Visualization of two transfer RNAs trapped in transit
during elongation factor G-mediated translocation
David J. F. Ramratha,1,2
, Laura Lancasterb,1
, Thiemo Sprinka
, Thorsten Mielkea,c
, Justus Loerkea
, Harry F. Nollerb,3
,
and Christian M. T. Spahna,3
a
Institut für Medizinische Physik und Biophysik, Charité-Universitätsmedizin Berlin, 10117-Berlin, Germany; b
Department of Molecular, Cell and
Developmental Biology, Center for Molecular Biology of RNA, University of California, Santa Cruz, CA 95064; and c
UltraStrukturNetzwerk,
Max Planck Institute for Molecular Genetics, 14195 Berlin, Germany
Contributed by Harry F. Noller, November 4, 2013 (sent for review August 22, 2013)
During protein synthesis, coupled translocation of messenger
RNAs (mRNA) and transfer RNAs (tRNA) through the ribosome
takes place following formation of each peptide bond. The
reaction is facilitated by large-scale conformational changes within
the ribosomal complex and catalyzed by elongtion factor G (EF-G).
Previous structural analysis of the interaction of EF-G with the
ribosome used either model complexes containing no tRNA or only
a single tRNA, or complexes where EF-G was directly bound to
ribosomes in the posttranslocational state. Here, we present a
multiparticle cryo-EM reconstruction of a translocation intermediate
containing two tRNAs trapped in transit, bound in chimeric intrasubunit
ap/P and pe/E hybrid states. The downstream ap/P-tRNA is
contacted by domain IV of EF-G and P-site elements within the 30S
subunit body, whereas the upstream pe/E-tRNA maintains tight
interactions with P-site elements of the swiveled 30S head. Remarkably,
a tight compaction of the tRNA pair can be seen in this
state. The translocational intermediate presented here represents
a previously missing link in understanding the mechanism of translocation,
revealing that the ribosome uses two distinct molecular
ratchets, involving both intra- and intersubunit rotational movements,
to drive the synchronous movement of tRNAs and mRNA.
ratcheting | chimeric hybrid state | ribosome dynamics |
translocation mechanism | fusidic acid
During protein synthesis the ribosome iteratively incorporates
new amino acids delivered by aminoacylated transfer RNAs
(tRNA) into the growing polypeptide chain in a manner specified
by the codons in a messenger RNAs (mRNA). This elongation
cycle is controlled by the two translocational GTPases elongation
factors (EF)-Tu and EF-G. Following EF-Tu–dependent delivery
of aminoacyl-tRNA to the A site and peptide bond formation,
the ribosome adopts a pretranslocational state containing
a peptidyl A-site tRNA and a deacylated P-site tRNA. In the
subsequent translocation reaction, the interplay between the ribosome
and elongation factor EF-G shifts the tRNAs from the A
and P sites to the P and E sites, respectively. In each of these
binding sites a tRNA contacts both ribosomal subunits and
interacts with the 30S and 50S subunits via its anticodon-stem
loop (ASL) and acceptor arm, respectively (1). Partial tRNA
movement can occur before the EF-G–dependent translocation
step, involving spontaneous and reversible movement of the
tRNA acceptor arms relative to the large ribosomal subunit,
which leads to a shift from classic A/A and P/P binding states into
intersubunit A/P and P/E hybrid states (where the first and
second letters indicate tRNA contacts on the small and large
subunits, respectively) (2–4).
