MOLECULAR AND CELLULAR BIOLOGY, Jan. 2005, p. 185–196 Vol. 25, No. 1
0270-7306/05/$08.00ϩ0 doi:10.1128/MCB.25.1.185–196.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Nse2, a Component of the Smc5-6 Complex, Is a SUMO Ligase
Required for the Response to DNA Damage
Emily A. Andrews, Jan Palecek, John Sergeant, Elaine Taylor, Alan R. Lehmann,
and Felicity Z. Watts*
Genome Damage and Stability Centre, School of Life Sciences, University of Sussex,
Falmer, Brighton, United Kingdom
Received 21 May 2004/Returned for modification 30 June 2004/Accepted 24 September 2004
The Schizosaccharomyces pombe SMC proteins Rad18 (Smc6) and Spr18 (Smc5) exist in a high-Mr complex
which also contains the non-SMC proteins Nse1, Nse2, Nse3, and Rad62. The Smc5-6 complex, which is
essential for viability, is required for several aspects of DNA metabolism, including recombinational repair and
maintenance of the DNA damage checkpoint. We have characterized Nse2 and show here that it is a SUMO
ligase. Smc6 (Rad18) and Nse3, but not Smc5 (Spr18) or Nse1, are sumoylated in vitro in an Nse2-dependent
manner, and Nse2 is itself autosumoylated, predominantly on the C-terminal part of the protein. Mutations of
C195 and H197 in the Nse2 RING-finger-like motif abolish Nse2-dependent sumoylation. nse2.SA mutant cells,
in which nse2.C195S-H197A is integrated as the sole copy of nse2, are viable, whereas the deletion of nse2 is
lethal. Smc6 (Rad18) is sumoylated in vivo: the sumoylation level is increased upon exposure to DNA damage
and is drastically reduced in the nse2.SA strain. Since nse2.SA cells are sensitive to DNA-damaging agents and
to exposure to hydroxyurea, this implicates the Nse2-dependent sumoylation activity in DNA damage responses
but not in the essential function of the Smc5-6 complex.
SUMO is a small ubiquitin-like protein that is covalently
attached to target proteins. In yeasts and lower eukaryotes,
SUMO is encoded by a single gene, while in higher eukaryotes
there are three isoforms, SUMO-1, SUMO-2, and SUMO-3.
The attachment of SUMO to target proteins is similar to the
process of ubiquitination: SUMO is produced as a precursor
protein which is processed to the mature form by SUMO
proteases, revealing a diglycine motif. SUMO is subsequently
activated by the formation of a thioester bond with a cysteine
residue on the SUMO E1-like activator enzyme, a heterodimer
known as SAE. SUMO is then passed to an E2-like SUMO
conjugator, with which it also forms a thioester bond at a
cysteine residue. SUMO ligases have been identified in several
organisms. However, whereas E3 ligases are required for the
attachment of ubiquitin to targets both in vitro and in vivo, the
requirement for SUMO ligases for the attachment of SUMO
to targets appears to be less stringent in vitro, and possibly also
in vivo. This would be consistent with reports that several
SUMO target proteins interact directly with the E2-like
SUMO conjugator (e.g., see reference 4).
Two classes of SUMO ligases have been identified. Proteins
in the first category contain C3HC4-like RING domains, while
proteins in the second category do not. Members of the first
category include the Saccharomyces cerevisiae proteins Siz1
and Siz2 (16) and the mammalian PIAS family of proteins (20,
32, 38). Members of the second category include the RanBP2
and Pc proteins (18, 33). In S. cerevisiae (budding yeast), the
SIZ1 and SIZ2 genes are not essential for viability, and null
mutants do not show the severe cell and nuclear morphologies
(16) that are observed with mutants that are defective in other
components of the sumoylation system (17, 39). It remains
unclear if there are additional SUMO ligases in S. cerevisiae or
if the SUMO ligases serve to facilitate only a subset of SUMO
conjugation reactions, with the remainder being driven by direct
interactions with the E2-like conjugator.
In Schizosaccharomyces pombe (fission yeast), SUMO is encoded
by the pmt3 gene (44), while the SAE heterodimer and
the SUMO conjugator are encoded by the fub2, rad31, and
hus5 genes, respectively (1, 12, 40, 44). Early analyses of rad31
and hus5 mutants indicated that cells defective in SUMO conjugation
were sensitive to DNA-damaging agents, such as UV
and ionizing radiation (IR), and to the DNA synthesis inhibitor
hydroxyurea (HU) (1, 40). These results imply that sumoylation
is required for the DNA damage response in fission yeast.
Several DNA replication and repair proteins have recently
been shown to be sumoylated. These include PCNA in S.
cerevisiae (14, 41), topoisomerase I and thymine DNA glycosylase
in humans (9, 25, 27), topoisomerase II in both humans
and S. cerevisiae (2, 24), and Rad22 (the homologue of Rad52)
in S. pombe (12). In the case of S. cerevisiae PCNA, sumoylation
occurs on two sites in the protein, one of which is also
targeted by ubiquitin. Sumoylation of PCNA occurs during
normal S phase, while mono- and polyubiquitination are required
for different modes of replication past DNA damage
(14, 41).
The precise function of SUMO modification remains unknown.
Unlike ubiquitination, sumoylation does not target
proteins for proteasome-mediated destruction. SUMO modification
has been reported to have a range of effects on protein
function, but there is no unifying theme underlying how these
effects are mediated. In some cases, SUMO and ubiquitin
compete for the same lysine residue, e.g., in the cases of I␬B␣
and PCNA (7, 14, 41). Sumoylation has been proposed to
antagonize both ubiquitin-dependent degradation (in the case
* Corresponding author. Mailing address: Genome Damage and
Stability Centre, School of Life Sciences, University of Sussex, Falmer,
Brighton BN1 9RQ, United Kingdom. Phone: 1273 678257. Fax: 1273
678433. E-mail: f.z.watts@sussex.ac.uk.
185
of I␬B␣) and ubiquitin-mediated changes in protein function
(in the case of PCNA). SUMO modification has also been
shown to affect protein localization and protein-protein interactions.
For example, sumoylation of PML is required for the
recruitment of Daax and Sp100 to discrete subnuclear bodies
termed PODs (15, 22, 46), and sumoylation of RanGAP1 is
required for its association with RanBP2 (23, 35).
Smc6 (Rad18) is a member of the SMC family of proteins
and interacts with Smc5 (Spr18) to form the core of an Smc5-6
complex in fission yeast (8, 21) that is required for several
aspects of DNA metabolism. Smc6 mutants (rad18.X and
rad18.74) have been characterized as defective in recombinational
repair processes (21, 31) and in the maintenance of the
DNA integrity checkpoint in the presence of persistent unrepaired
DNA damage (45). Unlike proteins involved in homologous
recombination and checkpoint functions in fission yeast,
the Smc5-6 complex also has an essential function (21). The
nature of this defect is unclear, but it results in spontaneous
checkpoint activation (10) and may be related to chromosomal
fragmentation over several generations of growth (28). Smc6
(Rad18) and Smc5 (Spr18) have been shown to form a high-Mr
complex (8) which contains several non-SMC proteins (26; see
also the accompanying paper [39a]), namely, Nse1, Nse2, Nse3,
and Rad62.
We demonstrate here that Nse2 is an autosumoylating
SUMO ligase and confirm that it is part of the Smc5-6 complex.
Using an in vitro sumoylation assay to analyze constituents
of the Smc5-6 complex, we found that Smc6 (Rad18) and
Nse3 are sumoylated in an Nse2-dependent manner but that
Smc5 (Spr18) and Nse1 are not. Mutations of two residues in
the C3HC4 RING-like domain of Nse2 resulted in a loss of
in vitro SUMO ligase activity, and a corresponding strain
(nse2.SA) containing the mutated gene as a single copy was
viable but failed to efficiently sumoylate Smc6 (Rad18) in vivo.
nse2 deletion cells were inviable, whereas nse2.SA cells were
viable but sensitive to DNA-damaging agents and to the DNA
synthesis inhibitor HU.
