Prostate Cancer Cell Lines under Hypoxia Exhibit Greater
Stem-Like Properties
Yuanyuan Ma1,5
, Dongming Liang1
, Jian Liu1
, Karol Axcrona2
, Gunnar Kvalheim3
, Trond Stokke4
, Jahn M.
Nesland1,5
, Zhenhe Suo1,5
*
1 Department of Pathology, University of Oslo, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway, 2 Department of Urology, University of Oslo, The
Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway, 3 Department of Cell Therapy, University of Oslo, The Norwegian Radium Hospital, Oslo University
Hospital, Oslo, Norway, 4 Department of Radiation Biology, Institute for Cancer Research, University of Oslo, The Norwegian Radium Hospital, Oslo University Hospital,
Oslo, Norway, 5 Department of Pathology, Faculty of Medicine, Institute of Clinical Medicine, University of Oslo, Oslo, Norway
Abstract
Hypoxia is an important environmental change in many cancers. Hypoxic niches can be occupied by cancer stem/
progenitor-like cells that are associated with tumor progression and resistance to radiotherapy and chemotherapy.
However, it has not yet been fully elucidated how hypoxia influences the stem-like properties of prostate cancer cells. In this
report, we investigated the effects of hypoxia on human prostate cancer cell lines, PC-3 and DU145. In comparison to
normoxia (20% O2), 7% O2 induced higher expressions of HIF-1a and HIF-2a, which were associated with upregulation of
Oct3/4 and Nanog; 1% O2 induced even greater levels of these factors. The upregulated NANOG mRNA expression in
hypoxia was confirmed to be predominantly retrogene NANOGP8. Similar growth rates were observed for cells cultivated
under hypoxic and normoxic conditions for 48 hours; however, the colony formation assay revealed that 48 hours of
hypoxic pretreatment resulted in the formation of more colonies. Treatment with 1% O2 also extended the G0/G1 stage,
resulting in more side population cells, and induced CD44 and ABCG2 expressions. Hypoxia also increased the number of
cells positive for ABCG2 expression, which were predominantly found to be CD44bright
cells. Correspondingly, the sorted
CD44bright
cells expressed higher levels of ABCG2, Oct3/4, and Nanog than CD44dim
cells, and hypoxic pretreatment
significantly increased the expressions of these factors. CD44bright
cells under normoxia formed significantly more colonies
and spheres compared with the CD44dim
cells, and hypoxic pretreatment even increased this effect. Our data indicate that
prostate cancer cells under hypoxia possess greater stem-like properties.
Citation: Ma Y, Liang D, Liu J, Axcrona K, Kvalheim G, et al. (2011) Prostate Cancer Cell Lines under Hypoxia Exhibit Greater Stem-Like Properties. PLoS ONE 6(12):
e29170. doi:10.1371/journal.pone.0029170
Editor: Dean G. Tang, The University of Texas M.D Anderson Cancer Center, United States of America
Received August 1, 2011; Accepted November 22, 2011; Published December 28, 2011
Copyright: ß 2011 Ma et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by The Norwegian Radium Hospital Research Foundation with grant number 333005 to ZS. The funders had no role in study
design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: zhenhes@medisin.uio.no
Introduction
Somatic tumors, including prostate cancer, contain a small
subset of stem-like cells, called cancer stem cells, with capacities for
self-renewal, differentiation, and initiation of new tumors. It has
been demonstrated that cancer stem cells can escape from
radiotherapy and chemotherapy, and are able to form metastatic
tumors in other organs [1,2]. Cancer stem cells preferentially
reside in specific hypoxic microenvironment-niches, often existing
inside tumors [3,4].
The hypoxia inducible factors (HIFs) are key regulators found in
mammalian cells under lower oxygen tension; they are involved
with multiple functions, such as cell survival, angiogenesis, and
stem cell maintenance, and play essential roles in cellular and
systemic homeostasis in response to hypoxia [5]. HIFs are
heterodimers; HIF1A (HIF-1a) and EPAS1 (HIF-2a) are the two
major isoforms of the a-subunit, and share a high degree of
sequence homology. Oct3/4 (also called POU5F1) and Nanog are
embryonic stem cell markers that are important for transcription
and in maintaining self-renewal of embryonic stem cells and
primordial germ cells. They have also been identified in different
somatic tumors, including head and neck, lung, colorectal,
ovarian, and prostate cancers [6–11]. Comparatively, the
expressions of these genes are down-regulated in all differentiated
somatic cell types, in vitro as well as in vivo [12,13]. NANOG, also
called NANOG1, has several pseudogenes, and among them
NANOGP8 has later been confirmed to be a retrogene. Both
NANOG1 and NANOGP8 expressions have been identified in
different cancer cell types [14,15], including prostate cancer cells
[16].
A number of surface markers have been used to isolate putative
cancer stem/progenitor cells. In prostate cancer, the early
progenitor cells are associated with several specific surface
markers, such as CD44, CD133, and CXCR4 [17–19]. Side
population technology has also been used to isolate cancer stem
cells with the ability to pump out Hoechst 33342 [20]. Efflux of the
dye is attributed to members of the ATP-binding cassette family,
such as ABCG2 (breast cancer resistance protein, BCRP). The
upregulation of ABCG2 is also responsible for chemotherapeutic
resistance in certain cancer cells [21]. In breast and prostate
cancers, previous studies have identified CD44+
or CD117+
/
ABCG2+
cells with stem-like characteristics, such as increased
PLoS ONE | www.plosone.org 1 December 2011 | Volume 6 | Issue 12 | e29170
clonogenic/tumorigenic properties, higher expressions of stemness
genes, and stronger ability to form tumors in animal models
[19,22,23].
Hypoxia helps embryonic stem cells to maintain stemness and
higher oxygen tensions drive cells into proliferation and differentiation,
which are more susceptible to conventional treatment
modalities [24,25]. Similar results have been observed in adult
cells, like adipocytes, fibroblasts, and several types of cancer cells
[26–28]. However, the effects of hypoxia on prostate cancer cells
have not been fully elucidated. Therefore, in this study we
examined the prostate cancer cell lines PC-3 and DU145 at
different oxygen tensions in order to better understand the effect of
hypoxia on the stem-like properties of the cells. Stemness factors,
Oct3/4 and Nanog, were expressed at higher levels in the cells
under hypoxic cultivation and these cells exhibited elevated colony
formation potential compared to the cells under normoxic
condition. Furthermore, the upregulated NANOG mRNA expression
under hypoxia was confirmed mainly derived from the
retrogene NANOGP8. In these prostate cancer cell lines, hypoxia
also increased the fraction of side population cells, extended the
G0/G1 stage and resulted in higher levels ABCG2 and CD44
expressions. Additional experiments demonstrated that CD44bright
cells exhibited significantly greater stemness, as verified by colony
formation assay, sphere growth assay, and stemness factor
expression analyses.
Materials and Methods
Cell culture
Human prostate cancer cell lines, PC-3 and DU145, were
purchased from ATCC (American Type Culture Collection, USA)
and maintained in our lab for this study. For conventional cell
culture, cells were seeded in culture flasks with RPMI 1640
medium supplemented with 10% fetal bovine serum, 100 units/ml
penicillin, and 100 mg/ml streptomycin. Cultures were maintained
at 37uC in a humidified incubator in an atmosphere of 20% O2,
5% CO2, and 75% N2.
