3841.12222.
8. Dobiasova H, Kutilova I, Piackova V, Vesely T, Cizek A, Dolejska M.
2014. Ornamental fish as a source of plasmid-mediated quinolone resistance
genes and antibiotic resistance plasmids. Vet Microbiol 171:413–
421. http://dx.doi.org/10.1016/j.vetmic.2014.02.011.
9. Brown CJ, Sen D, Yano H, Bauer ML, Rogers LM, Van der Auwera GA,
Top EM. 2013. Diverse broad-host-range plasmids from freshwater carry
few accessory genes. Appl Environ Microbiol 79:7684–7695. http://dx.doi
.org/10.1128/AEM.02252-13.
10. Schluter A, Krahn I, Kollin F, Bonemann G, Stiens M, Szczepanowski
R, Schneiker S, Puhler A. 2007. IncP-1-beta plasmid pGNB1 isolated
from a bacterial community from a wastewater treatment plant mediates
decolorization of triphenylmethane dyes. Appl Environ Microbiol 73:
6345–6350. http://dx.doi.org/10.1128/AEM.01177-07.
11. Schluter A, Heuer H, Szczepanowski R, Poler SM, Schneiker S, Puhler
A, Top EM. 2005. Plasmid pB8 is closely related to the prototype IncP-
1beta plasmid R751 but transfers poorly to Escherichia coli and carries a
new transposon encoding a small multidrug resistance efflux protein.
Plasmid 54:135–148. http://dx.doi.org/10.1016/j.plasmid.2005.03.001.
12. Qi M, Wang D, Bradley CA, Zhao Y. 2011. Genome sequence analyses of
Pseudomonas savastanoi pv. glycinea and subtractive hybridization-based
comparative genomics with nine pseudomonads. PLoS One 6:e16451.
http://dx.doi.org/10.1371/journal.pone.0016451.
13. Rodriguez-Palenzuela P, Matas IM, Murillo J, Lopez-Solanilla E,
Bardaji L, Perez-Martinez I, Rodriguez-Moskera ME, Penyalver R,
Lopez MM, Quesada JM, Biehl BS, Perna NT, Glasner JD, Cabot EL,
Neeno-Eckwall E, Ramos C. 2010. Annotation and overview of the Pseudomonas
savastanoi pv. savastanoi NCPPB 3335 draft genome reveals the
virulence gene complement of a tumour-inducing pathogen of woody
hosts. Environ Microbiol 12:1604–1620. http://dx.doi.org/10.1111/j.1462
-2920.2010.02207.x.
14. Boyd J, Williams J, Curtis B, Kozera C, Singh R, Reith M. 2003. Three
small, cryptic plasmids from Aeromonas salmonicida subsp. salmonicida
A449. Plasmid 50:131–144. http://dx.doi.org/10.1016/S0147-619X(03)00058-1.
15. Naas T, Bonnin RA, Cuzon G, Villegas MV, Nordmann P. 2013.
Complete sequence of two KPC-harbouring plasmids from Pseudomonas
aeruginosa. J Antimicrob Chemother 68:1757–1762. http://dx.doi.org/10
.1093/jac/dkt094.
16. Haines AS, Cheung M, Thomas CM. 2006. Evidence that IncG (IncP-6)
and IncU plasmids form a single incompatibility group. Plasmid 55:210–
215. http://dx.doi.org/10.1016/j.plasmid.2005.11.003.
17. Han JE, Kim JH, Choresca CH, Jr, Shin SP, Jun JW, Chai JY, Park SC.
2012. First description of ColE-type plasmid in Aeromonas spp. carrying
quinolone resistance (qnrS2) gene. Lett Appl Microbiol 55:290–294. http:
//dx.doi.org/10.1111/j.1472-765X.2012.03293.x.
18. Huddleston JR, Brokaw JM, Zak JC, Jeter RM. 2013. Natural transformation
as a mechanism of horizontal gene transfer among environmental
Aeromonas species. Syst Appl Microbiol 36:224–234. http://dx.doi.org/10
.1016/j.syapm.2013.01.004.
Sequences of IncU Plasmids in Aeromonas from Fish
January 2016 Volume 60 Number 1 aac.asm.org 657Antimicrobial Agents and Chemotherapy
onJanuary5,2016byguesthttp://aac.asm.org/Downloadedfrom
Příloha 30
DOLEJSKA, M., MASARIKOVA, M., DOBIASOVA, H., JAMBOROVA, I., KARPISKOVA, R., HAVLICEK,
M., CARLILE, N., PRIDDEL, D., CIZEK, A., LITERAK, I., 2016, High prevalence of Salmonella and
IMP-4-producing Enterobacteriaceae in the silver gull on Five Islands, Australia: Journal of
Antimicrobial Chemotherapy, v. 71, p. 63-70.
Souhrn
V jedné z největších hnízdních kolonií racků australských byly nalezeny u 40 % vyšetřených mláďat izoláty
různých druhů čeledi Enterobacteriaceae s produkcí metalo-beta-laktamázy skupiny IMP-4. Jedná se teprve
o třetí záchyt karbapenemáz u volně žijících zvířat a o první případ s tak vysokou prevalencí. Izoláty náležely
k různým sekvenčním typům a gen pro produkci metalo-beta-laktamázy byl nalezen na různých skupinách
plazmidů. Ornitologické pozorování v oblasti ukazuje na pravděpodobný zdroj těchto kmenů v blízké skládce
komunálního odpadu, kam rackové zalétávají za potravou pro svá mláďata. IMP-4 představuje dominující
karbapenemázu v australských nemocnicích, což ukazuje na humánní zdroj těchto izolátů. Tento pilotní
výsledek potvrzuje nutnost intenzivního sledování stavu šíření producentů karbapenemáz do prostředí.
High prevalence of Salmonella and IMP-4-producing Enterobacteriaceae
in the silver gull on Five Islands, Australia
Monika Dolejska1,2*, Martina Masarikova1,3, Hana Dobiasova2, Ivana Jamborova2, Renata Karpiskova4,
Martin Havlicek5, Nicholas Carlile6, David Priddel6, Alois Cizek1,3 and Ivan Literak1,2
1
Central European Institute of Technology, University of Veterinary and Pharmaceutical Sciences Brno, Palackeho tr. 1/3, 612 42 Brno,
Czech Republic; 2
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and
Pharmaceutical Sciences Brno, Palackeho tr. 1/3, 612 42 Brno, Czech Republic; 3
Department of Infectious Diseases and Microbiology,
Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno, Palackeho tr. 1/3, 612 42 Brno, Czech Republic;
4
Veterinary Research Institute, Hudcova 296/70, 621 00 Brno, Czech Republic; 5
Small Animal Specialist Hospital, Richardson Place 1/1,
North Ryde, NSW 2113, Australia; 6
Office of Environment and Heritage (NSW), PO Box 1967, Hurstville, NSW 2220, Australia
*Corresponding author. Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and
Pharmaceutical Sciences Brno, Palackeho tr. 1/3, 612 42 Brno, Czech Republic. Tel: +420-541-562-640; E-mail: monika.dolejska@gmail.com
Received 26 May 2015; returned 7 July 2015; revised 14 July 2015; accepted 27 August 2015
Objectives: The objective of this study was to investigate the silver gull as an indicator of environmental contamination
by salmonellae and carbapenemase-producing Enterobacteriaceae (CPE) in south-east Australia.
Methods: A total of 504 cloacal samples were collected from gull chicks at three nesting colonies in New South
Wales, Australia [White Bay (n¼144), Five Islands (n¼200) and Montague Island (n¼160)] and were examined
for salmonellae and CPE. Isolates were tested for carbapenemase genes and susceptibility to 14 antibiotics.
Clonality was determined by PFGE and MLST. Genetic context and conjugative transfer of the carbapenemase
gene were determined.
Results: A total of 120 CPE of 10 species, mainly Escherichia coli (n¼85), carrying the gene blaIMP-4, blaIMP-38
or blaIMP-26 were obtained from 80 (40%) gulls from Five Islands. Thirty percent of birds from this colony were
colonized by salmonellae. Most isolates contained the gene within a class 1 integron showing a blaIMP-4qacG-aacA4-catB3
array. The blaIMP gene was carried by conjugative plasmids of variable sizes (80–400 kb)
and diverse replicons, including HI2-N (n¼30), HI2 (11), A/C (17), A/C-Y (2), L/M (5), I1 (1) and non-typeable (6).
Despite the overall high genetic variability, common clones and plasmid types were shared by different birds and
bacterial isolates, respectively.
Conclusions: Our data demonstrate a large-scale transmission of carbapenemase-producing bacteria into wildlife,
likely as a result of the feeding habits of the birds at a local waste depot. The isolates from gulls showed significant
similarities with clinical isolates from Australia, suggesting the human origin of the isolates. The sources of CPE for
gulls on Five Islands should be explored and proper measures applied to stop the transmission into the environment.
Introduction
Carbapenems are one of the most important antibiotics in human
medicine and are regarded as last-line drugs to treat infections
caused by MDR Gram-negative bacteria. Clinical efficacy of
these antibiotics is threatened by carbapenemases, b-lactamases
capable of rapid degradation of carbapenems. Metallo-blactamases,
mainly VIM, NDM and IMP, are among the most disseminated
carbapenemases worldwide.1
IMP-type b-lactamases
are found in various clinically important Gram-negative bacteria, such
as Pseudomonas spp., Acinetobacter spp. and Enterobacteriaceae, all
round the world,2
endemically in Japan, Taiwan, China, Korea and
the Philippines.3–6
Currently, IMP-4 is the most commonly reported
carbapenemase in clinical isolates of Enterobacteriaceae, associated
with outbreaks in healthcare settings in Australia,7
but its
wide dissemination has been documented also in China.4
Transmission of carbapenem-resistant bacteria to foodproducing
animals and the environment is of great concern. So
far, there are scarce reports of carbapenemase-producing
Enterobacteriaceae (CPE) from farm animals and wildlife.8
# The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://
creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the
original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com
J Antimicrob Chemother
doi:10.1093/jac/dkv306
1 of 8
Journal of Antimicrobial Chemotherapy Advance Access published October 15, 2015
atTheUniversityofVeterinaryandPharmaceuticalSciences,Palackeho1-3,61onOctober15,2015http://jac.oxfordjournals.org/Downloadedfrom
Salmonella is an important zoonotic pathogen causing infections
in humans and domestic animals. Wild birds, such as gulls, influenced
by various anthropogenic activities, are important
in the epidemiology of human and livestock salmonellosis.9
In Australia, the prevalence of Salmonella, including antibioticresistant
strains in wild birds, is largely unknown.10
In this work, we studied the silver gull (Chroicocephalus novaehollandiae)
as an indicator of environmental contamination by
Salmonella and CPE in south-east Australia in respect of the current
epidemiological situation in this country. The silver gull feeds
on fish, marine and terrestrial invertebrates, but also on human
refuse collected at landfills.11,12
This study is the first known report
of a large-scale transmission of CPE into wildlife.
Materials and methods
Birds and sampling
The silver gull is widespread throughout Australia, New Zealand and New
Caledonia. There has been marked expansion of the population of the
silver gull in Australia in the last century, with most increases in numbers
occurring near to and within major cities. Although silver gulls do occur
near inland wetlands, they are predominantly a coastal species. In southeast
Australia they breed mostly on marine islands, the highest densities
occurring on islands close to major urban areas, particularly Newcastle,
Sydney and Wollongong. Seventy percent of coastal breeding in New
South Wales (NSW) occurs at Five Islands off the coast of Wollongong.11,12
A total of 504 cloacal samples were taken from silver gull chicks within
the three nesting colonies on the south-eastern coast of NSW, Australia—
White Bay (n¼144), Five Islands (n¼200) and Montague Island
(n¼160)—in October 2012. The samples were collected using a sterile
cotton swab and placed in an Amies transport medium (Coban, Italy).
The small colony at White Bay near Glebe (33886′
S, 151818′
E) nest on
a diffused industrial wharf within Sydney Harbour, 70 km north of Five
Islands. In October 2012, the colony contained 1500 birds. These birds
feed at the nearby fish markets and in other suburban areas surrounding
Sydney Harbour,11,12
which provides natural prey enriched by refuse
carried by urban runoff.
Big Island, in the Five Islands group (34829′
S, 150856′
E), is a 19 ha
nature reserve 500 m offshore from Port Kembla, 60 km south of
Sydney. Big Island represents the largest silver gull breeding colony in
NSW, with historical estimates of up to 50000 pairs,11
although numbers
have declined recently for unknown reasons. During our sampling in the
2012 breeding season we estimated only 3854 pairs. Studies have
shown that the gulls breeding on Big Island feed predominantly on
human refuse.12
As many as 6000 gulls per hour have been recorded leaving
Whyte Gully landfill (34826′
S, 150848′
E), the main waste depot,
located on the mainland 12 km from the nesting colony. Regurgitations
from gulls trapped on Big Island contained solely human refuse (85%
of samples), solely natural food (13%) or a mixture of both (2%). Meat
constituted 63% of the human refuse.12
Montague Island (36815′
S, 150814′
E) lies 6 km offshore, 10 km southwest
of Narooma, NSW. The entire island is a natural reserve of 82 ha and
supports a silver gull population of 1500–2000 pairs, which feed predominantly
on a natural diet of worms, fish, crustaceans and insects (N. Carlile,
unpublished results).
Isolation of carbapenemase-producing isolates
and Salmonella
Individual cloacal samples were enriched overnight in Buffered Peptone
Water (Oxoid, UK) and then cultured for carbapenemase-producing
Enterobacteriaceae on CHROMagarTM
KPC (CHROMagar, Paris, France) and
MacConkey agar supplemented with meropenem (0.125 mg/L) and ZnSO4
(100 mg/L) (MCAmer) and for Salmonella using semi-solid Rappaport–
Vassiliadis medium (Oxoid) and X.L.D. agar (Oxoid). One colony for each
morphological type growing on CHROMagar KPC or MCAmer was selected
and identified by MALDI-TOF MS (Microflex LT, Bruker Daltonics, Bremen,
Germany). Salmonella isolates were subjected to serotyping using the
Kauffmann–White–LeMinor scheme13
and phage typing according to the
HPA Colindale protocol.14,15
Antibiotic resistance profiling
Susceptibility to 14 antibiotics, including amoxicillin/clavulanic acid
(30 mg), ampicillin (10 mg), cefalotin (30 mg), ceftazidime (30 mg), chloramphenicol
(30 mg), ciprofloxacin (5 mg), gentamicin (10 mg), imipenem
(10 mg), meropenem (10 mg), nalidixic acid (30 mg), streptomycin
(10 mg), sulfamethoxazole/trimethoprim (25 mg), compound sulphonamides
(300 mg) and tetracycline (30 mg) (Oxoid, UK), was tested in
Salmonella and blaIMP-positive isolates using a disc-diffusion
method.16
Isolates negative for the tested carbapenemase genes
were screened for metallo-b-lactamase, AmpC and ESBL production
by phenotypic assays.16 – 18
MICs of meropenem for IMP- and AmpC-producing isolates were
determined using the agar dilution method.16
Statistical significance of the data was analysed using the x2
test. P
value ≤0.05 was considered to be statistically significant.
Molecular typing of CPE isolates
Enterobacteriaceae isolates growing on CHROMagar KPC or MCAmer and all
Salmonella isolates were screened for carbapenemase genes (blaIMP,
blaNDM, blaKPC, blaVIM and blaOXA-48-type) by PCR (Table S1, available as
Supplementary data at JAC Online). Isolates positive for blaIMP were tested
for the gene blaIMP-4 using PCR followed by sequencing of the amplicons
(Table S1). Clonality of blaIMP-positive isolates was determined by
XbaI-PFGE. Cluster analysis using Dice similarity indices was done in
BioNumerics 6.6 software (Applied Maths, Ghent, Belgium) to generate a
dendrogram describing the relationships among PFGE profiles. Isolates
with ≥85% similarity of PFGE profiles were assigned to the same cluster
(designated as 1, 2, 3, etc. for Escherichia coli and A, B, C, etc. for other species).
MLST of representative isolates of E. coli and Klebsiella pneumoniae
showing unique PFGE profiles was performed using Achtman’s19
and
Institut Pasteur’s schemes,20
respectively. A PCR-based scheme was
used to categorize E. coli isolates into phylogenetic groups.21
Genetic context and transferability of the blaIMP gene
At least one randomly selected isolate for each PFGE pattern/bacterial
species was further analysed for context of the blaIMP-4 gene. A reference
sequence of typical Australian class 1 integron array blaIMP-4-qacGaacA4-catB3
(Accession number JX101693) was used to design the PCR
mapping.22
The presence of the blaIMP gene inside a class 1 integron
was tested using primers specific for the 5′
-conserved region of a class 1
integron and blaIMP. The 3′
parts of the integron were analysed in three
reactions using forward primer IMP-F in combination with reverse primers
targeting the aminoglycoside resistance gene aacA4, the chloramphenicol
resistance gene catB3 or the 3′
-conserved region of a class 1 integron (for
list of primers see Table S1). Selected amplicons were sequenced.
Conjugative transfer of blaIMP was tested in all 120 isolates at 378C using
the plasmid-free, rifampicin- and sodium-azide-resistant E. coli MT102
recipient strain. Since IncHI plasmids have a thermosensitive mode for
conjugation,23
the experiment was performed in parallel at 25 and 378C
for all isolates harbouring IncHI2 plasmids. Transconjugants were selected
on media supplemented with cefotaxime (2 mg/L), sodium azide
(100 mg/L) and rifampicin (25 mg/L) and transfer of blaIMP was confirmed
Dolejska et al.
2 of 8
atTheUniversityofVeterinaryandPharmaceuticalSciences,Palackeho1-3,61onOctober15,2015http://jac.oxfordjournals.org/Downloadedfrom
by PCR. Plasmids carrying blaIMP were assigned to incompatibility groups
by PCR-based replicon typing (PBRT)24,25
and their sizes were determined
using PFGE of the total DNA digested with S1 nuclease. Where transconjugants
with a single blaIMP-carrying plasmid were obtained, plasmid
contents were confirmed in the corresponding donor strains using the
same procedure.
Results
Salmonella
A total of 66 (13%) Salmonella enterica isolates were obtained from
504 silver gull cloacal samples from all three nesting colonies. The
highest prevalence of salmonellae was found in gulls from Five
Islands (56/200; 28%), while the other two locations showed significantly
lower prevalences of 0.6% and 6% (Table 1). Salmonellae of
17 different serotypes, with dominance of Salmonella Typhimurium
(33/66; 50%), were identified (Table 1). Salmonella Typhimurium
DT2 and DT12 were the most common phage types, found in 16
and 8 gulls, respectively. Antibiotic resistance was demonstrated
only in 3/66 (4.5%) Salmonella isolates (Table 1).
Isolation of Enterobacteriaceae with the blaIMP gene
A total of 167 Enterobacteriaceae isolates were obtained by culture
on selective media, 150 and 17 on MCAmer and CHROMagar
KPC, respectively. The only carbapenemase gene detected was
blaIMP, found in 120 (72%, n¼167) isolates. All blaIMP-positive isolates
originated from 80 of 200 (40%) gulls sampled on Five
Islands. No carbapenemase-producing isolates were found in
the other two locations, White Bay and Montague Island.
Thirty-seven out of 80 (46%) blaIMP-positive gulls carried more
than one isolate; 33 and 4 gulls were colonized by two and
three different isolates, respectively. The isolates were identified
as E. coli (85 isolates), Escherichia fergusonii (10), K. pneumoniae
(9), Enterobacter aerogenes (4), Proteus mirabilis (4), Kluyvera
georgiana (2), Citrobacter freundii (2), Enterobacter cloacae (2),
Proteus penneri (1) and Citrobacter braakii (1). Isolates negative
for the carbapenemase genes (n¼36) included P. mirabilis (14),
Hafnia alvei (6), E. coli (4), Providencia spp. (4), E. aerogenes (3),
E. cloacae (2), Morganella morganii (2) and Proteus vulgaris (1)
and were susceptible to third-generation cephalosporins (data
not shown). Twelve of them (33%) produced inducible AmpC
b-lactamase while neither carbapenemase nor ESBL production
was found in the other 24 (67%) isolates. AmpC producers
showed resistance to ampicillin, amoxicillin/clavulanic acid,
cefalotin and cefoxitin and MICs to meropenem varied from
0.06 to 1 mg/L; they were identified as H. alvei (5), E. aerogenes
(3), E. cloacae (2), Providencia spp. (1) and M. morganii (1).
Antibiotic resistance profiles of blaIMP-positive isolates
All blaIMP-positive isolates showed resistance to at least two
antibiotic groups. Resistance to sulphonamides was the most
prevalent (100%), followed by resistance to ampicillin (99%),
amoxicillin/clavulanic acid (99%), ceftazidime (98%), gentamicin
(93%), sulfamethoxazole/trimethoprim (93%), chloramphenicol
(73%), tetracycline (69%), nalidixic acid (67%), streptomycin
(53%), ciprofloxacin (46%), meropenem (25%) and imipenem
(6%). According to CLSI criteria, 57% and 18% showed intermediate
resistance and susceptibility to meropenem, respectively.
Intermediate resistance and susceptibility to imipenem was
observed in 33% and 61% of isolates, respectively. A significantly
higher number of non-E. coli isolates showed susceptibility to
meropenem compared with E. coli isolates (P,0.01). Such differences
were not observed for imipenem. According to CLSI criteria,
the majority (79%) of the isolates were susceptible to meropenem,
with MICs ≤4 mg/L. MICs were distributed as follows:
≤0.125 mg/L (6 isolates); 0.25 mg/L (7); 0.5 mg/L (39); 1 mg/L
(26); 2 mg/L (27); 4 mg/L (12); and 8 mg/L (3).
Clonality of blaIMP-positive isolates
PFGE and MLSTanalysis demonstrated significant genetic diversity
of blaIMP-positive isolates (Figure 1), but also the carriage of identical
isolates by different birds (Figure S1). Eighty-five E. coli isolates
showed 36 unique PFGE profiles and were divided into 25
clusters based on the criteria of 85% similarity of PFGE patterns.
MLST analysis assigned the isolates to 19 different STs (Figure 1).
Table 1. S. enterica isolates from the silver gull in three nesting colonies in
Australia
Serotype, phage type
Nesting colony (no. of samples)
WB (144) FI (200) MI (160)
Bovismorbificans 2
Charity 1
Chester 1
Heidelberg 1
Infantis 1
Mbandaka 1
Muenchen 1
Oranienburg 1
Paratyphi B 1
Rissen 4a
3,10:r:– 1a
Saintpaul 5
Senftenberg 4
Stanleyville 4
Typhimurium DT2 1 14a
1
Typhimurium DT8 1
Typhimurium DT12 8
Typhimurium DT13 1
Typhimurium DT120 3
Typhimurium RDNC 4
Virchow 4
Wangata 1
Total (prevalence) 9 (6%) 56 (28%) 1 (0.6%)
WB, White Bay; FI, Five Islands; MI, Montague Island.
a
Three isolates showing resistance to tested antibiotics: Salmonella
3,10:r:– (strain no. 1620), resistant to ampicillin and amoxicillin/clavulanic
acid; Salmonella Typhimurium DT2 (strain no. 1718), resistant to ampicillin,
amoxicillin/clavulanic acid, cefalotin and ceftazidime; and Salmonella
Rissen (strain no. 1786), resistant to ampicillin, amoxicillin/clavulanic
acid, streptomycin, compound sulphonamides, sulfamethoxazole/trimethoprim
and tetracycline.
Carbapenemase-producing bacteria in gulls
3 of 8
JAC
atTheUniversityofVeterinaryandPharmaceuticalSciences,Palackeho1-3,61onOctober15,2015http://jac.oxfordjournals.org/Downloadedfrom
Figure 1. Characteristics of E. coli isolates with the blaIMP-4 gene from the silver gull on Five Islands. a
Isolates with ≥85% similarity of PFGE profiles are assigned to the same cluster
(designated as 1, 2, 3, etc.). Isolates from the same cluster with ,100% identity of PFGE patters are indicated by letters (e.g. 5a, 5b, 6a, 6b, 6c, etc.). b
Five of the six E. coli ST58
isolates (indicated by an asterisk) carry both blaIMP-4 and blaIMP-38. c
Integrons with intI1-blaIMP-4 arrays are missing the 3′
parts of the integron conserved region. d
STR, streptomycin;
SUL, compound sulphonamides; TET, tetracycline; SXT, sulfamethoxazole/trimethoprim; CHL, chloramphenicol; GEN, gentamicin; NAL, nalidixic acid; CIP, ciprofloxacin; IPM, imipenem;
MEM, meropenem. All isolates showed resistance to ampicillin, amoxicillin/clavulanic acid, cefalotin and ceftazidime. Resistance is indicated by ‘R’. Resistance patterns of isolates from the
same cluster that show variable profiles are indicated by ‘X’. e
Transfer of the gene by conjugation to recipient strains of E. coli. All isolates of E. coli ST58 carrying two blaIMP variants
transferred only the gene blaIMP-4. f
nt, plasmid non-typeable by PBRT.
Dolejskaetal.