MATERIALS AND METHODS
Strains and plasmids. The wild-type S. pombe strain used for experiments was
sp0.011 (ade6-704 ura4-⌬18 leu1-32 hϪ
) unless otherwise stated. rad18.X was
described previously (21), rad18.74 was obtained from M. O’Connell (45), and
rad18.T2 and rhp51.d were described elsewhere (29, 39a). The nse2 open reading
frame (ORF) was amplified from cDNA by a PCR using the following primers:
E32_EcoRI (5Ј GAATTCAAATGAGTGTGAAGCACAATTAAAAAC 3Ј)
and E32_NcoI (5Ј CCATGGGACTAAGCTTCTTTTAAATTAC 3Ј). The rad18
(smc6) and spr18 (smc5) ORFs have been described elsewhere (8, 21). The nse1
and nse3 ORFs and partial sequences of smc6 (rad18) and nse2 were described
in the accompanying paper (39a). The nse2 ORF was deleted by transformation
of a diploid strain with a DNA fragment comprising 1 kb of the nse2 5Ј region,
ura4, and 1 kb of the nse2 3Ј region. The 5Ј region was amplified by use of the
following primers: Nse2_KpnIF (5Ј CTGGTACCGAATCAGACGAGCAAGA
ATCTCG 3Ј) and Nse2_XhoIR (5Ј GTGCTCGAGTCATTTACGATTCCATT
CGAG 3Ј). The 3Ј region was amplified by the use of primers Nse2_EcoRIF (5Ј
GAATTCTATTTACATTGTAGTACTGATCCCGG 3Ј) and Nse2_PstIR (5Ј
CTGCAGCATCAACAGTTGTTCTGCCTCTCAGAC 3Ј). Truncated forms of
Nse2 were created as described by Sergeant et al. (39a). The nse2.SA mutant was
created by use of the primers Nse2_C195S,H197A.F (5Ј CCCAATATTATCG
ACAGCCTCTAATGCTTTTTATGAAAAAGATGC 3Ј) and Nse2_C195S,
H197A.R (5Ј GCATCTTTTTCATAAAAAGCATTAGAGGCTGTCGATAAT
ATTGGG 3Ј). The nse2.SA mutant sequence was integrated into the genome
with the ura4 gene cloned between the 3Ј end of the nse2 ORF and the nse2 3Ј
region amplified as described above. A wild-type control (nse2.CH) containing
the ura4 gene adjacent to the wild-type nse2 sequence was created in parallel in
a similar manner.
Proteins were expressed in Escherichia coli as glutathione S-transferase (GST)
fusions by use of a modified form of pGEXGH (a gift from H. Lindsay, Sussex,
United Kingdom) or as His-tagged proteins by the use of pET15b (Novagen).
For expression in S. pombe, cDNAs were cloned into pREP42MH or pREP41MH
under the control of a modified form of the nmt1 promoter (6).
Protein methods and in vitro sumoylation assay. An in vitro sumoylation assay
was used as described previously (12). pmt3.GG and pmt3.GG,K30R were created
by site-directed mutagenesis as described elsewhere (J. Ho F. Z. Watts,
submitted for publication). Gel filtration was performed with 200-ml exponentially
growing cultures. Cells were harvested, washed, and then resuspended in 1
ml of lysis buffer (45 mM HEPES [pH 6.8], 300 mM KCl, 5 mM EGTA, 12 mM
NaF, 10% glycerol, 80 mM ␤-glycerophosphate, 0.1 mM sodium orthovanadate,
1 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, 3 mM MgCl2, and a
protease inhibitor cocktail consisting of 5 ␮g each of trypsin inhibitor, pepstatin,
leupeptin, and aprotinin/ml, 10 ␮g each of bestatin and E-64/ml, and 50 ␮g of
chymostatin/ml). The cells were then broken in a ribolyser, and cell debris was
removed by centrifugation twice at 45,000 ϫ g for 10 min. Proteins (1.5 mg) were
loaded onto a Superdex 200 column, and 0.5-ml fractions were collected. Fifteen
microliters of each fraction was analyzed by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-PAGE).
Total cell extracts were prepared by the use of trichloroacetic acid as described
by Caspari et al. (5). Ni2ϩ
pull-down experiments were performed as described
previously (12). Immunoprecipitation was undertaken with cells in which the
genomic smc6 (rad18) gene was N-terminally tagged with the c-myc epitope (8)
as in the accompanying paper (39a).
Anti-SUMO antisera were raised as described previously (12), anti-GST antisera
were a gift from S. Morley (Sussex, United Kingdom), anti-Smc5 (Spr18)
antisera were described previously (8), and anti-Smc6 (Rad18) and anti-Nse1
antisera were described in the accompanying paper (39a). Anti-Nse2 antisera
were prepared by the use of a recombinant Nse2 protein, which was prepared by
thrombin cleavage of GST-tagged Nse2 to remove the GST, followed by injection
into New Zealand White rabbits. The antibodies were affinity purified with
glutathione-Sepharose beads to which GST-Nse2 had been cross-linked. Antitubulin
monoclonal antibodies were purchased from Sigma.
Analysis of DNA damage and HU sensitivity. UV and IR sensitivities were
analyzed as described previously (30). HU and methyl methanesulfonate (MMS)
sensitivities were analyzed by plating cells on yeast extract-agar plates containing
6 mM HU or 0.005% MMS. Synchronous cultures were prepared with lactose
gradients (3). G2 cells were irradiated with 200 or 400 Gy of IR before incubation
at 30°C. Samples were taken at 20-min intervals postirradiation for DAPI (4Ј,6Јdiamidino-2-phenylindole)
staining. Pulsed-field gel electrophoresis was performed
with 20 A595 units of untreated exponentially growing cells or treated
cells at various times after exposure to 450 Gy of IR. The cells were washed twice
with CSE (20 mM citrate-phosphate [pH 5.6], 40 mM EDTA, 1.2 M sorbitol) and
then incubated with 5 ml of CSE containing zymolyase (1.5 mg/ml) at 37°C for
1 h. The cells were then resuspended in 300 ␮l of TSE (10 mM Tris-HCl [pH 7.5],
45 mM EDTA, 0.9 M sorbitol) and warmed to 37°C. Next, 1.3 volumes of 1%
LGT agarose were added, and 100-␮l aliquots were dispensed into a plug mold.
The cells were lysed by incubating the plugs in a solution containing 50 mM
Tris-HCl (pH 7.5), 25 mM EDTA, and 1% SDS for 90 min at 55°C. The plugs
were then transferred to a solution containing 1% lauryl sarcosine, 0.5 mM
EDTA (pH 9.5), and 0.5 mg of proteinase K/ml and incubated at 55°C for 48 h.
Fresh proteinase K was added (to 0.5 mg/ml) after 24 h. The plugs were inserted
into wells in 0.8% agarose gels in 1ϫ Tris-acetate-EDTA. The gels were run for
48 h with a pulse time of 1,800 s at 2 V/cm and an angle of 100°. The gels were
then stained with ethidium bromide and photographed.
RESULTS
nse2 encodes a SUMO ligase. BLAST searches using the
S. cerevisiae Siz1 SUMO ligase protein identified a related
protein in the fission yeast S. pombe encoded by ORF
SPAC1687.05. A characterization of this ORF, which we have
named Pli1, will be described elsewhere (Ho et al., submitted).
Using the Pli1 amino acid sequence to search the database for
related S. pombe proteins, we identified the protein encoded by
SPAC16A10.06c, the closest S. pombe homolog of the S. cerevisiae
Mms21 protein. An alignment of the N-terminal region
186 ANDREWS ET AL. MOL. CELL. BIOL.
of these four proteins is shown in Fig. 1A. The SPAC16A10.06c
ORF encodes the Nse2 protein, which was recently identified
both by McDonald et al. (26) and by ourselves (39a; also see
below) as part of the Smc5-6 complex. We amplified the coding
sequence of Nse2 from cDNA (see Materials and Methods). A
sequence analysis of the cDNA and a comparison with the
genomic sequence indicated that the gene contains two introns,
I and II, of 247 and 115 nucleotides (nt), respectively.