The Xvivo Closed Incubation System (Xvivo system 300 C,
BioSpherix, New York, USA) was used in this study in order to
accurately maintain different oxygen tensions in different chambers.
After 24 hours of cultivation in conventional cell culture
(allowing cells to attach onto the flasks), the cells were transferred
into different chambers with 1% O2, 5% CO2, and 94% N2; 7%
O2, 5% CO2, and 88% N2; or 20% O2, 5% CO2 and 75% N2 for
variable periods of time before being harvested for additional
analysis.
Semiquantitative reverse transcription-PCR (RT-PCR)
Total RNA was extracted from the cultivated cells using the
RNeasy Kit (Qiagen, CA, USA) according to the manufacturer’s
instruction. To eliminate any DNA, DNase I was used in the RNA
isolation procedure. RNA sample concentrations were quantified
using a spectrophotometer (Nanodrop ND-1000, USA) at OD260/
280.
Complementary DNA (cDNA) was subsequently synthesized
from 5 mg total RNA using the Multiscribe reverse transcriptase
(Applied Biosystems, Foster City, CA). The conditions for reverse
transcription were: 25uC for 10 minutes, 37uC for 12 minutes,
85uC for 5 minutes, followed by holding at 4uC. cDNA was stored
at 270uC for later PCR analyses.
PCR amplification of cDNA was performed using a PCR
system (DOPPIO VWR, UK) and the following program: initial
denaturation at 95uC for 10 minutes; followed by 30 cycles (28
cycles for GAPDH) of annealing at 60uC for 30 seconds, and
extension at 72uC for 30 seconds; followed by termination with a
10 minute elongation step at 72uC. The primers used for RT-PCR
were: for Nanog, F 59-ATGCCTCACACGGAGACTGT-39 and
R 59-AGGGCTGTCCTGAATAAGCA-39, amplifying a 66-bp
fragment; for Oct3/4, F 59-ACATGTGTAAGCTGCGGCC-39
and R 59-GTTGTGCATAGTCGCTGCTTG-39, amplifying a
297-bp fragment; for HIF-1a, F 59-AGTGTACCCTAACTAGCCGAGGAA-39
and R 59-CTGAGGTTGGTTACTGTTGGTATCA-39,
amplifying a 113-bp fragment; for HIF-2a, F
59-GACCAGCAGATGGACAACTTGTAC-39 and R 59-CAGAAAGATCATGTCGCCATCTT-39,
amplifying a 84-bp fragment;
and for GAPDH, F 59-CCTCAAGATCATCAGCAATGC-39
and R 59-TGGTCATGAGTCCTTCCACG-39, amplifying
a 101-bp product. The experiments were repeated at least
three times.
The amplified PCR products were separated by 7.5%
polyacrylamide gel electrophoresis, stained with GelRed (Molecular
Probes, Invitrogen), and visualized with a syngene image
system (G: BOX Syngene, USA).
The mRNA expressions of NANOG1 and NANOGP8 were
measured by quantitative PCR using a Taqman ABI 7900
Sequence Detector System (Applied Biosystems). The published
specific primers and probes [29] were used in this study . For
NANOG1: forward primer was 59-CGCCCTGCCTAGAAAAGACATTT
-39, reverse primer was 59-AGAAGCCGTCTCTGGCTATAGATAA
-39, and the probe was CTGCTAAGGACAACATTGAT;
for NANOGP8: forward primer was 59CGCCCTGCCTAGAAAAGACATTT-39
, reverse primer was
59-ACGAGTTTGGATATCTTTAGGGTTTAGAATC-39, and
the probe was CCTTGGCTGCCGTCTCTG. All the primers
and probes labeled with FAM-MGB were obtained from Applied
Biosystems. The GAPDH was used as an internal control and the
Ct values at 20% O2 were used as calibrators for evaluating
NANOG1 and NANOGP8 expression levels in response to hypoxia.
The experiments were performed in duplicate. The expression
levels of the NANOG1 and NANOGP8 were analyzed through the
DDCt method [29].
Immunoblotting
Cells were quickly rinsed with ice-cold phosphate-buffered
saline (PBS) and scraped into RIPA buffer (25 mM Tris HCl
pH 7.6, 100 mM NaCl, 1% NP40, 1% sodium deoxycholate,
0.1% SDS; Thermo Scientific Pierce, Germany), with protease
inhibitors (0.1 mM aprotinin, 1.0 mM PMSF, 1 mM leupeptin,
1 mM pepstatin) added immediately before use. The samples were
centrifuged at 15,000 rpm for 15 minutes at 4uC and the
supernatants were transferred to new tubes. The protein
concentrations were measured with a Bio-Rad protein assay
according to the manufacturer’s instruction. The samples were
heated with a benchtop heater (Model 111002, Boekel Scientific,
USA) at 100uC for 5 minutes in SDS-loading buffer (500 mM
Tris-HCl pH 6.8; 10% Glycerol, 2% SDS, 0.6 M DTT, 0.05%
bromophenol blue), and then an equal amount of protein (50 mg)
per sample was subjected to 10% SDS-PAGE and transferred to
polyvinylidene difluoride transfer membrane (BIO-RAD, USA).
Membranes were blocked with 5% non-fat dry milk in TBSTween
for 60 minutes at room temperature and then incubated
with the primary antibodies at optimal dilution in TBST/5% milk
overnight at 4uC. The optimized antibodies used in this study
included: HIF-1a (1 mg/ml MAB1536, R&D), HIF-2a (1 mg/ml
MAB2886, R&D), GAPDH (0.2 mg/ml AF5718, R&D), Oct3/4
(1 mg/ml MAB1759, R&D), Nanog (1 mg/ml AF1997, R&D), and
ABCG2 (0.5 mg/ml B7059, Sigma-Aldrich). The membranes were
then incubated with secondary HRP-conjugated antibodies and
Stem-Like Properties of Prostate Cancer
PLoS ONE | www.plosone.org 2 December 2011 | Volume 6 | Issue 12 | e29170
immunocomplexes were visualized by enhanced chemiluminescence
(GE Healthcare, UK). Western blotting experiments were
repeated at least three times.
Cell block preparation
Cells were grown to 80% confluence and then were digested
with 0.25% trypsin and EDTA (Invitrogen, USA), harvested, and
centrifuged at 2000 rpm for 10 minutes. Supernatants were
discarded, 3 drops of plasma and 2 drops of thrombin were
added to the sedimentation, and the contents were carefully mixed
by tube rotation. One minute later, the mixture was coagulated
and 4% buffered formalin was added to the tube for fixation. The
coagulated mass was then placed in linen paper and used to
construct a paraffin block by the conventional process.
Immunocytochemistry
Cell blocks were sliced into 4-mm paraffin sections that were
then deparaffinized using PT-Link apparatus. Next, the sections
were rinsed with DAKO wash buffer, incubated with hydrogen
peroxide for 5 minutes, and then incubated with primary antibody
for 30 minutes at room temperature. The antibodies used and
their concentrations were: HIF-1a (mouse, 1:200; catalog number:
NB100-150, Novus), HIF-2a (rabbit, 1:100; catalog number:
NB100-122, Novus), Oct3/4, (goat, 10 mg/ml; catalog number:
AF1759, R&D) and Nanog (goat, 5 mg/ml; catalog number:
AF1997, R&D).