4of8
atTheUniversityofVeterinaryandPharmaceuticalSciences,Palackeho1-3,61onOctober15,2015 http://jac.oxfordjournals.org/ Downloadedfrom
Table 2. Characteristics of non-E. coli isolates with the blaIMP gene from the silver gull on Five Islands
Species
PFGE
clustera
ST
No. of
isolates blaIMP integron
Antibiotic resistance profileb
blaIMP
transferc
Plasmid
carrying
blaIMP
d
STR SUL TET SXT CHL GEN NAL CIP IPM MEM
Escherichia fergusonii H1 2 intI1-blaIMP-4-qacG-aacA4-catB3 R R R R yes HI2 (1)
H2 7 intI1-blaIMP-4-qacG-aacA4-catB3 X R X R X X yes HI2 (5)
H3 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R R R yes HI2 (1)
Klebsiella pneumoniae A 1735 2 intI1-blaIMP-26-qacG-aacA4-catB3 R R R R R R R yes A/C (2)
B 1736 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R R R yes nt (1)
C 1734 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R R yes A/C-Y (1)
D 394 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R R R R R no
E 1737 2 intI1-blaIMP-4-qacG-aacA4-catB3 X R X X X R X X X yes HI2-N (1)
F 1738 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R R no
G 584 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R yes L/M (1)
Kluyvera georgiana I 2 intI1-blaIMP-4-qacG-aacA4-catB3 R R R yes
Enterobacter
aerogenes
J1 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R R R yes L/M (1)
J2 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R R yes L/M (1)
J3 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R R R yes nt (1)
L 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R R R R R yes L/M (1)
Enterobacter cloacae O 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R R R R R R no
P 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R R R yes L/M (1)
Citrobacter freundii M 1 intI1-blaIMP-38-qacG-aacA4-catB3 R R R yes A/C (1)
N 1 intI1-blaIMP-38-qacG-aacA4-catB3 R R R R R R yes A/C (1)
Citrobacter braakii V 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R R R R R R R no
Proteus mirabilis Q 1 intI1-blaIMP-4-qacG-aacA4 R R R R R R R yes nt (1)
R 1 intI1-blaIMP-4-qacG-aacA4 R R R R R R R no
S 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R R R R yes
T 1 intI1-blaIMP-4-qacG-aacA4-catB3 R R R R R R yes nt (1)
Proteus penneri U 1 intI1-blaIMP-4-qacG-aacA4 R R R R R R R R yes nt (1)
a
Isolates with ≥85% similarity of PFGE profiles are assigned to the same cluster (designated as A, B, C, etc.). Isolates from the same cluster with ,100% identity of PFGE patters are
indicated by numbers (e.g. H1, H2, etc.).
b
STR, streptomycin; SUL, compound sulphonamides; TET, tetracycline; SXT, sulfamethoxazole/trimethoprim; CHL, chloramphenicol; GEN, gentamicin; NAL, nalidixic acid; CIP, ciprofloxacin;
IPM, imipenem; MEM, meropenem. All isolates showed resistance to ampicillin, amoxicillin/clavulanic acid, cefalotin and ceftazidime except for two isolates of P. mirabilis (isolate of PFGE
type S susceptible to ampicillin, amoxicillin/clavulanic acid and ceftazidime, and isolate of PFGE type T, susceptible to ceftazidime). Resistance is indicated by ‘R’. Resistance patterns of
isolates from the same cluster that show variable profiles are indicated by ‘X’.
c
Transfer of the gene by conjugation to recipient strains of E. coli.
d
nt, plasmid non-typeable by PBRT.
Carbapenemase-producingbacteriaingulls
5of8
JAC
atTheUniversityofVeterinaryandPharmaceuticalSciences,Palackeho1-3,61onOctober15,2015 http://jac.oxfordjournals.org/ Downloadedfrom
The most prevalent clonal lineages included ST216 (n¼27), ST58
(n¼14), ST354 (n¼9), ST167 (n¼8) and ST224 (n¼5) and constituted
68% of all E. coli isolates. Two novel STs (ST4657 and
ST4658) were identified among three isolates. Eleven birds carried
two E. coli isolates of different STs. Twenty-four birds were colonized
by two or three different species of the Enterobacteriaceae
family. Ten E. fergusonii isolates belonged to a single cluster, H,
with overall similarity of 95% (Table 2). Nine K. pneumoniae isolates
were divided into seven distinct PFGE clusters and belonged
to seven different STs, including five novel types (ST1734–
ST1738). Two different E. coli strains sharing an identical
blaIMP-4-integron array and plasmid replicon type were identified
only in one bird, which may suggest a limited role of in vivo plasmid
conjugative transfer inside the gull intestine.
Sequence analysis and genetic environment of the
blaIMP gene
The sequence analysis of blaIMP amplicons revealed the presence
of blaIMP-4 in 116 (97%) isolates. Single-locus variants of blaIMP-4,
the genes blaIMP-26 and blaIMP-38, were found in two (2%) and
seven (6%) isolates, respectively. The gene blaIMP-26 was identified
in two isolates of K. pneumoniae ST1735 while blaIMP-38 was found
in two C. freundii isolates (Table 2) and five E. coli ST58 that were
also positive for the variant blaIMP-4 (Figure 1). Seventy randomly
selected isolates representing each PFGE cluster/ST/bacterial species,
including 40 E. coli and 30 non-E. coli, were tested for the
genetic context of the blaIMP gene (Figure S1). The gene blaIMP
was present in the class 1 integron as the first gene cassette in
all isolates. PCR mapping revealed the blaIMP-4-qacG-aacA4-catB3
cassette array in 50 (71%) isolates (65% E. coli, 80% non-E. coli).
The same integron arrangement was also demonstrated for
blaIMP-26 and blaIMP-38 from K. pneumoniae and C. freundii isolates,
respectively. An additional blaIMP-4-qacG-aacA4 array was identified
in three Proteus spp. PCR mapping of the 3′
parts of the integron
carrying blaIMP-4 or blaIMP-38 failed in 14 E. coli (21%), suggesting
the existence of a structure different from the typical Australian
integron used as a reference in this study.
Plasmids carrying the blaIMP gene
All isolates were tested for transfer of blaIMP by conjugation. In 57
(67%) and 22 (63%) E. coli and non-E. coli isolates, respectively,
the gene was transferred at 378C. The experiment was repeated
at 258C in 41 isolates that did not transfer the gene by conjugation
at 378C, revealing another seven positive isolates. Overall, the conjugative
transfer of blaIMP was successful in 86 (72%) isolates.
Transconjugants carrying blaIMP on a single plasmid were
obtained from 66 isolates, including E. coli of 11 different STs,
E. fergusonii, K. pneumoniae, E. aerogenes, E. cloacae, C. freundii,
P. mirabilis and P. penneri. Furthermore, five isolates produced
two or three transconjugants that showed a difference in size of
blaIMP-carrying plasmids (Figure S1); therefore, they were all
included in the further analysis. Testing of 72 transconjugants
demonstrated the association of the gene with plasmids of variable
sizes (80–400 kb) and diverse replicons: HI2 (n¼41), N (30),
A/C (19), Y (2), L/M (5) and I1 (1). Thirty-five plasmids contained
multi-replicons HI2-N (30) and A/C-Y (2). Six plasmids were not
typeable by PBRT.
IncA/C plasmids ranged from 180 to 220 kb and were associated
with three blaIMP genes (blaIMP-4, blaIMP-26, blaIMP-38) within
the typical Australian cassette array. The gene blaIMP-4 was found
on replicon A/C in E. coli of various genotypes (ST58, ST167, ST189
and ST1144) as well as on multi-replicon A/C-Y in one E. coli
ST1178 and one K. pneumoniae ST1734. The presence of the
two A/C and Y replicons on a single plasmid did not occur as a
result of plasmid fusion during the conjugative experiment.
IncL/M plasmids of 75 kb carrying blaIMP-4 within the typical
Australian array were found in one isolate of K. pneumoniae
ST584, three E. aerogenes isolates and one E. cloacae isolate. Six
strains, including E. coli ST542, K. pneumoniae ST1736, E. aerogenes,
P. mirabilis and P. penneri, contained the gene on plasmids
ranging between 140 and 400 kb that were not typeable by
the PBRT scheme. Apart from two Proteus isolates that carried
the gene in a class 1 integron with a different cassette array
(blaIMP-4-qacG-aacA4), the typical Australian array was identified
for these plasmids.
The most common replicon associated with blaIMP-4 was HI2,
found in 41 transconjugants of donor strains, including E. coli
(n¼33; ST48, ST58, ST216, ST746 and ST2178), E. fergusonii (7)
and K. pneumoniae ST1737 (1). E. coli ST58 isolates with two
blaIMP variants (blaIMP-4 and blaIMP-38) produced transconjugants
that carried the gene blaIMP-4 on HI2-N replicons. The gene
blaIMP-38 was not transferred by conjugation. IncHI2 plasmids ranged
from 150 up to 320 kb and contained the gene in both the
typical Australian array (47%) or as a single-gene cassette with
unknown structure of the 3′
parts of the integron (53%).
Twenty-two transconjugants contained plasmids of higher
molecular weight than their donors, indicating frequent fusions
during conjugation, likely occurring between blaIMP-carrying
IncHI2 or IncHI2-N plasmids and other plasmids, co-resident
within the donor strain. The majority (84%) of IncHI2 plasmids
were transferred at 378C and no relationship between the change
in plasmid size and temperature used for conjugative transfer was
observed (data not shown).
Discussion
Our study demonstrates a high level of colonization by
Salmonella and carbapenemase-producing bacteria of gulls on
Five Islands. This is the first known report of extensive transmission
of carbapenemase-producing bacteria into wild animals.
Feeding habits related to garbage and sewage have been largely
assumed to increase the risk of transmission of bacteria originating
from humans or farm animals to wildlife. The long-term observations
of the colony on Five Islands demonstrated the role of
human refuse from the local depot near the city of Wollongong
as an important source of food for breeding gulls in the colony.12
We assume that the source of IMP-4-producing isolates for gulls
could be clinical material contaminating this local waste depot,
supported by the demonstrated significant similarities of gull isolates
with those reported from humans in Australia and the fact
that no carbapenemase-producing bacteria have been reported
from livestock and meat in that continent.
The distribution of Salmonella serovars in Australia varies geographically;
however, Salmonella Typhimurium is one of the most
commonly reported serovars from human infections. Three phage
types of Salmonella Typhimurium, DT135, DT170/108 and DT9,
Dolejska et al.
6 of 8
atTheUniversityofVeterinaryandPharmaceuticalSciences,Palackeho1-3,61onOctober15,2015http://jac.oxfordjournals.org/Downloadedfrom
are predominantly isolated from human infections, but also from
animals.26
Although Salmonella Typhimurium dominated in the
gulls in our study, none of these phage types was identified. The
most prevalent phage type found in gulls, DT2, is commonly isolated
from pigeons worldwide.27
The second most prevalent
phage type, DT12, used to be prevalent in human infections in
Australia, but it has declined in recent years.26
Carbapenemase producers belonged to 10 different species of
the Enterobacteriaceae family and showed resistance to several
groups of antimicrobials. Most isolates were selected by cultivation
on in-house MacConkey agar supplemented with meropenem
(0.125 mg/L) and ZnSO4 (100 mg/L) compared with commercially
available CHROMagar KPC, suggesting that media with a low concentration
of carbapenems are more suitable for environmental
samples, where carbapenemase-producing bacteria can be present
at very low concentration. CPE are infrequent in Australia,
with overall prevalence of 0.3% and ,0.1% in hospitals and the
community, respectively.28
Nevertheless, blaIMP-4, found in the
majority of the isolates from gulls, is also the most prevalent
among carbapenemase-producing clinical Enterobacteriaceae
isolates in Australia. IMP-4-producing E. coli isolates from gulls
showed significant clonal similarity with five predominant STs
(ST58, ST167, ST216, ST224 and ST354), suggesting their common
source in the environment. The majority of them belonged
to widely disseminated pathogenic and commensal MDR clones
contributing to the spread of ESBL.29 – 31
Of note is that E. coli
ST354 is the most common clonal lineage found among colonized
and infected dogs in Australia.32
ST216, the most prevalent ST in
our study, is not frequently reported in association with emerging
resistance mechanisms.
Various plasmids and class 1 integrons were described to play a
role in the dissemination of blaIMP-4 between clinical isolates in
Australia, including the blaIMP-4-qacG-aacA4-catB3 array carried
by IncA/C and IncL/M plasmids in Sydney and Melbourne22
and
the blaIMP-4-aacA4 array on IncHI2 or IncL/M plasmids in the
state of Queensland.33
The same blaIMP-4-qacG-aacA4-catB3
array was present in the majority of the isolates from gulls in
our study and it was carried by conjugative plasmids of various
sizes and replicon types, including IncHI2, IncA/C, IncL/M, IncI1
and multi-replicon (HI2-N, A/C-Y) and non-typeable plasmids.
We also identified this integron array in single-nucleotide variants
of the blaIMP-4 gene, the genes blaIMP-26 and blaIMP-38, carried by
IncA/C plasmids. In Australia and the Philippines, blaIMP-26 has
been identified in various STs of K. pneumoniae with the
blaIMP-26-qac-aacA4 cassette array on A/C or L/M replicons.6
A
novel blaIMP-4-qacG-aacA4 cassette array, recently reported for
blaIMP-26,6
was found in Proteus spp. isolates. In 14 E. coli isolates,
blaIMP-4 was found as a single cassette of the integron missing the
3′
-conserved region and carried by multi-replicon HI2-N plasmids.
These observations point out the high plasticity of class 1 integrons
carrying genes of the blaIMP-4 family and their ability to be
transferred between various plasmid families, likely increasing
their dissemination potential in bacterial communities.
The most prevalent plasmids associated with the blaIMP gene
found in 57% of transconjugants belonged to IncHI2. Recently,
a high incidence of IncHI2 plasmids carrying blaIMP-4 was identified
in various human clinical isolates of Enterobacteriaceae in
Queensland,33
suggesting a growing role of this plasmid family
in dissemination of blaIMP-4 in Australia. In contrast with this
report, most of our plasmids showed a second replicon specific
for plasmids of the IncN family and contained the blaIMP-4-integron
within a different cassette array. IncN plasmid pIMP-HZ1, carrying
blaIMP-4 in a class 1 integron with a truncated 3′
-conserved region,
as observed in our IncHI2-N plasmids, has been recently
described in China.34
Ability of IncHI2 plasmids to conjugate at
low temperature and to fuse with highly conjugative epidemic
plasmids with a broad host range, such as IncN, may facilitate
their dissemination in the environment. We identified several
plasmids, such as IncI1 or non-typeable, that have not been previously
associated with the blaIMP-4 gene. Demonstrated variability
of Enterobacteriaceae isolates and plasmids carrying blaIMP-4
as well as the ability of the plasmids to be efficiently transferred
by conjugation even at low temperature may indicate the further
movement of the gene between bacteria and replicons after
transmission to the environment of the gull nesting colony.
Overall, the findings from the silver gull reflect the current epidemiological
situation in Australia, indicating the human origin of
IMP-4-producing Enterobacteriaceae. Differences from reported
data on human isolates may reflect unexplored complexity of epidemiology
of IMP-4-producing bacteria in that continent and the
important role of the environment in dissemination of the gene.
This study documents a significant level of environmental contamination
by bacteria resistant to clinically important carbapenems,
which may potentially pose a risk for public health. As
migratory birds, gulls may be potential vectors of IMP-producing
strains along the coast of Australia. The cloacal samples were
taken only from gull chicks in the colony, and the level of colonization
by CPE in adult birds as possible vectors is unknown and
should be explored in the future studies to fully understand the
importance of these findings and the real risks indicated by
them. The source of these MDR bacterial strains among the
gulls nesting on Five Islands should be explored and proper measures
applied to stop the transmission of this pathogen from the
human population into the environment.
Acknowledgements
We thank Jana Hofirkova, Katerina Kachlikova, Katerina Kralova,
Magdalena Sevcikova, Jiri Sedmik, Veronika Hradilova, Monika Novakova,
Nicol Janecko, Dana Halova, Eva Suchanova and Petra Myskova for
excellent cooperation in the laboratory. Our thanks go to Alessandra
Carattoli and Sally Partridge for providing control strains. We thank the
team of the curators of the Institut Pasteur MLST system (Paris, France)
for importing novel alleles, profiles and/or isolates at http://bigsdb.web.
pasteur.fr. This publication made use of the E. coli/MLST database
developed by Mark Achtman and colleagues at University College Cork,
formally hosted at http://mlst.ucc.ie/mlst/dbs/Ecoli.
Funding
This work was funded by the Czech Science Foundation (15-14683Y/P502)
and CEITEC (CZ.1.05/1.1.00/02.0068) from the European Regional
Development Fund. I. J. and H. D. were supported by the Internal Grant
Agency of the University of Veterinary and Pharmaceutical Sciences (projects
12/2014/FVHE and 242/2015/FVHE). Characterization of Salmonella
isolates was partially funded by project LO1218 of MEYS of the CR under
the NPU I programme.
Carbapenemase-producing bacteria in gulls
7 of 8
JAC
atTheUniversityofVeterinaryandPharmaceuticalSciences,Palackeho1-3,61onOctober15,2015http://jac.oxfordjournals.org/Downloadedfrom
Transparency declarations
None to declare.
Supplementary data
Table S1 and Figure S1 are available as Supplementary data at JAC Online
(http://jac.oxfordjournals.org/).
References
1 Cornaglia G, Giamarellou H, Rossolini GM. Metallo-b-lactamases: a last
frontier for b-lactams? Lancet Infect Dis 2011; 11: 381–93.
2 Zhao WH, Hu ZQ. IMP-type metallo-b-lactamases in Gram-negative
bacilli: distribution, phylogeny, and association with integrons. Crit Rev
Microbiol 2011; 37: 214–26.
3 Nordmann P, Naas T, Poirel L. Global spread of carbapenemaseproducing
Enterobacteriaceae. Emerg Infect Dis 2011; 17: 1791–8.
4 Hu L, Zhong Q, Shang Y et al. The prevalence of carbapenemase genes
and plasmid-mediated quinolone resistance determinants in carbapenemresistant
Enterobacteriaceae from five teaching hospitals in central China.
Epidemiol Infect 2014; 142: 1972–7.
5 Hong JS, Kim JO, Lee HB. Characteristics of metallo-b-lactamaseproducing
Pseudomonas aeruginosa in Korea. Infect Chemother
2015; 47: 33–40.
6 Peirano G, Lascols C, Hackel M et al. Molecular epidemiology of
Enterobacteriaceae that produce VIMs and IMPs from the SMART surveillance
program. Diagn Microbiol Infect Dis 2014; 78: 277–81.
7 Leung GH, Gray TJ, Cheong EY et al. Persistence of related blaIMP-4
metallo-b-lactamase producing Enterobacteriaceae from clinical and
environmental specimens within a burns unit in Australia—a six-year
retrospective study. Antimicrob Resist Infect Control 2013; 2: 35.
8 Guerra B, Fischer J, Helmuth R. An emerging public health problem:
acquired carbapenemase-producing microorganisms are present in
food-producing animals, their environment, companion animals and
wild birds. Vet Microbiol 2014; 171: 290–7.
9 Palmgren H, Aspan A, Broman T et al. Salmonella in black-headed gulls
(Larus ridibundus); prevalence, genotypes and influence on Salmonella
epidemiology. Epidemiol Infect 2006; 134: 635–44.
10 Iveson JB, Shellam GR, Bradshaw SD et al. Salmonella infections in
Antarctic fauna and island populations of wildlife exposed to human activities
in coastal areas of Australia. Epidemiol Infect 2009; 137: 858–70.
11 Smith GC, Carlile N. Habitat use by silver gulls Larus novaehollandiae in
the Sydney-Wollongong region, New South Wales. Wetlands (Australia)
1992; 11: 33–46.
12 Smith GC, Carlile N. Food and feeding ecology of breeding silver gulls
(Larus novaehollandiae) in urban Australia. Colonial Waterbirds
1993; 16: 9–17.
13 Grimont P, Weill F. Antigenic Formulae of the Salmonella Serovars. 9th
edn. Paris, France: WHO Collaborating Centre for Reference and Research
on Salmonella, 2007.
14 Anderson ES, Ward LR, Saxe MJ et al. Bacteriophage-typing designations
of Salmonella typhimurium. J Hyg (Lond) 1977; 78: 297–300.
15 Ward LR, de Sa JD, Rowe B. A phage-typing scheme for Salmonella
enteritidis. Epidemiol Infect 1987; 99: 291–4.
16 Clinical and Laboratory Standards Institute. Performance Standards
for Antimicrobial Susceptibility Testing: Twenty-fourth Informational
Supplement M100-S24. CLSI, Wayne, PA, USA, 2014.
17 Dunne MW, Hardin DJ. Use of several inducer and substrate antibiotic
combinations in a disk approximation assay format to screen
for AmpC induction in patient isolates of Pseudomonas aeruginosa,
Enterobacter spp., Citrobacter spp., and Serratia spp. J Clin Microbiol
2005; 43: 5945–9.
18 Giske CG, Gezelius L, Samuelsen Ø et al. A sensitive and specific
phenotypic assay for detection of metallo-b-lactamases and KPC in
Klebsiella pneumoniae with the use of meropenem disks supplemented
with aminophenylboronic acid, dipicolinic acid and cloxacillin. Clin
Microbiol Infect 2011; 17: 552–6.
19 Diancourt L, Passet V, Verhoef J et al. Multilocus sequence typing of
Klebsiella pneumoniae nosocomial isolates. J Clin Microbiol 2005; 43:
4178–82.
20 Wirth T, Falush D, Lan R et al. Sex and virulence in Escherichia coli: an
evolutionary perspective. Mol Microbiol 2006; 60: 1136–51.
21 Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of
the Escherichia coli phylogenetic group. Appl Environ Microbiol 2000; 66:
4555–8.
22 Espedido BA, Partridge SR, Iredell JR. blaIMP-4 in different genetic contexts
in Enterobacteriaceae isolates from Australia. Antimicrob Agents
Chemother 2008; 52: 2984–7.
23 Maher D, Taylor DE. Host range and transfer efficiency of incompatibility
group HI plasmid. Can J Microbiol 1993; 39: 581–7.
24 Carattoli A, Bertini A, Villa L et al. Identification of plasmids by
PCR-based replicon typing. J Microbiol Methods 2005; 63: 219–28.
25 Garcia-Fernandez A, Fortini D, Veldman K et al. Characterization of plasmids
harbouring qnrS1, qnrB2 and qnrB19 genes in Salmonella. J Antimicrob
Chemother 2009; 63: 274–81.
26 Powling J. National Enteric Pathogens Surveillance Scheme, Human
Annual Report 1996–2010. Victoria: Microbiological Diagnostic Unit,
University of Melbourne, 2010.
27 Rabsch W, Andrews HL, Kingsley RA et al. Salmonella enterica serotype
Typhimurium and its host-adapted variants. Infect Immun 2002; 70:
2249–55.
28 Australian Group on Antimicrobial Resistance. The Evolution of
Carbapenemases in Enterobacteriaceae in Australia. Updated 20 October
2014. http://www.agargroup.org/files/AGAR_Carbapenemase_evolution%
20Final.pdf.
29 Dahmen S, Metayer V, Gay Eet al. Characterization of extended-spectrum
b-lactamase (ESBL)-carrying plasmids and clones of Enterobacteriaceae
causing cattle mastitis in France. Vet Microbiol 2013; 162: 793–9.
30 Fischer J, Rodriguez I, Baumann B et al. blaCTX-M-15-carrying Escherichia
coli and Salmonella isolates from livestock and food in Germany.
J Antimicrob Chemother 2014; 69: 2951–8.
31 Izdebski R, Baraniak A, Fiett J et al. Clonal structure, extendedspectrum
b-lactamases, and acquired AmpC-type cephalosporinases of
Escherichia coli populations colonizing patients in rehabilitation centers
in four countries. Antimicrob Agents Chemother 2013; 57: 309–16.
32 Guo S, Wakeham D, Brouwers HJ et al. Human-associated
fluoroquinolone-resistant Escherichia coli clonal lineages, including
ST354, isolated from canine feces and extraintestinal infections in
Australia. Microbes Infect 2015; 17: 266–74.
33 Sidjabat HE, Townell N, Nimmo GR et al. Dominance of IMP-4producing
Enterobacter cloacae amongst carbapenemase-producing
Enterobacteriaceae in Australia. Antimicrob Agents Chemother 2015; 59:
4059–66.
34 Lo WU, Cheung YY, Lai E et al. Complete sequence of an IncN plasmid,
pIMP-HZ1, carrying blaIMP-4 in a Klebsiella pneumoniae strain associated
with medical travel to China. Antimicrob Agents Chemother 2013; 57:
1561–2.
Dolejska et al.
8 of 8
atTheUniversityofVeterinaryandPharmaceuticalSciences,Palackeho1-3,61onOctober15,2015http://jac.oxfordjournals.org/Downloadedfrom
Příloha 31
MASARIKOVA, M., MANGA, I., CIZEK, A., DOLEJSKA, M., ORAVCOVA, V., MYSKOVA, P.,
KARPISKOVA, R., LITERAK, I., 2016, Salmonella enterica resistant to antimicrobials in wastewater
effluents and black-headed gulls in the Czech Republic, 2012: Science of the Total Environment,
v. 542, p. 102-107.
Souhrn
Ve vzorcích přečištěné odpadní vody při výtoku z Čistírny odpadních vod do řeky Svratky a u mláďat racků
chechtavých z hnízdní kolonie na vodním díle Nové mlýny, do kterého se řeka Svratka vlévá, byla sledována
přítomnost salmonel. Ve většině vzorků byly zjištěny rezistentní salmonely různých sérotypů a fagotypů. Byly
identifikovány izoláty s identickým genetickým profilem ve vodě a u vyšetřených racků. Studie dokumentuje
šíření rezistentních salmonel cestou odpadních vod do vodních toků. Čistírny odpadních vod mohou
představovat potenciální zdroj rezistentních a patogenních bakterií pro volně žijící zvířata obývající přilehlé
vodní ekosystémy.
Salmonella enterica resistant to antimicrobials in wastewater effluents
and black-headed gulls in the Czech Republic, 2012
Martina Masarikova a,b,
⁎, Ivan Manga a,b
, Alois Cizek a,b
, Monika Dolejska b,c
, Veronika Oravcova c
,
Petra Myskova d
, Renata Karpiskova d
, Ivan Literak b,c
a
Department of Infectious Diseases and Microbiology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republic
b
CEITEC VFU Brno, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republic
c
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republic
d
Department of Bacteriology, Veterinary Research Institute, Brno, Czech Republic
H I G H L I G H T S
• We documented the continuous presence
of resistant Salmonella in waste-
water.
• Using PFGE, we confirmed identical
clusters of Salmonella in wastewater
and gulls.
• Wastewater aids to the spreading of resistant
Salmonella in the environment.
• Prevalence of resistant Salmonella gull
isolates in Czech Republic increased.
G R A P H I C A L A B S T R A C T
PFGE analysis of salmonellae from wastewaters and gulls.
Lanes C: control strain — S. Braenderup H9812, L. 1: S. Senftenberg — gull, L. 2: S. Senftenberg — wastewater, L. 3:
S. Agona — wastewater, L. 4: S. Agona — wastewater, L. 5: S. Agona — gull, L. 6: S. Agona — gull, L. 7: S. Agona — gull,
L. 8: S. Agona — gull.
a b s t r a c ta r t i c l e i n f o
Article history:
Received 10 June 2015
Received in revised form 14 October 2015
Accepted 14 October 2015
Available online 28 October 2015
Editor: D. Barcelo
Keywords:
Salmonella
Antibiotic resistance
PFGE
We investigated the presence and epidemiological relatedness of Salmonella isolates from a wastewater treatment
plant (WWTP) in Brno, Czech Republic and from nestlings of black-headed gulls (Chroicocephalus
ridibundus) at the Nove Mlyny waterworks, situated 35 km downstream from the WWTP. During 2012, we collected
37 wastewater samples and 284 gull cloacal swabs. From wastewater samples, we obtained 89 Salmonella
isolates belonging to 19 serotypes. At least one resistant strain was contained in 89% of those samples. Ten different
serotypes of Salmonella were detected in 38 young gulls, among which 14 (37%) were resistant to antimicrobials.