Intron II is larger than that predicted by McDonald et al. (26)
and involves a different, upstream 5Ј splice site, the sequence
of which (5Ј GTACGT 3Ј) closely matches the 5Ј splice site
consensus sequence. The cDNA thus encodes a protein with a
predicted Mr of approximately 29 kDa and with 250 amino
acids (aa), which is 17 aa shorter than that previously predicted
(26).
Pairwise comparisons (Fig. 1B) of the full sequences of
Nse2, Mms21, Pli1, and Siz1 (which comprise 250, 267, 727,
and 750 aa, respectively) indicated that the two pairs of sequences
with the highest identities are Pli1 and Siz1 (23%
identical) and Nse2 and Mms21 (21% identical). A key feature
FIG. 1. Nse2 has homology to SUMO ligases. (A) Sequence alignment of the N-terminal sequences of S. pombe Nse2 (aa 1 to 237 or 250) and
Pli1 (aa 1 to 375 or 727) with those of S. cerevisiae Siz1 (aa 1 to 420 or 750) and Mms21 (1 to 253 or 267), created by use of the ClustalW program.
Dark shading, identical amino acids; light shading, conserved residues, *, conserved Cys and His residues (C195 and H197 in Nse2). (B)
Percentages of identity between S. cerevisiae Mms21 and Siz1 and S. pombe Pli1 and Nse2. The first figure in each pair is the percent identity along
the full length of the proteins, and the figure in parentheses is the percent identity between RING-finger-like domains.
VOL. 25, 2005 Nse2 IS A SUMO LIGASE 187
of the Siz1 class of SUMO ligases is the presence of a C3HC4
RING-finger-like domain. A related sequence occurs in the
Nse2 protein, between aa 179 and 219. Focusing on this region
of the proteins, we again observed the highest sequence identity
between Pli1 and Siz1 (43%), with all other pairwise comparisons
yielding figures of 21 to 25%.
SUMO ligase activity. The cDNA encoding the Nse2 ORF
was cloned into the E. coli expression vector pGEX and transformed
into E. coli cells, and the GST-tagged fusion protein
was purified by the use of glutathione-Sepharose from induced
cell extracts as described in Materials and Methods. The resulting
protein migrated close to the predicted size of 55 kDa
for GST-tagged Nse2 (Fig. 2A, lane 2). In order to determine
whether Nse2 has SUMO ligase activity, we assayed the fusion
protein by using a previously established in vitro sumoylation
system (12). SUMO has been shown to be capable of forming
chains in vitro, as determined by the production of high-Mr
SUMO-containing species in vitro in the absence of a target
protein (16). The production of these conjugated species is
dependent on the addition of the E1-like SAE heterodimer,
the E2-like conjugator Hus5, and Pmt3 (SUMO) (data not
shown). Under conditions in which the level of the E2-like
conjugator Hus5 was kept low (0.05 ␮g/␮l), the level of SUMO
conjugates also remained low (Fig. 2B, lane 1). Under these
conditions, the addition of Nse2 (0.2 ␮g/␮l) resulted in a substantial
increase in the level of SUMO chains (lane 2). This is
consistent with Nse2 having SUMO ligase activity when assayed
for SUMO chain formation.
Previous studies of Pli1 suggested that K30 is the major
acceptor lysine for chain formation by SUMO (Ho et al., submitted).
A comparison of lanes 2 and 4 in Fig. 2B indicates that
Pmt3.GG (K30R) is a less efficient substrate for chain formation
by Nse2 than is Pmt3.GG. This result indicates that K30 is
a major acceptor site for Pmt3 modification but that it may not
be the only lysine capable of accepting Pmt3 linkage in this
assay. Previous reports indicated that the mature form of
SUMO (Pmt3.GG) is required for both chain formation and
sumoylation of target proteins (17; Ho et al., submitted). We
FIG. 2. Nse2 has SUMO ligase activity. (A) Expression of Nse2 in E. coli. ORF SPAC16A10.06c, which was amplified by PCR and cloned into
pGEX, was expressed in BL21 cells, purified by the use of glutathione-Sepharose (lane 2), and compared to extracts from cells transformed with
the empty pGEX vector (lane 1). (B) Pmt3 sequence requirements. The results of an in vitro sumoylation assay to test three forms of Pmt3
(Pmt3.GG, Pmt3.GG,K30R, and Pmt3) are shown. Hus5 (0.05 ␮g/␮l) was used in all assays. The products were analyzed by Western blotting with
anti-Pmt3 antisera. The species migrating at about 35 and 50 kDa are likely SUMO chains and reaction intermediates. The arrow indicates the
junction of stacking and separating gels. (C) Nse2 is itself sumoylated. An in vitro sumoylation assay was performed with 35
S-labeled Nse2 as a
substrate and with 0.05 ␮g of Hus5/␮l. The products were separated by SDS-PAGE and detected with a phosphorimager. The species migrating
at 37 kDa is a nonspecific band. (D) Sumoylation of Nse2 occurs predominantly on the C-terminal part of the protein in vitro. An in vitro
sumoylation assay was performed with 35
S-labeled N- and C-terminal fragments of Nse2 as indicated. Nse2-N, aa 1 to 178; Nse2-C, aa 114 to 250.
The products were detected as described above. *, modified forms.
188 ANDREWS ET AL. MOL. CELL. BIOL.
therefore determined whether this is also the case for Nse2mediated
sumoylation. Figure 2B, lanes 5 and 6, indicates that
SUMO chains are not formed when the sole source of SUMO
is the precursor form (Pmt3), even in the presence of Nse2
(lane 6). This is in contrast to what was observed with the
mature form (Pmt3.GG, lanes 1 and 2). Together, these data
demonstrate that the activity associated with Nse2 behaves like
a bona fide SUMO ligase activity in vitro.
Nse2 is itself sumoylated. Many of the previously characterized
SUMO ligases have been demonstrated to be sumoylated
themselves (18, 36, 43). To determine whether Nse2 can also
be modified by SUMO, we tested Nse2 labeled with [35
S]methionine
(by in vitro translation) as a potential substrate in the
in vitro sumoylation assay described above. Figure 2C indicates
that the incubation of 35
S-labeled Nse2 with the SAE heterodimer,
Hus5, and SUMO (Pmt3.GG) resulted in the appearance
of slower migrating forms with sizes consistent with
their being sumoylated species of Nse2 (lane 2). The presence
of these species was dependent on SAE, Hus5, and Pmt3 (data
not shown), further confirming that they are sumoylated forms
of Nse2.
At least three modified forms of Nse2 were observed (Fig.
2C, lane 2). These may have arisen due to the use of more than
one SUMO acceptor site or to the production of SUMO
chains. Sumoylation occurs on lysine residues that are generally
in the context of a consensus sequence, ␺KxE (where ␺ is
a hydrophobic amino acid). Nse2 has 17 lysine residues. We
separately tested the N-terminal 178-aa (1–178) region of Nse2
and a C-terminal fragment of 127 aa (114–250) which contains
the C3HC4 RING-finger-like domain for the ability to be
sumoylated in vitro. Figure 2D, lane 2, indicates that there was
a weak modification of the N-terminal fragment when it was
incubated in the presence of all of the assay components (compare
lane 2 to the situation in the absence of added Pmt3.GG
[lane 1]). In contrast, when the C-terminal fragment was used
in the in vitro assay, we found a more profound modification in
the presence of all of the assay components (compare lane 4 to
the situation in the absence of added Pmt3.GG [lane 3]).