After another rinse with DAKO wash buffer, mouse/rabbit
EnVision FLEX+Linker reagent was added and samples were
incubated for 15 minutes at room temperature, followed by
incubation with EnVision FLEX+HRP for 30 minutes at room
temperature. Samples with primary antibodies from goat were
incubated for 30 minutes at room temperature with mouse antigoat
IgG before the addition of mouse EnVision FLEX+Linker
reagent and EnVision FLEX+HRP as described above. The
sections were rinsed, color reaction developed with DAB reagent,
counterstained in hematoxylin for 20 seconds, dehydrated, and
mounted under glass cover slips in preparation for evaluation by
microscopy.
Cell counting (cell proliferation rate)
Cell proliferation was evaluated by counting cell numbers using
the Electronics Countess Automated Cell Counter (Invitrogen,
USA). After trypsinization, the floating cells were collected to
create a cell suspension that contained no obvious cell clusters. In
each preparation, 10 ml of cell suspension was mixed with 0.4%
trypan blue dye (1:1) before being loaded onto a cell counting
chamber slide for cell counting. The number of viable cells that
were able to exclude the dye was counted for each experimental
condition. For each sample, the cell number was counted at least
three times.
Colony formation assay
Using six-well plates, 500 cells per well were maintained in
oxygen tensions of 1%, 7%, and 20% for 48 hours. All plates were
then placed in an incubator with 20% O2 for 2 weeks for
observation of colony formation. Colonies were fixed with 4%
buffered formalin for 15 minutes, and then stained with 1% crystal
violet for 30 minutes. The plates were gently washed with PBS
and dried before microscopic colony evaluation. Colonies that
contained more than 30 cells were counted. Colony formation
efficiency was calculated as follows: colony formation efficiency =
colonies/input cells6100%. Data are representative of three
independent experiments.
Cell cycle analysis
After incubation under different oxygen tensions, including 1%
or 20% O2, the PC-3 and DU145 cells were harvested and fixed
with methanol at 220uC overnight. These cells were used to
prepare a single cell suspension to which was added 1.5 mg/ml of
Hoechst 33258 before the cells were kept on ice for 30 minutes.
After that, the samples were analyzed with an LSRII flow
cytometer (Becton Dickinson, San Jose, CA, USA).
Side population assay
Cells grown to 80% confluence (about 16106
cells) were
harvested and suspended in prewarmed RPMI 1640 medium
containing 2% fetal bovine serum and 2 mM HEPES buffer.
Hoechst 33342 dye (stock solution of 1 mg/ml; Sigma) was then
added to a final concentration of 5 mg/ml, and the mixture was
incubated with intermittent shaking for 90 minutes at 37uC, in the
presence or absence of verapamil (50 mM; Sigma). Then, the cells
were washed with ice-cold HBSS with 2% FBS, centrifuged at
4uC, and resuspended in ice-cold HBSS containing 2% FBS.
Propidium iodide was added to the suspended cells to a final
concentration of 2 mg/ml, in order to reveal viable cells. Before
analysis, the cells were filtered through a 70-mm cell strainer to
obtain a single cell suspension. The cell aggregates were discarded
from the analysis by doublet discrimination and single cells were
analyzed on a LSRII flow cytometer (BD Biosciences). Hoechst
33342 dye was excited at 350 nm and the side-population cells
were visualized by the use of red (red, 660/10 nm) vs. blue (blue,
424/44 nm) detection.
ABCG2/CD44 phenotype and Fluorescence-activated cell
sorting (FACS)
After 48 hours of incubation at oxygen tensions of 1% and
20%, the PC-3 and DU145 cells were trypsinized, counted,
washed with cold FACS buffer (PBS+BSA 0.03%), and
resuspended to a final concentration of 106
cells/ml. The cells
were pre-blocked with 5% BSA for 30 minutes on ice before they
were stained with primary antibodies (anti-CD44 monoclonal
antibody directly conjugated with APC (allophycoyanin) and
anti-ABCG2 monoclonal antibody directly conjugated with FE
(phycoerythin); BD Pharmingen Company) on ice, in the dark,
for 30 minutes. Cell suspensions were washed twice, resuspended
in 400 ml FACS buffer, and filtered through a 70-mm nylon
mesh. Samples were analyzed on a flow cytometer (Becton
Dickinson, San Jose, CA, USA) for detection of ABCG2 and
CD44, and a FACS DiVa cell sorter was used for cell sorting.
After cultivation at 1% or 20% O2 for 48 hours, the PC-3 and
DU145 cells were sorted based on CD44 expression. For the
CD44 positive cells, only the top 10% expressing cells were
selected (called CD44bright
); for the CD44 negative cells, the
bottom 10% expressing cells were isolated (called CD44dim
). For
each sample, viable and single cells were gated; APC Mouse
IgG2b (BD Pharmingen, USA) and FE Mouse IgG2b (BD
Pharmingen, USA) isotype controls were used as negative
controls.
Sphere formation assay
The assay used was based on previously described methods
[30]. After the CD44bright
cells were sorted with the method as
described above, single CD44bright
and CD44dim
cells were plated
at a density of 300 cells per well, in ultralow attachment six-well
plates (Ultra low cluster plates, Life sciences). These cells were
cultivated in serum free DMEM/F12 medium (Invitrogen)
supplemented with 20 ng/ml EGF and 20 ng/ml bFGF for ten
Stem-Like Properties of Prostate Cancer
PLoS ONE | www.plosone.org 3 December 2011 | Volume 6 | Issue 12 | e29170
days under normoxia conditions before the spheres were evaluated
under inverse miscopy and counted (more than 30 cells within a
sphere was considered to be a full sphere). Data are representative
of three independent experiments.
Statistical analyses
For each experiment, data are shown as mean 6 SEM of at
least three independent experiments; SPSS software (version 16.0)
was used for data analysis. Statistical analyses were performed
Figure 1. Hypoxia increases the expressions of HIF-1a and HIF-2a. (A) In comparison to the cells cultivated at 20% O2, the cells cultivated at
7% O2 show higher levels of HIF-1a and HIF-2a, and the cells cultivated at 1% O2 show the highest levels of HIF-1a and HIF-2a by both RT-PCR and
immunoblotting. (B) Immunocytochemistry reveals higher levels of HIF-1a and HIF-2a expressions in the cells cultivated under 7% O2 and the highest
levels of HIF-1a and HIF-2a expressions in the cells cultivated under 1% O2 for both cell lines. The breast carcinoma sections were used as positive
controls for both HIF-1a and HIF-2a. All photos were originally taken at 2006 and all the insets were taken at 4006.
doi:10.1371/journal.pone.0029170.g001
Stem-Like Properties of Prostate Cancer
PLoS ONE | www.plosone.org 4 December 2011 | Volume 6 | Issue 12 | e29170
Figure 2. Hypoxia increases the expressions of Oct3/4 and Nanog. (A) In comparison to the cells cultivated at 20% O2, the cells cultivated at
7% O2 show higher levels of Oct3/4 and Nanog expressions, and the cells cultivated at 1% O2 show the highest levels of Oct3/4 and Nanog
expressions in PC-3 and DU145 cell lines by both RT-PCR and immunoblotting. (B) Immunocytochemistry reveals corresponding higher levels of Oct3/
4 and Nanog expressions at 7% O2 and the highest levels of Oct3/4 and Nanog expressions at 1% O2, in comparison to the cells cultivated at 20% O2
for both cell lines. Human seminoma tissue sections were used as positive controls for these two antibodies. All photos were originally taken at 2006
and all the insets were taken at 4006.
doi:10.1371/journal.pone.0029170.g002
Stem-Like Properties of Prostate Cancer
PLoS ONE | www.plosone.org 5 December 2011 | Volume 6 | Issue 12 | e29170
using the one-way ANOVA test and Student’s t-test (P,0.05 was
considered statistical significance).