Wastewater isolates were mostly resistant to sulphonamides and tetracycline, gull isolates to tetracycline
and ampicillin. We detected the occurrence of blaTEM-1, tet(A), tet(B), tet(G), sul1, sul2, sul3, floR and strA resistance
genes. For the first time, we identified a class 1 integron with the dfrA12–orfF–aadA2 gene cassette in S.
Infantis. Using pulsed-field gel electrophoresis, we confirmed the presence of identical clusters of S. Agona, S.
Science of the Total Environment 542 (2016) 102–107
⁎ Corresponding author at: University of Veterinary and Pharmaceutical Sciences Brno, Palackého tř. 1/3, Brno 61242, Czech Republic.
E-mail address: masarikovam@vfu.cz (M. Masarikova).
http://dx.doi.org/10.1016/j.scitotenv.2015.10.069
0048-9697/© 2015 Elsevier B.V. All rights reserved.
Contents lists available at ScienceDirect
Science of the Total Environment
journal homepage: www.elsevier.com/locate/scitotenv
Wastewater
Black-headed gull
Enteritidis PT8, S. Infantis and S. Senftenberg in wastewater and black-headed gulls, thus indicating the possibility
of resistant Salmonella isolates spreading over long distances in the environment.
© 2015 Elsevier B.V. All rights reserved.
1. Introduction
Salmonella is one of the most common causes of bacterial food-borne
diseases worldwide (WHO, 2014), and it is one of the leading foodborne
pathogen in causing death (Behravesh et al., 2011). In the Czech
Republic, non-typhoidal Salmonella serotypes cause an estimated
10,000 human salmonellosis cases annually (SZÚ, 2015). In general,
the most frequently occurring serotypes responsible for human salmonellosis
are S. Enteritidis and S. Typhimurium. In addition, the
monophasic variant S. 4,[5],12:i:-, responsible for a number of human
salmonellosis outbreaks, has appeared in many countries including
the Czech Republic (Hopkins et al., 2010).
Antimicrobial drug resistance among Salmonella serotypes, especially
in S. Typhimurium and S. 4,[5],12:i:-, manifests an increasing
tendency and constitutes an even more serious health problem.
The prevalence of resistant Salmonella is often connected with antimicrobial
use in food animals (Crump et al., 2011), where treatment
with tetracyclines and penicillins is most frequently seen, but the
usage of quinolones in poultry is also considerable in the Czech
Republic (Hera et al., 2012).
Wastewater treatment processes do not eliminate all pathogens and
resistant bacteria (Szczepanowski et al., 2009). Moreover, wastewater
treatment plant (WWTP) environments provide an ideal ecosystem
for transfer, evolution and spread of the resistance genes, as they offer
good conditions in terms of pH, temperature, high nutrient concentration,
and close contact of bacteria (Dolejska et al., 2011). Furthermore,
the presence of antibiotics and their metabolites may promote the selection
of antibiotic-resistant strains and horizontal transfer of
antibiotic-resistance genes. These antibiotic-resistant bacteria and resistance
genes may be spread into the natural environment, via surface
water systems (Huang et al., 2012).
Gulls in urbanized areas are frequently colonized by bacteria of the
family Enterobacteriaceae, and can be colonized also by Escherichia coli
producing extended-spectrum beta-lactamases (ESBL) and/or resistant
to quinolones (Dolejská et al., 2009). These birds are considered to constitute
an important reservoir and vector of these isolates in the environment.
Other study have also detected resistant Salmonella isolates
in wild black-headed gulls (Chroicocephalus ridibundus) in the Czech
Republic (Čížek et al., 2007).
We therefore investigated the presence of Salmonella, including
antibiotic-resistant strains, at a WWTP and associated gull colony and
carried out an epidemiological comparison of these isolates to demonstrate
the possibility of gull colonization by strains from WWTP
effluents.
2. Materials and methods
2.1. Sample collection
Treated wastewater was sampled at the outflow of a WWTP located
at Brno, Czech Republic from which the effluents go directly into the
Svratka River and further downstream into the Nove Mlyny waterworks.
The water samples were taken weekly over a period between
March and December 2012. We collected 37 wastewater samples
using the Moore swab method (Moore, 1948). The cotton swabs were
exposed to the water effluents for 7 days, after which the swabs were
placed into a sterile flask and transported to the laboratory.
Black-headed gulls are the most common birds nesting on the Nove
Mlyny waterworks (48° 53′ N, 16° 36′ E). The distance between their
nesting colonies and the WWTP at Brno is 35 km. The WWTP and
colonies are directly connected by the Svratka River. In May 2012, we
collected 284 samples of cloacal swabs from pre-flight nestlings (one
sample per nestling).
2.2. Salmonella isolation and identification
Swabs from the WWTP and gulls were cultured in buffered peptone
water (Oxoid, UK) at 37 °C for 24 h to resuscitate and multiply Enterobacteriaceae
bacteria. Subsequently, 20 μl of pre-enriched samples
were selectively enriched in modified semisolid Rappaport-Vassiliadis
Agar (MSRVA) with novobiocin (Oxoid, UK) but no additional antibiotics
and then incubated at 42 °C for 24 h. WWTP samples were cultured
in parallel in MSRVA supplemented with one of the following antibiotics:
tetracycline (8 mg·L−1
), cefotaxime (2 mg·L−1
) and ciprofloxacin
(0.05 mg·L−1
).
Samples which showed motility in MSRVA were sub-cultivated on
Xylose Lysine Deoxycholate (XLD) Agar (Oxoid, UK) at 37 °C for 24 h.
One presumptive Salmonella colony from each XLD agar was then cultured
on Columbia blood agar (Oxoid, UK) and, after incubation for
24 h at 37 °C, identified by matrix-assisted laser desorption ionization
time-of-flight mass spectrometry (MALDI-TOF MS) (Bruker Daltonics,
Germany). Antigenic structure was determined by slide agglutination
with commercial antisera (DenkaSeiken, Japan, and BioRad, France)
and Kauffmann-White-LeMinor scheme (Grimont and Weill, 2007).
Phage typing was performed according to the HPA Colindale protocol
(Anderson et al., 1977; Ward et al., 1987). Salmonella enterica subsp.
Enterica serotypes Enteritidis PT1 and PT8; 4,[5],12:i:- DT193, DT208
and U302; and Typhimurium DT1 and DT27 were used as control strains
(Veterinary Research Institute, Brno, Czech Republic).
2.3. Antimicrobial susceptibility testing
The antimicrobial susceptibility of Salmonella isolates was tested by
disk diffusion method according to Clinical and Laboratory Standards
Institute guidelines (CLSI, 2010). Twelve antibacterial substances were
tested, as described previously (Dolejska et al., 2007). Isolates with decreased
susceptibility to quinolones in disk diffusion test were tested
for minimum inhibitory concentration (MIC) to nalidixic acid and ciprofloxacin
using the agar dilution method (CLSI, 2004).
2.4. Detection of antimicrobial resistance determinants and integrons and
sequencing of gyrA, gyrB, parC and parE genes
Isolates were tested for the presence of the blaTEM, blaSHV, blaOXA,
blaCTX-M, and blaPSE genes encoding resistance to beta-lactams; catA1,
cmlA, and floR genes for chloramphenicol resistance; and plasmidmediated
quinolone resistance genes qnrA, qnrB, qnrC, qnrD, qnrS,
aac(6′)-Ib, qepA, oqxA, and oqxB genes by PCR. Isolates resistant to streptomycin
were tested for the strA gene; those resistant to sulphonamides
for the sul1, sul2, sul3 genes; and those to tetracyclines for the tet(A),
tet(B), tet(C), tet(D), tet(E), tet(G) genes. The presence of integrase
genes intI1 and intI2, variable regions of class 1 and class 2 integrons,
and gene cassettes within class 1 and 2 integrons were detected
(Literak et al., 2010). Integrons composition was verified by comparing
restriction fragment length polymorphism patterns with those of control
strains (Machado et al., 2005). Non-standard integrons and blaTEM
genes were sequenced and the composition was determined using
BLAST.
Isolates resistant to nalidixic acid and/or ciprofloxacin were tested
for the presence of mutations in gyrA, gyrB, parC, and parE genes. PCR
103M. Masarikova et al. / Science of the Total Environment 542 (2016) 102–107
Table 1
Salmonella isolates detected in wastewater and young black-headed gulls in the Czech Republic during 2012.
Serotype (phage type) Resistance phenotypea
Detected genes, integrons and gene cassettes Number of isolates
WWTPb
Gulls Total
S. Abony ND – 0 1 1
S. Agona ND – 6(2) 10
(4)
16
A blaTEM-1 0 1 1
Gn intI2; I2, 2.5 kb: dfrA1/sat/aadA1 1cip
0 1
S – 0 1 1
T tet(B) 0 1 1
Na, Su, T sul1, tet(A), intI1; I1, 1 kb: aadA1 1cef
0 1
A, Na, Su, T blaTEM-1, sul1, sul2, sul3, tet(A), tet(B), intI1; I1, 1.5 kb: dfr1/aadA1 1cip
0 1
A, S, Su, T strA, sul1, tet(A), intI1; I1, 1 kb: aadA2 1tet
0 1
A, Su, Sxt, T blaTEM-1, sul1, sul2, tet(A), intI1; I1, 1.5 kb: dfr1/aadA1 2cip
, 2tet
0 4
Na, S, Su, T strA, tet(A), sul1, intI1; I1, 1 kb: aadA1 1cip
0 1
A, S, Su, Sxt, T blaTEM-1, strA, sul1, sul2, tet(A), intI1; I1, 1.5 kb: dfr1/aadA1 2tet
0 2
S. Altona A, Su sul2, sul3 1tet
0 1
S. Braenderup A, S, Su, Sxt, T blaTEM-1, strA, sul1, sul2, tet(A), intI1; I1, 1.5 kb: dfr1/aadA1, intI2; I2, 2.5 kb:
dfrA1/sat/aadA1
1tet
0 1
S. Derby ND – 1 0 1
T tet(B) 0 1 1
S. Enteritidis (PT4b) ND – 0 1 1
Na – 0 1 1
S. Enteritidis (PT8) ND – 3(3) 5(5) 8
Na – 0 1 1
S. Enteritidis (PT12) ND – 0 1 1
S. Infantis A blaTEM-1 1tet
0 1
A, Ac, Caz blaTEM-1 1 0 1
Na, Su, T sul1, tet(A), intI1; I1, 1 kb: aadA1 3cip
6tet
(4)
0 9
Na, Su, T sul1, tet(A), intI1; I1, 1 kb: adA1, intI2; I2, 2.5 kb: dfrA1/sat/aadA1 1tet
(1) 0 1
Na, Su, T sul2, tet(A), intI1; I1, 1 kb: aadA1 0 1(1) 1
Na, Su, T sul1, sul2, tet(A), intI1; I1, 1 kb: aadA1 1tet
(1) 0 1
A, Su, Sxt, T – 1tet
0 1
A, Su, Sxt, T blaTEM-1, sul1, sul2, tet(A), intI1; I1, 1.5 kb: dfr1/aadA1 1tet
0 1
Ac, Caz, Na, T tet(A) 1tet
0 1
Kf, Na, Su, T sul1, intI1; I1, 1 kb: aadA1 1cip
0 1
Na, S, Su, T tet(A), intI1; I1, 1 kb: aadA1 1cip
0 1
Na, S, Su, T sul1, tet(A), intI1; I1, 1 kb: aadA1 2cip
0 2
Na, S, Su, T sul1, tet(A), intI1; I1, 1 kb: aadA1 1 0 1
Na, Su, Sxt, T sul1, tet(A), intI1; I1, 0.75 kb: dfrV 1tet
0 1
Na, Su, Sxt, T sul1, tet(A), intI1; I1, 1 kb: aadA1 1tet
0 1
A, S, Su, Sxt, T blaTEM-1 1tet
0 1
A, S, Su, Sxt, T blaTEM-1, strA, sul1, sul2, tet(A), intI1; I1, 1.5 kb: dfr1/aadA1 3tet
0 3
A, Cn, Na, Su, Sxt, T sul1, tet(A), intI1; I1, 2 kb: dfr12/orf/aadA2 1tet
0 1
A, Cip, Na, S, Su, T sul1, tet(A), intI1; I1, 1 kb: aadA1 1cip
0 1
A, Na, S, Su, Sxt, T strA, sul1, tet(A), intI1; I1, 1 kb: aadA1 1tet
0 1
A, C, Cn, Cip, Na, S, Su, Sxt, T blaTEM-1, cat, strA, sul2, tet(A), intI1; I1, 1 kb: aadA1, intI2; I2, 2.5 kb: dfrA1/sat/aadA1 1cip
0 1
S. Kentucky A, Kf, Na – 1cip
0 1
Na, S, Su, T strA, sul1, sul2, tet(A), intI1; I1, 1 kb: aadA1, intI2; I2, 2.5 kb: dfrA1/sat/aadA1 1cip
0 1
A, Ac, Cip, Kf, Na, Su blaTEM-1, sul1 1cip
0 1
A, Ac, Cip, Cn, Kf, Na, Su, Sxt,
T
blaTEM-1, sul1, sul2, tet(A), intI1; I1, 1.5 kb: aac(3)-Id/aadA7 1 0 1
S. Mbandaka ND – 7 0 7
S. Mikawasima ND – 1 0 1
S. Montevideo ND – 3 0 3
S. Montevideo A, C, S, Su, T floR, strA, sul1, sul2, tet(A), intI1; I1, 1.2 kb: blaPSE-1/aadA2 1tet
0 1
S. Muenchen ND – 1 0 1
S. Muenster ND – 1 0 1
S. Newport ND – 0 3 3
S. Ohio ND – 3 0 3
S. Ohio Caz intI1 1 0 1
S. Senftenberg ND – 2(1), 2tet
1(1) 5
S. Senftenberg Su, Sxt sul1, sul2, intI1; I1, 1.3 kb: dfr1 1 0 1
S. Stanley Na – 1cip
0 1
S. Stanley Na intI1; I1, 1.5 kb: dfr1/aadA1, intI2; I2, 2.5 kb: dfrA1/sat/aadA1 1cip
0 1
S. Tennessee ND – 2 0 2
S. Typhimurium (DT85) ND – 0 1 1
S. Typhimurium (DT104) A, C, Su, T blaTEM-1, floR, sul1, sul2, tet(A), intI1; I1, 1.2 kb: blaPSE-1/aadA2 1tet
0 1
A, C, Na, S, Su, T floR, sul2, tet(G), intI1; I1, 1.2 kb: blaPSE-1/aadA2 0 1 1
S. Typhimurium (DT116) A, C, S blaTEM-1, floR, strA 0 1 1
S. Umbilo ND – 1 0 1
S. Zanzibar Na, T tet(A) 1cip
0 1
A, S, T blaTEM-1, strA, tet(A) 1tet
0 1
S. 9,12:I,v:- ND – 0 1 1
S. 4,[5],12:i:- (DT193) A, S, Su, T blaTEM-1, strA, sul2, tet(B) 0 3 3
S. 4,[5],12:i:- (DT193) A, S, Su, T blaTEM-1, strA, sul1, sul2, tet(B) 0 1 1
104 M. Masarikova et al. / Science of the Total Environment 542 (2016) 102–107
fragments containing the quinolone-resistance determining region
(QRDR) of the gyr and par genes were amplified using primers as
shown in Supplementary material — Table S1.
2.5. Pulsed-field gel electrophoresis (PFGE)
XbaI-pulsed-field gel electrophoresis was carried out to analyze the
relatedness of Salmonella isolates from WWTP and gulls. In total, 23 isolates
of the same serotype, phage type and antibiotic-resistance phenotype
were chosen for the comparison. Eight of these belonged to the S.
Enteritidis PT8 serotype (3 WWTP + 5 gulls isolates), seven to S. Infantis
(6 + 1), six to S. Agona serotype (2 + 4), and two each to S. Senftenberg
(1 + 1). The one-day standardized laboratory protocol for molecular
subtyping of Salmonella by PFGE was used, as recommended by
PulseNetUSA (2004). Profiles were analyzed using BioNumerics 6.6 fingerprinting
software (Applied Maths, Belgium). Cluster analysis of the
Dice similarity indices was done to generate a dendrogram describing
the relationships among PFGE profiles. Isolates were considered to be
related and to belong to the same PFGE cluster if their Dice similarity
index was ≥85%.
3. Results
3.1. Salmonella isolation and classification
We found Salmonella in all 37 wastewater samples, and 89 Salmonella
isolates were isolated overall. Among these we identified 19 serotypes.
The serotypes found most frequently were S. Infantis (35%, 31/
89), S. Agona (19%, 17/89), S. Mbandaka (8%, 7/89) and S. Senftenberg
(6%, 5/89). Salmonella was found in 38 (13%) of 284 young gulls.
Among 10 different serotypes, the most common was S. Agona (34%,
13/38), followed by S. Enteritidis (24%, 9/38), S. 4,[5],12:i:- (13%, 5/
38), and S. Typhimurium (8%, 3/38) (Table 1).
3.2. Antimicrobial resistance testing
Resistant Salmonella isolates were found in 33 (89%) out of 37 wastewater
samples. Forty-eight isolates were resistant to three or more antimicrobials.
Resistance to sulphonamide compounds and tetracycline
(both 52%, 46/89), nalidixic acid (38%, 34/89) and ampicillin (31%, 28/
89) was most frequent. Among 38 gull Salmonella isolates, 37% (14/
38) were resistant to antimicrobials. Eight isolates displayed resistance
to three or more antimicrobials. Most frequent was resistance to tetracycline
(24%, 9/38), followed by ampicillin and streptomycin (both
21%, 8/38), and to sulphonamides (18%, 7/38). The quinolone resistance
phenotype was detected in 33 wastewater isolates, all of which demonstrated
nalidixic acid MIC ≥256 mg·L−1
. Three of them showed resistance
also to ciprofloxacin by disk diffusion test, with MIC to
ciprofloxacin N8 mg·L−1
. Five gull Salmonella isolates with the quinolone
resistance phenotype demonstrated MIC to nalidixic acid from
4 mg·L−1
to N256 mg·L−1
with MIC50 and MIC90 value N256 mg·L−1
.
All isolates from gulls were susceptible to ciprofloxacin. All detected
resistance genes and integrons are shown in Table 1. For the first time,
we identified class 1 integron with the dfrA12-orfF-aadA2 gene cassette
in S. Infantis.
The sequence analysis, performed in five Salmonella isolates resistant
to nalidixic acid from gulls and in 33 isolates resistant to
nalidixic acid or ciprofloxacin from the WWTP, revealing single nucleotide
polymorphisms (SNPs) inducing amino acid substitutions
only in the gyrA and parC genes. None of the isolates carried mutation
in a parE or gyrB gene. All mutations are shown as Supporting information
— Table S2.
3.3. Pulsed-field gel electrophoresis
All tested S. Agona and S. Senftenberg, six S. Enteritidis PT8 and two
S. Infantis isolates from the WWTP and from gulls had the same
macrorestriction patterns within their serotypes. The remaining isolates
were related and had a Dice coefficient of similarity greater than 85%.
Hence, we demonstrated the clonal relatedness of these strains (Fig. 1,
Graphical abstract).
4. Discussion
We documented the continuous presence of Salmonella in WWTP effluents
and confirmed the occurrence of resistant Salmonella strains in
89% of samplings. Such a high proportion of resistant Salmonella isolated
from wastewater points to a high risk for environmental contamination.
Multi-resistant Salmonella isolates from wastewater have been observed
also in other studies (Pignato et al., 2010; Oubrim et al., 2012),
indicating the great importance of WWTP effluents and that these
may constitute a risk for public health. Wastewater can play a role as a
mixing vessel for pathogenic microorganisms originating from different
sources (Tennstedt et al., 2003). In addition, significant risks consist in
the possibility for horizontal transfer of resistance genes among these
organisms together with the possibility of direct contact with antibiotic
residues occurring in wastewaters (Dolejska et al., 2011). After the
treatment process, wastewater drains into rivers, microbes are spread
into the environment, and these may potentially colonize wildlife.
The serotype Enteritidis has long been the leading cause of human
non-typhoid salmonellosis in the Czech Republic (SZÚ, 2015), and our
isolates of this serotype may therefore be of human origin. Nevertheless,
this serotype dominates also in poultry (Bzdil et al., 2012) and one of the
wastewater contributors to the Brno WWTP is a poultry slaughterhouse.
Therefore, we must also consider the possibility that these strains are of
animal origin. It is surprising that we only rarely isolated such a common
isolate. Moreover, the serotype Typhimurium, which often is isolated
from pigs in the Czech Republic (Bzdil et al., 2012), comprised
only a small percentage of our Salmonella isolates. We did not isolate
the monophasic variant S. 4,[5],12: i:- from the wastewater at all, but
this has been shown to occur repeatedly among Salmonella isolated
from gulls. We could speculate about the ability of these serotypes to
survive the treatment process. Similarly, Baudart et al. (2000) detected
S. Typhimurium in WWTP effluents only sporadically in comparison
Table 1 (continued)
Serotype (phage type) Resistance phenotypea
Detected genes, integrons and gene cassettes Number of isolates
WWTPb
Gulls Total
S. 4,[5],12:i:- (DT193) A, S, Su, T, Na strA, sul1, sul2, tet(B) 0 1 1
Total 89 38 127
WWTP: wastewater treatment plant.
Numbers in brackets represent number of isolates selected for pulsed-field gel electrophoresis.
a
A: ampicillin; Ac: amoxicillin/clavulanic acid; C: chloramphenicol; Caz: ceftazidime; Cf: cephalothin; Cip: ciprofloxacin; Gn: gentamicin; Na: nalidixic acid; S: streptomycin;
Su: sulphonamides cp.; Sxt: sulfamethoxazole/trimethoprim; T: tetracycline; ND: resistance or resistance genes were not detected.
b
Method of isolation through modified semisolid Rappaport-Vassiliadis Agar (MSRVA): cef — MSRVA with cefotaxime (2 mg·L−1
); cip — MSRVA with ciprofloxacin (0.05 mg·L−1
);
tet — MSRVA with tetracycline (8 mg·L−1
); without index: nonselective MSRVA.
105M. Masarikova et al. / Science of the Total Environment 542 (2016) 102–107
with other sampling sites, and they did not detect S. Enteritidis in
WWTP effluents. By contrast, and similar to our study, S. Agona and S.
Infantis occurred often in their WWTP effluents. On the other hand,
we have demonstrated in wastewater the serotype Mikawasima, the incidence
of which has significantly increased in Europe and in the Czech
Republic during 2012–2013 (EFSA and ECDC, 2013; Myšková and
Karpíšková, 2014), as well as the serotype Stanley, which was involved
in epidemic outbreaks across Europe during 2011–2013 (Kinross et al.,
2014). Based on the wide range of serotypes detected, we assume that
the Salmonella isolates from the Brno WWTP were of both human and
animal origins.
Human sewage is an important source of antibiotic-resistant bacteria,
some of which survive the treatment process and are released into
the environment (Dolejska et al., 2011). Therefore, we set out to document
the occurrence of Salmonella in WWTP effluents and subsequently
in young pre-flying gulls. We detected Salmonella isolates with the same
macrorestriction profiles in the WWTP and in gulls. These results
strongly support the assumption that antibiotic-resistant Salmonella is
spreading from the WWTP to the water environment and then to wildlife,
including migratory waterbirds. In addition to feed, water environment
surrounding nesting colony is dominant source of (resistant)
microorganisms, which can colonize nestlings (Čížek et al., 2007). We
could hypothesize that young gulls have been colonized by bacteria
via the feed collected by their parents directly in the area of WWTP
Brno. However, this is unlikely, due to the distance between the colony
and the WWTP (35 km). Adults search feed within a radius of 10 km
from the colony during the nesting season (Hudec and Stastny, 2005).
We isolated Salmonella of ten different serotypes from 13% of gulls.
This prevalence is lower than in other countries. In the USA, Salmonella
was demonstrated in 17% of seagulls (Gruszynski et al., 2014), and in
Chile even 51% of kelp gulls (Larus dominicanus) and 75% of Franklin's
gulls (Leucophaeus pipixcan) were observed to carry Salmonella
(Rodríguez et al., 2012). The prevalence of Salmonella in young blackheaded
gulls at Nove Mlyny has shown a decreasing tendency. Whereas
31% of young gulls had been found to be colonized by Salmonella in
1991, in 2005 only 9% of them carried Salmonella (Čížek et al., 2007).
Nevertheless, the prevalence of resistant Salmonella colonizing gulls at
Nove Mlyny is increasing. While in 1991 resistant Salmonella had been
detected among 1% of gulls (3/267) and in 2005 all Salmonella isolates
were susceptible to the tested antibiotics (Čížek et al., 2007), in this
study resistant Salmonella was detected in 5% of gulls from the same
locality.
Integrons were present in Salmonella isolated from both wastewater
and gulls, and more often in Salmonella cultivated via antibioticssupplemented
MRSVA. We detected integrons of class 1 and class 2 containing
several types of gene cassettes. In Portugal, Salmonella isolated
from wild boars and Bísaro pigs contained only integrons of class 1
(Caleja et al., 2011), and 14 isolates of S. Rissen contained gene cassettes
dfrA12-orfF-aadA2. The gene cassette dfrA12-orfF-aadA2 has also previously
been described in different serotypes (Fernández et al., 2007;
Hsu et al., 2013). We report here for the first time about the gene cassette
dfrA12-orfF-aadA2 in S. Infantis.
Acknowledgments
We would like to thank Marie Slavikova, Jana Hofirkova, Dalibor
Pavlicek and Martina Janatova for their help in the field and laboratory.
This work was supported by the Central European Institute of Technology
Project of the European Regional Development Fund [grant
number CZ.1.05/1.1.00/02.0068]; by the Internal Grant Agency of the
University of Veterinary and Pharmaceutical Sciences Brno, Czech
Republic [grant number IGA 74/2014/FVL]; by the Ministry of Education,
Youth and Sports of the Czech Republic under the NPU I program
[grant number LO1218]; by the Ministry of Education, Youth and Sports
of the Czech Republic under the program OP VK [grant number CZ.1.07/
2.3.00/30.0053]; and by Ministry of Health of the Czech Republic [grant
number NT/14398].
