1 Antisense oligonucleotides ©Old ich Farsa 2012ř 2 Antisense RNA •Expression vector that produces a transcript, which is complementary to a known transcript •Expression vector is introduced into a host cell by transfection and blocks translation of target mRNA 3 Antisense RNA 4 Therapeutic Antisense RNA •Insulin-like growth factor 1 • prevalent in malignant glioma (common brain tumour) as well as prostate carcinomas •Rat prostate carcinoma cells transfected with antisense receptor cDNA •Mouse injected with transfected cells • small or no tumours compared to control rats treated with non-transfected carcinoma cells 5 Why Antisense Oligonucleotides? •Large antisense RNA is readily subjected to degradation • Human cells specifically target dsRNA for turnover by nucleases •DNA oligonucleotides more stable, more readily delivered to target cells •Directed to 5’ or 3’ ends of mRNAs, intronexon boundaries, naturally ds regions 6 Antisense Oligonucleotides 7 Antisense Oligonucleotides - „mode of action“ 8 Possibilities of RNA-triplex forming by action of antisense-oligos 9 Possibilities of RNA-triplex forming by action of antisense-oligos (continued) 10 Optimizing Antisense Oligos • Natural oligos (A) susceptible to cellular nucleases • Alterations improve nuclease resistance • Replacement of free oxygen with sulfur in phosphodiester bond (B) particularly effective • Replacement of deoxyribose with morpholine ring together with substitution of hydroxyl group in phosphate moiety (D) with dimethylamine led also to active compounds O O O base PO OH O base 3' 5' O O O base PO SH O base 3' 5' A B O O NH base PO OH O base 3' 5' C D O base O CH3 5' E N N NH2 O CH2 F (3') (5') O base NPN O OCH3 CH3 O base N 11 Phosphorothioate Antisense Oligos (B) •Water-soluble in form of polysodium salts •Complex with target mRNA activates RNase H •Some therapeutics in clinical trials • eg. against cytomegalovirus infection of retinas in patients with AIDS •Decreased mRNA binding, increased nonspecific protein binding wrt native oligos 12 Native oligos: Splice Site Correction •β-thalassemia: Mutations in hemoglobin chains lead to reduced oxygen binding (anemia) •Binding of oligos prevent inappropriate splice activity 13 Oligos' Delivery • Extremely hydrophilic • Exactly tissue-targeted delivery needed • Liposome plus cell-specific binding proteins could allow targeted, efficient delivery of appropriate doses of therapeutic antisense oligonucleotides 14 Compounds Used fomivirsen •21 deoxyribonukleotides, phosphorothioate •docosasodium salt •sequence 5'-G-C-G-T-T-T-G-C-T-C-T-T-C-T-T-C-T-T-G-C-G-3' • cytomegalovirus replication inhibitor: complementary to RNA of IE2 („immediate early region 2“) of HCMV, inhibits IE2 protein production and thus virus replication •treatment of CMV retinitis in patients with AIDS •Vitravene™ intravitreal inj. (approved in USA cca 1998 - 2001) 15 Compounds in Clinical Trials Phosphorothioate oligos alicaforsen – therapeutic of ulcerative collitis, inh. of synt. ICAM (intercellular adhesion molecule) afovirsen – antivirotic & antineoplastic – inhibitor of human papillomavirus replication miravirsen, SPC-3649 – antivirotic – anti liver-specific miRNA - hepatitis C aprinocarsen, Affinitak™ − antineoplastic – inhibitor of protein kinase Cα - non small cells lung & breast cancer oblimersen, Genasense® − antineoplastic - targeted to gene of Bcl2 anti-apoptic protein – various tumours trabedersen, AP-12009 – antineoplastic - inhibitor of overexpression of Transforming Growth Factor β2 (TGF β2 ) – brain cancers (gliome, astrocytome) 