Results
Hypoxia induces expression of HIF-1a, HIF-2a, Oct3/4 and
Nanog
HIF-1a and HIF-2a, the major transcriptional factors responding
to hypoxia, were examined in human prostate cancer cells PC-
3 and DU145 that were exposed to different oxygen tensions for
variable periods of time. At 20% O2 tension, HIF-1a and HIF-2a
were weakly expressed at both the mRNA and protein levels;
comparatively higher levels of HIF-1a and HIF-2a expression
were observed at 7% O2 tension, and the highest levels were seen
at 1% O2 tension (Figure 1A). At reduced oxygen tension levels,
these two factors were already upregulated after 6 hours of
cultivation. Their expressions reached the highest levels at
12 hours of cultivation at 7% O2 tension, but reached highest
levels at only 6 hours of cultivation at 1% O2. Protein expression
after 48 hours of cultivation at different oxygen tensions was also
studied by immunocytochemistry (Figure 1B). The expressions of
HIF-1a and HIF-2a were consistently higher in the hypoxiatreated
cells, in agreement with the findings obtained by RT-PCR
and immunoblotting.
Oct3/4 and Nanog are frequently used as markers for the
undifferentiated cells and play an essential role in sustaining
capacity of self-renewal in adult stem cells [31,32]. The
expressions of these transcription factors were also examined in
PC-3 and DU145 cells that were cultivated at different oxygen
tensions. At both the mRNA and protein levels (Figure 2A), weak
expressions of Oct3/4 and Nanog were revealed in these two cell
lines cultivated at 20% O2 tension, while their expressions were
upregulated in cells cultivated under 7% and 1% O2 conditions. In
both cell lines, the expressions of these two factors were higher at
1% O2 than at 7% O2. As was also seen in immunoblotting
analyses (Figure 2A), Oct3/4 and Nanog began to substantially
increase as early as 6 hours after the cells were transferred to 1%
O2, and reached maximum levels at 12 hours for both cell lines.
When the cells were placed in 7% O2, the expressions of these two
factors were also substantially elevated after 6 hours, and reached
the highest levels at 12 hours cultivation; however, these expression
levels were weaker than those observed in cells exposed to 1%
O2. Similar results were also obtained by immunocytochemistry
(Figure 2B). Following exposure to hypoxic condition, enhanced
Oct3/4 and Nanog expressions were seen in both PC-3 and
DU145 cells.
To determine whether the elevated NANOG expression was
derived from NANOG1 or NANOGP8, quantitative RT-PCR
analyses were further performed, with the corresponding cells
cultivated under normoxia as calibrators. It was repeatedly verified
that the NANOG1 expression in the cells under normoxia was at
very low level, with average Ct values 37.24 and 37.37 for the PC-
3 cell and DU145 cells, respectively. However, the NANOGP8
expression in the cells under normoxia was relatively high, with
average Ct values 33.56 and 33.51 for the PC-3 cell and DU145
cells, respectively. Although higher levels NANOG1 and NANOGP8
expressions could be observed in both cell lines under hypoxia, the
elevated NANOG expression was confirmed predominantly NANOGP8,
with up to 6-fold and 10-fold increase in expression in the
PC-3 and DU145 cells under 1% O2, respectively (Figure 3). Since
the NANOG1 expression in the cells under normoxia was extremely
low, the 2.6-fold and 3.1-fold increase in expression of this gene in
the PC-3 and DU145 cells under 1% O2 represented still quite low
expression level.
Hypoxia increases colony formation capability and
extends G0/G1 stage
Since hypoxia increased the expression of stemness factors, we
next investigated whether hypoxia influenced the proliferation of
these cells. The PC-3 and DU145 cells were cultivated under
normoxia (20% O2) or hypoxia conditions (1% O2 and 7% O2)
for 48 hours for the proliferation assay. As shown in Figure 4A,
for each cell line there were no statistically significant differences
in proliferation of the cells cultivated at different oxygen tensions
(P.0.05), although the cells grew somewhat slower under
Figure 3. Quantitative PCR results of NANOG1 and NONOGP8.
Compared to the cells under normoxia, there are elevated NANOG1 and
NONOGP8 expressions in the cells under 7% O2 for both cell lines, with
up to 1.8-fold increase NANOG1 expression and up to 2.5-fold NONOGP8
increase in both cell lines; the cells under 1% O2 express even higher
levels of NANOG1 and NONOGP8, with 2.6-fold and 3.1-fold increase in
NANOG1 expression in the PC-3 and DU145 cell lines, respectively, and
with 6-fold and 10-fold increase in NONOGP8 expressions in the PC-3
and DU145 cell lines, respectively.
doi:10.1371/journal.pone.0029170.g003
Stem-Like Properties of Prostate Cancer
PLoS ONE | www.plosone.org 6 December 2011 | Volume 6 | Issue 12 | e29170
Stem-Like Properties of Prostate Cancer
PLoS ONE | www.plosone.org 7 December 2011 | Volume 6 | Issue 12 | e29170
hypoxia than normoxia. Next, we asked whether hypoxiapretreatment
could influence clonogenicty in these cells. The
cells were initially exposed to different oxygen tensions for
48 hours, followed by transfer to a normoxic chamber (20% O2)
for 14 days for the colony formation assay. Compared to the cells
that were steadily cultivated at 20% O2, more colonies were
observed in the cells that were pretreated at 7% O2, and even
more colonies were seen in the cells pretreated at 1% O2
(Figure 4B). Compared to the cells always cultivated under
normoxia, statistically significantly higher colony formation
efficiency was identified in the hypoxia-pretreated PC-3 and
DU145 ells (Figure 4C). Cell cycle analyses demonstrated an
extended G0/G1 stage in the cells that were exposed to 1% O2
for 48 hours in comparison with the cells cultivated at 20% O2 as
controls (P,0.05) (Figure 4D and E), indicating more cells in a
quiescent status under hypoxia.
Hypoxia increases the fraction of cells with stem-like
phenotype
Side population cells, assumed to contain putative prostate
cancer stem cells, are known to pump out the dye Hoechst 33342
[20,33]. Cells exhibiting this activity were further assessed during
cultivation at different oxygen tensions. Higher fractions of these
side population cells were observed in cultures kept at 1% O2
tension for 48 hours in comparison to the cells cultivated at 20%
O2 (Figure 5A and B).