Appendix A. Supplementary data
Supplementary tables.
Fig. 1. XbaI-pulsed-field gel electrophoresis of 23 Salmonella isolates from WWTP and gulls.
W: wastewater G: gull.
106 M. Masarikova et al. / Science of the Total Environment 542 (2016) 102–107
References
Anderson, E.S., Ward, L.R., Saxe, M.J., de Sa, J.D., 1977. Bacteriophage-typing designations
of Salmonella Typhimurium. J. Hyg. (Lond.) 78 (2), 297–300.
Baudart, J., Lemarchand, K., Brisabois, A., Lebaron, P., 2000. Diversity of Salmonella strains
isolated from the aquatic environment as determined by serotyping and amplification
of the ribosomal DNA spacer regions. Appl. Environ. Microbiol. 66 (4),
1544–1552.
Behravesh, C.B., Jones, T.F., Vugia, D.J., Long, C., Marcus, R., Smith, K., Thomas, S., Zansky, S.,
Fullerton, K.E., Henao, O.L., Scallan, E., FoodNet Working Group, 2011. Deaths associated
with bacterial pathogens transmitted commonly through food: foodborne diseases
active surveillance network (FoodNet), 1996–2005. J. Infect. Dis. 204 (2),
263–267.
Bzdil, J., Hubíková-Kubíčková, I., Kvapilová, M., 2012. Výskyt salmonel v klinických
materiálech v humánní a veterinární sféře v letech 2006–2010 (Prevalence of Salmonella
in clinical materials in human and veterinary sphere over the period of 2006 to
2010). Veterinářství 62, 625–629 (In Czech).
Caleja, C., de Toro, M., Gonçalves, A., Themudo, P., Vieira-Pinto, M., Monteiro, D.,
Rodrigues, J., Sáenz, Y., Carvalho, C., Igrejas, G., Torres, C., Poeta, P., 2011. Antimicrobial
resistance and class I integrons in Salmonella enterica isolates from wild boars and
Bísaro pigs. Int. Microbiol. 14 (1), 19–24.
Čížek, A., Dolejská, M., Karpíšková, R., Dědičová, D., Literák, I., 2007. Wild black-headed
gulls (Larus ridibundus) as an environmental reservoir of Salmonella strains resistant
to antimicrobial drugs. Eur. J. Wildl. Res. 53 (1), 55–60.
CLSI, 2004. Methods for Antimicrobial Susceptibility Testing of Anaerobic Bacteria: Approved
Standard M11-A6. Clinical and Laboratory Standards Institute, Wayne, PA.
CLSI, 2010. Performance Standards for Antimicrobial Disk Susceptibility Tests: Approved
Standard M02-A10 (Wayne, PA).
Crump, J.A., Medalla, F.M., Joyce, K.W., Krueger, A.L., Hoekstra, R.M., Whichard, J.M.,
Barzilay, E.J., Emerging Infections Program NARMS Working Group, 2011. Antimicrobial
resistance among invasive nontyphoidal Salmonella enterica isolates in the United
States: National Antimicrobial Resistance Monitoring System, 1996 to 2007.
Antimicrob. Agents Chemother. 55 (3), 1148–1154.
Dolejska, M., Cizek, A., Literak, I., 2007. High prevalence of antimicrobial-resistant genes
and integrons in Escherichia coli isolates from Black-headed Gulls in the Czech
Republic. J. Appl. Microbiol. 103 (1), 11–19.
Dolejská, M., Bierošová, B., Kohoutová, L., Literák, I., Čížek, A., 2009. Antibiotic-resistant
Salmonella and Escherichia coli isolates with integrons and extended-spectrum betalactamases
in surface water and sympatric black-headed gulls. J. Appl. Microbiol.
106 (6), 1941–1950.
Dolejska, M., Frolkova, P., Florek, M., Jamborova, I., Purgertova, M., Kutilova, I., Cizek, A.,
Guenther, S., Literak, I., 2011. CTX-M-15-producing Escherichia coli clone B2-O25bST131
and Klebsiella spp. isolates in municipal wastewater treatment plant effluents.
J. Antimicrob. Chemother. 66 (12), 2784–2790.
EFSA, ECDC, 2013. Unusual increase of Salmonella Mikawasima infections in humans.
http://www.efsa.europa.eu/en/supporting/doc/512e.pdf.
Fernández, A.G., Cloeckaert, A., Bertini, A., Praud, K., Doublet, B., Weill, F.X., Carattoli, A.,
2007. Comparative analysis of IncHI2 plasmids carrying blaCTX-M-2 or blaCTX-M-9
from Escherichia coli and Salmonella enterica strains isolated from poultry and
humans. Antimicrob. Agents Chemother. 51 (11), 4177–4180.
Grimont, P.A.D., Weill, F.X., 2007. Antigenic Formulae of the Salmonella Serovars. 9th ed.
http://www.pasteur.fr/ip/portal/action/WebdriveActionEvent/oid/01s-000036-089.
Gruszynski, K., Pao, S., Kim, C., Toney, D.M., Wright, K., Colón, A., Engelmeyer, T., Levine,
S.J., 2014. Evaluating gulls as potential vehicles of Salmonella enterica serotype Newport
(JJPX01.0061) contamination of tomatoes grown on the eastern shore of Virginia.
Appl. Environ. Microbiol. 80 (1), 235–238.
Hera, A., Koutecká, L., Dorn, D., Pokludová, L., 2012. Consumption of antibiotics and antiparasitics
in veterinary medicine in the Czech Republic: trends in consumptions of
premixes in 2005–2011; detailed comparison of antimicrobial consumption in
2010–2011. http://www.uskvbl.cz/attachments/665_ATB_spotreba 2003-2011
finalni draft.pdf (In Czech).
Hopkins, K.L., Kirchner, M., Guerra, B., Granier, S.A., Lucarelli, C., Porrero, M.C., Jakubczak,
A., Threlfall, E.J., Mevius, D.J., 2010. Multiresistant Salmonella enterica serovar 4,[5],12:
i:- in Europe: a new pandemic strain? Euro. Surveill. 15 (22), 19580.
Hsu, Y.M., Tang, C.Y., Lin, H., Chen, Y.H., Chen, Y.L., Su, Y.H., Chen, D.S., Lin, J.H., Chang, C.C.,
2013. Comparative study of class 1 integron, ampicillin, chloramphenicol, streptomycin,
sulfamethoxazole, tetracycline (ACSSuT) and fluoroquinolone resistance in various
Salmonella serovars from humans and animals. Comp. Immunol. Microbiol.
Infect. Dis. 36 (1), 9–16.
Huang, J.J., Hu, H.Y., Lu, S.Q., Li, Y., Tang, F., Lu, Y., Wei, B., 2012. Monitoring and evaluation
of antibiotic-resistant bacteria at a municipal wastewater treatment plant in China.
Environ. Int. 42, 31–36.
Hudec, K., Stastny, K., 2005. Larus ridibundus Linnaeus. In: Hudec, K., Stastny, K. (Eds.),
Ptáci – Aves fauna CR II/2 (Birds of the Czech Republic). Academia, Prague,
pp. 759–769 (In Czech).
Kinross, P., van Alphen, L., Martinez Urtaza, J., Struelens, M., Takkinen, J., Coulombier, D.,
Makela, P., Bertrand, S., Mattheus, W., Schmid, D., Kanitz, E., Rucker, V.,
Krisztalovics, K., Paszti, J., Szogyenyi, Z., Lancz, Z., Rabsch, W., Pfefferkorn, B., Hiller,
P., Mooijman, K., Gossner, C., 2014. Multidisciplinary investigation of a multicountry
outbreak of Salmonella Stanley infections associated with Turkey meat in the
European Union, August 2011 to January 2013. Euro. Surveill. 19 (19), 20801.
Literak, I., Dolejska, M., Janoszowska, D., Hrusakova, J., Meissner, W., Rzyska, H., Bzoma, S.,
Cizek, A., 2010. Antibiotic-resistant Escherichia coli bacteria, including strains with
genes encoding the extended-spectrum beta-lactamase and QnrS, in waterbirds on
the Baltic Sea Coast of Poland. Appl. Environ. Microbiol. 76 (24), 8126–8134.
Machado, E., Cantón, R., Baquero, F., Galán, J.C., Rollán, A., Peixe, L., Coque, T.M., 2005.
Integron content of extended-spectrum-beta-lactamase-producing Escherichia coli
strains over 12 years in a single hospital in Madrid, Spain. Antimicrob. Agents
Chemother. 49 (5), 1823–1829.
Moore, B., 1948. The detection of paratyphoid carriers in towns by means of sewage examination.
Mon. Bull. Minist. Health. Public Health Lab. Serv. 7, 241–248.
Myšková, P., Karpíšková, R., 2014. Unusual occurrence of Salmonella Mikawasima in
2012–2013 in the Czech Republic: part of a multistate outbreak? Pol. J. Microbiol.
63 (3), 355–357.
Oubrim, N., Ennaji, M.M., Badri, S., Cohen, N., 2012. Removal of antibiotic-resistant Salmonella
in sewage water from wastewater treatment plants in Settat and Soualem,
Morocco. Eur. J. Sci. Res. 68 (4), 565–573.
Pignato, S., Coniglio, M.A., Faro, G., Lefevre, M., Weill, F.X., Giammanco, G., 2010. Molecular
epidemiology of ampicillin resistance in Salmonella spp. and Escherichia coli from
wastewater and clinical specimens. Foodborne Pathog. Dis. 7 (8), 945–951.
PulseNetUSA, 2004. One-day (24–28 h) standardized laboratory protocol for molecular
subtyping of Escherichia coli O157:H7, non-typhoidal Salmonella serotypes, and Shigella
sonnei by pulsed field gel electrophoresis (PFGE). PulseNet PFGE Manual 5.1–5.3
pp.1–13.
Rodríguez, F., Moreno, J., Ortega, R., Mathieu, C., García, A., Cerda-Leal, F., González-Acuña,
D., 2012. Evidence for Kelp Gulls (Larus dominicanus) and Franklin's Gulls
(Leucophaeus pipixcan) as carriers of Salmonella by real-time polymerase chain reaction.
J. Wildl. Dis. 48 (4), 1105–1108.
Szczepanowski, R., Linke, B., Krahn, I., Gartemann, K.H., Gützkow, T., Eichler, W., Pühler, A.,
Schlüter, A., 2009. Detection of 140 clinically relevant antibiotic-resistance genes in
the plasmid metagenome of wastewater treatment plant bacteria showing reduced
susceptibility to selected antibiotics. Microbiology 155 (7), 2306–2319.
SZÚ, 2015. Infections in Czech Republic — EPIDAT. http://www.szu.cz/publikace/data/
infekce-v-cr (In Czech).
Tennstedt, T., Szczepanowski, R., Braun, S., Pühler, A., Schlüter, A., 2003. Occurrence of
integron-associated resistance gene cassettes located on antibiotic resistance plasmids
isolated from a wastewater treatment plant. FEMS Microbiol. Ecol. 45 (3),
239–252.
Ward, L.R., de Sa, J.D.H., Rowe, B., 1987. A phage-typing scheme for Salmonella Enteritidis.
Epidemiol. Infect. 99 (2), 291–294.
WHO, 2014. Salmonella. http://www.who.int/topics/salmonella/en/.
107M. Masarikova et al. / Science of the Total Environment 542 (2016) 102–107
Příloha 32
PAPAGIANNITSIS, C.C., DOLEJSKA, M., IZDEBSKI, R., GIAKKOUPI, P., SKÁLOVÁ, A., CHUDĚJOVÁ, K.,
DOBIASOVA, H., VATOPOULOS, A.C., DERDE, L.P., BONTEN, M.J., GNIADKOWSKI, M., HRABÁK, J.,
2016, Characterisation of IncA/C2 plasmids carrying an In416-like integron with the blaVIM-19 gene
from Klebsiella pneumoniae ST383 of Greek origin. International Journal of Antimicrobial Agents:
v. 47, p. 158-162.
Souhrn
V rámci této studie byla sestavena primární nukleotidová sekvence tří multirezistentních IncA/C plazmidů
z čeledi Enterobacteriaceae nesoucích gen karbapenemázy VIM-19. Bioinformatická analýza prokázala, že
všechny tři plazmidy náleží do linie IncA/C2 a gen blaVIM-19 je součást integronu třídy 1 s identickou strukturou.
V práci je nastíněna možná evoluce této skupiny plazmidů. Studie upozorňuje na význam této plazmidové linie
na diseminaci In416 integronu mezi klinickými izoláty enterobakterií.
International Journal of Antimicrobial Agents 47 (2016) 158–162
Contents lists available at ScienceDirect
International Journal of Antimicrobial Agents
journal homepage: http://www.elsevier.com/locate/ijantimicag
Short Communication
Characterisation of IncA/C2 plasmids carrying an In416-like integron
with the blaVIM-19 gene from Klebsiella pneumoniae ST383 of Greek
origin
Costas C. Papagiannitsisa,b,∗
, Monika Dolejskac,d
, Radosław Izdebskie
,
Panagiota Giakkoupif
, Anna Skálováa
, Kateˇrina Chudˇejováa
, Hana Dobiasovac,d
,
Alkiviadis C. Vatopoulosf
, Lennie P.G. Derdeg
, Marc J.M. Bonteng
, Marek Gniadkowskie
,
Jaroslav Hrabáka,b
a
Faculty of Medicine and University Hospital in Plzeˇn, Charles University in Prague, Plzeˇn, Czech Republic
b
Biomedical Center, Faculty of Medicine and University Hospital in Plzeˇn, Charles University in Prague, Plzeˇn, Czech Republic
c
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences Brno, Brno,
Czech Republic
d
CEITEC, University of Veterinary and Pharmaceutical Sciences Brno, Brno, Czech Republic
e
National Medicines Institute, Warsaw, Poland
f
Department of Microbiology, National School of Public Health, Athens, Greece
g
University Medical Center Utrecht, Utrecht, The Netherlands
a r t i c l e i n f o
Article history:
Received 18 August 2015
Accepted 1 December 2015
Keywords:
IncA/C2 plasmids
CMY
VIM
Class 1 integron
a b s t r a c t
The complete nucleotide sequences of three multidrug resistance (MDR) IncA/C-like plasmids
from Enterobacteriaceae isolates carrying the VIM-type carbapenemase-encoding integrons In4863
(blaVIM-19–aacA7–dfrA1– aadA1–smr2) or In4873 (blaVIM-1–aacA7–dfrA1– aadA1–smr2) were determined,
which are the first In416-like elements identified in Greece. Plasmids pKP-Gr642 and pKP-Gr8143
were from Klebsiella pneumoniae ST383 isolates, whereas plasmid pEcl-Gr4873 was from an Enterobacter
cloacae ST88 isolate. Sequencing showed that pKP-Gr642 (162 787 bp) and pKP-Gr8143 (154 395 bp)
consisted of the type 1 IncA/C2 conserved backbone, the blaCMY-2-like gene-containing region, and
the ARI-B (with the sul2 gene) and ARI-A (with a class 1 integron) resistance islands, like the plasmid
pUMNK88 161 from the USA. The third plasmid, pEcl-Gr4873 (153 958 bp), exhibited extensive similarity
with the type 2 IncA/C2 plasmid pR55 from France. pEcl-Gr4873 carried only one resistance island
of a hybrid transposon structure inserted in a different location to ARI-A in type 1 A/C2 plasmids. In
all three plasmids, the In416-like integrons In4863 or In4873 were identified within non-identical
class II transposon structures. All three In416-like-carrying regions presented significant similarities
with the MDR region of the IncA/C2 plasmid pCC416 from Italy, carrying the prototype In416 integron
(blaVIM-4–aacA7–dfrA1– aadA1–smr2). These findings provided the basis for speculations regarding
the evolution of IncA/C2 plasmids with In416-like integrons, and confirmed the rapid evolution of
some IncA/C2 plasmid lineages. Considering the broad host range of IncA/C2 molecules, it seems that
pKP-Gr642, pKP-Gr8143 and pEcl-Gr4873 plasmids might support the diffusion of In416-like integrons
among Enterobacteriaceae.
© 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
∗ Corresponding author. Present address: Department of Microbiology, Faculty of
Medicine and University Hospital in Plzeˇn, Alej Svobody 80, 304 60 Plzeˇn, Czech
Republic. Tel.: +420 603 113 354; fax: +420 37 710 3250.
E-mail address: c.papagiannitsis@gmail.com (C.C. Papagiannitsis).
1. Introduction
In recent years there has been a growing interest in IncA/Ctype
multidrug resistance (MDR) plasmids, which are commonly
identified among agricultural and clinical bacterial isolates in the
USA, Europe and elsewhere. IncA/C plasmids share a conserved
backbone into which resistance fragments are integrated at various
positions, and they readily circulate in numerous species and
http://dx.doi.org/10.1016/j.ijantimicag.2015.12.001
0924-8579/© 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
C.C. Papagiannitsis et al. / International Journal of Antimicrobial Agents 47 (2016) 158–162 159
across taxonomic borders [1,2]. Among many resistance genes
observed, the A/C plasmids have often been found to disseminate
blaCMY-2-like cephalosporinase genes [1]; more recently, the
spread of blaNDM carbapenemase genes has also been in part associated
with such molecules [3]. Carattoli et al. [1] reported that
blaCMY-2-like-carrying plasmids from the USA represented a new
replicon variant, named repA/C2 (IncA/C2), exhibiting 26 nucleotide
substitutions with respect to the IncA/C reference plasmid pRA1
(IncA/C1) [4]. In addition, a comparison of IncA/C2 plasmids from
different geographic areas showed that those with the blaCMY-2like
region represent a unique phylogenetic lineage [5], increasingly
spreading in bacterial populations [1,5]. The DNA segment containing
the blaCMY-2-like gene is a part of an ISEcp1 transposition unit
(TU), which is always found in the same location. In some plasmids,
the blaCMY-2-like gene has been duplicated and is associated both
with complete and partial copies of ISEcp1. Along with blaCMY-2-like
genes, this lineage also carries sul2- and class 1 integron-containing
segments, the so-called resistance islands ARI-B and ARI-A, respectively
[2,4,5]. A recent analysis of backbones of numerous complete
A/C2 plasmid sequences identified two distinct types (types 1 and
2) that diverged a long time ago [2]. The ARI-A island was found
only in type 1 A/C2 plasmids, whereas ARI-B was observed in both
types [2]. Overall, the IncA/C2 type 1 plasmid lineage that also possesses
the blaCMY-2-like region is remarkable since it contains three
resistance islands serving as hotspots for further plasmid evolution
by in situ acquisition of resistance determinants.
VIM-type metallo-␤-lactamase-producing Enterobacteriaceae
have been observed in Greece since 2001 [6]. In 2002–2007, a
variety of Klebsiella pneumoniae sequence types (STs) and other
species expressing VIM-1 disseminated into hospitals throughout
the country [7]. In most of these isolates, blaVIM-1 was part
of In-e541 (blaVIM-1–aacA7–dfrA1–aadA1)-like integrons [6,8] carried
by self-transferable IncN plasmids [6,7], similar to the fully
sequenced pNL194 [9]. Later, the In-e541-like elements have also
been found on molecules with replicons W, R or FIIk, multiple
replicons R+FIIK or R+A/C, non-typeable plasmids or in the chromosome
[8]. Other blaVIM-type genes found in Enterobacteriaceae
of Greek origin encoded the VIM-1 variants VIM-4, VIM-19, VIM-26,
VIM-27 and VIM-39 [8,10–13] as well as the variant VIM-12, being
a VIM-1/VIM-2 hybrid [14]. The blaVIM-26, blaVIM-27 and blaVIM-39
variants were identified in In-e541-like integrons [8,12,13], whilst
the blaVIM-12 gene was part of the class 1 integron In-h12
(aacA7–blaVIM-12–aacA7) [14]. A recent study showed that blaVIM-19,
which is often linked with K. pneumoniae ST383 [8], occurred as
the first cassette of In4863 (blaVIM-19–aacA7–dfrA1– aadA1–smr2),
being the first In416-like element identified in Greece [8]. Interestingly,
in the same study, a second In416-like element, In4873
(blaVIM-1–aacA7–dfrA1– aadA1–smr2), encoding VIM-1, was found
in an Enterobacter cloacae ST88 isolate [8]. The original In416
element, reported in Italy, Russia and the United Arab Emirates
[15–17], comprises blaVIM-4, aacA7, dfrA1, aadA1 and smr2 gene
cassettes [18], sharing the first four cassettes with the In-e541like
variants with the aadA1 cassette truncated by 82 bp at the
5 -end ( aadA1). VIM-19 differs by a single amino acid substitution
from VIM-4 (Asn215Lys) and by two substitutions from
VIM-1 (Asn215Lys and Ser228Arg). In Italy, In416 was associated
with transposons Tn1696 and Tn8802 [15]. In416-like integrons are
usually present on IncA/C-type plasmids [8,15,17], like the CMY-4encoding
pCC416 from Italy [15].
In the present study, we describe the complete nucleotide
sequences of two IncA/C-type plasmids carrying the In4863 integron
from K. pneumoniae ST383. We have also sequenced the
IncA/C-type plasmid carrying In4873 from E. cloacae ST88 in order
to examine whether the same or different plasmid with In416-like
integrons are spreading in different species of Enterobacteriaceae
in Greece.
2. Materials and methods
2.1. Plasmids
Plasmid pKP-Gr642 was from a K. pneumoniae ST383 isolate
(Kpn-642) recovered in the Czech Republic in 2011 from a patient
who had been previously hospitalised in Northern Greece. Plasmids
pKP-Gr8143 and pEcl-Gr4873 were from K. pneumoniae ST383
(Kpn-8143) and E. cloacae ST88 (Ecl-4873) isolates cultured in 2010
and 2009, respectively, from patients in different Athens hospitals
and reported previously [8].
2.2. Plasmid sequencing
Plasmid DNA was extracted from Escherichia coli transconjugants
or transformants and was sequenced using a 454 Genome
Sequencer Junior System (Roche, Prague, Czech Republic) on a
standard DNA fragment library. Reads were assembled using the GS
De Novo Assembler software (Roche). Sequence gaps were filled by
sequencing of PCR amplicons. The BLAST algorithm (http://www.
ncbi.nlm.nih.gov/BLAST), IS Finder (http://www-is.biotoul.fr/) and
open reading frame (ORF) Finder (http://www.bioinformatics.org/
sms/) were used for data analysis.
2.3. Nucleotide sequence accession numbers
The nucleotide sequences of the plasmids pKP-Gr642, pKPGr8143
and pEcl-Gr4873 were deposited in GenBank under
accession nos. KR559888, KR559889 and KR559890, respectively.
3. Results
Plasmids carrying In416-like integrons from three Enterobacteriaceae
isolates of Greek origin were analysed. Sequencing of
pKP-Gr642, pKP-Gr8143 and pEcl-Gr4873 confirmed that all of
these plasmids belonged to the IncA/C group, subgroup IncA/C2.
Furthermore, the backbones of the three plasmids were highly conserved
(>99% identity). This finding is in agreement with previous
studies documenting that core backbones of IncA/C plasmids are
highly syntenic with no genetic rearrangements [4].
3.1. pKP-Gr642
The self-transferable plasmid pKP-Gr642 (10−6 transconjugants
per donor cell) is a 162 787-bp molecule with a sequence closely
related to the type 1 A/C2 plasmids, like pUMNK88 161 (91% coverage,
99% identity) (Fig. 1) from the USA [5]. The pKP-Gr642
backbone was composed of regions responsible for replication
(repA gene), conjugative transfer (Tra1 and Tra2 regions) and plasmid
maintenance (higBA and parAB operons, and xerD and kfrA-like
genes). Apart from the backbone, pKP-Gr642 carried the blaCMY-2like-containing
region, and the ARI-B and ARI-A resistance islands,
as previously described in other type 1 A/C2 MDR plasmids [2,4,5].
In pKP-Gr642, the blaCMY-2-like-containing region resembled the
type II structure, which includes a single copy of the blaCMY-2-like
gene. This region was inserted into the Tra1 region, 99 bp downstream
of traA, and consisted of an ISEcp1 TU with blaCMY-4, blc,
sugE and ecnR genes of Citrobacter freundii origin. The ISEcp1 TU
was flanked by direct repeats of 5 bp (ATTTC; DR1) and differed
only in the blaCMY sequence (blaCMY-4 vs. blaCMY-2) from the respective
regions of other type 1 A/C2 plasmids. The ARI-B with two
copies of IS26, an ISCR2 element, and the floR, tetA(A), strA, strB and
sul2 genes (resistance to phenicols, tetracyclines, aminoglycosides
and sulfonamides) occurred upstream of Tra1 and was identical to
the respective part of pUMNK88 161 as well as other type 1 A/C2
160 C.C. Papagiannitsis et al. / International Journal of Antimicrobial Agents 47 (2016) 158–162
plasmids. Similar to other type 1 A/C2 plasmids, a 10 984-bp segment
of the plasmid backbone (nucleotides [nts] 19 083–30 066 in
pRMH760 [2]) was probably deleted due to insertion of the ARI-B
resistance island.
The ARI-A resistance island has a complex mosaic structure
composed of a class 1 integron and multiple transposons included
within a class II transposon structure that is flanked by 5-bp direct
repeats of the target (TTGTA; DR2). The ARI-A resistance island
was inserted upstream of Tra2, in exactly the same position as
in pUMNK88 161 and all other type 1 A/C2 MDR plasmids. The
islands exhibited identical extremities but harboured significantly
different class 1 integrons, insertion sequences, transposons and
resistance genes (Fig. 1). The ARI-A of pKP-Gr642 included the
In416-like integron In4863, encoding VIM-19 [8]. The IRi of In4863
was located between resI and resII sites of the Tn1696 module, in
precisely the same position as In4 in Tn1696. Similar to In416 in the
plasmid pCC416 from Italy [15], the ISPa21 element was inserted
into the attC site of the smr2 cassette, and In4863 lacked the 3 CS.