Nse2 complexes. Nse2 was recently identified as a component
of the Smc5-6 complex in fission yeast (26; see also the
accompanying paper [39a]). The SMC proteins Smc6 (Rad18)
and Smc5 (Spr18) form the core of a multiprotein complex in
S. pombe. We investigated whether Nse2 is present in S. pombe
extracts solely in a Smc6 (Rad18)-containing complex or
whether it is also present in other complexes or in a monomer
form. Total soluble cell extracts prepared from wild-type S.
pombe were analyzed by gel filtration as described in Materials
and Methods, and the resulting fractions were analyzed by
Western blotting. Figure 3 indicates that the majority of the
Nse2 protein comigrated with Smc6 (Rad18). Nse2 was present
in fractions 7 to 9, which corresponded to molecular masses of
Ͼ670 kDa. In contrast, Smc6 (Rad18) and Smc5 (Spr18) were
present in these fractions but were also abundant in fractions
10 and 11, corresponding to molecular masses of approximately
670 kDa. The absence of Nse1 and Nse2 from fractions
10 and 11 suggests that there may be other forms of the Smc6Smc5
(Rad18-Spr18) complex, one of which contains Nse1 and
Nse2 and another that does not. An alternative explanation is
that Nse1 and Nse2 are less tightly associated with the complex
and dissociate during purification. Nse1 and Nse2 were also
observed in fractions 23 to 26 and in fractions 21 and 22,
respectively, consistent with the sizes expected for the monomeric
Nse1 and Nse2 proteins.
Nse2 is a SUMO ligase for Smc6 (Rad18) and Nse3. We
wished to determine whether other members of the Smc5-6
(Spr18-Rad18) complex are sumoylated and, if so, whether
these modifications are dependent on Nse2. Figure 4A to D
show the results of an in vitro sumoylation assay using Smc6
(Rad18), Smc5 (Spr18), Nse1, and Nse3 as target proteins. For
these assays, the level of Hus5 was kept low (0.05 ␮g/␮l). In the
absence of Nse2, modified forms of Smc6 (Rad18) were not
observed (panel A, lane 2), and only low levels of modified
forms of Nse3 were observed (panel D, lane 2). In both of
these cases, the addition of Nse2 to the reaction (0.2 ␮g/␮l)
resulted in an increase in the levels of the sumoylated forms
compared to those observed in the absence of Nse2 (cf. lanes
3 in panels A and D). The addition of the other S. pombe
SUMO ligase, Pli1 (0.2 ␮g/␮l), resulted in a low level of sumoylation
of Rad18 (panel A, lane 4), but this was lower than that
observed with Nse2 (lane 3). In contrast to what we observed
with Smc6 (Rad18) and Nse3, we did not detect any sumoylated
forms of Smc5 (Spr18) or Nse1 in the in vitro assay (Fig.
4B and C), even when we used large amounts (0.15 ␮g/␮l) of
Hus5 (data not shown). Consistent with this, we did not observe
modification even in the presence of Nse2 (lane 3). These
data indicate that Smc6 (Rad18) and Nse3, but not Nse1 or
Smc5 (Spr18), are modified by SUMO in vitro and that this
modification is stimulated by Nse2-dependent SUMO ligase
activity.
Smc6 (Rad18) is sumoylated in vivo. To investigate the
possible biological significance of the sumoylation of Smc6
(Rad18) in vitro, we investigated whether Smc6 (Rad18)
is modified in vivo. First, we overexpressed Myc-His-tagged
Smc6 (Rad18) in wild-type cells and purified the expressed
protein by using Ni2ϩ
-agarose beads (see Materials and Methods).
The purified proteins were analyzed by Western blotting
with anti-Myc (Smc6) and anti-Pmt3 (SUMO) antisera. Figure
4E indicates that no species were observed that cross-reacted
with the anti-Myc antiserum when an extract was prepared
from cells transformed with the empty vector, pREP42MH
(lane 1), and that after the purification of Ni2ϩ
binding proteins
from this control extract, no anti-Myc-reactive species
were detected (lane 3). In contrast, species of 135 and 155 kDa
were observed in total extracts prepared from cells transformed
with pREP42MH-Smc6 (Rad18) (lane 2). After puriFIG.
3. Nse2 is present in high-molecular-mass complexes. A wildtype
cell extract was analyzed by gel filtration on a Superdex 200
column and Western blotted with antisera as indicated.
VOL. 25, 2005 Nse2 IS A SUMO LIGASE 189
fication of the Ni2ϩ
binding proteins by the use of Ni2ϩ
-agarose
(lane 4), these same species could be detected. Probing a
parallel blot of these Ni2ϩ
-agarose-purified samples with antiPmt3
antisera (lanes 5 and 6) allowed the detection of species
of 155 and 175 kDa (lane 6). The faster migrating (155 kDa)
band of the anti-Pmt3-reactive species was coincident with the
slower migrating anti-Myc-reactive species observed in lanes 2
and 4. The 155- and 175-kDa species likely corresponded to
FIG. 4. Smc6 (Rad18) and Nse3 are sumoylated in an Nse2-dependent manner in vitro, and Smc6 (Rad18) is sumoylated in vivo. (A to D)
35
S-labeled proteins were tested with in vitro sumoylation assays using 0.05 ␮g of Hus5/␮l and 0 or 0.2 ␮g of Nse2 or Pli1/␮l, as indicated. (A) Smc6
(Rad18); (B) Smc5 (Spr18); (C) Nse1; (D) Nse3. (E) Smc6 (Rad18) is sumoylated in vivo. Ni2ϩ
pull-down assays were performed with cell extracts
from cells transformed with pREP42MH (empty vector) (lanes 1, 3, 5, and 7) or pREP42MH-Rad18 (Smc6) (lanes 2, 4, 6, and 8). TCA, total cell
extract controls. Western analysis was conducted with anti-Myc or anti-Pmt3 antisera as indicated. (F) Sumoylation of Smc6 (Rad18) expressed
at wild-type levels increases after exposure to MMS. Lysates (containing 50 mg of total protein) prepared from a Myc-tagged Smc6 (Rad18) strain
and an untagged control with or without exposure to MMS (0.01%) were incubated overnight at 4°C with an anti-Myc antibody that had been
previously cross-linked to protein G-Sepharose beads. The beads were washed extensively, and bound proteins were eluted by incubation with 100
mM glycine, pH 2.3, separated by SDS-PAGE, and analyzed by Western blotting (WB) with anti-Myc and anti-Pmt3 antibodies, as indicated. Lanes
1, 2, 5, 7, and 8, Myc-tagged Rad18 (Smc6) strain; lanes 3, 4, 6, 9, and 10, wild type (untagged Rad18 [Smc6]). Lanes 5 and 6 are the same as lanes
7 and 9, but with longer exposure times. *, modified forms.
190 ANDREWS ET AL. MOL. CELL. BIOL.
mono- and disumoylated forms of Smc6 (Rad18). Again, these
anti-Pmt3-reactive species were not observed in extracts of
cells transformed with the empty vector (lane 5). (Lanes 7 and
8 show the results of probing the total cell extract with antiPmt3
antisera.) Taken together, these data indicate that Smc6
(Rad18) is sumoylated in vivo.
To demonstrate that Smc6 (Rad18) is sumoylated when expressed
at wild-type levels, we performed immunoprecipitation
with extracts of cells in which Smc6 (Rad18) was tagged
with Myc in the genome (Fig. 4F, lanes 1 and 5), using an
untagged strain as a negative control (lanes 3 and 6). Probing
the Western blots with anti-Pmt3 antisera indicated two
modified forms of Smc6 (Rad18) after a long exposure of
the film (lane 5), at 155 and 175 kDa, which were absent
from the negative control (lane 6). This demonstrates that
Smc6 (Rad18) is sumoylated in vivo when expressed at wildtype
levels. Since Smc6 (Rad18) has roles in the DNA damage
response, we were interested to determine whether
sumoylation of the protein was affected by the exposure of
cells to DNA-damaging agents. Even after a short exposure
of the film, strong bands of sumoylated Smc6 (Rad18) were
observed for cells 3 h after the treatment of cells with MMS
(0.01%) (lane 8), in contrast to the weaker levels of sumoylation
in untreated cells (lane 7).