ABCG2 and CD44 have been described as prostate cancer
stem-like markers based on clinical investigations and studies in
prostate cancer cell lines [19,33]. Therefore, ABCG2 and CD44
expressions in the PC-3 and DU145 cells that were incubated at
1% or 20% O2 tensions for 48 hours were examined with flow
cytometry. As shown in Figures 5C and D, threw were 1.20-fold
and 1.42-fold increase in ABCG2 expression in the PC-3 and
DU145 cells under 1% O2, respectively, in comparison to the cells
always cultivated under normoxia. Similarly, there were 1.50-fold
and 1.45-fold increases in CD44 expression in the PC-3 and
DU145 cells under 1% O2, respectively, in comparison to the cells
always cultivated under normoxia (Figures 5E and F).
Since hypoxia could induce both ABCG2 and CD44 expression
in both cell lines, we further investigated the relationship between
CD44 and ABCG2. Double staining of these two surface markers
revealed that the hypoxia-induced ABCG2+
cells were primarily
CD44bright
cells, and the CD44dim
cells under the same culture
condition were mostly negative for ABCG2 expression (Figure 6A).
CD44bright
cells show stem-like properties
The sorted CD44bright
and CD44dim
cells were further
examined by immunoblotting. As shown in Figure 6B, in both
PC-3 and DU145 cell lines grown under normoxia, the CD44bright
cells expressed higher levels of ABCG2, Oct3/4, and Nanog than
the CD44dim
cells. Hypoxic pretreatment of these cell lines for
48 hours resulted in even greater levels of expression of these
factors in the CD44bright
cells.
After verifying the higher stemness factor and ABCG2
expressions in the CD44bright
cells, both under hypoxia and
normoxia, we examined whether the CD44bright
cells had greater
colony formation capability (a property of stem-like cells). As can
be seen in Figures 7A and 7B, the CD44bright
cells formed
significantly more colonies compared to the CD44dim
cells. Next,
we tested how the CD44bright
and CD44dim
cells responded to
hypoxic pretreatment (1% O2), in comparison to the cells
consistently cultivated at normoxia. The CD44bright
cells which
were hypoxic-pretreated for 48 hours could form significantly
more colonies than the CD44bright
cells without hypoxic
pretreatment.
The sorted subpopulations of CD44bright
and CD44dim
cells
were additionally examined by sphere growth assays since sphere
growth is common in stem-like cells. As shown in Figure 7C, the
CD44dim
cells hardly formed any sphere, no matter the cells were
hypoxia pre-treated or not. However, there was a great number of
spheres in the CD44bright
cells from both cell lines, either from the
nomoxia or from the hypoxia pretreatment. Although there was
no significant sphere formation efficiency difference in the hypoxia
pre-treated CD44bright
cells compared to the nomoxia pre-treated
CD44bright
cells in both cell lines, the hypoxia pre-treated
CD44bright
cells in the PC-3 cell line demonstrated a 1.21-fold
increase in sphere formation efficiency, and the hypoxia pretreated
CD44bright
cells in the DU145 cells revealed a 1.14-fold
increase in sphere formation efficiency, in comparison with their
control cells.
Discussion
Hypoxia often occurs in the inner part of solid tumors, creating
an environment where undifferentiated tumor cells can exist. For
prostate cancer, hypoxia is commonly associated with poor
prognosis [34]. In this study, we have demonstrated that hypoxia
can upregulate stem-like properties of the prostate cancer cell lines
PC-3 and DU145. It has been hypothesized that cancer stem-like
cells may persist as a distinct population within tumors and cause
relapse and metastasis following general cancer therapies like
radiotherapy and chemotherapy. Therefore, it is of great value to
identify factors that affect the stem-like properties of cancer cells
and to determine what conditions influence the differentiation of
stem cells.
The hypoxia inducible factors HIF-1a and HIF-2a are
reportedly activated in aggressive tumor cells [35,36]. HIF-1a
expression is increased in primary prostate cancers, prostate
cancer bone marrow metastasis of PC-3 and brain metastasis of
DU145, compared to in normal prostate epithelium [37,38]. In
this study, HIF-1a was weakly expressed under normoxia and
their expressions were increased under hypoxic conditions. This is
in agreement with earlier reports of higher expressions in response
to hypoxia [39–41]. In our study, HIF-2a was also upregulated in
response to hypoxia treatment in consistent with increased
expression of HIF-1a. Moreover, in a clinical observation, HIF-
1a expression was elevated in high-grade prostatic intraepithelial
neoplastic lesions (the precursor of a majority of invasive prostate
adenocarcinoma), relative to expression levels in normal epithelium,
stromal cells, and benign prostatic hyperplasia [42].
The biological impact of hypoxia is exerted through transcriptional
factors, such as Oct3/4 and Nanog [43]. Oct3/4 and Nanog
are key players in a transcriptional network for maintenance of
Figure 4. Hypoxic effects on cell proliferation, colony formation and cell cycle. (A) Cell proliferation curves show no statistical difference for
cell growth under different oxygen tensions (P.0.05). (B) Colony formation assay for both cell lines shows more colonies in the cells pre-treated at 7%
O2 for 48 hours and even more colonies in the cells pre-treated under 1% O2 (C) Histograms for the colony formation efficiency shows statistically
higher efficiency in the cells pre-treated under hypoxia (7% or 1% O2) for both cell lines (P,0.0001). (D) Flow cytometry shows extended G0/G1 stage
for both cell lines which have been cultivated under 1% O2 for 48 hours, in comparison to the cells always kept under normoxia. (E) Statistical
analyses reveal significantly extended G0/G1 stage in the cells cultivated under hypoxia for both cell lines (P,0.05).
doi:10.1371/journal.pone.0029170.g004
Stem-Like Properties of Prostate Cancer
PLoS ONE | www.plosone.org 8 December 2011 | Volume 6 | Issue 12 | e29170
Stem-Like Properties of Prostate Cancer
PLoS ONE | www.plosone.org 9 December 2011 | Volume 6 | Issue 12 | e29170
embryonic stem cell and primordial germ cells self-renewal [6,11].
Our present study revealed that Oct3/4 and Nanog were expressed
in the prostate cancer cell lines PC-3 and DU145, albeit in a lower
level. Invasive tumor cells are shown with a stem-like genomic
signature expressing a number of stem cell genes, including Oct3/4
and Nanog and these cells are more tumorigenic compared to their
non-invasive counterpart [44]. In our present study, we found that
the expressions of these genes were upregulated upon hypoxia
exposure, at both the mRNA and protein levels, in parallel with the
increasing expressions of HIF-1a and HIF-2a. The upregulation of
Oct3/4 expression could be correlated with the enhanced HIF-2a
expression under hypoxia and this observation is consistent with
previous findings that HIF-2a binds to the promoter of Oct3/4 and
induces its expression and activity directly [45], supporting a
potential role for the interaction of HIF-2a and Oct3/4 in prostate
cancer cells response to hypoxia.