16 Compounds in Clinical Trials Intercellular Adhesion Molecule (ICAM) Synthesis Inhibitors Ulcerative Colitis = Inflammatory Bowel Disease (IBD) = chronic relapsing inflammatory disease of the mucose layer of the intestine •idiopathic = ethiology is unknown •pathogenesis is believed to be multifactorial and to include genetic, environmental and immunologic factors •chronic inflammation is manifested namely due to dysregulation of the adaptive immunity system, which leads to a change of tolerance to intestinal bacteria and to an anomalous response to the normal luminal microflora ⇒ immunologic imbalance ⇒ ↑ production of inflammatory cytokines and adhesion molecules (ICAM, MadCAM), ↑ activation of polymorphonuclear monocytes (PMN); their migration into the intestine and interaction with the epithelium influences epithlium functions from the barrier one to electrolytes management 17 Mechanism of origin of IBD, biomolecules engage in it and therapeutic targets of selected biodrugs ICAM-1 intercelullar adhesion molecule 1 EGF epidermal growth factor MadCAM mucous address adhesion molecule PMN – polymorphonuclear monocyte IFN interferon IL interleukin 18 O O O O O O O O OH O O O OH O O O O O O O O O O O O O O O N N O NH2 O O N N H N N O O NH2 N N H O O O O CH3 P O S - N N N N NH2 O P O S - P O S P O S - P O S - P O S - P O S - N N O NH2 O O N N O NH2 O O P O S - N N H N N O O NH2 P O S - P O S - P O S - N N O NH2 O O N N N N NH2 O P O S - N N H O O O O CH3 P O S - P O S - P O S - P O S - P O S - N N N N NH2 O N N O NH2 O O N N O NH2 O O N N H N N O O NH2 N N H N N O O NH2 N N O NH2 O O N N H N N O O NH2 N N H O O O O CH3 N N N N NH2 O N N O NH2 O O P O S - P O S - O Alicaforsen syn. ISIS 2302 •oligodeoxyribonucleotide modified by thiophosphoric acid (phosphorothioate) •20 bases •binds (hybridizes) to the non-translated 3'region of human ICAM-1 mRNA ⇒ activation of nuclease RNasy-H ⇒ cleavage of the heterodimer ⇒ attenuation of ICAM synthesis •phase 3 clinical tests 19 Compounds in clinical trials: antiviral agents afovirsen, syn. ISIS 8741 – free „acid“; ISIS 2105 – nonadecasodium salt •Sequence: ttgcttccat cttcctcgtc •Modification: residues of phosphoric acid substituted with those of thiophosphoric acid •Usage: treatment of human papillomavirus infections (HPV; manifestations of the infection: warts of female genitals – cervical cancer) •mode of action: binding to viral mRNA Effect of ISIS 2105 and ISIS 3925 (20 residue phosphorothioate oligonucleotide designed to be complementary to influenza A virus) to HPV DNA replication. 24 h after infection by electroporation, cells of the line SCC-4 were treated with increasing doses of either ISIS 2105 or ISIS 3925. Cells were „harvested“ 24 h after electroporation and their HPV DNA content was determined. Data are plotted in % of untreated control experiment; mean of 3 assays. 20 Compounds in clinical trials: antiviral agents miravirsen, SPC3649 •RNA, (P-thio)((2'-O,4'-C-methylene)m5C-dC-(2'-O,4'-C-methylene)A-dT-dT-(2'-O,4'-C- methylene)G-(2'-O,4'-C-methylene)m5U-dC-dA-(2'-O,4'-C-methylene)m5C-dA-(2'-O,4'-Cmethylene)m5C-dT-(2'-O,4'-C-methylene)m5C-(2'-O,4'-C-methylene)m5C), sodium salt (1:14) •16 bases, phosphorothioate groups, 8 methylene bridges between 2'-O and 4'-C atoms of ribose N N O NH2 O O O OH N N O NH2 O O P OH S OO N N N N NH2 O O P OH S O N NH O O CH3 O P OH S O O N NH O O CH3 O O O P OH S O NNH2 N N NH O O OP S O O N NH O O CH3 O OP OH S O N OOP OH S O N O NH2 O O OP OH S N N N N NH2 N N N N NH2 O O O P O S O N N O NH2 O O P OH S O N NH O O CH3 O O P OH S O