A remarkable feature of translocation is the precise coupling
of movement of the tRNAs together with the bound mRNA
(designated as the tRNA2•mRNA module), so that the mRNA
advances by exactly one codon on the ribosome. Translocation is
associated with large-scale conformational changes within the
ribosomal complex, which includes rotation and back-rotation
between the two subunits (during which the small subunit rotates
counterclockwise and clockwise relative to the large subunit,
viewing the ribosome from the solvent side of the small subunit)
(5–7), and an additional forward and reverse swiveling movement
of the 30S head (an autonomous domain of the 30S subunit,
which can rotate around an axis roughly orthogonal to the
axis of intersubunit rotation) (6, 8–13). Structural studies have
suggested that intersubunit rotation within the pretranslocational
complex is coupled to tRNA hybrid state formation (14–18). EFG–dependent
movement of the tRNAs and mRNA on the 30S
subunit then occurs during reversal of the intersubunit rotation
(6, 7). Moreover, multiparticle cryo-EM and X-ray crystallography
studies suggest that movement of the tRNAs relative to the
30S subunit occurs via additional intermediate tRNA binding
states, which are formed upon the back rotation of the 30S-body/
platform and a large swiveling movement of the 30S head (6, 10).
One of the first implications of swiveling of the 30S subunit head
came from the studies of Schuwirth et al. (19), who observed
a constriction of 13 Å between head and body of the 30S subunit
that would block passage of tRNA between the P and E sites.
These authors suggested that rotation of the 30S head would
allow movement of the tRNA ASL, and could correspond to an
unlocking event during translocation. Although swiveling of the
Significance
One of the most critical and complex steps of the protein
synthesis elongation cycle is the coupled translocation of messenger
(m)RNA and the A- and P-site transfer (t)RNAs through
the ribosome, catalyzed by the elongation factor EF-G. This
step involves large-scale molecular movements in the ribosome,
including rotational movements of the body and head of
the 30S subunit. Previously, structures have been obtained for
trapped intermediates containing a single tRNA. Here, we report
the cryo-EM structure of an intermediate trapped with
both tRNAs. This structure represents a previously missing link
in understanding the mechanism of translocation, revealing
that the ribosome uses two distinct molecular ratchets, involving
both intra- and intersubunit rotational movements, to
drive the synchronous movement of tRNAs and mRNA.
Author contributions: D.J.F.R., L.L., H.F.N., and C.M.T.S. designed research; D.J.F.R., L.L.,
T.S., T.M. and J.L. performed research; L.L. contributed new reagents/analytic tools; D.J.F.R.,
L.L., H.F.N. and C.M.T.S. analyzed data; and D.J.F.R., L.L., H.F.N. and C.M.T.S. wrote the
paper.
The authors declare no conflict of interest.
Data deposition: The data reported in this paper have been deposited in the EMDB
database, www.ebi.ac.uk/pdbe/emdb/ (accession no. EMDB-5775), and the Protein Data
Bank, www.ebi.ac.uk/pdbe/ (accession nos. 3j5n and 3j5o).
1
D.J.F.R. and L.L. contributed equally to this work.
2
Present address: Department of Biology, Institute of Molecular Biology and Biophysics,
Eidgenössiche Technische Hochschule Zürich, 8093 Zürich, Switzerland.
3
To whom correspondence may be addressed. E-mail: harry@nuvolari.ucsc.edu or
christian.spahn@charite.de.
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.
1073/pnas.1320387110/-/DCSupplemental.
20964–20969 | PNAS | December 24, 2013 | vol. 110 | no. 52 www.pnas.org/cgi/doi/10.1073/pnas.1320387110
small subunit head has been observed in different ribosomal
complexes with bound EF-G (or eEF2) (6, 8–13) or with bound
tRNAs (18), it has not been observed directly in the context of an
authentic translocation complex containing EF-G together with
two tRNAs. Previous structural analysis of translocation used
model complexes where EF-G was directly bound to either vacant
ribosomes, to ribosomal complexes with one tRNA, or to
complexes in the posttranslocational state (5, 6, 8, 10–13, 20–22).