Figure 5. Stem-like phenotype analyses by flow cytometry. PC-3 and DU145 cells were cultivated in 1% O2 and 20% O2 coditions for 48 hours
to analyze stem-like phenotype through flow cytometry assay. (A) The representative images show that side population cells were induced in both
cell lines after hypoxic treatment. (B) Statistic analyses show significant difference in side population. (C) Flow cytometry analyses show higher levels
of ABCG2 expression intensity in both cell lines under hypoxia. (D) Histogram shows statistically significant difference in ABCG2 expression. (E) Flow
cytometry analyses show higher CD44 expression intensity in both cell lines under hypoxia. (F) Histogram shows statistically significant difference in
CD44 expression.
doi:10.1371/journal.pone.0029170.g005
Figure 6. CD44bright
cells are mainly positive for ABCG2, Oct3/4 and Nanog. (A) Double staining of CD44 and ABCG2 surface markers with
flow cytometry assay shows higher levels expressions of these factors in both cell lines under hypoxia for 48 hours. (B) The CD44bright
cells under
normoxia express higher levels of ABCG2, Oct3/4 and Nanog, but the CD44dim
cells under the same normoxia condition express very low levels of
these factors. The CD44bright
cells pretreated under 1% O2 for 48 hours show even higher levels of these factors compared to the CD44bright
cells
cultivated under normoxia.
doi:10.1371/journal.pone.0029170.g006
Stem-Like Properties of Prostate Cancer
PLoS ONE | www.plosone.org 10 December 2011 | Volume 6 | Issue 12 | e29170
Stem-Like Properties of Prostate Cancer
PLoS ONE | www.plosone.org 11 December 2011 | Volume 6 | Issue 12 | e29170
In order to discriminate whether the upregulated NANOG
mRNA expression was derived from NANOG1 and/or NANOGP8
genes in response to hypoxia, specific primers and probes were
used to detect the expressions of these two genes in PC-3 and
DU145 cell lines under different oxygen tensions by quantitative
RT-PCR. In line with previous reports, there was extremely low
level NANOG1 expression in these cells [16,29]. Although hypoxia
could upregulate the expression of this gene in both cell lines, the
expressions of the gene in these cells were still very low even in the
cells under hypoxia. However, the NANOGP8 was expressed in
higher levels in both cell lines under normoxia, and its expression
was greatly upregulated by hypoxia, with up to 6-fold and 10-fold
increase in the PC-3 and DU145 cell lines, respectively, indicating
that NANOGP8 expression was predominantly influenced by
hypoxia. Since Nanog protein expression was upregulated under
hypoxia, and the cells under hypoxia revealed greater stem-like
features, our results may support the notion that NANOGP8 plays
an important role on the cancer stem-like properties in prostate
cancer cells [16,29].
It is well documented that oxygen plays an important role in the
development of tissues and cells. Hypoxia often occurs in
pathophysiological conditions, especially when growth exceeds
the blood supply in the tumor. It has been speculated that the
formation of a hypoxic niche may drive selection of cancer stem
cells that can maintain tumors by regulating specific developmental
programs. Based on these reports, we wanted to know whether
hypoxia influenced cell proliferation. Although there was no
statistically significant difference between cells’ proliferation under
hypoxia compared to that under normoxia, the cells grew slowly
under hypoxia with extended G0/G1, indicating higher quiescent
status of these cells in hypoxia.
To study the effect of hypoxia on stem-like cell phenotypes, we
assessed the fraction of side population cells. The side population
assay has been successfully used for identification of cancer stemlike
cells in studies of common urological malignancies, including
prostate, bladder, and renal cancers [47]. Our experiments
revealed a significantly higher number of side population cells in
both the PC-3 and DU145 cells that were treated with 48 hours in
1% O2, strongly indicating that stem-like properties of these
cancer cells could be greatly upregulate in vitro. Side population
cells contain active ATP-cassette family members (e.g., ABCG2)
that can pump Hoechst 33342 dye out of the cells and ABCG2 is
associated with multi-drug resistance. Importantly, ABCG2 is a
key molecular determinant for the side population cells and has
been reviewed as a universal stem cell marker [33]. Consistent
with the elevated fraction of side population cells, the expression of
ABCG2 was correspondingly increased in the cells treated at 1%
O2 tension, in comparison with the cells cultivated at 20% O2 for
both cell lines. Since CD44 is considered a putative surface marker
for cancer stem/progenitor cells in breast and prostate cancers
[19,22,48,49], we analyzed CD44 expressions in these cells as well.
Our study showed that CD44 expression was significantly induced
under hypoxia. The putative prostate cancer stem-like cell marker
CD44 has been associated with prostate cancer stem like feature
[46], and has been indicated to play an essential role in the
quiescence of hematopoietic stem cells in the osteoblastic niche
[50]. The extended G0/G1 stage and induced CD44 and ABCG2
expressions in our present study may suggest more slow-cycling
cancer stem-like cells under hypoxia, which is in line with the study
reported by Ishimoto et al [51].
Both CD44 and ABCG2 have been strongly indicated as stem
cell markers in previous studies [19,52,53]. In the present study,
we examined these two factors in the same cell populations, in
order to explore whether their responses to hypoxic treatments
were related. Using flow cytometry, we found that most of the PC-
3 and DU145 cells were CD44 positive, but only a small portion of
cells in these two cell lines were ABCG2 positive. The ABCG2
positive cells were mostly CD44bright
cells, and hypoxia induced
expressions of CD44 and ABCG2 in both cell lines, indicating that
ABCG2 expression may be associated with CD44bright
cells. Next,
we sorted the CD44bright
cells and verified that they were primarily
strongly positivity for ABCG2. On the contrary, all the CD44dim
cells were almost ABCG2 negative. Furthermore, there were
higher levels ABCG2 expressions in the hypoxia pretreated
CD44bright
cells than the CD44bright
cells without hypoxiapretreatment
in both cell lines. Collectively, our results suggest a
strong association between ABCG2+
and CD44bright
cells.
In consistent with previous report that both NANOGP8 mRNA
and Nanog protein are enriched in the CD44bright
human prostate
cancer cells [16], we also found that higher protein expressions of
Oct3/4 and Nanog in the CD44bright
cells compared to the
corresponding CD44dim
cells. Moreover, we examined additional
stemness features of these cells using colony formation and sphere
growth assays. These experiments showed that the CD44bright
cells
formed more colonies than the CD44dim
cells. The sphere growth
assay also showed significantly higher sphere formation efficiency
for the CD44bright
cells, and this finding is supported by the former
report that CD44bright
prostate cancer cells display stem –like
characteristics such as more proliferative, clonogenic, tumorigenic
and metastatic than the corresponding CD44dim
cells [54].
Furthermore, the colony efficiency of the CD44bright
cells was
significantly improved following hypoxic pretreatment, whereas
the CD44dim
cells did not respond to such hypoxic exposure. Since
colony formation and sphere formation capabilities are confined to
stem cells [46,55,56], these results may support the hypothesis that
CD44bright
cells possess stem-like properties in the prostate cancer
cells [54].
In summary, hypoxia enhanced the stem-like properties of the
human prostate cancer cell lines PC-3 and DU145. Hypoxic
treatment also induced growth capability of CD44 positive cells in
these two cell lines, and CD44bright
cells possessed greater stem
cell-like features, as verified by higher expressions of stemness
factors and ABCG2, and significantly higher colony and sphere
formation efficiency. Furthermore, the stem-like properties of
the CD44bright
cells were significantly increased upon hypoxic
pretreatment.