The ISPa21 left inverted repeat (IRL) was deleted probably due to
insertion of Tn8082 carrying an arsenic resistance operon (ars) [15],
but in contrast to pCC416 the Tn8082 tnpR gene lacked 70 bp of its
5 end due to IS26 insertion (IS26-3). A segment including a 142-bp
fragment of Tn21 and a mercury resistance operon (mer), previously
found in pDU1358 [18], was identified upstream of IS26-3. The IR
of the Tn1696 tnp module and the IR of the pDU mer module, at the
boundaries of the plasmid backbone, were disrupted by IS5075 and
IS4321, respectively. IS5075 is an isoform of IS4321 (93% homology),
shown previously to target the IRs of Tn21-like transposons [19].
Notably, two mobile elements, an ISEc23 element and a novel
insertion sequence ISVpa4 (IS3 family), were inserted into the
IncA/C2 backbone of pKP-Gr642. Target site duplications of 8 bp
(GAATATTG; DR3) and 3 bp (GTC; DR4) at boundaries of the latter
IS elements indicated insertions by transposition. These elements
are absent in pUMNK88 161.
3.2. pKP-Gr8143
The non-self-transferable plasmid pKP-Gr8143 is 154 395 bp in
size and sequence analysis demonstrated that it is a derivative of
pKP-Gr642 (100% coverage, 100% identity). Only two differences
between the two plasmids were observed. An 8392-bp segment
(nts 125 372–133 763 in pKP-Gr642), including the right boundary
of the ARI-A resistance island (pDU mer module) and a part of
the plasmid backbone (1611 bp) (Fig. 1), was not present in pKPGr8143.
In addition, the insertion sequence ISEc23 was inserted
into the traN gene of pKP-Gr8143, probably explaining the inability
of the plasmid to conjugate. Transposition of ISEc23 into traN
of pKP-Gr8143 was indicated by the 8-bp target site duplication
(AGAGTATG).
3.3. pEcl-Gr4873
pEcl-Gr4873 is a self-transferable plasmid (7 × 10−4 transconjugants
per donor cell) carrying the In416-like integron In4873,
coding for VIM-1. Its sequence comprised 153 958 bp sharing
extensive similarity with the sequence of type 2 A/C2 plasmid pR55
(95% coverage, 99% identity) (Fig. 1) from France [20]. The similarity
with pKP-Gr642 was lower (84% coverage, 99% identity). As
in the above plasmids, the IncA/C2 backbone of pEcl-Gr4873 carried
all of the genes implicated in replication, conjugative transfer
and maintenance. Of note, an intact group II intron (1389 bp; nts
33 810–35 198) was identified within the pEcl-Gr4873 backbone,
between repA and the Tra1 region.
As other type 2 A/C2 plasmids, pEcl-Gr4873 carried none of the
blaCMY-2-like, ARI-B and ARI-A regions. However, it had another
resistance island, a hybrid transposon structure inserted into the
rhsD gene (2647 bp downstream the rhsD start codon). Interestingly,
the same insertion position (RI position 4) was previously
identified for resistance islands of the type 2 A/C2 plasmids pKOX-
86d, pTC2 and p1643 10 [2]. The resistance island of pEcl-Gr4873
contained In4873 [8], located in the Tn1696 module, in the same
configuration previously described in In4. Similar to In4863 in pKPGr642,
the ISPa21 was inserted into the attC site of smr2. However,
unlike in pKP-Gr642, an intact 3 CS was found upstream of ISPa21
in pEcl-Gr4873 (Fig. 1). Furthermore, a Tn21 fragment consisting
of IS1326, tniB 1, tniA and the mer operon was found next to the
3 CS, 108 bp downstream of orf5, as in In2-like integrons. The resistance
island of pEcl-Gr4873 was flanked by the IRtnp and IRmer of
Fig. 1. (a) Linear maps of the IncA/C2 plasmids pKP-Gr642 and pEcl-Gr4873. (b) Detailed comparison of the ARI-A resistance islands of the IncA/C2 plasmids pKP-Gr642,
pKP-Gr8143 and pUMNK88 161 [5] and of the class II transposon structures found in the IncA/C2 plasmids pEcl-Gr4873 and pCC416 [15]. Open reading frames (ORFs)
are shown as rectangles (arrows within rectangles indicate the direction of transcription). Intact insertion sequences (IS) are represented by arrows, whilst truncated IS
elements appear as rectangles. Replicons of the plasmids are indicated as purple rectangles. Resistance genes, IS elements and transposases are shown in red, yellow and
green, respectively. Orange rectangles indicate integrases; the group II intron is shown in pink. The remaining genes, including plasmid scaffold regions, are indicated as grey
rectangles. The blue shades correspond to highly similar sequences among all plasmids, whilst the yellow shades show highly similar sequences found only in type 1 A/C2
plasmids. Highly similar sequences, found only in plasmids carrying In416-like integrons, are indicated by pink shades. (For interpretation of the references to colour in this
figure legend, the reader is referred to the web version of the article.)
C.C. Papagiannitsis et al. / International Journal of Antimicrobial Agents 47 (2016) 158–162 161
(b)
pUMNK88_161
(HQ023862)
tnpR
tnpA
intI1
aadA1
cmlA1
aadA2
tniBΔ1
qacEΔ1
sul1
IS1326
IS1353
IS5075
IS26
merE
merB
merA
merR
merT
IS4321
merD
merP
rhs
IRtnpofTn1696
IRmerofpDU
pCC416
(AJ704863)
tnpR
tnpA
intI1
blaVIM-19
dfrA1
ΔaadA1
smr2
aacA7
tnpR
IS5075
ΔISPa21
IRtnpofTn1696
IRLTn8082
arsD
arsR
arsA
arsB
arsC
tnpA
Δsul1
qacEΔ1
cmlA7
aadB
IRRTn2
intI1
pEcl-Gr4873
tnpR
tnpA
intI1
tniBΔ1
qacEΔ1
sul1
Δrhs
blaVIM-1
dfrA1
ΔaadA1
smr2
aacA7
tniA
Δrhs
IS5075
IRtnpofTn1696
ISPa21
IS1326
urf2
merE
merD
merA
merC
merP
merT
merR
IRmerofTn1696
pKP-Gr8143
tnpR
tnpA
intI1
blaVIM-19
dfrA1
ΔaadA1
smr2
aacA7
ΔtnpR
IS5075
ΔISPa21
arsD
arsR
arsA
arsB
arsC
IS26
rhs
IRLTn8082
IRtnpofTn1696
pKP-Gr642
tnpR
tnpA
intI1
blaVIM-19
dfrA1
ΔaadA1
smr2
aacA7
ΔtnpR
IS5075
ΔISPa21
IRLTn8082
arsD
arsR
arsA
arsB
arsC
IS26
merE
merD
merB
merA
merR
merP
merT
IS4321
IRmerofpDU
rhs
IRtnpofTn1696
Fig. 1. (Continued))
Tn1696, with IRtnp disrupted by IS5075, whilst IRmer being intact.
Direct repeats of 5 bp (AATCT; DR5) were found at the boundaries
of Tn1696, suggesting its transposition into the pEcl-Gr4873 back-
bone.
4. Discussion
This is the first report on complete nucleotide sequences of
IncA/C2 plasmids carrying In416-like integrons, observed in Italy,
the United Arab Emirates and Greece [8,15,17]. Of note, plasmid
analysis did not justify the hypothesis that the same type of IncA/C2
plasmids carrying In416-like elements circulate among different
species. However, sequencing revealed that pKP-Gr642 and pKPGr8143
of K. pneumoniae ST383, encoding VIM-19 and CMY-4
␤-lactamases, are very similar to each other and probably are close
derivatives of the previously described and partially sequenced
pCC416 from Italy [15]. In addition, the complete sequence of pKPGr642
suggested that a common progenitor of the pCC416-like
plasmids might be a type 1 IncA/C2 plasmid, having the blaCMY-2like,
ARI-B and ARI-A resistance islands, like pUMNK88 161 [5]. At a
certain step, a pUMNK88 161-like molecule has evolved via in situ
gain and/or loss of transposons, insertion sequences and resistance
genes, including a blaVIM-like gene cassette. The pCC416-like plasmids
evolved further through rearrangements facilitated by mobile
elements such as IS26.
On the other hand, pEcl-Gr4873, encoding VIM-1 only, carried
none of the blaCMY-2-like, ARI-B and ARI-A regions. In addition, the
plasmid backbone of pEcl-Gr4873 showed extensive similarity to
type 2 IncA/C2 MDR plasmids [2], like pR55 [20]. Considering also
the different insertion sites of the resistance island in pEcl-Gr4873
and of the ARI-A in pCC416-like molecules, it is clear that the
In416-like-carrying regions appeared in the two distinct IncA/C2
lineages by two different acquisition events. Of note, the presence
of the intact 3 CS upstream of ISPa21 suggested that In4873
might be a forerunner of In416-like integrons found in pCC416-like
plasmids.
162 C.C. Papagiannitsis et al. / International Journal of Antimicrobial Agents 47 (2016) 158–162
These findings, in addition to recent reports describing the
epidemic emergence of the blaNDM-1 carbapenemase gene in
Enterobacteriaceae associated with IncA/C2 plasmids [2,3], underscore
the rapid evolution of these molecules. Being of broad host
range and serving as reservoirs of various resistance genes, they
will likely create challenges to human and animal health by limiting
therapeutic options in cases of infection with a carrier organism.
Acknowledgments
The authors are very grateful to H. Giamarellou (Attikon General
Hospital, Athens, Greece) and G.L. Petrikkos (Laikon General Hospital,
University of Athens, Athens, Greece) for their participation
in the EU project MOSAR, during which the Kpn-8143 and Ecl-4873
isolates were identified [8]. The authors thank A. Baraniak, J. Fiett
and M. Herda (National Medicines Institute, Warsaw, Poland) for
their assistance. The authors also thank the curator team of the
Institute Pasteur (Paris, France) for curating the MLST data of K.
pneumoniae and making them publicly available.
Funding: This work was supported by the Ministry of Health
of the Czech Republic [grant 15-28663A], the Czech Ministry of
Education [grant LQ1601], the Czech Science Foundation [grant
15-14683Y/P502] and the Charles University Research Fund [grant
P36].
Competing interests: None declared.
Ethical approval: Not required.
References
[1] Carattoli A, Miriagou V, Bertini A, Loli A, Colinon C, Villa L, et al. Replicon
typing of plasmids encoding resistance to newer ␤-lactams. Emerg Infect Dis
2007;12:1145–8.
[2] Harmer CJ, Hall RM. The A to Z of A/C plasmids. Plasmid 2015;80:63–82.
[3] Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, Balakrishnan R,
et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan,
and the UK: a molecular, biological, and epidemiological study. Lancet Infect
Dis 2010;10:597–602.
[4] Fricke WF, Welch EJ, McDermott PF, Mammel MK, LeClerc JE, White DG, et al.
Comparative genomics of the IncA/C multidrug resistance plasmid family. J
Bacteriol 2009;191:4750–7.
[5] Fernández-Alarcón C, Singer RS, Johnson TJ. Comparative genomics of
multidrug resistance-encoding IncA/C plasmids from commensal and
pathogenic Escherichia coli from multiple animal sources. PLoS ONE 2011;
6:e23415.
[6] Miriagou V, Tzelepi E, Gianneli D, Tzouvelekis LS. Escherichia coli with a selftransferable,
multiresistant plasmid coding for metallo-␤-lactamase VIM-1.
Antimicrob Agents Chemother 2003;47:395–7.
[7] Psichogiou M, Tassios PT, Avlamis A, Stefanou I, Kosmidis C, Platsouka E, et al.
Ongoing epidemic of blaVIM-1-positive Klebsiella pneumoniae in Athens, Greece:
a prospective survey. J Antimicrob Chemother 2008;61:59–63.
[8] Papagiannitsis CC, Izdebski R, Baraniak A, Fiett J, Herda M, Hrabák J, et al. Survey
of metallo-␤-lactamase-producing Enterobacteriaceae colonizing patients
in European ICUs and rehabilitation units, 2008–11. J Antimicrob Chemother
2015;70:1981–8.
[9] Miriagou V, Papagiannitsis CC, Kotsakis SD, Loli A, Tzelepi E, Legakis NJ,
et al. Sequence of pNL194, a 79.3-kilobase IncN plasmid carrying the
blaVIM-1 metallo-␤-lactamase gene in Klebsiella pneumoniae. Antimicrob Agents
Chemother 2010;54:4497–502.
[10] Ikonomidis A, Spanakis N, Poulou A, Pournaras S, Markou F, Tsakris A.
Emergence of carbapenem-resistant Enterobacter cloacae carrying VIM-4
metallo-␤-lactamase and SHV-2a extended-spectrum ␤-lactamase in a conjugative
plasmid. Microb Drug Resist 2007;13:221–6.
[11] Pournaras S, Poulou A, Voulgari E, Vrioni G, Kristo I, Tsakris A. Detection of the
new metallo-␤-lactamase VIM-19 along with KPC-2, CMY-2 and CTX-M-15 in
Klebsiella pneumoniae. J Antimicrob Chemother 2010;65:1604–7.
[12] Samuelsen Ø, Toleman MA, Hasseltvedt V, Fuursted K, Leegaard TM, Walsh
TR, et al. Molecular characterization of VIM-producing Klebsiella pneumoniae
from Scandinavia reveals genetic relatedness with international clonal
complexes encoding transferable multidrug resistance. Clin Microbiol Infect
2011;17:1811–6.
[13] Papagiannitsis CC, Kotsakis SD, Petinaki E, Vatopoulos AC, Tzelepi E, Miriagou V,
et al. Characterization of metallo-␤-lactamase VIM-27, an A57S mutant of VIM-
1 associated with Klebsiella pneumoniae ST147. Antimicrob Agents Chemother
2011;55:3570–2.
[14] Pournaras S, Ikonomidis A, Tzouvelekis LS, Tokatlidou D, Spanakis N, Maniatis
AN, et al. VIM-12, a novel plasmid-mediated metallo-␤-lactamase from Klebsiella
pneumoniae that resembles a VIM-1/VIM-2 hybrid. Antimicrob Agents
Chemother 2005;49:5153–6.
[15] Colinon C, Miriagou V, Carattoli A, Luzzaro F, Rossolini GM. Characterization
of the IncA/C plasmid pCC416 encoding VIM-4 and CMY-4 ␤-lactamases. J
Antimicrob Chemother 2007;60:258–62.
[16] Shevchenko OV, Mudrak DY, Skleenova EY, Kozyreva VK, Ilina EN, Ikryannikova
LN, et al. First detection of VIM-4 metallo-␤-lactamase-producing Escherichia
coli in Russia. Clin Microbiol Infect 2012;18:E214–7.
[17] Sonnevend Á, Ghazawi A, Yahfoufi N, Al-Baloushi A, Hashmey R, Mathew M,
et al. VIM-4 carbapenemase-producing Enterobacter cloacae in the United Arab
Emirates. Clin Microbiol Infect 2012;18:E494–6.
[18] Griffin HG, Foster TJ, Silver S, Misra TK. Cloning and sequence of the mercuricand
organomercurial-resistance determinants of plasmid pDU1358. Proc Natl
Acad Sci U S A 1987;84:3112–6.
[19] Partridge SR, Hall RM. The IS1111 family members IS4321 and IS5075
have subterminal inverted repeats of Tn21 family transposons. J Bacteriol
2003;185:6371–84.
[20] Doublet B, Boyd D, Douard G, Praud K, Cloeckaert A, Mulvey MR. Complete
nucleotide sequence of the multidrug resistance IncA/C plasmid
pR55 from Klebsiella pneumoniae isolated in 1969. J Antimicrob Chemother
2012;67:2354–60.
Příloha 33
DOBIASOVA, H., KUTILOVA, I., PIACKOVA, V., VESELY, T., CIZEK, A., DOLEJSKA, M., 2014,
Ornamental fish as a source of plasmid-mediated quinolone resistance genes and antibiotic
resistance plasmids: Veterinary Microbiology, v. 171, p. 413-421.
Souhrn
Izoláty Aeromonas spp. z okrasných ryb importovaných do ČR ze zahraničí a z koi kaprů chovaných v ČR byly
vyšetřeny na přítomnost plazmidově determinované rezistence k chinolonům. Izoláty s prokázaným výskytem
PMQR genu byly podrobeny kompletní analýze fenotypu i genotypu a byl testován horizontální přenos PMQR
genů a jejich vazba na MGE. Geny PMQR byly detekovány u obou skupin izolátů, přičemž rozdíly v prevalenci
nebyly statisticky významné. V porovnání s izoláty z koi kaprů vykazovaly izoláty z okrasných ryb z dovozu vyšší
hodnoty MIC k chinolonům, byly multirezistentní a spektrum genů rezistence a integronů bylo rovněž vyšší.
Studie upozorňuje na rizika spojená s chovem a dovozem okrasných ryb v šíření multirezistentních bakterií do
prostředí a ke člověku.
Ornamental fish as a source of plasmid-mediated quinolone
resistance genes and antibiotic resistance plasmids
Hana Dobiasova a,b
, Iva Kutilova a
, Veronika Piackova c
, Tomas Vesely d
,
Alois Cizek b,e
, Monika Dolejska a,b,
*
a
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical
Sciences Brno, Palackeho tr. 1/3, 612 42 Brno, Czech Republic
b
CEITEC VFU, University of Veterinary and Pharmaceutical Sciences Brno, Palackeho tr. 1/3, 612 42 Brno, Czech Republic
c
South Bohemian Research Center of Aquaculture and Biodiversity of Hydrocenoses, Faculty of Fisheries and Protection of Waters,
University of South Bohemia in Ceske Budejovice, Zatisi 728/II, 389 25 Vodnany, Czech Republic
d
Veterinary Research Institute, Hudcova 296/70, 621 00 Brno, Czech Republic
e
Department of Infectious Diseases and Microbiology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical
Sciences, Brno, Czech Republic
1. Introduction
Intensive fish farming has resulted in increasing
problems of bacterial diseases leading to the subsequent
heavy use of antibiotics (Cabello et al., 2013). Over 1 billion
ornamental fish are traded globally each year (Whittington
and Chong, 2007). Several public health concerns have
Veterinary Microbiology 171 (2014) 413–421
A R T I C L E I N F O
Keywords:
Aeromonas
Ornamental fish
Quinolone resistance
Plasmids
A B S T R A C T
Growing ornamental fish industry is associated with public health concerns including
extensive antibiotic use accompanied by increasing antibiotic resistance. The aim of this
study was to analyze Aeromonas isolates from imported tropical ornamental fish and
coldwater koi carps bred in the Czech Republic to assess the potential risk of ornamental
fish as a source of plasmid-mediated quinolone resistance genes (PMQR) and antibiotic
resistance plasmids. A collection of Aeromonas spp. with reduced susceptibility to
ciprofloxacin (MIC ! 0.05 mg/L) was selected for the detection of PMQR genes. Isolates
harbouring PMQR genes were further analyzed for the additional antibiotic resistance,
integron content, clonality, biofilm production and transferability of PMQR genes by
conjugation and transformation.
Comparative analysis of plasmids carrying PMQR genes was performed. Fifteen (19%,
n = 80) isolates from koi carps and 18 (24%, n = 76) isolates from imported ornamental fish
were positive for qnrS2, aac(60
)-Ib-cr or qnrB17 genes. PMQR-positive isolates from
imported ornamental fish showed higher MIC levels to quinolones, multiresistance and
diverse content of antibiotic resistance genes and integrons compared to the isolates from
the carps. Related IncU plasmids harbouring qnrS2 and aac(60
)-Ib-cr genes were found in
Aeromonas spp. from imported ornamental fish and koi carps from various geographical
areas. Ornamental fish may represent a potential source of multiresistant bacteria and
mobile genetic elements for the environment and for humans.
ß 2014 Elsevier B.V. All rights reserved.
* Corresponding author at: Department of Biology and Wildlife
Diseases, Faculty of Veterinary Hygiene and Ecology, University of
Veterinary and Pharmaceutical Sciences Brno, Palackeho tr. 1/3, 612 42
Brno, Czech Republic. Tel.: +420 541 562 643; fax: +420 541 562 631.
E-mail address: m.dolejska@centrum.cz (M. Dolejska).
Contents lists available at ScienceDirect
Veterinary Microbiology
journal homepage: www.elsevier.com/locate/vetmic
http://dx.doi.org/10.1016/j.vetmic.2014.02.011
0378-1135/ß 2014 Elsevier B.V. All rights reserved.
been associated with the ornamental fish industry such as
the transmission of zoonotic pathogens to humans and
terrestrial animals, antimicrobial use practices and antibiotic
resistance (Lupo et al., 2012; Weir et al., 2012). The
ornamental fish producers tend to administer antibiotics for
a prophylactic or preventive treatment in order to decrease
the bacterial disease outbreaks while fish are recovering
from harvesting and handling and to increase their survival
during shipment. Excessive or incorrect use of a prophylactic
treatment can increase selection and facilitate the
spread of antibiotic-resistant bacteria (Weir et al., 2012).
Specific antibiotics as nitrofurans, quinolones and oxytetracycline
are commonly used in the ornamental fish trade.
Quinolones are broad-spectrum antimicrobial agents
widely used in both human and veterinary medicine and
they are among the most widely used antibiotics in the
aquacultures (Smith, 2008). Their extensive use has been
associated with worldwide increasing quinolone resistance.
Resistance to quinolones is mediated by specific
chromosomal mutations or by plasmid-mediated quinolone
resistance (PMQR) genes that play an important role
in dissemination of quinolone resistance via horizontal
gene transfer (HGT; Strahilevitz et al., 2009). PMQR
determinants include Qnr proteins, aac(60
)-Ib-cr and efflux
pumps and confer high level of resistance to nalidixic acid
and low level fluoroquinolone resistance in bacteria
according to CLSI breakpoints. However, the presence of
PMQR can facilitate the emergence of high level fluoroquinolone
resistance via mutations in DNA gyrase and
topoisomerase IV genes gyrA and parC (Cattoir et al., 2008;
Verner-Jeffreys et al., 2009; Han et al., 2012a,b).
Aeromonads are suitable indicator bacteria for studying
the incidence and development of antibiotic resistance in
aquacultures (Naviner et al., 2011). These bacteria are
interconnected within the water ecosystem, colonize fish
and can cause various infections. Antibiotic resistance in
Aeromonas spp. from imported ornamental fish is of high
concern for public health (Verner-Jeffreys et al., 2009;
Sreedharan et al., 2012). Aeromonas spp. have been proven
to cause human infections (Parker and Shaw, 2011).
The greatest potential public health risk linked with
extensive antimicrobial use in aquaculture is the development
of reservoirs of antibiotic resistance genes in
aquatic ecosystems from where such genes can be spread
by HGT to other bacteria including human pathogens
(Lupo et al., 2012). There is limited information on mobile
genetic elements transferring quinolone-resistance genes
in Aeromonas from ornamental fish (Verner-Jeffreys et al.,
2009; Han et al., 2012a,b). The aim of this study was to
analyze Aeromonas isolates from imported tropical ornamental
fish and coldwater koi carps bred in the Czech
Republic to assess the potential risk of ornamental fish as a
source of plasmid-mediated quinolone resistance genes
and antibiotic resistance plasmids.
2. Material and methods
2.1. Bacterial isolates
A collection of 156 Aeromonas spp. isolates originating
from tropical freshwater ornamental fish (76 isolates) and
coldwater ornamental (koi) carps (80 isolates) was analyzed
in this study. Koi carpisolates were gained from gills and skin
swabsof euthanized healthyfishon7farmsin2005and2006
(Cizek et al., 2010). Tropical freshwater ornamental fish were
sampled in a wholesale distributor (Hodonin, Czech Republic)
during their health inspection after they arrived to the
Czech Republic from Vietnam, Thailand, China, Slovakia,
Brazil and Peru between 2005 and 2007. Fish were kept and
transported in their original carriage water in sealed bags in
polystyrene boxes. The samples were obtained from skin,
gills and body cavity swabs of diseased fish. All samples were
cultivated on Columbia agar (CM331; Oxoid Ltd., Basingstoke,
UK) supplemented with 5% sheep blood and suspect
Aeromonas cultures were identified as described elsewhere
(Cizek et al., 2010). Susceptibility to ciprofloxacin (0.015–
128 mg/L) of all Aeromonas isolates was determined by agar
dilution method in accordance with Clinical and Laboratory
Standard Institute (CLSI, 2006, 2008). Quality control was
done using reference strains Escherichia coli ATCC 25922 and
Aeromonas salmonicida spp. salmonocida ATCC 33658.
2.2. Detection of PMQR genes and characterization of PMQRpositive
isolates
Isolates with minimum inhibitory concentration (MIC)
to ciprofloxacin !0.05 mg/L were selected for the detection
of PMQR genes (qnrA, qnrB, qnrC, qnrD, qnrS, aac(60
)-Ib-cr,
qepA, oqxAB) using PCR followed by sequencing (Literak
et al., 2012). Isolates positive for PMQR genes were further
characterized. Susceptibility to 8 antibiotics (chloramphenicol,
gentamicin, nitrofurantoin, florfenicol, oxytetracycline,
sulfonamides cp., sulfamethoxazole/trimethoprim,
trimethoprim) was determined by disc diffusion method
(CLSI, 2006). The selection of the tested antibiotics is based
on their approved common use (e.g. tetracycline) or offlabel
use (e.g. chloramphenicol) in food or ornamental fish
farming. The isolates were tested for tetracycline resistance
genes tet(A), tet(B), tet(C), tet(D), tet(E), chloramphenicol
resistance genes catA1, cmlA and floR, sulfonamide resistance
genes sul1, sul2, sul3, beta-lactamase gene blaOXA-1, the
class 1 and class 2 integrase genes intI1 and intI2,
respectively, the variable region of class 1 integrons and
gene cassettes inside the integron structure (Wilkerson
et al., 2004; Dolejska et al., 2007). Clonality of the isolates
was examined by XbaI digestion and pulsed-field gel
electrophoresis (PFGE). Restriction profiles were analyzed
using BioNumerics fingerprinting software (Applied Maths,
Belgium). Cluster analysis of the dice similarity indices was
done to generate a dendrogram describing the relationships
among PFGE profiles. Isolates were considered to be related
andtobelongtothe samePFGEclusteriftheirDicesimilarity
indices were !85%. Letters were used to discriminate PFGE
patterns assigned to the same cluster. Biofilm production
was tested using crystal violet biofilm assay (Genevaux
et al., 1996) and all tested isolates were assigned to one of
the four categories based on their adherence capabilities
(non-adherent, weakly, moderately and strongly adherent
strains) according to Stepanovic´ et al. (2000). MICs to
nalidixic acid (NA), oxolinic acid (OA), flumequine (UB) and
enrofloxacin (ENR) were determined by agar dilution
method (CLSI, 2006, 2008).