The present study describes a cryo-EM reconstruction more
closely resembling an authentic translocation intermediate, in
which EF-G•GTP was bound to a canonical pretranslocational
ribosomal complex containing two tRNAs and mRNA, and
stalled during the translocation reaction by the antibiotic fusidic
acid (FA). The resulting sample was analyzed by means of
multiparticle cryo-EM (23). The classification yielded only a single
major population of 70S•EF-G•GDP•FA particles trapped in an
intermediate state of the translocation reaction. In contrast to all
previously described 70S•EF-G structures (5, 6, 10–13, 20–22), the
resulting reconstruction directly visualizes two tRNAs bound to
the ribosome in two different chimeric intrasubunit hybrid states.
The data presented here show how reciprocal conformational
changes within the ribosome coordinate the synchronous movement
of the mRNA and bound tRNA pair.
Results
Sample Preparation and Multiparticle Classification. To analyze the
mechanism of translocation, EF-G, GTP, and the antibiotic FA
were incubated with Escherichia coli 70S ribosomes in the pretranslocational
state carrying tRNAfMet
and Val-tRNAVal
in the P
and A sites, respectively. FA specifically traps EF-G upon ribosome
binding and GTP hydrolysis as it prevents complete conversion
from the GTP to the GDP conformation, which is
required for release of EF-G•GDP from the ribosome (6, 10, 22).
The resulting sample was subjected to multiparticle classification
to solve the problem of potential conformational heterogeneity
within a prepared cryo-EM specimen, which can be caused by
substoichometric complex formation (23). However, the multiparticle
classification of the cryo-EM dataset yielded only a single
population of 279,309 70S•EF-G•GDP•FA particle images,
which were used for a final cryo-EM reconstruction giving a resolution
of 6.8 Å (Fig. 1 and Fig. S1). The resulting cryo-EM map
shows the complex of a 70S ribosome together with EF-G bound
to the factor-binding site, mRNA, and two tRNAs (Fig. 1). At this
subnanometer resolution the reconstruction displays clearly visible
secondary structural features, such as rod-shaped α-helical elements.
This finding provided the basis for generating pseudoatomic
models based on 3D coordinates of ribosomal (11), mRNA (10),
tRNA (10, 22), and EF-G (11) X-ray structures.
Overall Conformation of the Ribosome. Although the composition
of our specimen, which contains EF-G•GDP•FA and two tRNAs,
is similar to that of the posttranslocational 70S•EF-G•GDP•FA
complex, which was used for X-ray crystallography (22), remarkable
large-scale differences can be observed by comparing the ribosomal
conformations of the two complexes. Foremost among
these structural differences is the conformation of the 30S ribosomal
subunit and its orientation relative to the 50S subunit. In
contrast to the X-ray structure of the posttranslocational 70S•EFG•GDP•FA
complex in a classic unrotated and unswiveled ribosomal
state (22), the 30S head domain of the present complex is
swiveled by ∼18°, whereas the body/platform domain has undergone
a moderate rotation of ∼2.5° (Fig. 1C). These movements
cause a displacement of peripheral elements of the 30S head over
distances of up to ∼36 Å compared with a ribosome in the
unrotated state (22) (Fig. 1C). The conformation of the present
complex bears overall similarity to recently described 70S•EF-G
complexes designated as translocation intermediate (TIPOST
) (6)
or GDPNP-II (10) characterized by an intermediate (∼5°) body/
platform rotation and large (∼18°) head swivel. However, the
latter complexes contained only a single tRNA (6, 10), whereas
the present complex contains two tRNAs, more closely resembling
an authentic translocation intermediate (TIPOST
). In this view, the
TIPOST
state is adopted after formation of the preceding TIPRE
state, which was observed with a single bound tRNA (6, 12, 13).
This TIPRE
to TIPOST
transition would include a back-rotation of
the body/platform region from ∼7–9° to ∼2.5° and an additional
swiveling movement of the 30S head domain from ∼5–7.5° to
∼18°. In agreement with the X-ray structures of 70S•EF-G complexes
(10), the present structure also shows that the swiveling
movement of the 30S head is accompanied by a lateral movement
of the tip of Helix H38 (also called the A-site finger) and leads to
formation of a new intersubunit contact formed between S19 and
the tip of the A-site finger (SI Results and Discussion and Fig. S2).