Author Contributions
Conceived and designed the experiments: YM DL ZS. Performed the
experiments: YM DL JL. Analyzed the data: YM DL JL KA GK TS JMN
ZS. Contributed reagents/materials/analysis tools: ZS. Wrote the paper:
YM DL JL KA GK TS JMN ZS.
Figure 7. CD44bright
cells show stem-like properties. (A) For both PC-3 and DU145 cell lines, more colonies are shown in the CD44bright
cells
than the CD44dim
cells under nomoxia condition, while even more colonies can be seen in the CD44bright
cells pretreated under 1% O2 for 48 hours.
(B) Histograms for the colony formation efficiency show statistically significantly higher efficiency in the CD44bright
cells than the corresponding
CD44dim
cells (P,0.0001 for both cell lines), and even higher level efficiency in the hypoxia- pretreated CD44bright
cells in comparisons with the
CD44bright
cells without hypoxic pretreatment (P,0.05 for both cell lines). (C) Sphere formation assay shows spheres in the CD44bright
cells in both
normoxia and hypoxic pretreated cells while there is no qualified sphere in the corresponding CD44dim
cells for both cell lines. (D) Histograms show
sphere formation efficiency in the CD44bright
and CD44dim
cells with and without hypoxia pretreatment.
doi:10.1371/journal.pone.0029170.g007
Stem-Like Properties of Prostate Cancer
PLoS ONE | www.plosone.org 12 December 2011 | Volume 6 | Issue 12 | e29170
References
1. Crea F, Mathews LA, Farrar WL, Hurt EM (2009) Targeting prostate cancer
stem cells. Anticancer Agents Med Chem 9: 1105–13.
2. Maitland NJ, Collins AT (2008) Prostate cancer stem cells: a new target for
therapy. J Clin Oncol 26: 2862–70.
3. Marignol L, Coffey M, Lawler M, Hollywood D (2008) Hypoxia in prostate
cancer: a powerful shield against tumour destruction? Cancer Treat Rev 34:
313–27.
4. Sharifi N, Kawasaki BT, Hurt EM, Farrar WL (2006) Stem cells in prostate
cancer: resolving the castrate-resistant conundrum and implications for
hormonal therapy. Cancer Biol Ther 5: 901–6.
5. Heddleston JM, Li Z, Lathia JD, Bao S, Hjelmeland AB, et al. (2010) Hypoxia
inducible factors in cancer stem cells. Br J Cancer 102: 789–95.
6. Bae KM, Su Z, Frye C, Mcclellan S, Allan RW, et al. (2010) Expression of
pluripotent stem cell reprogramming factors by prostate tumor initiating cells.
J Urol 183: 2045–53.
7. Chen C, Wei Y, Hummel M, Hoffmann TK, Gross M, et al. (2011) Evidence for
epithelial-mesenchymal transition in cancer stem cells of head and neck
squamous cell carcinoma. PLoS One 6: e16466.
8. Nirasawa S, Kobayashi D, Tsuji N, Kuribayashi K, Watanabe N (2009)
Diagnostic relevance of overexpressed Nanog gene in early lung cancers. Oncol
Rep 22: 587–91.
9. Peng S, Maihle NJ, Huang Y (2010) Pluripotency factors Lin28 and Oct4
identify a sub-population of stem cell-like cells in ovarian cancer. Oncogene 29:
2153–9.
10. Saigusa S, Tanaka K, Toiyama Y, Yokoe T, Okugawa Y, et al. (2009)
Correlation of CD133, OCT4, and SOX2 in rectal cancer and their association
with distant recurrence after chemoradiotherapy. Ann Surg Oncol 16: 3488–98.
11. Sotomayor P, Godoy A, Smith GJ, Huss WJ (2009) Oct4A is expressed by a
subpopulation of prostate neuroendocrine cells. Prostate 69: 401–10.
12. Ben-Porath I, Thomson MW, Carey VJ, Ge R, Bell GW, et al. (2008) An
embryonic stem cell-like gene expression signature in poorly differentiated
aggressive human tumors. Nat Genet 40: 499–507.
13. Sperger JM, Chen X, Draper JS, Antosiewicz JE, Chon CH, et al. (2003) Gene
expression patterns in human embryonic stem cells and human pluripotent germ
cell tumors. Proc Natl Acad Sci U S A 100: 13350–5.
14. Ambady S, Malcuit C, Kashpur O, Kole D, Holmes WF, et al. (2010)
Expression of NANOG and NANOGP8 in a variety of undifferentiated and
differentiated human cells. Int J Dev Biol 54: 1743–54.
15. Zhang J, Wang X, Li M, Han J, Chen B, et al. (2006) NANOGP8 is a retrogene
expressed in cancers. Febs J 273: 1723–30.
16. Jeter CR, Badeaux M, Choy G, Chandra D, Patrawala L, et al. (2009)
Functional evidence that the self-renewal gene NANOG regulates human tumor
development. Stem Cells 27: 993–1005.
17. Collins AT, Berry PA, Hyde C, Stower MJ, Maitland NJ (2005) Prospective
identification of tumorigenic prostate cancer stem cells. Cancer Res 65:
10946–51.
18. Miki J, Furusato B, Li H, Gu Y, Takahashi H, et al. (2007) Identification of
putative stem cell markers, CD133 and CXCR4, in hTERT-immortalized
primary nonmalignant and malignant tumor-derived human prostate epithelial
cell lines and in prostate cancer specimens. Cancer Res 67: 3153–61.
19. Palapattu GS, Wu C, Silvers CR, Martin HB, Williams K, et al. (2009) Selective
expression of CD44, a putative prostate cancer stem cell marker, in
neuroendocrine tumor cells of human prostate cancer. Prostate 69: 787–98.
20. Bhatt RI, Brown MD, Hart CA, Gilmore P, Ramani VA, et al. (2003) Novel
method for the isolation and characterisation of the putative prostatic stem cell.
Cytometry A 54: 89–99.
21. Cortes-Dericks L, Carboni GL, Schmid RA, Karoubi G (2010) Putative cancer
stem cells in malignant pleural mesothelioma show resistance to cisplatin and
pemetrexed. Int J Oncol 37: 437–44.
22. Hurt EM, Kawasaki BT, Klarmann GJ, Thomas SB, Farrar WL (2008) CD44+
CD24(2) prostate cells are early cancer progenitor/stem cells that provide a
model for patients with poor prognosis. Br J Cancer 98: 756–65.
23. Liu T, Xu F, Du X, Lai D, Liu T, et al. (2010) Establishment and
characterization of multi-drug resistant, prostate carcinoma-initiating stem-like
cells from human prostate cancer cell lines 22RV1. Mol Cell Biochem 340:
265–73.
24. Forristal CE, Wright KL, Hanley NA, Oreffo RO, Houghton FD (2010)
Hypoxia inducible factors regulate pluripotency and proliferation in human
embryonic stem cells cultured at reduced oxygen tensions. Reproduction 139:
85–97.
25. Ma T, Grayson WL, Frohlich M, Vunjak-Novakovic G (2009) Hypoxia and
stem cell-based engineering of mesenchymal tissues. Biotechnol Prog 25: 32–42.