H. Dobiasova et al. / Veterinary Microbiology 171 (2014) 413–421414
2.3. Transferability of PMQR genes
Conjugative transfer of plasmids carrying PMQR genes
was tested. Plate-mating experiments were performed
using plasmid-free, rifampicin- and sodium azide-resistant
E. coli and Aeromonas sp. recipient strains at 28 8C and
37 8C. Plasmid DNA from Aeromonas strains was isolated by
the alkaline extraction procedure and introduced to
competent E. coli DH5a (Invitrogen, USA) by chemical
transformation followed by selection of transformants on
Luria Bertani agar (Difco, USA) supplemented with
ciprofloxacin (0.05 mg/L). The presence of the relevant
PMQR gene in transformants was confirmed by PCR. Cotransfer
of other antibiotic resistance genes and integrons
was tested. The sizes of plasmids carrying PMQR genes in
donors and transformants were determined by S1 nucle-
ase-PFGE.
2.4. Analysis of plasmids harbouring PMQR genes
Only PMQR-positive transformants carrying a single
plasmid were further analyzed. Plasmids were replicontyped
(Carattoli et al., 2005; Cattoir et al., 2008). Plasmid
DNA from transformants was transferred to a positively
charged nylon membrane (Biodyne1
B, Pall Corporation,
USA) by Southern blot and hybridized with qnrS2, aac(60
)-Ibcr
and IncU rep gene probes labelled with DIG-11-dUTP by
PCR using PCR DIG Probe Synthesis Kit (Roche Diagnostics,
Germany). Detection of hybridizations was performed using
the DIG Wash and Block Buffer Set (Roche Diagnostics). All
plasmids were analyzed by restriction fragment length
polymorphism (RFLP) using the HincII (Takara, Otsu, Japan)
or AluI (Takara) restriction enzymes. Digested fragments
were separated by electrophoresis in a 1% agarose gel for
14 h at 67 V/cm. Letters were used to discriminate RFLP
patterns. Restricted plasmids belonging to IncU were
transferred by Southern blot and hybridized with qnrS2,
aac(60
)-Ib-cr and IncU rep gene probes. PCR screening and
sequencing were used to determine the surrounding region
of the qnrS2 gene using primers targeting qnrS (qnrS FW 50
-
GCAAGTTCATTGAACAGGGT-30
; qnrS RV 50
-TCTAAACCGTC-
GAGTTCGGCG-30
) and a putative zinc-metalloprotease gene
mpR (mpR FW 50
-CTTACGACGAACTACAGCGG-30
; mpR RV
50
-CATCCAACTGATCCGATAGTC-30
). IncU plasmid P2G1
(GenBank accession no. HE616910) from Aeromonas spp.
harbouringqnrS2wasusedasareferencesequencetodesign
the primers targeting the mpR gene.
2.5. Data analysis
The results obtained were statistically evaluated by chisquare
test using MS Excel software with the Analyze-it
module. Differences with p 0.05 were considered as
significant.
3. Results and discussion
3.1. Antimicrobials in ornamental fish farming
The use of antibiotics in aquacultures in developed
countries has been restricted to avoid potential selection
of human pathogens resistant to antimicrobials effective
in clinical practices (Cabello, 2006). In the Czech Republic
oxytetracycline and flumequine are permitted for therapeutic
usage in aquacultures. However, the situation is
more problematic in countries where such regulations
are less stringent or even missing and various antimicrobial
substances are used in aquacultures in
uncontrolled manner. Some of these countries include
important world producers of ornamental fish. The Czech
Republic imports live ornamental fish from sources as
diverse as Vietnam, Indonesia, Malaysia, China, Singapore,
Thailand, Nigeria and Peru. Given the stress during
air transport, antimicrobials and chemical additives are
routinely added to the transport water to prevent the
growth of potential pathogens (Cole et al., 1999).
Considering the widespread use of quinolones in aquacultures
and their importance for human health, Aeromonas
spp. harbouring plasmid-mediated quinolone
resistance originated from imported ornamental fish
and koi carps bred in the Czech Republic were the focus of
this study.
3.2. Aeromonas from ornamental fish shows high prevalence
of qnrS2 gene
Thirty-six (45%, n = 80) Aeromonas isolates from koi
carps and 76 (n = 76, 100%) from imported ornamental
fish showed decreased susceptibility to ciprofloxacin
(MIC ! 0.05 mg/L). These isolates were selected for
detection of PMQR genes using PCR followed by
sequencing. Fifteen (19%, n = 80) isolates from koi carps
and 18 (24%, n = 76) isolates from imported ornamental
fish were positive for at least one PMQR gene. The gene
qnrS2 was the most prevalent followed by aac(60
)-Ib-cr
and qnrB17 (Table 1). Twelve isolates contained two
or three PMQR genes and the combination of
qnrS2 + aac(60
)-Ib-cr was frequently observed. No significant
difference in prevalence of PMQR genes between
carps and imported ornamental fish was observed
(p ! 0.05). All PMQR-positive isolates were identified
as species complexes based on phenotypic testing
criteria (Cizek et al., 2010): Aeromonas hydrophila (17
isolates), Aeromonas sobria (15) and one isolate belonged
to A. hydrophila/sobria. Clonal relatedness of all 33
Aeromonas isolates carrying PMQR genes was tested by
XbaI-PFGE. The isolates were divided into 5 clusters (AE)
based on their restriction profiles. Clonally related
isolates from tropical ornamental fish and koi carps were
found (Table 1).
The gene qnrS2 in quinolone-resistant Aeromonas
isolates from ornamental fish has been identified previously
(Han et al., 2012a,b; Verner-Jeffreys et al., 2009).
High (37%) prevalence of qnrS2 gene was reported in
Aeromonas spp. from imported cold- and warmwater
ornamental fish and their carriage water in UK (VernerJeffreys
et al., 2009). Aeromonas harbouring qnrS2 is
isolated from diverse aquatic environment (Cattoir et al.,
2008; Pica˜o et al., 2008) but also from human infections
(Arias et al., 2010) indicating the wide distribution of this
gene in population of aeromonads in different sources and
geographical areas.
H. Dobiasova et al. / Veterinary Microbiology 171 (2014) 413–421 415
Table 1
Aeromonas isolates from imported tropical ornamental fish and koi carps harbouring PMQR genes.
Isolate Species
complexa
Originb
PFGEc
PMQR genes MIC (mg/mL)d
Antibiotic
resistance
phenotypee
Additional
antibiotic
resistance genes
Integron
size (kb)f
Gene cassettes TFg
NA UB OA ENR CIP
Tropical fish N42 A.
sobria
Vietnam NT qnrS2,
aac(60
)-Ib-cr
512 128 64 64 >128 C, CN, OT, S3,
SXT, T
sul1, tet(B) – dfrA12-aadA2 +
CH10 A. sobria Vietnam D2 qnrS2, aac(60
)-Ib-cr 512 128 64 >64 >128 C, FFC, OT,
S3, SXT, T
sul1, sul2, tet(B),
floR
– dfrA12-aadA2 +
CH11 A. sobria Vietnam D1 qnrS2, aac(60
)-Ib-cr 512 128 128 >64 >128 C, FFC, OT, S3,
SXT, T
sul1, sul2, tet(B),
floR
– dfrA12-aadA2 +
CH12 A. sobria Thailand D1 qnrS2, aac(60
)-Ib-cr 512 128 128 >64 >128 C, FFC, OT, S3,
SXT, T
sul1, sul2, tet(B),
floR
– dfrA12-aadA2 +
CH13 A. sobria Thailand NT qnrS2, aac(60
)-Ib-cr 256 128 32 64 128 C, FFC, OT, S3,
SXT, T
sul1, tet(B), floR,
blaOXA-1
– dfrA12-aadA2 +
CH20 A. sobria Vietnam NT qnrS2, qnrB17,
aac(60
)-Ib-cr
256 128 32 64 128 C, FFC, OT, S3,
SXT, T
sul1, sul2, tet(B),
floR
– dfrA12-aadA2 À
CH21 A. sobria Thailand NT qnrS2 512 128 32 32 64 C, CN, OT, S3,
SXT, T
sul1, tet(B) 0.75; – dfrA22;
dfrA12-aadA2
+
CH26/1 A. hydrophila Thailand A1 qnrS2 512 128 32 32 64 C, CN, FFC, OT,
S3, SXT, T
sul1, tet(D), floR 2 dfrA12-aadA2 +
CH31 A. hydrophila Vietnam A1 qnrS2 512 128 32 32 64 C, CN, FFC, OT,
S3, SXT, T
sul1, tet(D), floR 2 dfrA12-aadA2 +
CH36 A. hydrophila/
sobria
Vietnam A2 qnrS2 >512 >256 >128 >64 >128 C, FFC, S3,
SXT, T
sul1, tet(D), floR 2.4 arr3-aacA4-
dfrA1-orf
+
CH38 A. hydrophila Vietnam A3 qnrS2 512 256 >128 >64 >128 OT tet(E) – – +
CH39 A. hydrophila Vietnam A3 qnrS2 512 256 128 >64 >128 C, FFC, OT, S3,
SXT, T
sul1 – – +
CH40 A. hydrophila Vietnam B2 qnrS2 >512 256 >128 >64 >128 C, FFC, OT, S3,
SXT, T
sul1, tet(B), floR 2; 2.4 dfrA12-aadA2;
arr3-aacA4-
dfrA1-orf
À
CH44 A. hydrophila Vietnam B1 qnrS2 >512 256 >128 >64 >128 C, FFC, OT, S3,
SXT, T
sul1, tet(B), floR 2; 2.4 dfrA12-aadA2;
arr3-aacA4-
dfrA1-orf
À
CH45 A. hydrophila Vietnam B1 qnrS2 >512 256 >128 >64 >128 C, FFC, OT, S3,
SXT, T
sul1, tet(B), floR 2; 2.4 dfrA12-aadA2;
arr3-aacA4-
dfrA1-orf
À
CH47 A. hydrophila Slovakia B1 qnrS2 >512 256 >128 >64 >128 OT, S3, SXT, T sul1, tet(B),
tet(E), floR
–; 1.3 dfrA12-aadA2;
arr3-dfrA27
À
CH48 A. hydrophila Slovakia D3 qnrS2 256 64 32 16 32 OT, S3, SXT, T sul1, sul2,
tet(B), floR
2 orf-aadA1 À
CH59 A. sobria Singapore NT qnrS2,
aac(60
)-Ib-cr
256 128 64 64 >128 C, FFC, OT, S3,
SXT, T
sul1, tet(B),
blaOXA-1
– dfrA12-aadA2 À
H.Dobiasovaetal./VeterinaryMicrobiology171(2014)413–421416
Koi carps 4 A. hydrophila A (2005) A5 qnrS2, aac(60
)-Ib-cr 128 32 16 4 8 – – – – +
6 A. hydrophila A (2005) A4 qnrS2, aac(60
)-Ib-cr 128 64 16 4 8 – – – – +
7 A. hydrophila A (2005) A4 qnrS2, aac(60
)-Ib-cr 128 32 16 4 8 – – – – +
10 A. hydrophila A (2005) A5 qnrS2, aac(60
)-Ib-cr 128 32 16 4 4 – – – – +
93 A. sobria C (2005) NT qnrS2 128 4 4 1 0.25 OT tet(B) – – +
224 A. sobria A (2006) NT qnrS2 128 32 8 4 4 S3 sul1, tet(A) 1 qacD2-orf +
225 A. hydrophila A (2006) NT qnrS2 256 32 8 16 8 – – – – +
227 A. hydrophila A (2006) E qnrS2 512 64 16 16 8 C, OT tet(E) – – +
228 A. sobria A (2006) C3 qnrS2 512 32 8 4 4 OT tet(E) – – +
231 A. sobria A (2006) C2 qnrS2 128 32 8 2 4 OT, S3, SXT tet(E) – – +
232 A. sobria A (2006) C1 qnrS2 512 64 16 16 4 OT, S3, SXT, T sul1, tet(D) 2 dfrA12-aadA2 +
233 A. sobria A (2006) C1 qnrS2 512 64 16 16 4 OT, S3, SXT, T sul1, tet(D) 2 dfrA12-aadA2 +
236 A. sobria A (2006) C4 qnrS2 512 32 64 16 8 C, OT, S3, SXT, T sul1, tet(E) 1.6 dfrB1-aadA1 +
240 A. hydrophila B (2006) C5 qnrS2 512 32 8 4 4 OT – – – +
250 A. hydrophila B (2006) A6 qnrS2, aac(60
)-Ib-cr 256 32 16 1 1 – – – – +
a
Identification as species complexes based on phenotypic testing criteria (Cizek et al., 2010).
b
Aeromonas isolates originated from 7 koi carp farms in the Czech Republic designed as A-G. Isolates positive for PMQR genes were found only in three farms A, B and C. The year of the isolation is indicated in
brackets.
c
Isolates were considered to be related and to belong to the same PFGE cluster designed by letter A-E if their Dice similarity indices were !85%. Isolates that belonged to the same cluster but showed one or more
band differences in PFGE pattern were distinguished by numbers (e.g. A1, A2, etc.). NT, isolates non-typeable by XbaI-PFGE.
d
MIC, minimal inhibitory concentration; NA, nalidixic acid; UB, flumequine; OA, oxolinic acid; ENR, enrofloxacin; CIP, ciprofloxacin.
e
C, chloramphenicol; CN, gentamicin; FFC, florfenicol; OT, oxytetracycline; S3, sulfonamides cp.; SXT, sulfamethoxazole/trimethoprim; T, trimethoprim.
f
Size of variable region amplified using primers 50
CS and 30
CS (Dolejska et al., 2007) targeting 50
- and 30
-conservative region of class 1 integrons is indicated in kb. Some class 1 integrons showed negative results
of PCR amplification but PCR mapping using primers targeting 50
-conservative region and variable region (gene cassettes dfrA12 and aadA2) was positive. À, conservative region of class 1 integron was not detected
by PCR using 5’CS and 3’CS primers.
g
TF, transfer of PMQR genes to E. coli recipients using chemical transformation; +, positive; À, negative.
H.Dobiasovaetal./VeterinaryMicrobiology171(2014)413–421417
3.3. Multiresistance and diverse integrons in Aeromonas from
imported ornamental fish
Isolates showed variable MIC levels to ciprofloxacin
(0.25 – >128 mg/L); those from tropical ornamental fish
showed higher MIC levels (64 – >128 mg/L) than isolates
from koi carps (0.25–8 mg/L). These MIC levels exceeding
CLSI breakpoints might indicate the presence of chromosomal
mutations in topoisomerase genes (Strahilevitz
et al., 2009). PMQR-positive Aeromonas spp. from
imported ornamental fish showed higher MIC levels to
all tested quinolones, multiresistance phenotypes, more
diverse set of antibiotic resistance genes and integrons in
contrast to koi carp isolates (Table 1). The results may
indicate that various antibiotics in more extensive
manner are used in imported ornamental fish than koi
carps that were bred in the Czech Republic and therefore
subjected to antibiotic use restriction applied in this
country. Additional resistance to chloramphenicol, florfenicol,
oxytetracycline, sulfamethoxazole and trimethoprim
was common in isolates from imported ornamental
fish which are antimicrobials commonly used in fish
farming, especially in developing countries. Relevant
genes conferring resistance to these antimicrobials were
detected (Table 1).
Most (89%) isolates from imported tropical ornamental
fish contained a variable set of class 1 integrons
with antibiotic resistance gene cassettes and five of them
harboured two different types of class 1 integrons
(Table 1). Similarly, Verner-Jeffreys et al. (2009) have
demonstrated that 50% Aeromonas isolates from
imported ornamental fish in UK possessed class 1
integrons. In our study, all integron-positive isolates
contained sulfonamide resistance gene sul1 as an
essential part of class 1 integrons. Gene cassettes dfrA12
and aadA2 were the most prevalent and were identified in
16 isolates. These gene cassettes are commonly reported
in Aeromonas from aquatic environments but also from
humans (Lee et al., 2008; Lukkana et al., 2012). In nine
isolates positive for dfrA12 and aadA2 genes PCR reaction
using primers targeting 50
and 30
conservative region of
class 1 integron (50
CS and 30
CS primers) was negative.
PCRs using combination of primers targeting 50
conservative
region of class 1 integron with dfrA12 or aadA2
gene cassettes were positive. The results indicate a
mutation in 30
region of these integrons. Such atypical
integrons have been previously reported in aeromonads
from ornamental fish in Thailand (Lukkana et al., 2012).
Integrons with unusual structure harbouring rifampicin
resistance gene arr3 along with aminoglycoside and
trimethoprim resistance gene cassettes aacA4 and dfrA1,
respectively, were identified in isolates from imported
ornamental fish. These integrons showed !99% homology
to an integron described in Vibrio cholerae
(AB219236). Rifampicin is commonly used for the
treatment of mycobacterial infections in humans including
the cases of Mycobacterium marinum infection
associated with ornamental fish exposure (Tigges et al.,
2009). The presence of rifampicin resistance genes in
ornamental fish may represent a possible risk for public
health.
3.4. Biofilm formation and the role of horizontal gene transfer
in aquatic environments
All Aeromonas isolates carrying PMQR genes from both
imported ornamental fish and koi carps examined in our
study showed ability to form biofilm. According to the
Table 2
Characterization of PMQR-harbouring plasmids in transformants from Aeromonas isolates originating from imported tropical ornamental fish and koi carps.
Isolate Species complexa
Originb
PFGEc
Location of PMQR and AR genesd
RFLPe
N42 A. sobria Tropical fish (Vietnam) NT IncU (20 kb): qnrS2, aac(60
)-Ib-cr a
CH10 A. sobria Tropical fish (Vietnam) D2 IncU (20 kb): qnrS2, aac(60
)-Ib-cr a
CH11 A. sobria Tropical fish (Vietnam) D1 IncU (20 kb): qnrS2, aac(60
)-Ib-cr a
CH12 A. sobria Tropical fish (Thailand) D1 IncU (20 kb): qnrS2, aac(60
)-Ib-cr a
4 A. hydrophila Koi carp (farm A) A5 IncU (20 kb): qnrS2, aac(60
)-Ib-cr a
6 A. hydrophila Koi carp (farm A) A4 IncU (20 kb): qnrS2, aac(60
)-Ib-cr a
7 A. hydrophila Koi carp (farm A) A4 IncU (20 kb): qnrS2, aac(60
)-Ib-cr a
10 A. hydrophila Koi carp (farm A) A5 IncU (20 kb): qnrS2, aac(60
)-Ib-cr a
CH21 A. sobria Tropical fish (Thailand) NT IncU (35 kb): qnrS2, sul1, Int 0.75 kb: dfrA22 b
227 A. hydrophila Koi carp (farm A) E IncU (40 kb): qnrS2 c
CH31 A. hydrophila Tropical fish (Vietnam) A1 NT (<20 kb): qnrS2 d
CH36 A. hydrophila/sobria Tropical fish (Vietnam) A2 NT (<20 kb): qnrS2 e
CH26/1 A. hydrophila Tropical fish (Thailand) A1 NT (<20 kb): qnrS2 e
CH38 A. hydrophila Tropical fish (Vietnam) A3 NT (<20 kb): qnrS2 f
CH39 A. hydrophila Tropical fish (Vietnam) A3 NT (<20 kb): qnrS2 g
93 A. sobria Koi carp (farm C) NT NT (<20 kb): qnrS2 h
224 A. sobria Koi carp (farm A) NT NT (<20 kb): qnrS2 i
a
Identification as species complexes based on phenotypic testing criteria (Cizek et al., 2010).
b
Isolates were obtained from Tropical fish (country of origin is given in the brackets) and Koi carp farm A and C in the Czech Republic.
c
Isolates were considered to be related and to belong to the same PFGE cluster designed by letter A-E if their Dice similarity indices were !85%. Isolates
that belonged to the same cluster but showed one or more band differences in PFGE pattern were distinguished by numbers (e.g. A1, A2, etc.). NT, isolates
non-typeable by XbaI-PFGE.
d
PMQR and other antibiotic resistance genes were located on IncU and non-typeable plasmids. Size of plasmids (in kb) is shown in the brackets; AR,
antibiotic resistance; Int, class 1 integron including the size of variable region and a gene cassette.
e
RFLP, restriction fragment length polymorphism profiles of plasmid DNA obtained by HincII (IncU plasmids) and AluI (NT, non-typeable plasmids)
digestion. Identical RFLP paterns of IncU plasmids are indicated by letters a–c. RFLP profiles of non-typeable plasmids are differentiated by letters d–i.
H. Dobiasova et al. / Veterinary Microbiology 171 (2014) 413–421418
classification proposed by Stepanovic´ et al. (2000), 48%
(n = 16) and 52% (n = 17) Aeromonas isolates were weakly
and moderately adherent, respectively. Biofilm matrix
with high density of bacteria concentrated in a limited
place may represent a suitable environment for HGT
processes in aquatic ecosystems (Lupo et al., 2012). HGT
and recombination of antibiotic resistance genes and
mobile genetic elements between different bacterial
species are promoted under selective pressure including
residual and subinhibitory antimicrobial concentrations of
tetracyclines and quinolones in sediments (Kruse and
Sørum, 1994). Quinolones are slowly degraded and are
well-known inducers of mutagenesis and antimicrobial
tolerance (Blazquez et al., 2012). In our study, PMQR genes
from 79% Aeromonas isolates were transferred to recipient
E. coli cells by chemical transformation. Despite the
method used, Huddleston et al. (2013) demonstrated that
Aeromonas spp. belong to naturally transformable bacteria
and 73% and 100% of tested aeromonads could act as a
recipients and donors of DNA, respectively. Aeromonas may
play an important role in the dissemination of antibiotic
resistance genes and resistance plasmids in aquatic
environment. Conjugative transfer to recipient cells of
Aeromonas spp. and E. coli was not successful. Low
conjugative ability of Aeromonas plasmids has been
demonstrated (Cattoir et al., 2008).
3.5. IncU plasmids as vectors of quinolone resistance in
aquatic environment
A total of 17 transformants harbouring a single plasmid
were obtained for further comparative analyses (Table 2).
In seven transformants the gene qnrS2 was presented on
small plasmids of different RFLP profiles designed as
untypeable by the methods used. Small IncQ and ColE-type
plasmids have been demonstrated to be involved in the
dissemination of qnrS2 gene in Aeromonas isolates in
aquatic environments (Han et al., 2012a,b). However, any
PCR-based typing scheme for IncQ and ColE plasmids from
aquatic bacteria has not been proposed up to now. In most
transformants PMQR genes were found to be associated
with plasmids of IncU family. IncU plasmids of 20 kb in size
harbouring qnrS2 and aac(60
)-Ib-cr genes showing identical
RFLP patterns were identified in Aeromonas strains from
both koi carps from the Czech Republic and ornamental
fish imported from Vietnam and Thailand (Table 2, Fig. 1).
Hybridization experiments of these plasmids showed the
location of qnrS2, aac(60
)-Ib-cr and IncU rep gene on
particular DNA fragments. Two strains (CH21, 227)
contained 35 and 40 kb IncU plasmids that showed
differences in PMQR gene content, RFLP patterns and
location of IncU rep and qnrS2 gene compared to the 20-kb
IncU plasmids (Table 2, Fig. 1). PCR mapping of the qnrS2
surrounding regions was performed in all transformants
harbouring IncU plasmids. The gene qnrS2 in isolates was
inserted within the mpR gene encoding a putative zincmetalloprotease
as found in p37 and p42 IncU plasmids
from Aeromonas punctata (EU439940) and Aeromonas
media (EU439941), respectively. In transformants of
tropical ornamental fish and koi carp (isolates no. CH21
and 227) the qnrS2 region showed 100% identity to the
reference sequences p37 and p42. In the remaining IncU
plasmids, PCR mapping of the region flanking the 50
end of
the qnrS2 failed while the region surrounding the qnrS2 at
30
end showed 100% homology to p37 and p42. The results
indicate a different structure of qnrS2 upstream region in
these plasmids such as an insertion of other genes
separating qnrS2 from 50
end of mpR gene and resulting
in failure of PCR amplification.
Members of the IncU plasmid group are implicated
particularly in the dissemination of antibiotic resistance in
Aeromonas strains associated with fish and aquatic
environments (Sørum et al., 2003; Cattoir et al., 2008).
Fig. 1. HincII restriction profiles of IncU plasmids. Letters used at the
heading of the picture represent particular RFLP patterns of IncU plasmids
(a–c). Plasmids showing identical RFLP patterns are designed by the same
letter. Restriction fragments identified by DIG-11-dUTP-labelled probes
used for hybridization experiments are indicated with arrows in
representative plasmids showing different RFLP patterns a–c. Probes
targeted sequences of qnrS2, aac(60
)-Ib-cr and IncU rep genes. Two
restriction fragments were expected for the hybridization with IncU rep
probe, since this gene contains an internal HincII restriction site. Plasmid
DNA of E. coli transformants of respective Aeromonas isolates on the gel:
lane 1, N42; lane 2, CH10; lane 3, CH11; lane 4, CH12; lane 6, 6; lane 7, 7;
lane 8, CH21; lane 9, 227; lane 11, 4; lane 12, 10. Lanes 5, 10, HighRanger
Plus 100 bp DNA ladder (Norgen Biotek).
H. Dobiasova et al. / Veterinary Microbiology 171 (2014) 413–421 419
Aeromonas isolates harbouring qnrS2 and/or aac(60
)-Ib-cr
genes on IncU plasmids have been reported in river and
lake water (Cattoir et al., 2008; Pica˜o et al., 2008). In our
study, restriction and hybridization analysis of IncU
plasmids suggested that transfer of related
qnrS2 À aac(60
)-Ib-cr-harbouring plasmids may have
occurred between Aeromonas species in various aquatic
environments and geographical locations. We demonstrate
that IncU plasmids are important vectors of clinical
relevant quinolone resistance in ornamental fish with the
ability to be transferred and replicated in E. coli. It has been
described that treatment of A. hydrophila infection in
ornamental fish with ineffective concentrations of quinolones
or the ineffective antimicrobials such as tetracycline
and trimethoprim strongly induced expression of genes
mediating conjugative transfer of the IncU plasmid (Cantas
et al., 2012).
4. Conclusion
Multiresistant phenotype, diverse antibiotic resistance
genes and integrons were identified in quinolone-resistant
aeromonads associated with ornamental fish. Related IncU
plasmids carrying PMQR genes were found in Aeromonas
spp. from various geographical areas. More studies
including whole plasmid sequencing need to be done to
understand the epidemiology and evolution of plasmids
disseminating quinolone resistance in aquatic environments.