FIG. 5. Mutation of C195 and H197 results in a loss of sumoylating activity in vitro and in vivo. (A) Nse2.SA protein is unable to form SUMO
chains in vitro. An in vitro sumoylation assay was performed in the absence of an added target protein, with 0.05 ␮g of Hus5/␮l. The products were
detected by Western analysis with anti-Pmt3 antisera. The arrow indicates the junction of stacking and separating gels. (B) Nse2.SA does not
facilitate sumoylation of Smc6 (Rad18) in vitro. An in vitro sumoylation assay was performed with 35
S-labeled Smc6 (Rad18) and 0.05 ␮g of
Hus5/␮l. The products were detected with a phosphorimager. (C) Nse2.SA is not sumoylated in vitro. An in vitro sumoylation assay was performed
with an 35
S-labeled wild-type or mutant (Nse2.SA) Nse2 protein. The products were detected as described for panel B. (D) Western analysis of
total cell extracts probed with anti-Pmt3 antisera (top) or anti-tubulin antisera (bottom). Lane 1, wild type (sp.011); lane2, rad31.d; lane 3, hus5.17;
lane 4, hus5.62; lane 5, pli1.d; lane 6, nse2.SA; lane 7, nse2.CH. (E) nse2.SA cells have reduced levels of sumoylated Smc6 (Rad18). Extracts of
wild-type (nse2.CH) (lanes 3 and 4) and mutant (nse2.SA) (lanes 1 and 2) strains harboring either pREP41MH-Rad18 (Smc6) (lanes 1 and 3) or
the empty pREP41MH vector (lanes 2 and 4) were bound to nickel beads under denaturing conditions, and the bound proteins were analyzed by
immunoblotting with either anti-Myc or anti-Pmt3 antibodies as indicated. *, modified forms.
VOL. 25, 2005 Nse2 IS A SUMO LIGASE 191
The RING domain of Nse2 is required for sumoylation in
vitro. To determine whether the C3HC4 RING-finger-like domain
of Nse2 is required for its sumoylation activity, we mutated
Cys195 and His197 to Ser and Ala, respectively. The
mutant protein (Nse2.SA) was expressed in E. coli, and its
sumoylation activity was assayed in vitro for both the ability to
promote SUMO chain formation and the ability to act as a
SUMO ligase for Smc6 (Rad18). Figure 5A indicates that,
whereas wild-type Nse2 has the ability to form high-Mr SUMOcontaining
species (lane 3), this ability is lacking in the
Nse2.SA mutant protein (lane 4). Figure 5B indicates that, as
previously observed in Fig. 4A, the wild-type Nse2 protein
increased the level of sumoylated Smc6 (Rad18) forms (lanes
3 and 4) compared to equivalent reactions lacking Nse2 (lane
2). In contrast, the Nse2.SA mutant protein was not able to
promote the appearance of modified forms of Smc6 (Rad18)
(lane 5).
If the Nse2.SA protein is ligase-dead, we should be able to
determine if the SUMO modification we observed for Nse2
itself was a result of in cis autosumoylation or of an in trans
reaction by which one Nse2 molecule promoted the ligation of
SUMO onto a second Nse2 molecule. We thus tested the
35
S-labeled mutant Nse2 protein for its ability to be sumoylated.
Figure 5C indicates that, in contrast to wild-type Nse2
(lanes 1 to 3), the Nse2.SA mutant protein was not modified
(lanes 5 and 6). Importantly, this remained the case when the
wild-type Nse2 protein (0.2 ␮g/␮l) was added to the reaction
(lane 6). This indicates that the Nse2.SA mutant protein is not
recognized as a substrate by wild-type Nse2, suggesting that the
SUMO modification of Nse2 occurs by autosumoylation. This
was confirmed in lane 3, in which the addition of wild-type
unlabeled Nse2 to a reaction using 35
S-labeled wild-type Nse2
decreased the level of sumoylation of the labeled species.
Given the ratio of mutant to wild-type Nse2 in these reactions,
we do not favor a model whereby the mutant protein acts as a
dominant-negative inhibitor of wild-type Nse2.
The nse2.SA mutant has reduced levels of sumoylated Rad18
(Smc6). Smc6 (Rad18), Smc5 (Spr18), and Nse1 are all essential
genes (8, 21, 26). We therefore determined whether or not
nse2 is essential for viability. One copy of the nse2 gene was
deleted from a diploid strain (see Materials and Methods), and
tetrads were dissected from sporulating heterozygotes. Each
tetrad resulted in only two viable colonies, all of which were
uraϪ
, indicating that nse2 is essential for cell viability. This
confirms the results of MacDonald et al. (26). We were next
interested in determining whether cells containing the nse2.SA
mutation were viable. The nse2.SA mutant sequence was therefore
integrated into the genome as the sole copy of nse2 (see
Materials and Methods). Colonies containing the nse2.SA mutant
gene were successfully obtained by use of a haploid strain
for transformation, indicating that the mutation does not result
in lethality. Backcrossing ensured that suppressor mutations
were not required for this viability.
The nse2.SA mutant strain grew equally well at a range of
temperatures (25 to 36°C), with generation times resembling
those of the wild type, indicating that it is not temperature
sensitive. By performing Western blotting, we showed that the
level of Nse2 protein in nse2.SA cells was identical to that
observed in wild-type total cell extracts (data not shown). Probing
total cell extracts with anti-Pmt3 antisera demonstrated
that the total sumoylation levels in nse2.SA (Fig. 5D, lane 6)
resembled those observed for wild-type cells (lanes 1 and 7).
This was in contrast to the situation seen for deletion mutants
of the other SUMO ligase, pli1 (lane 5) (Ho et al., submitted),
and for rad31.d, hus5.17, and hus5.62 mutants (lanes 2 to 4), in
which sumoylation levels were substantially reduced. We have
also shown by gel filtration that the Smc5-6 complex was not
disrupted in the nse2.SA mutant (data not shown).
We have shown that in vitro, the Nse2.SA protein has a
reduced ability to direct the sumoylation of Smc6 (Rad18). To
determine whether the sumoylation of Smc6 was affected in the
nse2.SA strain in vivo, we performed Ni2ϩ
-agarose affinity purification
as described for Fig. 4E. Extracts were prepared from
nse2.SA and wild-type cells that had been transformed with
either the pREP41MH empty vector control or pREP41MHSmc6
(Rad18). nse2.SA and wild-type cells transformed with
pREP41MH-Smc6 (Rad18) expressed similar levels of MycHis-Smc6
(Rad18) (Fig. 5E, lanes 1 and 3, respectively), indicating
that the stability of the expressed Smc6 (Rad18) protein
was not affected in the mutant strain. After the purification of
Myc-His-Smc6 (Rad18) by Ni2ϩ
-agarose affinity chromatography
from extracts prepared from wild-type cells that had been
transformed with pREP41MH-Smc6 (Rad18), bands corresponding
to SUMO-containing species of 155 and 175 kDa
were observed (Fig. 5E, lane 7). These species were absent
from equivalent purification reactions from extracts of wildtype
cells that had been transformed with the empty vector
(Fig. 5E, lane 8). In contrast, the high-Mr SUMO-containing
species were barely detectable in extracts prepared from
nse2.SA cells that had been transformed with pREP41MHSmc6
(Rad18) (Fig. 5E, lane 5). These data indicate that the
sumoylation of Smc6 (Rad18) is substantially reduced in vivo
in nse2.SA cells.