Structural Characterization of the tRNA Binding Sites. The observed
structural changes of the ribosome have a unique influence on the
interactions between the ribosome and bound tRNAs. In each of
the three classic binding states a tRNA interacts with a specific set
of rRNA and ribosomal protein residues, which are distributed
between both ribosomal subunits (1). In the trapped intermediate
structure described here, the CCA acceptor ends of the tRNAs are
fully translocated from the P and A sites to the E and P sites,
Fig. 1. Overview of the canonical TIPOST
complex. (A and B) Cryo-EM density of the ligands ap/P- and pe/E-tRNAs (green and orange), mRNA (magenta), and
EF-G (red) in surface representation within the 70S complex [50S (blue) and 30S (yellow)] (A) or with a mesh representation of both subunits together with
docked models of the 30S [16S (yellow) and S-proteins (gray)] and 50S [23S and 5S (blue) and L-proteins (orange)] (B). (C) View from the intersubunit space
onto the 30S subunit in the presented authentic TIPOST
complex. Elements are colored according to their structural displacement compared with the classic
conformation (30) upon a common 50S alignment.
Ramrath et al. PNAS | December 24, 2013 | vol. 110 | no. 52 | 20965
BIOCHEMISTRY
respectively, on the 50S subunit (Fig. 1B). However, the tRNA
ASLs have moved to an intermediate state of translocation relative
to the 30S subunit. Interactions between the ASLs of the Val-
tRNAVal
and tRNAfMet
and the A- and P-site elements of the 30S
body are disrupted and replaced by contacts with 16S rRNA Pand
E-site residues A790 and U788/A695, respectively (Fig. S3).
At the same time, the ASL of tRNAfMet
maintains its characteristic
P-site contacts with A1229, G1338, and A1339 within the 30S
head, as it moves to follow the large ∼18° swiveling movement of
the 30S head (Fig. S3). The latter movement results in a chimeric
hybrid binding state (the pe/E state; where p and e indicate contact
between the ASL and the P site of the 30S head and E site of
the 30S body/platform; and E indicates contact of the acceptor
end with the 50S E site) in which the ASL of tRNAfMet
is held
between the P site of the 30S head and the E site of the 30S body,
whereas its CCA acceptor end is bound to the 50S E site, as observed
in previous 70S•EF-G complexes containing a single tRNA
(6, 10). Meanwhile, contacts between the ASL of the A-site Val-
tRNAVal
and the A-site elements of the 30S body are disrupted, as
the ASL had moved during TIPOST
state formation. This process
results in formation of an additional chimeric hybrid state (the ap/
P state) in which the ASL is positioned between the A site of the
30S head and the P site of the 30S body, whereas its acceptor end
is bound to the 50S P site (Fig. S3). This observed network of
ribosome–tRNA interactions is distinct from the posttranslocational
70S•EF-G•GDP•FA complex in which the tRNAs are
bound in their classic P/P and E/E binding states (22), and to
rotated pretranslocational ribosome complexes with tRNAs bound
in intersubunit A/P and P/E hybrid states (14–18) (Fig. S3).
Therefore, the Val-tRNAVal
and tRNAfMet
bound in the complex
presented here occupy a pair of tRNA binding states that can be
understood as chimeric intrasubunit ap/P and pe/E hybrid states,
which is consistent with related single-molecule studies (24). Although
the pe/E binding state is similar to that observed previously
for trapped ribosome•EF-G intermediate complexes containing
a single tRNA (6, 10), the ap/P tRNA represents a previously
unobserved binding state whose functional role was predicted by
a recently suggested model for canonical translocation (6).