Considering the rapid growth of aquaculture
industry, efforts are needed to prevent development and
spread of antimicrobial resistance in aquaculture to reduce
the risk for human health.
Conflict of interest
Nothing to declare.
Acknowledgements
This study was funded by National Agency for
Agricultural Research (project no. QJ1210237), Ministry
of Agriculture of the Czech Republic (MZE 0002716202)
and ‘CEITEC – Central European Institute of Technology’
(CZ.1.05/1.1.00/02.0068) of the European Regional Development
Fund. The study was partially supported by
CENAKVA (CZ.1.05/2.1.00/01.0024) and The Project
LO1205 with a financial support from the MEYS of the
Czech Republic under the NPU I program. Monika Dolejska
was supported by the Operational Programme ‘‘Education
for Competitiveness’’ (CZ.1.07/2.3.00/30.0014) from the
European Social Fund. We thank to Marie Slavikova, Jana
Kucerova and Dagmar Tausova for excellent laboratory
work.
References
Arias, A., Seral, C., Gude, M.J., Castillo, F.J., 2010. Molecular mechanisms of
quinolone resistance in clinical isolates of Aeromonas caviae and
Aeromonas veronii bv sobria. Int. Microbiol. 13, 135–141.
Blazquez, J., Couce, A., Rodriguez-Beltran, J., Rodriguez-Rojas, A., 2012.
Antimicrobials as promoters of genetic variation. Curr. Opin. Microbiol.
15, 561–569.
Cabello, F.C., 2006. Heavy use of prophylactic antibiotics in aquaculture: a
growing problem for human and animal health and for the environment.
Environ. Microbiol. 8, 1137–1144.
Cabello, F.C., Godfrey, H.P., Tomova, A., Ivanova, L., Do¨lz, H., Millanao, A.,
Buschmann, A.H., 2013. Antimicrobial use in aquaculture re-examined:
its relevance to antimicrobial resistance and to animal and human
health. Environ. Microbiol. 15, 1917–1942.
Cantas, L., Midtlyng, P.J., Sørum, H., 2012. Impact of antibiotic treatments
on the expression of the R plasmid tra genes and on the host innate
immune activity during pRAS1 bearing Aeromonas hydrophila infection
in zebrafish (Danio rerio). BMC Microbiol. 12, 37.
Carattoli, A., Bertini, A., Villa, L., Falbo, V., Hopkins, K.L., Threlfall, E.J., 2005.
Identification of plasmids by PCR-based replicon typing. J. Microbiol.
Methods 63, 219–228.
Cattoir, V., Poirel, L., Aubert, C., Soussy, C.J., Nordmann, P., 2008. Unexpected
occurrence of plasmid-mediated quinolone resistance determinants in
environmental Aeromonas spp. Emerg. Infect. Dis. 14, 231–237.
Cizek, A., Dolejska, M., Sochorova, R., Strachotova, K., Piackova, V.,
Vesely, T., 2010. Antimicrobial resistance and its genetic determinants
in aeromonads isolated in ornamental (koi) carp (Cyprinus
carpio koi) and common carp (Cyprinus carpio). Vet. Microbiol. 142,
435–439.
CLSI, 2006. Methods for antimicrobial disk susceptibility testing of bacteria
isolated from aquatic animals. In: Approved Guideline M42-A.
Clinical and Laboratory Standards Institute, Wayne, Pennsylvania,
USA.
CLSI, 2008. Performance Standards for Antimicrobial Susceptibility Testing:
Eighteenth Informational Supplement M100-S18. Clinical and
Laboratory Standards Institute, Wayne, Pennsylvania, USA.
Cole, B., Tamaru, C.S., Bailey, R., 1999. Shipping Practices in the Ornamental
Fish Industry. Center for Tropical and Subtropical Aquaculture,
USA, pp. 25 Publication No. 131.
Dolejska, M., Cizek, A., Literak, I., 2007. High prevalence of antimicrobialresistant
genes and integrons in Escherichia coli isolates from Blackheaded
gulls in the Czech Republic. J. Appl. Microbiol. 103, 11–19.
Genevaux, P., Muller, S., Bauda, P., 1996. A rapid screening procedure to
identify mini-Tn10 insertion mutants of Escherichia coli K-12 with
altered adhesion properties. FEMS Microbiol. Lett. 142, 27–30.
Han, J.E., Kim, J.H., Choresca Jr., C.H., Shin, S.P., Jun, J.W., Chai, J.Y., Park,
S.C., 2012a. A small IncQ-type plasmid carrying the quinolone resistance
(qnrS2) gene from Aeromonas hydrophila. Lett. Appl. Microbiol.
54, 374–376.
Han, J.E., Kim, J.H., Choresca Jr., C.H., Shin, S.P., Jun, J.W., Chai, J.Y., Park,
S.C., 2012b. First description of ColE-type plasmid in Aeromonas spp.
carrying quinolone resistance (qnrS2) gene. Lett. Appl. Microbiol. 55,
290–294.
Huddleston, J.R., Brokaw, J.M., Zak, J.C., Jeter, R.M., 2013. Natural transformation
as a mechanism of horizontal gene transfer among environmental
Aeromonas species. Syst. Appl. Microbiol. 36, 224–234.
Kruse, H., Sørum, H., 1994. Transfer of multiple drug resistance plasmids
between bacteria of diverse origins in natural microenvironments.
Appl. Environ. Microbiol. 60, 4015–4021.
Lee, M.F., Peng, C.F., Lin, Y.H., Lin, S.R., Chen, Y.H., 2008. Molecular
diversity of class 1 integrons in human isolates of Aeromonas spp.
from Southern Taiwan. Jpn. J. Infect. Dis. 61, 343–349.
Literak, I., Micudova, M., Tausova, D., Cizek, A., Dolejska, M., Papousek, I.,
Prochazka, J., Vojtech, J., Borleis, F., Guardone, L., Guenther, S., Hordowski,
J., Lejas, C., Meissner, W., Marcos, B.F., Tucakov, M., 2012.
Plasmid-mediated quinolone resistance genes in fecal bacteria from
rooks commonly wintering throughout Europe. Microb. Drug Resist.
18, 567–573.
Lukkana, M., Wongtavatchai, J., Chuanchuen, R., 2012. Class 1 integrons in
Aeromonas hydrophila isolates from farmed Nile tilapia (Oreochromis
nilotica). J. Vet. Med. Sci. 74, 435–440.
Lupo, A., Coyne, S., Berendonk, T.U., 2012. Origin and evolution of antibiotic
resistance: the common mechanisms of emergence and spread
in water bodies. Front. Microbiol. 3, 18.
Naviner, M., Gordon, L., Giraud, E., Denis, M., Mangion, C., Le Bris, H.,
Ganiere, J.P., 2011. Antimicrobial resistance of Aeromonas spp. isolated
from the growth pond to the commercial product in a rainbow
trout farm following a flumequine treatment. Aquaculture 315, 236–
241.
Parker, J.L., Shaw, J.G., 2011. Aeromonas spp. clinical microbiology and
disease. J. Infect. 62, 109–118.
Pica˜o, R.C., Poirel, L., Demarta, A., Silva, C.S., Corvaglia, A.R., Petrini, O.,
Nordmann, P., 2008. Plasmid-mediated quinolone resistance in Aeromonas
allosaccharophila recovered from a Swiss lake. J. Antimicrob.
Chemother. 62, 948–950.
Smith, P., 2008. Antimicrobial resistance in aquaculture. Rev. Sci. Tech. 27,
243–264.
H. Dobiasova et al. / Veterinary Microbiology 171 (2014) 413–421420
Sørum, H., L’Abe´e-Lund, T.M., Solberg, A., Wold, A., 2003. Integron-containing
IncU R plasmids pRAS1 and pAr-32 from the fish pathogen
Aeromonas salmonicida. Antimicrob. Agents Chemother. 47, 1285–
1290.
Sreedharan, K., Philip, R., Singh, I.S., 2012. Virulence potential and antibiotic
susceptibility pattern of motile aeromonads associated with
freshwater ornamental fish culture systems: a possible threat to
public health. Braz. J. Microbiol. 43, 754–765.
Stepanovic´, S., Vukovic´, D., Dakic´, I., Savic´, B., Svabic´-Vlahovic´, M., 2000. A
modified microtiter-plate test for quantification of staphylococcal
biofilm formation. J. Microbiol. Methods 40, 175–179.
Strahilevitz, J., Jacoby, G.A., Hooper, D.C., Robicsek, A., 2009. Plasmidmediated
quinolone resistance: a multifaceted threat. Clin. Microbiol.
Rev. 22, 664–689.
Tigges, F., Bauer, A., Hochauf, K., Meurer, M., 2009. Sporotrichoid atypical
cutaneous infection caused by Mycobacterium marinum. Acta Dermatovenerol.
Alp. Panonica Adriat. 18, 31–34.
Verner-Jeffreys, D.W., Welch, T.J., Schwarz, T., Pond, M.J., Woodward, M.J.,
Haig, S.J., Rimmer, G.S.E., Roberts, E., Morrison, V., Baker-Austin, C.,
2009. High prevalence of multidrug-tolerant bacteria and associated
antimicrobial resistance genes isolated from ornamental fish and
their carriage water. PLoS ONE 4, e8388.
Weir, M., Rajic´, A., Dutil, L., Cernicchiaro, N., Uhland, F.C., Mercier, B.,
Tusˇevljak, N., 2012. Zoonotic bacteria, antimicrobial use and antimicrobial
resistance in ornamental fish: a systematic review of the
existing research and survey of aquaculture-allied professionals.
Epidemiol. Infect. 140, 192–206.
Whittington, R.J., Chong, R., 2007. Global trade in ornamental fish from an
Australian perspective: the case for revised import risk analysis and
management strategies. Prev. Vet. Med. 81, 92–116.
Wilkerson, C., Samadpour, M., van Kirk, N., Roberts, M.C., 2004. Antibiotic
resistance and distribution of tetracycline resistance genes in Escherichia
coli O157:H7 isolates from human and bovines. Antimicrob.
Agents Chemother. 48, 1066–1067.
H. Dobiasova et al. / Veterinary Microbiology 171 (2014) 413–421 421
Příloha 34
DOBIASOVA, H., DOLEJSKA, M., 2016, Prevalence and diversity of IncX plasmids carrying
fluoroquinolone and β-lactam resistance genes in Escherichia coli originating from diverse
sources and geographical areas: Journal of Antimicrobial Chemotherapy, v tisku.
Souhrn
Cílem studie bylo popsat prevalenci a diverzitu IncX plazmidů ve sbírce rezistentních izolátů čeledi
Enterobacteriaceae z různých zdrojů (člověk, zvířata, prostředí) a geografických oblastí. U Izolátů nesoucích
IncX plazmid byl stanoven profil rezistence a jejich příbuznost byla vyšetřena analýzou makrorestrikčních
profilů genomové DNA. IncX plazmidy byly podrobeny komparativní analýze s cílem identifikovat dominantní
rozšířené linie plazmidů. Plazmidy podskupiny IncX1 nesoucí geny qnrS1 a blaTEM-/-135 byly identifikovány
u E. coli z různých zdrojů a oblastí. Druhou nejčastěji skupinou byly IncX2 plazmidy s geny qnrS1 a tet(A)
rozšířené zejména u vodních ptáků v Evropě. Studie upozorňuje na šíření IncX plazmidů v prostředí a jejich
sdružení s geny rezistence k fluorochinolonům.
Prevalence and diversity of IncX plasmids carrying fluoroquinolone
and b-lactam resistance genes in Escherichia coli originating from
diverse sources and geographical areas
Hana Dobiasova1* and Monika Dolejska1,2
1
Department of Biology and Wildlife Diseases, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical
Sciences Brno, Palackeho tr. 1946/1, 612 42 Brno, Czech Republic; 2
Central European Institute of Technology - University of Veterinary and
Pharmaceutical Sciences Brno (CEITEC VFU), Palackeho tr. 1946/1, 612 42 Brno, Czech Republic
*Corresponding author. Tel: +420-541-562-647; E-mail: dobiasova.hanka@gmail.com
Received 15 September 2015; returned 17 December 2015; revised 9 March 2016; accepted 28 March 2016
Objectives: Aim of the study was to describe the prevalence and diversity of IncX plasmids with antibiotic resistance
genes in Enterobacteriaceae and to identify the most disseminated lineages of the plasmid family.
Methods: IncX plasmids were screened in 1894 Enterobacteriaceae isolates resistant to cefotaxime (2 mg/L) or
with reduced susceptibility to ciprofloxacin (0.05 mg/L) obtained from various sources in five continents using
PCR. IncX plasmid-harbouring isolates were identified using MALDI-TOF or biochemical tests, and screened for
antibiotic resistance genes using PCR and sequencing; their clonality was determined by PFGE. Horizontal transfer
of plasmids was tested using transformation and conjugation. IncX plasmids were characterized by S1-nuclease
and PFGE, restriction fragment length polymorphism and hybridization.
Results: A total of 164 Escherichia coli isolates (8.7%, n¼1894) carried at least one IncX subgroup. Seven isolates
harboured two distinct subgroups. IncX1 subgroup was found in 93 isolates, followed by IncX2 (35 isolates),
IncX4 (28) and IncX3 (15). IncX4 plasmids were not transferred horizontally as single plasmids and therefore
excluded from further analysis. The most disseminated lineages of IncX plasmids included IncX1 harbouring
qnrS1 and blaTEM-1,-135 found in 36 E. coli from different sources in Europe and Australia and IncX2 carrying
qnrS1 and tet(A) detected in nine E. coli from wildlife in Europe. IncX3 plasmids harboured predominantly
blaSHV-12 and qnrS1 or qnrB7.
Conclusions: IncX plasmids were widely distributed in E. coli from wildlife in Europe and were predominantly associated
with fluoroquinolone resistance genes. Plasmids showing indistinguishable restriction profiles were identified
in E. coli from different sources and countries suggesting wide dissemination of certain plasmid lineages.
Introduction
Horizontal transfer of antibiotic resistance genes mediated by
plasmids belong to the most crucial means of antibiotic resistance
dissemination in Gram-negative bacteria.1
In Enterobacteriaceae,
IncF, IncA/C, IncL/M, IncI1, IncHI2 and IncN plasmids belong to
predominant plasmid families promoting worldwide spread of
carbapenemase, ESBL, AmpC cephalosporinase and plasmidmediated
quinolone resistance (PMQR) genes.1,2
In this context,
IncX plasmids belonged to rather rare plasmid families predominantly
associated with PMQR genes.1
However, the low prevalence
of IncX plasmids was associated with limitations of a standard
method used for identification of major plasmid families, PCRbased
replicon typing.3
IncX plasmids were detected in Salmonella and Klebsiella isolates
from the pre-antibiotic era.4
The most studied IncX plasmid
R6K is a multicopy self-transferable iteron-containing plasmid
with theta replication controlled by molecular interactions of
two minimal replicon components, g oriV and Rep (p protein).5
The host range of the R6K plasmid was supposed to be narrow
comprising several Enterobacteriaceae genera. Nevertheless, WT
R6K minimal replicon establishment was demonstrated in
Haemophilus influenzae, Vibrio cholerae and Zoogloea ramigera.5,6
The first division of the IncX plasmid family into two subgroups,
IncX1 and IncX2, was based on restriction analysis.4
Johnson
et al.3
proposed expansion of the plasmid family to IncX3 and
IncX4 subgroups based on phylogeny inferred from polymorphisms
within conserved regions of 18 sequenced IncX plasmids.
Shortly after, Chen et al.7
found K. pneumoniae ST429 isolate
with blaKPC-5-harbouring plasmid assigned to IncX5 subgroup.
To date, IncX plasmids were found to carry various antibiotic
resistance genes, e.g. PMQR genes (qnrS1, oqxAB), ESBL genes
Figure Read by: M.M. Copy Edited by: P.B.
# The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: journals.permissions@oup.com
J Antimicrob Chemother
doi:10.1093/jac/dkw144
1 of 7
5
10
15
20
25
30
35
40
45
50
55
60
65
70
75
80
85
90
95
100
105
110
115
(blaTEM-52, blaCTX-M-15, blaSHV-12), carbapenemase genes (blaNDM-1,
blaKPC-2,-5) and others.3,7 – 9
All these findings highlight the great
diversity of the IncX family and potentially underestimated role
of the plasmids in dissemination of antibiotic resistance genes
in Enterobacteriaceae.
The aim of our study was to determine the prevalence and diversity
of IncX plasmids harbouring fluoroquinolone and b-lactam
resistance genes in a large collection of Enterobacteriaceae isolates
from various sources and widely separated areas and to identify
the most disseminated lineages of the plasmids with respect to
their resistance gene content and restriction profile.
Materials and methods
Bacterial isolates
A collection of 1894 Enterobacteriaceae isolates consisting of 963 (50.8%)
and 931 (49.2%) isolates was obtained on MacConkey agar (MCA; Oxoid)
with ciprofloxacin (0.05 mg/L; Fluka, China) or cefotaxime (2 mg/L; Sigma,
China) after overnight cultivation at 378C, respectively. Isolates were identified
using API 20E (bioMe´rieux, France) or MALDI-TOF (Microflex LT, Bruker
Daltonics, Bremen, Germany). MALDI-TOF mass spectra were analysed
using FlexControl–microflex v 3.3 (Bruker Daltonics) and MALDI Biotyper
v 3.1 (Bruker Daltonics) software. Of 18 Enterobacteriaceae species in
the collection, the most prevalent species included Escherichia coli (1471
isolates, 77.7%, n¼1894), Klebsiella pneumoniae (165 isolates, 8.7%) and
Citrobacter freundii (130 isolates, 6.9%), 128 isolates (6.8%) were assigned
to other Enterobacteriaceae species including 15 samples of pooled DNA
extracted from different colonies grown on MCA with ciprofloxacin. These
Enterobacteriaceae isolates were obtained from wildlife (1252 isolates,
66.1%), municipal wastewater (438, 23.1%), domestic animals (117,
6.2%), humans (52, 2.7%), food-producing animals (34, 1.8%) and captive
animals (1, 0.1%) in Europe (904, 47.7%), Australia [New South Wales
(700, 37.0%)], Africa (193, 10.2%), North America (85, 4.5%) and South
America [Paraguay (12, 0.6%)] during 2009–2012 (Table S1, available
as Supplementary data at JAC Online). A total of 368 isolates were
drawn from previous studies lacking IncX plasmid analysis and 696
Enterobacteriaceae isolates originating from silver gulls (Australia) were
obtained via subcultivation on MCA with cefotaxime or ciprofloxacin.10–17
Furthermore, 19 IncX plasmids from 18 E. coli and one Enterobacter
cloacae that were characterized in previous studies were also included in
comparative analysis of IncX plasmids.18 –25
Screening of IncX plasmids and b-lactamase and
PMQR genes
IncX1–IncX4 subgroups were tested in 1894 Enterobacteriaceae isolates
using PCR targeting taxC.3
IncX-positive isolates grown on MCA with cefotaxime
were tested for ESBL (blaTEM, blaSHV, blaCTX-M, blaOXA), carbapenemase
(blaKPC, blaVIM, blaNDM, blaIMP, blaOXA-48-like) and AmpC (blaCMY-2-like)
genes using PCR and sequencing.16,24,26,27
Isolates grown on MCA with
ciprofloxacin were tested for PMQR genes [qnrA, qnrB, qnrC, qnrD, qnrS,
aac(6′
)-Ib-cr, qepA, oqxAB] using PCR and sequencing as described previ-
ously.14,21,24,28
All primers used are listed in (Table S2).
Horizontal transfer of IncX plasmids and their sizing
Plasmid DNA extracted from all IncX-carrying Enterobacteriaceae isolates
using alkaline lysis was transferred via heat-shock transformation of
plasmid-free E. coli DH5a or Top10 recipient cells. Transformants (TFs)
were selected on LB agar (Difco, France) containing cefotaxime (2 mg/L)
or ciprofloxacin (0.05 mg/L) based on the medium used for selective
isolation of the corresponding donor Enterobacteriaceae isolates.24
Conjugation was tested using filter-mating method with plasmid-free
rifampicin (Rf)-resistant and sodium azide (SA)-resistant recipient cells
of E. coli MT102RfSA and Salmonella Typhimurium SL5325RfSA or
Salmonella Enteritidis Fa8065RfSA Q1. IncX-positive isolates and recipients
were cultivated to exponential growth phase in brain heart infusion
broth (Oxoid, UK) with shaking at 378C and then mixed in 1:1 ratio. The
mixtures were cultivated on bacteriological filters placed on non-selective
Columbia Blood Agar Base (Oxoid) overnight at 378C. Transconjugants
(TCs) were selected on LB agar containing 25 mg/L rifampicin, 100 mg/L
sodium azide and 2 mg/L cefotaxime or 0.05 mg/L ciprofloxacin based
on the medium used for selective isolation of the corresponding donor
Enterobacteriaceae isolates.24
Successful horizontal transfer of IncX plasmids
was confirmed using PCR.3
If no TFs or TCs carrying IncX plasmids
were obtained on LB agar with cefotaxime, conjugation was repeated
and TCs were selected on LB agar containing ciprofloxacin. Likewise, if
no TFs or TCs with IncX plasmids were obtained on LB agar with ciprofloxacin,
TCs were selected on LB agar containing cefotaxime. Number and size
of successfully transferred plasmids were estimated using S1-nuclease
and PFGE along with plasmid DNA extraction followed by standard gel
electrophoresis. In TCs harbouring IncX plasmids of different size compared
with donor isolates, PCR-based replicon typing was performed
(Table S2).29
Plasmids were further characterized only in TFs or TCs harbouring
a single IncX plasmid.
Clonality of IncX-harbouring isolates
Relatedness of donor isolates with successfully transferred IncX plasmids
was determined using XbaI digestion (Takara, Japan) and PFGE30
and
assessed using UPGMA cluster analysis in BioNumerics (Applied Maths,
Belgium). IncX plasmid analysis was performed only from isolates showing
unique macrorestriction profiles.
Susceptibility and antibiotic resistance gene testing
Susceptibility of donor isolates to 12 antibiotics (10 mg ampicillin,
20+10 mg amoxicillin/clavulanate, 30 mg cefalotin, 30 mg ceftazidime,
30 mg chloramphenicol, 5 mg ciprofloxacin, 10 mg gentamicin, 30 mg nalidixic
acid, 10 mg streptomycin, 300 mg sulphonamides cp SQ1, 1.25+23.75 mg
trimethoprim/sulfamethoxazole, 30 mg tetracycline; Oxoid) was tested
using a disc diffusion method.31
Donor isolates, TCs or TFs were tested
for relevant antibiotic resistance genes including class 1 and 2 integrons
using PCR.24
If amplification of the whole variable region of the class 1
integron failed, the partial structure of the variable region was determined
using primers targeting conserved segments and relevant gene cassettes
(Table S2).
Relatedness of IncX plasmids
Plasmid DNA was isolated using alkaline extraction or a PureLinkw
HiPure Plasmid Filter Midiprep Kit (Invitrogen, Life Technologies,
Germany). IncX and IncX2–IncI1 plasmids were compared using HincII
(Thermo-Scientific, USA) or PstI (Takara, Japan) digestion under conditions
as recommended by the suppliers, respectively, and DNA fragments were
separated in 1% agarose gel at 6 V/cm for 5 h. IncX plasmids were divided
into clusters based on Dice coefficient ≥85% of similarity of their restriction
profiles assessed using UPGMA cluster analysis in BioNumerics
(Applied Maths). With respect to each subgroup, restriction profiles were
designated with letters (e.g. A, a, a) based on the Dice coefficient ≥85%.
Band differences in related restriction profiles were distinguished using
numbers (e.g. A1, b1). DNA fragments of IncX plasmids were transferred
to positively charged nylon membrane (Biodyne B; Pall Corporation, USA)
using Southern blot.32
DIG-11-dUTP-labelled probes targeting the taxC
gene of IncX1–IncX3 subgroups, RNAI of IncI1, qnrS1, qnrS2, qnrB7,
qnrB19, blaTEM and blaSHV-12 were prepared using a PCR DIG Probe
Dobiasova and Dolejska
2 of 7
120
125
130
135
140
145
150
155
160
165
170
175
180
185
190
195
200
205
210
215
220
225
230
Synthesis Kit (Roche Diagnostics, Germany). Hybridization results were
detected using a DIG Wash and Block Buffer Set (Roche Diagnostics).
Statistical analysis
To assess the statistical significance of obtained data, the x2
test was performed
using MS Excel. P≤0.05 was considered statistically significant.
Results and discussion
Prevalence and hosts of IncX plasmids
IncX plasmids were found in 164 E. coli isolates (8.7%, n¼1894)
originating from all of the continents and sources but humans.
Despite the previous detection of the plasmids in different
Enterobacteriaceae species,3,4,7,9
no IncX plasmids were found
in isolates belonging to any other Enterobacteriaceae species
from the tested collection.
Statistically significant (P¼0.02) high occurrence of IncX
plasmids was found in isolates with reduced susceptibility to
fluoroquinolones (98 isolates, 10.2%, n¼963). Despite most of
the test isolates originating from wildlife and from Europe, a statistically
significant (P,0.001) high occurrence of IncX plasmids
was detected in E. coli from wildlife (137 isolates, 10.9%,
nwildlife ¼1252) among the sources tested and from Europe
(117, 12.9%, nEurope ¼904) among the continents tested. A statistically
significant (P,0.001) low distribution of IncX plasmids
was found in isolates from municipal wastewater (16 isolates,
3.7%, nwastewater ¼438) among the sources tested, from
Africa (1 isolate, 0.5%, nAfrica ¼193) and Australia (38, 5.4%,
nAustralia ¼700) among all continents tested (Table 1). Of note,
no IncX plasmids were found in 52 isolates from humans.
However, IncX plasmids harbouring resistance genes have been
already reported from Enterobacteriaceae from hospitalized
patients and community.7 – 9,20,33
Absence of IncX plasmids in
Enterobacteriaceae isolates from humans was most likely associated
with a small number of these isolates and possibly with
the low prevalence of IncX plasmids found in African isolates as
all human isolates originated from Africa.