The nse2.SA mutant is sensitive to DNA-damaging agents
and to HU. Since the Smc5-6 complex is required for a range
of functions associated with the response to DNA damage in
addition to its essential function, we tested the response of the
nse2.SA mutant to DNA-damaging agents and to exposure to
the replication inhibitor HU. Figure 6A and B indicate that the
nse2.SA mutant was significantly, but not dramatically, sensitive
to both UV and ionizing radiation compared to wild-type
cells. It was markedly less sensitive to UV and IR than is the
nse2-1 allele (26). Strikingly, nse2.SA colonies appeared more
slowly than wild-type cells after exposure to UV (data not
shown). This is reminiscent of the response we observed for
rad18.X cells when they were exposed to UV, for which colony
formation was retarded substantially (data not shown). nse2.SA
cells were also sensitive to both HU (6 mM) and MMS (0.005%),
a similar profile to that seen for rad18.X cells (Fig. 6C).
A previous report demonstrated a direct DNA repair defect
associated with rad18.X (45). We thus investigated whether
nse2.SA cells are able to repair DNA double strand breaks by
using pulsed-field gel electrophoresis (PFGE). Figure 6D, lane
1, shows the three undamaged chromosomes in wild-type cells.
After exposure to 450 Gy of ionizing radiation (lane 2), the
chromosomes were damaged, as evidenced by the low-Mr
smear of DNA (lane 2). There was an almost complete repair
of the damage, as judged by the reappearance of intact chromosomes.
The chromosomes in rad18.X appeared somewhat
damaged even before exposure to IR (lane 11), which was
192 ANDREWS ET AL. MOL. CELL. BIOL.
FIG. 6. nse2.SA cells are sensitive to DNA-damaging agents. (A) UV survival analysis. (B) IR survival analysis. (C) HU and MMS sensitivities.
Five-microliter samples of 10-fold dilutions of exponentially growing cultures (5 ϫ 106
/ml) were plated onto yeast extract-agarose plates with
supplements as indicated. (D) PFGE. DNAs from wild-type, nse2.SA, and rad18.X cells before and after exposure to 450 Gy of IR were analyzed
by PFGE. (E and F) Epistasis analysis with rad18.T2 (E) and rhp51.d (F) cells. (G) Analysis of DNA damage checkpoint. Cells that were
synchronized by lactose gradients were incubated at 30°C after no treatment (■), 200 Gy of IR (}), or 400 Gy of IR (Œ). Samples were taken at
20-min intervals and fixed in methanol. They were stained with DAPI and calcofluor, and the percentages of cells that passed mitosis were assessed.
VOL. 25, 2005 Nse2 IS A SUMO LIGASE 193
possibly a sign of a DNA replication defect. Consistent with
previous reports (45), intact chromosomes were not seen even
10 h after the exposure of rad18.X cells to IR, indicating that
they cannot repair double strand breaks. Prior to irradiation,
nse2.SA cells displayed intact chromosomes (lane 6), implying
that DNA replication is not affected in these cells (as a replication
defect would result in retention of the DNA in the wells,
as seen for the rad4ts mutant [37]). The restoration of intact
chromosomes in nse2.SA cells after IR exposure (lanes 7 to 10)
was intermediate between that observed for wild-type (lanes 2
to 5) and for rad18.X (lanes 12 to 15) cells, with a fraction of
whole chromosomes observed after 7 to 10 h (lanes 9 and 10).
These data indicate that nse2.SA cells are partially defective in
double-strand-break repair after exposure to IR.
We next investigated interactions between the nse2.SA mutant
and some of the rad18 alleles. Double mutants of nse2.SA
with rad18.X and rad18.74 were not viable, and a nse2.SA
rad18.T2 double mutant grew more slowly than a rad18.T2
mutant. Epistasis analysis indicated that nse2.SA and rad18.T2
are epistatic in their response to IR (data not shown), but not
in their response to UV (Fig. 6E). To confirm that the nse2.SA
repair defect is epistatic with rhp51-dependent homologous
recombination repair, as previously demonstrated for the
rad18.X mutant (21) and the nse2-1 allele (26), we performed
epistasis analysis for nse2.SA and rhp51.d. nse2.SA was epistatic
with rhp51.d for its response to both UV and IR (Fig. 6F and
data not shown). Furthermore, like the rad18.X mutant, nse2.SA
was not epistatic with mutations in the nucleotide excision repair
pathway (swi10.d and rad16.d [data not shown]).
We compared the cell cycle arrest kinetics of wild-type,
nse2.SA, and rad18.74 cells. Interestingly, asynchronous cultures
of nse2.SA and rad18.74 cells both contained a small
proportion of elongated cells and cells with aberrant chromosomes
(data not shown), suggesting that there is a mitotic
defect in these cells. We analyzed checkpoint profiles of irradiated
synchronized cultures after irradiation by DAPI staining
to determine whether the cells were able to arrest the cell cycle
in response to DNA damage. G2-phase cultures were exposed
to 200 or 400 Gy of ionizing radiation, and the percentages of
cells that passed mitosis were monitored. As observed with
wild-type cells, nse2.SA and rad18.74 cells arrested the cell
cycle after exposure to IR in a dose-dependent manner (Fig.
6G) and returned to the cell cycle with similar kinetics to the
wild type.
DISCUSSION
The role of sumoylation is beginning to be elucidated for
many proteins. For example, sumoylation has roles in enhancing
protein-protein interaction capabilities and in conferring
specific subcellular localization properties. However, a coherent
molecular explanation for the influence of SUMO modification
on the change in function for individual proteins is not
yet forthcoming. It is possible either that a single physical
change in properties underpins the diverse functions assigned
to SUMO modification or that the modification can cause
specific proteins to acquire one or more of a diverse range of
properties. Equally poorly understood is the precise role of the
SUMO ligases in promoting SUMO modification. In S. cerevisiae,
deletion of the genes encoding the Siz1 and Siz2 proteins
results in only a weak phenotype (16), whereas the complete
loss of SUMO conjugation activity has a more dramatic effect
(e.g., see reference 39). This is consistent with the fact that the
SUMO conjugators have often been reported to be direct
binding partners for SUMO target proteins and that SUMO
modification can occur in vitro without the presence of a ligase
in a manner that is enhanced by increased concentrations of
the conjugator. Thus, it is possible that in vivo, as seen in vitro,
SUMO ligases act as efficiency factors for sumoylation rather
than being absolutely required for modification. This contrasts
with the role of the majority of ubiquitin ligases (11).
In S. pombe, a complete loss of SUMO conjugation results in
very sick cells that cannot be propagated beyond microcolonies
(1, 44). Here we demonstrated that the essential nse2 gene has
SUMO ligase activity. We also demonstrated that the highly
conserved Cys and His amino acids in the C3HC4 RINGfinger-like
domain are required for SUMO ligase activity in
vitro. The requirement for this RING-finger-like domain has
also been observed for Siz1 and some of the PIAS proteins (19,
32, 42). Our data show, however, that the inviability of the nse2
null mutant is not a consequence of a lack of Nse2-dependent
SUMO ligase activity.
We and others (26, 39a) have shown that Nse2 is a component
of the S. pombe Smc5-6 complex. Previous reports of
C3HC4-like domain-containing SUMO ligases have not identified
these proteins as existing as part of larger protein complexes,
although RanBP2, a member of a separate class of
SUMO ligases, is a component of the nuclear pore (33). Gel
filtration of S. pombe cell extracts indicated that the majority of
the Nse2 protein in these extracts was in the Smc5-6 complex,
with only a small amount present in the monomer form. Nse2
was not observed in any other high-Mr complexes. We cannot
determine directly whether there is free functional Nse2 in
intact cells or whether the small quantity of monomeric Nse2
seen in our fractionation studies was a result of the dissociation
of Nse2 from the Smc5-6 complex during the preparation of
extracts. However, our data strongly suggest that the major
role of Nse2 is performed as part of the Smc5-6 complex.