26. Kim Y, Lin Q, Glazer PM, Yun Z (2009) Hypoxic tumor microenvironment and
cancer cell differentiation. Curr Mol Med 9: 425–34.
27. Kim Y, Lin Q, Zelterman D, Yun Z (2009) Hypoxia-regulated delta-like 1
homologue enhances cancer cell stemness and tumorigenicity. Cancer Res 69:
9271–80.
28. Malladi P, Xu Y, Chiou M, Giaccia AJ, Longaker MT (2007) Hypoxia inducible
factor-1alpha deficiency affects chondrogenesis of adipose-derived adult stromal
cells. Tissue Eng 13: 1159–71.
29. Jeter CR, Liu B, Liu X, Chen X, Liu C, et al. (2011) NANOG promotes cancer
stem cell characteristics and prostate cancer resistance to androgen deprivation.
Oncogene 30: 3833–45.
30. Dontu G, Abdallah WM, Foley JM, Jackson KW, Clarke MF, et al. (2003) In
vitro propagation and transcriptional profiling of human mammary stem/
progenitor cells. Genes Dev 17: 1253–70.
31. Kim JH, Jee MK, Lee SY, Han TH, Kim BS, et al. (2009) Regulation of adipose
tissue stromal cells behaviors by endogenic Oct4 expression control. PLoS One
4: e7166.
32. Yasuda SY, Tsuneyoshi N, Sumi T, Hasegawa K, Tada T, et al. (2006)
NANOG maintains self-renewal of primate ES cells in the absence of a feeder
layer. Genes Cells 11: 1115–23.
33. Pascal LE, Oudes AJ, Petersen TW, Goo YA, Walashek LS, et al. (2007)
Molecular and cellular characterization of ABCG2 in the prostate. BMC Urol 7:
6.
34. Mori R, Dorff TB, Xiong S, Tarabolous CJ, Ye W, et al. (2010) The relationship
between proangiogenic gene expression levels in prostate cancer and their
prognostic value for clinical outcomes. Prostate 70: 1692–700.
35. Khandrika L, Lieberman R, Koul S, Kumar B, Maroni P, et al. (2009) Hypoxiaassociated
p38 mitogen-activated protein kinase-mediated androgen receptor
activation and increased HIF-1alpha levels contribute to emergence of an
aggressive phenotype in prostate cancer. Oncogene 28: 1248–60.
36. Koh MY, Powis G (2009) HAF: the new player in oxygen-independent HIF-
1alpha degradation. Cell Cycle 8: 1359–66.
37. Kimbro KS, Simons JW (2006) Hypoxia-inducible factor-1 in human breast and
prostate cancer. Endocr Relat Cancer 13: 739–49.
38. Park JY, Park JW, Suh SI, Baek WK (2009) D-glucosamine down-regulates HIF-
1alpha through inhibition of protein translation in DU145 prostate cancer cells.
Biochem Biophys Res Commun 382: 96–101.
39. Bryant CS, Munkarah AR, Kumar S, Batchu RB, Shah JP, et al. (2010)
Reduction of hypoxia-induced angiogenesis in ovarian cancer cells by inhibition
of HIF-1 alpha gene expression. Arch Gynecol Obstet 282: 677–83.
40. Hua K, Din J, Cao Q, Feng W, Zhang Y, et al. (2009) Estrogen and progestin
regulate HIF-1alpha expression in ovarian cancer cell lines via the activation of
Akt signaling transduction pathway. Oncol Rep 21: 893–8.
41. Shin J, Lee HJ, Jung DB, Jung JH, Lee HJ, et al. (2011) Suppression of STAT3
and HIF-1 Alpha Mediates Anti-Angiogenic Activity of Betulinic Acid in
Hypoxic PC-3 Prostate Cancer Cells. PLoS One 6: e21492.
42. Monsef N, Helczynski L, Lundwall A, Pahlman S (2007) Localization of
immunoreactive HIF-1alpha and HIF-2alpha in neuroendocrine cells of both
benign and malignant prostate glands. Prostate 67: 1219–29.
43. Li Z, Rich JN (2010) Hypoxia and hypoxia inducible factors in cancer stem cell
maintenance. Curr Top Microbiol Immunol 345: 21–30.
44. Mathews LA, Hurt EM, Zhang X, Farrar WL (2010) Epigenetic regulation of
CpG promoter methylation in invasive prostate cancer cells. Mol Cancer 9: 267.
45. Covello KL, Kehler J, Yu H, Gordan JD, Arsham AM, et al. (2006) HIF-2alpha
regulates Oct-4: effects of hypoxia on stem cell function, embryonic
development, and tumor growth. Genes Dev 20: 557–70.
46. Li H, Chen X, Calhoun-Davis T, Claypool K, Tang DG (2008) PC3 human
prostate carcinoma cell holoclones contain self-renewing tumor-initiating cells.
Cancer Res 68: 1820–5.
47. Oates JE, Grey BR, Addla SK, Samuel JD, Hart CA, et al. (2009) Hoechst
33342 side population identification is a conserved and unified mechanism in
urological cancers. Stem Cells Dev 18: 1515–22.
48. Marsden CG, Wright MJ, Pochampally R, Rowan BG (2009) Breast tumorinitiating
cells isolated from patient core biopsies for study of hormone action.
Methods Mol Biol 590: 363–75.
49. Ponti D, Zaffaroni N, Capelli C, Daidone MG (2006) Breast cancer stem cells:
an overview. Eur J Cancer 42: 1219–24.
50. Arai F, Suda T (2007) Maintenance of quiescent hematopoietic stem cells in the
osteoblastic niche. Ann N Y Acad Sci 1106: 41–53.
51. Ishimoto T, Oshima H, Oshima M, Kai K, Torii R, et al. (2010) CD44+ slowcycling
tumor cell expansion is triggered by cooperative actions of Wnt and
prostaglandin E2 in gastric tumorigenesis. Cancer Sci 101: 673–8.
52. Krishnamurthy P, Ross DD, Nakanishi T, Bailey-Dell K, Zhou S, et al. (2004)
The stem cell marker Bcrp/ABCG2 enhances hypoxic cell survival through
interactions with heme. J Biol Chem 279: 24218–25.
53. Mohan A, Kandalam M, Ramkumar HL, Gopal L, Krishnakumar S (2006)
Stem cell markers: ABCG2 and MCM2 expression in retinoblastoma.
Br J Ophthalmol 90: 889–93.
54. Patrawala L, Calhoun T, Schneider-Broussard R, Li H, Bhatia B, et al. (2006)
Highly purified CD44+ prostate cancer cells from xenograft human tumors are
enriched in tumorigenic and metastatic progenitor cells. Oncogene 25:
1696–708.
55. Hong SP, Wen J, Bang S, Park S, Song SY (2009) CD44-positive cells are
responsible for gemcitabine resistance in pancreatic cancer cells. Int J Cancer
125: 2323–31.
56. Lukacs RU, Lawson DA, Xin L, Zong Y, Garraway I, et al. (2008) Epithelial
stem cells of the prostate and their role in cancer progression. Cold Spring Harb
Symp Quant Biol 73: 491–502.
Stem-Like Properties of Prostate Cancer
PLoS ONE | www.plosone.org 13 December 2011 | Volume 6 | Issue 12 | e29170