N N O NH2 O O O P OH S O O P OH SN N O NH2 O OHO O N N O NH2 O OP OH OH OH S 21 •microRNAs are short (21-23 nucleotide) non-coding regulatory RNAs that influence gene expression at a post-transcriptional level • microRNA-122 (miR-122) is a major regulatory RNA in liver that fine-tunes the expression of over 100 cellular genes and enhances hepatitis C virus (HCV) replication through interaction with two adjacent sites downstream of stem loop I (SLI) within the HCV 5′ untranslated region (5′ UTR) of the viral RNA •„locked nucleic acid“ SPC3649-induced miR-122 antagonism suppressed HCV genotype 1a and 1b infection in vivo •phase 1 – 2 clinical tests against HCV infection have been finished 22 Compounds in clinical trials: antitumour agents Proteinkinase Cα inhibitors •proteikinases C: serine-threonine kinases taking part in cell signál transduction (phosphorylation of signal molecules); their altered expression is linked with cancerogenesis aprinocarsen, syn. ISIS 3521, LY900003, CGP 64128A Affinitak™ •deoxyribonucleotide, 20 bases, phosforothioate •A-C-T-T-T-G-A-G-T-G-G-T-C-G-C-T-C-T-T-G •phase 2 clinical tests against non-small cells lung cancer (inoperable or metastasizing) alone or combined with carboplatin, gemcitabin or paclitaxel; also against breast cancer treated previously by an other drug have been finished •phase 3 against lung cancer: addition of aprinocarsen to gemcitabin or carboplatin has neither prolonged patients survival nor increased treatment efectiveness evaluated by other measures 23 Compounds in Clinical Trials Morpholine oligos eteplirsen, AVI-4658 •treatment of Duchenne muscular dystrophy (DMD) •DMD: a fatal muscle degenerative disorder, caused by misreading and bad translation of DMD (dystrophin) gene to dystrophin peptide due to mutations of this gene •1 per 3500 newborn boys is affected •sequence CTCCAACATCAAGGAAGATGGCATTTCTAG; 30 bases; Mr = 10369.83 •targeted to 51. exone in dystrophine mRNA •enables partial restoration of reading and translation of DMD gene by „patching“ of its bad splicing ⇒ production of truncated, but functional chain of dystrophine •applied locally by i.m. injection •2 phase 2 clinical studies proceed 24 N N N NH O NH2 O NH O N N N N NH2 O N P N O CH3CH3 O N NH O O CH3 N P N O CH3CH3 O O N N O NH2 N P N O CH3CH3 O O N NH O O CH3 N P N O CH3CH3 O O O O N NH O O CH3 N P NO CH3 CH3 O O N NH O O CH3 N P NO CH3 CH3 O N N N N NH2 ON P NO CH3 CH3 O N N O NH2 N P NO CH3 CH3 O O N N N NH O NH2 ON P NO CH3 CH3 O N N N NH O NH2 ON P NO CH3 CH3 O O N N N N NH2 O N P N O CH3CH3 O N N N NH O NH2 O N P N O CH3CH3 O N N N N NH2 O N P N O CH3CH3 O N N N N NH2 O N P N O CH3CH3 O N N N NH O NH2 O N P N O CH3CH3 O N N N NH O NH2 O N P N O CH3CH3 O N N N N NH2 O N P N O CH3CH3 O O N N N N NH2 ON P NO CH3 CH3 O N N O NH2 N P NO CH3 CH3 O O N NH O O CH3 N P NO CH3 CH3 O O N N N N NH2 ON P NO CH3 CH3 O N N O NH2 N P NO CH3 CH3 O O N N N N NH2 ON P NO CH3 CH3 O O N N O NH2 N P N O CH3CH3 O O N N O NH2 N P N O CH3CH3 O O N NH O O CH3 N P N O CH3CH3 O O N N O NH2 N P N O CH3CH3 ON N O O OH O O P N O O CH3CH3 ON P NO CH3 CH3 O O N NH O O CH3 N P NO CH3 CH3 O N N N N NH2 25 26 Compounds in Clinical Trials Morpholine oligos radavirsen, AVI-7100 •phosphorodiamidate morpholino antisense oligomer with positive charges on selected subunits; 20 nucleotide bases 27 •intended for influenza A •specifically targets viral messenger RNA sequences •phase 1 clinical tests to characterize the safety, tolerability and pharmacokinetics of escalating single-administration doses of AVI-7100 in healthy human subjects.