Of the six components of the Smc5-6 complex, we have
shown that three (Smc6 [Rad18], Nse3, and Nse2 itself) are
sumoylated in an Nse2-dependent manner in vitro, whereas
Smc5 (Spr18) and Nse1 do not appear to be modified. Furthermore,
Smc6 (Rad18) was sumoylated in vivo and the levels
of the modified form increased substantially after exposure to
MMS, implicating that the sumoylation of Smc6 (Rad18) has a
role in the DNA damage response. The modification was dramatically
reduced in the nse2.SA mutant. In vitro, the Nse2.SA
mutant protein had lost its SUMO ligase activity, and it is
reasonable to predict on the basis of the function of the RING
domain in ubiquitin ligases that this will also be the case in
vivo. This would imply that one function of Nse2 is to promote
the sumoylation of Smc6 (Rad18). It is intriguing that Nse2
appears to bind via its N terminus to Smc5 (Spr18) (39a) and
that it sumoylates the Smc5 partner protein Smc6 (Rad18) via
the RING motif in the C terminus. The fact that the ligasedead
nse2.SA RING domain mutant was viable whereas a
deletion mutant was inviable may indicate that, in addition to
its SUMO ligase activity, Nse2 plays an essential structural role
in the Smc5-6 complex. Whatever the essential function of
Nse2 is, our data show the following two separate functions of
194 ANDREWS ET AL. MOL. CELL. BIOL.
Nse2: an essential role (possibly in the integrity of the Smc5-6
complex) and a nonessential role promoting the sumoylation
of targets (one of which is Smc6 [Rad18]).
An analysis of the phenotype of the nse2.SA mutant showed
that it was similar to, but somewhat less severe than, those of
rad18.X and rad18.74. Specifically, there were similarities in
the responses of the different mutants to UV, ionizing radiation,
HU, and MMS. nse2.SA mutants were also deficient in
the repair of double strand breaks (as judged by PFGE), and
the slow growth of nse2.SA colonies after exposure to UV may
also suggest that the mutant has a reduced ability to repair
UV-induced damage. Mutants with defects in the related protein
in S. cerevisiae (Mms21) are also sensitive to DNA-damaging
agents, including UV, ionizing radiation, and MMS. The
mms21-1 mutant displays increased spontaneous mitotic segregation,
which is consistent with a deficiency in the repair of
single strand DNA breaks, possibly arising during DNA replication
(34).
The UV- and IR-sensitive phenotypes of the nse2.SA mutant
also resembled, but were slightly less severe than, those of the
rad31.d mutant and the hus5 mutants, hus5.17 and hus5.62,
which are defective in one-half of the SUMO activator and the
SUMO conjugator, respectively (1, 13, 40). In contrast, the
rad31.d and hus5 mutants were more sensitive to MMS and
displayed a slow growth phenotype. The similar sensitivities to
UV and IR of the nse2.SA, rad31.d, and hus5 mutants suggest
that while, by analogy with the situation in other organisms,
many proteins may be sumoylated in S. pombe, the loss of
Nse2-dependent sumoylating activity (which may be limited to
a small number of targets) may account for a significant proportion
of the rad31.d and hus5 mutant UV- and IR-sensitive
phenotypes.
Taken together, our data suggest that the Nse2-dependent
SUMO modification of several target proteins is an important
aspect of the DNA damage response that involves the Smc5-6
complex. Indeed, we have identified Smc6 (Rad18) as a target
of SUMO modification in vivo and have shown that this largely
depends on the integrity of the ligase domain of Nse2. Several
other components of the Smc5-6 complex, including Nse2 itself,
are targets of Nse2 ligase in vitro, although this remains to
be verified in vivo. The presence of the majority of soluble
cellular Nse2 in the Smc5-6 complex further suggests that the
major role of Nse2 is its function as part of this complex. The
synthetic lethality of nse2.SA with the rad18.X and rad18.74
mutants suggests that sumoylation of Rad18 may be required
for its stability. One intriguing possibility is that the Smc5-6
complex localizes Nse2 to additional target proteins, perhaps
in response to DNA damage or during DNA replication. Further
biochemical and genetic analyses will determine whether
this is the case.
ACKNOWLEDGMENTS
E.A.A. was funded by a BBSRC studentship to F.Z.W. (G/07462).
This work was also funded by EC grant FI6R-CT-2003-508842 and an
MRC Programme grant to A.R.L.
REFERENCES
1. al-Khodairy, F., T. Enoch, I. M. Hagan, and A. M. Carr. 1995. The Schizosaccharomyces
pombe hus5 gene encodes a ubiquitin conjugating enzyme
required for normal mitosis. J. Cell Sci. 108:475–486.
2. Bachant, J., A. Alcasabas, Y. Blat, N. Kleckner, and S. J. Elledge. 2002. The
SUMO-1 isopeptidase Smt4 is linked to centromeric cohesion through
SUMO-1 modification of DNA topoisomerase II. Mol. Cell 9:1169–1182.
3. Barbet, N. C., and A. M. Carr. 1993. Fission yeast wee1 protein kinase is not
required for DNA damage-dependent mitotic arrest. Nature 364:824–827.
4. Bernier-Villamor, V., D. A. Sampson, M. J. Matunis, and C. D. Lima. 2002.
Structural basis for E2-mediated SUMO conjugation revealed by a complex
between ubiquitin-conjugating enzyme Ubc9 and RanGAP1. Cell 108:345–
356.
5. Caspari, T., M. Dahlen, G. Kanter-Smoler, H. D. Lindsay, K. Hofmann, K.
Papadimitriou, P. Sunnerhagen, and A. M. Carr. 2000. Characterization of
Schizosaccharomyces pombe Hus1: a PCNA-related protein that associates
with Rad1 and Rad9. Mol. Cell. Biol. 20:1254–1262.
6. Craven, R. A., D. J. Griffiths, K. S. Sheldrick, R. E. Randall, I. M. Hagan,
and A. M. Carr. 1998. Vectors for the expression of tagged proteins in
Schizosaccharomyces pombe. Gene 221:59–68.
7. Desterro, J. M., M. S. Rodriguez, and R. T. Hay. 1998. SUMO-1 modification
of IkappaBalpha inhibits NF-kappaB activation. Mol. Cell 2:233–239.
8. Fousteri, M. I., and A. R. Lehmann. 2000. A novel SMC protein complex in
Schizosaccharomyces pombe contains the Rad18 DNA repair protein.
EMBO J. 19:1691–1702.
9. Hardeland, U., R. Steinacher, J. Jiricny, and P. Schar. 2002. Modification of
the human thymine-DNA glycosylase by ubiquitin-like proteins facilitates
enzymatic turnover. EMBO J. 21:1456–1464.
10. Harvey, S. H., D. M. Sheedy, A. R. Cuddihy, and M. J. O’Connell. 2004.
Coordination of DNA damage responses via the Smc5/Smc6 complex. Mol.
Cell. Biol. 24:662–674.
11. Hershko, A., and A. Ciechanover. 1998. The ubiquitin system. Annu. Rev.
Biochem. 67:425–479.
12. Ho, J. C., N. J. Warr, H. Shimizu, and F. Z. Watts. 2001. SUMO modification
of Rad22, the Schizosaccharomyces pombe homologue of the recombination
protein Rad52. Nucleic Acids Res. 29:4179–4186.
13. Ho, J. C., and F. Z. Watts. 2003. Characterization of SUMO-conjugating
enzyme mutants in Schizosaccharomyces pombe identifies a dominant-negative
allele that severely reduces SUMO conjugation. Biochem. J. 372:97–
104.
14. Hoege, C., B. Pfander, G. L. Moldovan, G. Pyrowolakis, and S. Jentsch. 2002.
RAD6-dependent DNA repair is linked to modification of PCNA by ubiquitin
and SUMO. Nature 419:135–141.
15. Ishov, A. M., A. G. Sotnikov, D. Negorev, O. V. Vladimirova, N. Neff, T.
Kamitani, E. T. Yeh, J. F. Strauss III, and G. G. Maul. 1999. PML is critical
for ND10 formation and recruits the PML-interacting protein daxx to this
nuclear structure when modified by SUMO-1. J. Cell Biol. 147:221–234.
16. Johnson, E. S., and A. A. Gupta. 2001. An E3-like factor that promotes
SUMO conjugation to the yeast septins. Cell 106:735–744.