Isolates (95.7%, nIncX-positive E. coli ¼164) harboured a single
IncX subgroup. In six and one isolates, IncX4 along with IncX1
or IncX2 subgroups were detected, respectively. An IncX1 and
IncX4 combination was observed also in Salmonella Heidelberg
isolated from food in the USA.34
Division of the plasmid family
into four subgroups was based on overall phylogeny of the IncX
plasmid backbones and stable propagation of distinct IncX plasmid
subgroups in one cell line has not been addressed yet.3
However, Norman et al.35
described partial incompatibility of
IncX1 and IncX2 plasmids attributed to sequence divergence
within genes coding for partitioning. Similarly, Bielak et al.36
observed stable propagation of two distinct IncX1 plasmids in
one cell line ascribed to low amino acid sequence homology of
corresponding Rep proteins. Further studies are warranted to
assess the in-/compatibility of these plasmids among and within
IncX subgroups.
The IncX1 subgroup was found in 93 isolates (54.4%,
nIncX subgroups¼171), followed by the IncX2 subgroup (35 isolates,
20.5%), the IncX4 subgroup (28, 16.4%) and the IncX3 subgroup
(15, 8.8%). Intriguingly, the IncX1 subgroup was predominant
Table 1. Prevalence of IncX plasmids in Enterobacteriaceae isolates regarding their source, origin and antibiotic used for their selective isolation
Enterobacteriaceae isolates
No. of isolates
Pa
IncX-positive (%) IncX-negative (%) total
Source
captive animals 1 (100) 0 (0) 1 ND
domestic animals 8 (6.8) 109 (93.2) 117 0.47
food-producing animals 2 (5.9) 32 (94.1) 34 0.56
municipal wastewater 16 (3.7) 422 (96.3) 438 <0.001
humans 0 (0) 52 (100) 52 0.02
wildlife 137 (10.9) 1115 (89.1) 1252 <0.001
total no. of isolates 164 1730 1894 —
Origin
Africa 1 (0.5) 192 (99.5) 193 <0.001
Australia 38 (5.4) 662 (94.6) 700 <0.001
Europe 117 (12.9) 787 (87.1) 904 <0.001
North America 6 (7.1) 79 (92.9) 85 0.59
South America 2 (16.7) 10 (83.3) 12 0.32
total no. of isolates 164 1730 1894 —
Selective isolation
ciprofloxacin 98 (10.2) 865 (89.8) 963 0.02
cefotaxime 66 (7.1) 865 (92.9) 931 0.02
total no. of isolates 164 1730 1894 —
ND, not determined (P value of the x2
test was not determined due to small number of isolates).
a
P≤0.05 (bold) was considered statistically significant.
Prevalence and diversity of IncX plasmids
3 of 7
235
240
245
250
255
260
265
270
275
280
285
290
295
300
305
310
315
320
325
330
335
340
345
JAC
No. of
plasmids
Origin of isolates Representative
isolatef Reference
sources
AU, CZ,
ES, PL
CE 1220 This study
CZ P/67 25
CZ 46 M 20
AU CE 1824
AU CE 1551 This study
This study
CZ CE 780 h4 This study
40–45 CZ CE 1236 This study
35–40 CZ, PL 175 22
CZ 177 22
CZ HP131 16
ES HE68 16
Food-producing animal PY CE 1511 This study
SK 615cip 11
Wildlife CZ HP103 16
Wildlife AU CE 1588 This study
Wildlife AU CE 1594 This study
Wildlife AU CE 1975 This study
Wildlife AU CE 1564 This study
X3 Human CZ Encl-922 23
Wildlife DE HD76 16
Wildlife CZ CE 1251 This study
Wastewater CZ CE 1456 h8 This study
98.0
96.9
94.2
87.9
82.2
64.6
100
80
88.9
92.3
77.4
86.7
81.8
73.6
93.6
68.7
98.8
80.6
83.3
75.7
countriese
Domestic animal
Wildlife
Wildlife
Wildlife
Wildlife
Human
Wildlife
Wildlife
Wastewater
Wildlife
Food-producing animals, wildlife
Captive, food-producing, domestic
animals, wildlife, wastewater
36
3
1
1
1
1
2
9
1
1
3
1
1
1
1
1
1
1
1
1
1
1
Inc
RFLP
profileb
Size
(kb)
AR genes and class 1 integronscHybridization of HincII or PstI
restriction profilesa
X1
X1
X1
X1
X1
X1
X1
X2
X2
X2
X2
X2
X2
X2
X2
X2
X3
X3
X2-I1
X2-I1
X3-N
A1
A2
A3
A4
A5
B
C
a1
a2
b1
b2
c1
c2
d
e1
e2
f1
f2
a
b
g
d
45–50
50
45
50
55
60
30
35
40
35
30
35
55
45
145
145
50
80
50
40
qnrS1, blaTEM-1,-135
qnrS1, blaTEM-1
qnrS1d
qnrS1, blaTEM-1
qnrS1, blaTEM-1, aadA1, floR, sul3
qnrS1, blaTEM-1, floR, tet(A)
blaTEM-52b
qnrS1, tet(A)
qnrS1
qnrS1, intI1, 5′CS-aadA2
qnrS1, blaTEM-1, intI1, 5′CS-aadA2
qnrB19, tet(A)
qnrB19
qnrS2, intI1
qnrS1, blaTEM-176
qnrS1, blaTEM-176
qnrS1, blaTEM-176, aadA1, sul3
qnrS1, blaTEM-176, aadA1, sul3
blaNDM-4
qnrS1, blaSHV-12, blaTEM-1
qnrB7, blaSHV-12
qnrS1, blaSHV-12
Figure 1. Characteristics of IncX plasmids. AR, antibiotic resistance; Inc, incompatibility group; RFLP, restriction fragment length polymorphism. a
Restriction profiles of IncX and mosaic
IncX2–IncI1 plasmids were obtained using HincII and PstI digestion, respectively. DNA fragments bound to probes are marked as follows: filled circle, open circle and filled oval, taxC of
IncX1, IncX2 and IncX3 subgroup, respectively; filled square, blaTEM; filled triangle, qnrS1; open triangle, qnrS2; filled pentagon, qnrB19; open pentagon, qnrB7; asterisk, RNAI of IncI1; and
cross, blaSHV-12. b
Plasmids were divided into clusters of related plasmids if the Dice coefficient of their restriction profiles was ≥85%. Clusters of related plasmids were designated as
follows: IncX1, three clusters (A–C); IncX2 and IncX2–IncI1, six clusters (a–f); and IncX3 and IncX3–IncN, four clusters (a-d). Band differences in related restriction profiles were
differentiated using numbers (e.g. A1, A2; b1, b2). c
Whole variable region of class 1 integrons was determined using primers targeting 5′
- and 3′
-conserved segments. If
amplification of the whole variable region failed, the partial structure of the variable region was determined using PCR mapping with primers complementary to conserved segments
and relevant gene cassettes (Table S2).24 d
blaTEM on IncX1 plasmid of E. coli 46 M could be detected using only hybridization. e
AU, Australia; CZ, Czech Republic; DE, Germany; ES, Spain;
PL, Poland; PY, Paraguay; SK, Slovakia. f
Representative isolate was randomly chosen from isolates harbouring the IncX plasmid of a particular restriction profile.
DobiasovaandDolejska
4of7
350
355
360
365
370
375
380
385
390
395
400
405
410
415
420
425
430
435
440
445
450
455
460
in IncX-harbouring Enterobacteriaceae isolates from the preantibiotic
era (1920s–1940s) and antibiotic-resistant IncXpositive
Enterobacteriaceae isolated during the 1960s–1980s.4
IncX plasmids that were successfully transferred via transformation
or conjugation as single plasmids were further characterized.
In our study, the comparative analysis of 70 IncX1–IncX3
plasmids included 51 plasmids from E. coli isolates obtained in this
study, 18 and 1 plasmids from E. coli and E. cloacae characterized
in previous studies.18 – 25
All the 70 IncX1–IncX3 plasmids were
obtained from donor isolates showing unique macrorestriction
profiles (Figures S1 to S4). IncX4 plasmids could not be analysed
in our study because they were not transferred horizontally as single
plasmids.
IncX1 plasmids as widely disseminated vectors of qnrS1
A total of 43 and 2 IncX1 plasmids (40–60 kb) carried qnrS1 or
blaTEM-52b, respectively. Forty-two qnrS1-positive IncX1 plasmids
harboured blaTEM-1,-135. Additional resistance genes were found
on two IncX1 plasmids derived from E. coli CE 1551 from a silver
gull (Australia) and E. coli CE 780 h4 from municipal wastewater
(Czech Republic). Based on restriction profile analysis, 42
qnrS1-carrying IncX1 plasmids comprised a cluster of related plasmids
designated ‘A’ containing five subgroups (A1–A5; Figure 1).
The A1 subgroup covering 36 identical IncX1 plasmids was found
in E. coli from captive, food-producing and domestic animals,
wildlife and municipal wastewater in Australia, Czech Republic,
Poland and Spain indicating wide distribution of the plasmid lineage.
Hybridization results demonstrated a high degree of conservation
of IncX1 plasmids as probes targeting taxC, qnrS1 and
blaTEM were bound to identical DNA fragments of ‘A’ and ‘B’ restriction
profiles (Figure S5). The two identical blaTEM-52b-harbouring
plasmids found in E. coli from a wild boar and a gull in the
Czech Republic comprised a ‘C’ cluster (Figure 1). Similar
blaTEM-52b-harbouring IncX1 plasmids (pE001, pDKX1-TEM-52,
pYM4) were found in E. coli, Salmonella Manhattan and
Salmonella InfantisQ2 from poultry and beef meat in Denmark and
Japan.3,36,37
IncX2 plasmids are associated with different
fluoroquinolone resistance genes
Despite IncX2 subgroup constituted the second largest group containing
21 plasmids in our study, their occurrence is reported only
rarely.4,22
IncX2 (30–55 kb) and IncX2–IncI1 (145 kb) plasmids
harboured qnrS1 (18 plasmids), qnrB19 (2) or qnrS2 (1). IncX2
plasmids were divided into five clusters (a–e) ranging from
68.7% to 81.8% of their restriction profile similarity. Two closely
related IncX2–IncI1 plasmids comprised an ‘f’ cluster (Figure 1).
The most disseminated IncX2 lineage (a1) harbouring qnrS1 and
tet(A) was recovered from nine E. coli from wild birds in central
Europe. Characteristics of the ‘a1’ lineage corresponded to the
IncX2 plasmid pEBG1 found in E. coli from a human in Nigeria.33
The second largest group of IncX2 plasmids (b) was found in four
E. coli isolates from rooks in Spain and the Czech Republic.
Plasmids of the ‘b’ lineage carried qnrS1 and an incomplete
class 1 integron and differed in the presence of blaTEM-1.
Characteristics of the ‘b2’ lineage corresponded to the IncX2 plasmid
pNGX2-QnrS1 identified in E. coli from a Nigerian chicken.3
IncX2 plasmids with qnrS1 and blaTEM-176 (‘e’ cluster) from
Australian E. coli shared 68.7% similarity with plasmids from
Europe likely indicating the independent evolution of the plasmid
lineage. IncX2 plasmid of E. coli (HP103) from a rook (Czech
Republic) carried qnrS2. To our knowledge, this is the first report
documenting qnrS2 on IncX2 plasmid as the gene is usually
found on IncU plasmids in Aeromonas spp.38
Two related
qnrB19-harbouring plasmids (‘c’ cluster) were found in E. coli
from a broiler (Paraguay) and a dog (Slovakia). A 33 kb IncX
plasmid harbouring qnrB19 was identified also in Tunisia.39
Hybridization results showed a high degree of conservation within
each cluster of related IncX2 plasmids except for IncX2–IncI1
plasmids as a probe targeting RNAI of IncI1 was bound to different
fragments (Figure 1).
IncX3 plasmids showing the highest diversity among
studied IncX plasmids
Although IncX3 plasmids comprised the smallest group including
only four plasmids in our study, this plasmid subgroup harbouring
carbapenemase genes is currently frequently reported.8,9,40
Three
IncX3 (40–50 kb) and one IncX3–IncN (80 kb) plasmids showed
unrelated restriction profiles. Two IncX3 and one IncX3–IncN
plasmids from E. coli from wild birds and municipal wastewater
(central Europe) carried blaSHV-12 and qnrS1 or qnrB7. To our
knowledge, co-localization of these resistance genes on IncX3
plasmid has not been reported so far. Nevertheless, blaSHV-12
has been detected along with blaKPC-2 or blaNDM-1 on IncX3 plas-
mids.8,9,40
Recently, a large number of IncX3 plasmids with
blaNDM-4-like variants were recovered from human clinical
Enterobacteriaceae isolates including IncX3 plasmid (Encl-922)
with blaNDM-4 added to our study.9,23,40
IncX3 plasmids were suggested
to play a substantial role in emergence, development and
dissemination of blaNDM-4-like alleles.40
In our study, hybridization
identified differences in blaSHV-12 localization on IncX3 plasmids
(Figure 1).
Conclusions
In conclusion, our study showed wide distribution of IncX plasmids
in E. coli from wildlife in Europe and their association with
PMQR genes, particularly qnrS. In the present study, we have identified
several IncX1 and IncX2 plasmid lineages widely distributed
in non-related E. coli from various sources and geographical areas
indicating the role of these plasmids in the dissemination of different
antibiotic resistance genes. However, additional study the
concerning prevalence and diversity of IncX3–IncX5 plasmids is
warranted, as a limited number of IncX3, no IncX4 and IncX5 plasmids
were characterized in our study. Another issue concerning
in-/compatibility of plasmids among and within particular IncX
family subgroups also needs to be clarified in the future.
Acknowledgements
Part of this work was presented at the following conferences: Fifth
Symposium on Antimicrobial Resistance in Animals and the Environment
(ARAE) 2013 (P056); Fifth Congress of European Microbiologists (FEMS)
2013 (1856); Fifty-third Interscience Conference on Antimicrobial Agents
and Chemotherapy (ICAAC) 2013 (C2-1129); European Scientific
Conference on Applied Infectious Disease Epidemiology (ESCAIDE) 2014
(20142072); European Congress of Clinical Microbiology and Infectious
Prevalence and diversity of IncX plasmids
5 of 7
465
470
475
480
485
490
495
500
505
510
515
520
525
530
535
540
545
550
555
560
565
570
575
580
JAC
Diseases (ECCMID) 2015 (EV0190); and Fourth ASM Conference on
Antimicrobial Resistance in Zoonotic Bacteria and Foodborne Pathogens
(ASM) 2015 (S3:3).
We would like to thank A. Cizek, I. Literak, I. Jamborova, K. Albrechtova,
D. Tausova, M. Janatova, D. Halova, J. Hrabak and C. Papagiannitsis for
providing the test isolates. We thank M. Masarikova, J. Hofirkova,
E. Suchanova, M. Sevcikova, J. Vojtech, K. Rodova, P. Miskova, V. Dubska,
M. Brutovska, V. Oravcova, L. Zurek, A. Townsend, A. B. Clark, J. C. Ellis,
N. Janecko, M. Phinney, M. Elderkin, S. McBurney, N. Carlile, M. Havlicek
and D. Priddel for their help in the laboratory and in the field. We thank
G. Jacoby (Lahey Clinic Inc., Burlington, MA, USA), L. Cavaco, H. HasmanSQ2
(National Food Institute, Technical University of Denmark, Kongens
Lyngby, Denmark) and A. Carattoli (Istituto Superiore di Sanita`, Rome,
Italy) for providing positive control strains.
Funding
This work was supported by: theQ3 Internal Grant Agency of the University of
Veterinary and Pharmaceutical Sciences Brno (13/2014/FVHE); the
Internal Grant Agency of the Ministry of Health of the Czech Republic
(NT14398); the Czech Science Foundation (15-14683Y/P502); and
CEITEC 2020—Central European Institute of Technology (LQ1601) from
the Czech Ministry of Education, Youth and Sports within the National
Programme for Sustainability II.
Transparency declarations
None to declare.
Supplementary data
Tables S1 and S2 and Figures S1 to S5 are available as Supplementary data
at JAC Online (http://jac.oxfordjournals.org).
References
1 Carattoli A. Plasmids and the spread of resistance. Int J Med Microbiol
2013; 303: 298–304.
2 Carattoli A. Resistance plasmid families in Enterobacteriaceae.
Antimicrob Agents Chemother 2009; 53: 2227–38.
3 Johnson TJ, Bielak EM, Fortini D et al. Expansion of the IncX plasmid
family for improved identification and typing of novel plasmids in
drug-resistant Enterobacteriaceae. Plasmid 2012; 68: 43–50.
4 Jones CS, Osborne DJ, Stanley J. Molecular comparison of the IncX plasmids
allows division into IncX1 and IncX2 subgroups. J Gen Microbiol
1993; 139: 735–41.
5 Grudniak AM, Kraczkiewicz-Dowjat A, Wolska KI et al. Conjugal transfer
of plasmid R6K g ori minireplicon derivatives from Escherichia coli to various
genera of pathogenic bacteria. Curr Microbiol 2007; 55: 549–53.
6 Wild J, Czyz A, Rakowski SA et al. g Origin plasmids of R6K lineage replicate
in diverse genera of Gram-negative bacteria. Ann Microbiol 2004; 54:
471–80.
7 Chen L, Chavda KD, Fraimow HS et al. Complete nucleotide sequences
of blaKPC-4- and blaKPC-5-harboring IncN and IncX plasmids from
Klebsiella pneumoniae strains isolated in New Jersey. Antimicrob Agents
Chemother 2013; 57: 269–76.
8 Kassis-Chikhani N, Frangeul L, Drieux L et al. Complete nucleotide
sequence of the first KPC-2- and SHV-12-encoding IncX Plasmid,
pKpS90, from Klebsiella pneumoniae. Antimicrob Agents Chemother
2013; 57: 618–20.
9 Du XX, Wang JF, Fu Y et al. Genetic characteristics of blaNDM-1-positive
plasmid in Citrobacter freundii isolate separated from a clinical infectious
patient. J Med Microbiol 2013; 62: 1332–7.
10 Albrechtova K, Dolejska M, Cizek A et al. Dogs of nomadic pastoralists
in northern Kenya are reservoirs of plasmid-mediated cephalosporinand
quinolone-resistant Escherichia coli, including pandemic clone
B2-O25-ST131. Antimicrob Agents Chemother 2012; 56: 4013–7.
11 Albrechtova´ K, Litera´k I, Cˇı´zˇek A. Vy´skyt izola´tu˚ Escherichia coli s
produkcı´ sˇirokospektry´ch b-laktama´z a plazmidoveˇ prˇena´sˇenou
rezistencı´ k fluorochinolonu˚m u definovany´ch souboru˚ psu˚ a kocˇek v
Cˇeske´ a Slovenske´ republice. Veterina´rˇstvı´ 2014; 64: 277–82. [Article
in Czech].
12 Albrechtova K, Kubelova M, Mazancova J et al. High prevalence
and variability of CTX-M-15-producing and fluoroquinolone-resistant
Escherichia coli observed in stray dogs in rural Angola. Microb Drug Resist
2014; 20: 372–5.
13 Albrechtova K, Papousek I, De Nys H et al. Low rates of antimicrobialresistant
Enterobacteriaceae in wildlife in Tai National Park, Cote d’Ivoire,
surrounded by villages with high prevalence of multiresistant ESBLproducing
Escherichia coli in people and domestic animals. PLoS One
2014; 9: e113548.
14 Halova D, Papousek I, Jamborova I et al. Plasmid-mediated quinolone
resistance genes in Enterobacteriaceae from American crows: high prevalence
of bacteria with variable qnrB genes. Antimicrob Agents Chemother
2014; 58: 1257–8.
15 Janatova M, Albrechtova K, Petrzelkova KJ et al. Antimicrobial-resistant
Enterobacteriaceae from humans and wildlife in Dzanga-Sangha
Protected Area, Central African Republic. Vet Microbiol 2014; 171: 422–31.
16 Jamborova I, Dolejska M, Vojtech J et al. Plasmid-mediated resistance
to cephalosporins and fluoroquinolones in various Escherichia coli
sequence types isolated from rooks wintering in Europe. Appl Environ
Microbiol 2015; 81: 648–57.
17 Dolejska M, Masarikova M, Dobiasova H et al. High prevalence of
Salmonella and IMP-4-producing Enterobacteriaceae in the silver gull on
Five Islands, Australia. J Antimicrob Chemother 2016; 71: 63–70.
18 Literak I, Dolejska M, Radimersky T et al. Antimicrobial-resistant faecal
Escherichia coli in wild mammals in central Europe: multiresistant
Escherichia coli producing extended-spectrum b-lactamases in wild
boars. J Appl Microbiol 2010; 108: 1702–11.
19 Literak I, Dolejska M, Janoszowska D et al. Antibiotic-resistant
Escherichia coli bacteria, including strains with genes encoding the
extended-spectrum b-lactamase and QnrS, in waterbirds on the Baltic
Sea coast of Poland. Appl Environ Microbiol 2010; 76: 8126–34.
20 Literak I, Petro R, Dolejska M et al. Antimicrobial resistance in fecal
Escherichia coli isolates from healthy urban children of two age groups
in relation to their antibiotic therapy. Antimicrob Agents Chemother
2011; 55: 3005–7.
21 Dolejska M, Duskova E, Rybarikova J et al. Plasmids carrying blaCTX-M-1
and qnr genes in Escherichia coli isolates from an equine clinic and a horseback
riding centre. J Antimicrob Chemother 2011; 66: 757–64.
22 Tausova D, Dolejska M, Cizek A et al. Escherichia coli with extendedspectrum
b-lactamase and plasmid-mediated quinolone resistance
genes in great cormorants and mallards in Central Europe. J Antimicrob
Chemother 2012; 67: 1103–7.
23 Papagiannitsis CC, Studentova V, Chudackova E et al. Identification of a
New Delhi metallo-b-lactamase-4 (NDM-4)-producing Enterobacter
cloacae from a Czech patient previously hospitalized in Sri Lanka. Folia
Microbiol 2013; 58: 547–9.
24 Dobiasova H, Dolejska M, Jamborova I et al. Extended spectrum
b-lactamase and fluoroquinolone resistance genes and plasmids among
Dobiasova and Dolejska
6 of 7
585
590
595
600
605
610
615
620
625
630
635
640
645
650
655
660
665
670
675
680
685
690
695
Escherichia coli isolates from zoo animals, Czech Republic. FEMS Microbiol
Ecol 2013; 85: 604–11.
25 Literak I, Reitschmied T, Bujnakova D et al. Broilers as a source of
quinolone-resistant and extraintestinal pathogenic Escherichia coli in the
Czech Republic. Microb Drug Resist 2013; 19: 57–63.
26 Poirel L, Walsh TR, Cuvillier V et al. Multiplex PCR for detection of
acquired carbapenemase genes. Diagn Microbiol Infect Dis 2011; 70:
119–23.
27 Agerso Y, Aarestrup FM, Pedersen K et al. Prevalence of extendedspectrum
cephalosporinase (ESC)-producing Escherichia coli in Danish
slaughter pigs and retail meat identified by selective enrichment
and association with cephalosporin usage. J Antimicrob Chemother
2012; 67: 582–8.
28 Literak I, Micudova M, Tausova D et al. Plasmid-mediated quinolone
resistance genes in fecal bacteria from rooks commonly wintering
throughout Europe. Microb Drug Resist 2012; 18: 567–73.
29 Carattoli A, Bertini A, Villa L et al. Identification of plasmids by
PCR-based replicon typing. J Microbiol Methods 2005; 63: 219–28.
30 CDC. One-Day (24–28 h) Standardized Laboratory Protocol for Molecular
Subtyping of Escherichia coli O157:H7, Non-Typhoidal Salmonella serotypes,
and Shigella sonnei by Pulsed Field Gel Electrophoresis (PFGE). CDC, Atlanta,
GA, USA: The National Molecular Subtyping Network for Foodborne
Disease Surveillance, 2004. http://www.cdc.gov/pulsenet/protocols/ecoli_
salmonella_shigella_protocols.pdf.
31 Clinical and Laboratory Standards Institute. Performance Standards for
Antimicrobial Susceptibility Testing: Twenty-first Informational Supplement
M100-S21. CLSI, Wayne, PA, USA, 2011.
32 Brown T. Southern Blotting (00:IV:2.9A:2.9.1–2.9.20). In: Current
Protocols in Molecular Biology. John Wiley & Sons, Inc., 2001.
33 Sumrall ET, Gallo EB, Aboderin AO et al. Dissemination of the transmissible
quinolone-resistance gene qnrS1 by IncX plasmids in Nigeria. PLoS
One 2014; 9: e110279.
34 Hoffmann M, Zhao S, Pettengill J et al. Comparative genomic analysis
and virulence differences in closely related Salmonella enterica serotype
Heidelberg isolates from humans, retail meats, and animals. Genome
Biol Evol 2014; 6: 1046–68.
35 Norman A, Hansen LH, She QX et al. Nucleotide sequence of pOLA52: a
conjugative IncX1 plasmid from Escherichia coli which enables biofilm formation
and multidrug efflux. Plasmid 2008; 60: 59–74.
36 Bielak E, Bergenholtz RD, Jorgensen MS et al. Investigation of diversity
of plasmids carrying the blaTEM-52 gene. J Antimicrob Chemother 2011; 66:
2465–74.
37 Matsumoto Y, Izumiya H, Sekizuka T et al. Characterization
of blaTEM-52-carrying plasmids of extended-spectrum-b-lactamaseproducing
Salmonella enterica isolates from chicken meat with a
common supplier in Japan. Antimicrob Agents Chemother 2014; 58:
7545–7.
38 Cattoir V, Poirel L, Aubert C et al. Unexpected occurrence of
plasmid-mediated quinolone resistance determinants in environmental
Aeromonas spp. Emerg Infect Dis 2008; 14: 231–7.
39 Ben Sallem R, Ben Slama K, Rojo-Bezares B et al. IncI1 plasmids carrying
blaCTX-M-1 or blaCMY-2 genes in Escherichia coli from healthy humans and
animals in Tunisia. Microb Drug Resist 2014; 20: 495–500.
40 Espedido BA, Dimitrijovski B, van Hal SJ et al. The use of wholegenome
sequencing for molecular epidemiology and antimicrobial
surveillance: identifying the role of IncX3 plasmids and the spread
of blaNDM-4-like genes in the Enterobacteriaceae. J Clin Pathol 2015;
68: 835–8.
Prevalence and diversity of IncX plasmids
7 of 7
700
705
710
715
720
725
730
735
740
745
750
755
760
765
770
775
780
785
790
795
800
805
810
JAC