17. Johnson, E. S., I. Schwienhorst, R. J. Dohmen, and G. Blobel. 1997. The
ubiquitin-like protein Smt3p is activated for conjugation to other proteins by
an Aos1p/Uba2p heterodimer. EMBO J. 16:5509–5519.
18. Kagey, M. H., T. A. Melhuish, and D. Wotton. 2003. The polycomb protein
Pc2 is a SUMO E3. Cell 113:127–137.
19. Kahyo, T., T. Nishida, and H. Yasuda. 2001. Involvement of PIAS1 in the
sumoylation of tumor suppressor p53. Mol. Cell 8:713–718.
20. Kotaja, N., U. Karvonen, O. A. Janne, and J. J. Palvimo. 2002. PIAS proteins
modulate transcription factors by functioning as SUMO-1 ligases. Mol. Cell.
Biol. 22:5222–5234.
21. Lehmann, A. R., M. Walicka, D. J. Griffiths, J. M. Murray, F. Z. Watts, S.
McCready, and A. M. Carr. 1995. The rad18 gene of Schizosaccharomyces
pombe defines a new subgroup of the SMC superfamily involved in DNA
repair. Mol. Cell. Biol. 15:7067–7080.
22. Li, H., C. Leo, J. Zhu, X. Wu, J. O’Neil, E. J. Park, and J. D. Chen. 2000.
Sequestration and inhibition of Daxx-mediated transcriptional repression by
PML. Mol. Cell. Biol. 20:1784–1796.
23. Mahajan, R., C. Delphin, T. Guan, L. Gerace, and F. Melchior. 1997. A small
ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear
pore complex protein RanBP2. Cell 88:97–107.
24. Mao, Y., S. D. Desai, and L. F. Liu. 2000. SUMO-1 conjugation to human
DNA topoisomerase II isozymes. J. Biol. Chem. 275:26066–26073.
25. Mao, Y., M. Sun, S. D. Desai, and L. F. Liu. 2000. SUMO-1 conjugation to
topoisomerase I: a possible repair response to topoisomerase-mediated
DNA damage. Proc. Natl. Acad. Sci. USA 97:4046–4051.
26. McDonald, W. H., Y. Pavlova, J. R. Yates III, and M. N. Boddy. 2003. Novel
essential DNA repair proteins Nse1 and Nse2 are subunits of the fission
yeast Smc5-Smc6 complex. J. Biol. Chem. 278:45460–45467.
27. Mo, Y. Y., Y. Yu, Z. Shen, and W. T. Beck. 2002. Nucleolar delocalization of
human topoisomerase I in response to topotecan correlates with sumoylation
of the protein. J. Biol. Chem. 277:2958–2964.
28. Morishita, T., Y. Tsutsui, H. Iwasaki, and H. Shinagawa. 2002. The Schizosaccharomyces
pombe rad60 gene is essential for repairing double-strand
DNA breaks spontaneously occurring during replication and induced by
DNA-damaging agents. Mol. Cell. Biol. 22:3537–3548.
29. Muris, D. F., K. Vreeken, A. M. Carr, B. C. Broughton, A. R. Lehmann, P. H.
Lohman, and A. Pastink. 1993. Cloning the RAD51 homologue of Schizosaccharomyces
pombe. Nucleic Acids Res. 21:4586–4591.
VOL. 25, 2005 Nse2 IS A SUMO LIGASE 195
30. Murray, J. M., A. M. Carr, A. R. Lehmann, and F. Z. Watts. 1991. Cloning
and characterisation of the rad9 DNA repair gene from Schizosaccharomyces
pombe. Nucleic Acids Res. 19:3525–3531.
31. Murray, J. M., H. D. Lindsay, C. A. Munday, and A. M. Carr. 1997. Role of
Schizosaccharomyces pombe RecQ homolog, recombination, and checkpoint
genes in UV damage tolerance. Mol. Cell. Biol. 17:6868–6875.
32. Nishida, T., and H. Yasuda. 2002. PIAS1 and PIASxalpha function as
SUMO-E3 ligases toward androgen receptor and repress androgen receptordependent
transcription. J. Biol. Chem. 277:41311–41317.
33. Pichler, A., A. Gast, J. S. Seeler, A. Dejean, and F. Melchior. 2002. The
nucleoporin RanBP2 has SUMO1 E3 ligase activity. Cell 108:109–120.
34. Prakash, S., and L. Prakash. 1977. Increased spontaneous mitotic segregation
in MMS-sensitive mutants of Saccharomyces cerevisiae. Genetics 87:
229–236.
35. Saitoh, H., R. Pu, M. Cavenagh, and M. Dasso. 1997. RanBP2 associates
with Ubc9p and a modified form of RanGAP1. Proc. Natl. Acad. Sci. USA
94:3736–3741.
36. Saitoh, H., D. B. Sparrow, T. Shiomi, R. T. Pu, T. Nishimoto, T. J. Mohun,
and M. Dasso. 1998. Ubc9p and the conjugation of SUMO-1 to RanGAP1
and RanBP2. Curr. Biol. 8:121–124.
37. Saka, Y., P. Fantes, T. Sutani, C. McInerny, J. Creanor, and M. Yanagida.
1994. Fission yeast cut5 links nuclear chromatin and M phase regulator in the
replication checkpoint control. EMBO J. 13:5319–5329.
38. Schmidt, D., and S. Muller. 2002. Members of the PIAS family act as SUMO
ligases for c-Jun and p53 and repress p53 activity. Proc. Natl. Acad. Sci. USA
99:2872–2877.
39. Schwienhorst, I., E. S. Johnson, and R. J. Dohmen. 2000. SUMO conjugation
and deconjugation. Mol. Gen. Genet. 263:771–786.
39a.Sergeant, J., E. Taylor, J. Palecek, M. Fousteri, E. Andrews, S. Sweeney, H.
Shinagawa, F. Watts, and A. Lehmann. 2005. Composition and architecture
of the Schizosaccharomyces pombe Rad18 (Smc5-6) complex. Mol. Cell. Biol.
25:172–184.
40. Shayeghi, M., C. L. Doe, M. Tavassoli, and F. Z. Watts. 1997. Characterisation
of Schizosaccharomyces pombe rad31, a UBA-related gene required
for DNA damage tolerance. Nucleic Acids Res. 25:1162–1169.
41. Stelter, P., and H. D. Ulrich. 2003. Control of spontaneous and damageinduced
mutagenesis by SUMO and ubiquitin conjugation. Nature 425:188–
191.
42. Takahashi, Y., T. Kahyo, E. A. Toh, H. Yasuda, and Y. Kikuchi. 2001. Yeast
Ull1/Siz1 is a novel SUMO1/Smt3-ligase for septin components and functions
as an adaptor between conjugating enzyme and substrates. J. Biol.
Chem. 276:48973–48977.
43. Takahashi, Y., E. A. Toh, and Y. Kikuchi. 2003. Comparative analysis of
yeast PIAS-type SUMO ligases in vivo and in vitro. J. Biochem. (Tokyo)
133:415–422.
44. Tanaka, K., J. Nishide, K. Okazaki, H. Kato, O. Niwa, T. Nakagawa, H.
Matsuda, M. Kawamukai, and Y. Murakami. 1999. Characterization of a
fission yeast SUMO-1 homologue, Pmt3p, required for multiple nuclear
events, including the control of telomere length and chromosome segregation.
Mol. Cell. Biol. 19:8660–8672.
45. Verkade, H. M., S. J. Bugg, H. D. Lindsay, A. M. Carr, and M. J. O’Connell.
1999. Rad18 is required for DNA repair and checkpoint responses in fission
yeast. Mol. Biol. Cell 10:2905–2918.
46. Zhong, S., S. Muller, S. Ronchetti, P. S. Freemont, A. Dejean, and P. P.
Pandolfi. 2000. Role of SUMO-1-modified PML in nuclear body formation.
Blood 95:2748–2752.
196 ANDREWS ET AL. MOL. CELL. BIOL.