Within the present FA-stalled intermediate, the tRNA2•mRNA
module has already moved relative to the 50S subunit and the
30S body/platform domain, in agreement with a toe-print signal,
which indicated full mRNA-translocation for a similar FAtrapped
ribosomal complex (25). This observation is consistent
with the results of presteady-state kinetics experiments, which
showed that GTP hydrolysis by EF-G precedes movement of
the tRNA2•mRNA module (26). Movement then occurs independent
of and parallel to the release of Pi from the ribosomebound
EF-G•GDP•Pi complex. However, as shown here, translocation
is not completed in this FA-stalled state because the 30S
head still maintains its characteristic pretranslocational A and P
site contacts with the ap/P- and pe/E-tRNAs (Fig. S3). The kinetic
model of Savelsbergh et al. (26) does not account for the
occurrence of multiple steps of mRNA and tRNA movement. In
light of the important role of 30S head rotation, it seems likely
that this is a consequence of basing this model on a fluorescence
quenching assay to detect mRNA movement. As discussed elsewhere
(9), quenching may occur when the mRNA is moved into
contact with the head or body of the 30S subunit, or alternatively
when the 30S subunit head or body rotates into contact with the
mRNA during their respective reverse rotations; these different
possibilities render the interpretation of the quenching results
ambiguous. Thus, the quenching assay may not report on the final
steps of translocation.
EF-G Contacts the ap/P-tRNA, mRNA, and the 30S Head. The reconstruction
of the present complex displays well-defined cryoEM
density for EF-G, which binds to the factor-binding site and
places its domain IV into the ribosomal A site (Fig. 2). In this
position, domain IV establishes contacts with the ap/P-tRNA,
mRNA and h34 of 16S rRNA in the swiveled head (Fig. 2). Thus,
the structure unifies separate structural observations coming from
other 70S•EF-G complexes, in which either the domain IV–
codon-anticodon interaction (22) or the domain IV–h34 contact
were observed (6, 10). Interestingly, there are certain similarities
in comparing the two contacts between EF-G and the two RNA
helices, h34 and the mRNA codon–ap/P-tRNA anticodon helix
(codon-anticodon helix). In each case, one of two protruding loops
at the tip of domain IV (loop I or loop II) intercalates into the
minor groove of the codon-anticodon helix or h34 of 16S rRNA,
respectively. Remarkably, at the apical tips of both loops two
neighboring glycine residues, which are 100% conserved among
bacteria [Gly510/Gly511 and Gly542/Gly543 (E. coli nomenclature)
for loop I and loop II, respectively] facilitate the tight turns
required for their intercalation into the RNA minor grooves (Fig.
2B). Including all EF-G residues within 5 Å of mRNA and the ap/
P-tRNA, the loop I region of EF-G buries a surface area of ∼1,000
Å2
; in contrast, the loop II region buries an area of only ∼390 Å2
(Fig. 2). Accordingly, the loop I–codon-anticodon helix interaction
may act as a robust “doorstop” to prevent back-slippage of the
ap/P-tRNA and mRNA, whereas the less extensive loop II–h34
contact may help to stabilize the orientation of the 30S head. The
latter interaction can explain why binding of EF-G leads to transient
protection of h34 against chemical modification during the translocation
reaction (27). In this regard the present structure reveals an
important function of EF-G and explains the overall shape of its
Fig. 2. Contacts of EF-G domain IV. (A) Cryo-EM density of the presented
TIPOST
complex shown as transparent gray surface together with docked
models of the 30S, mRNA, ap/P-tRNA, and EF-G (colored as in Fig. 1) in the
indicated view (Left). (B) Cartoon representation of the canonical TIPOST
complex highlighting the interactions between loop I and loop II within EF-G
domain IV and the minor grooves of the mRNA codon–tRNA anticodon helix,
as well as h34, respectively. (C) Cartoon representation of the A1492 and
A1493 (blue) within h44 (yellow) in their tentative positions during translocation
(suggested by the present authentic TIPOST
) (Upper) and upon domain
closure during decoding (observed in a 70S•tRNA3•EF-Tu•GDP•kir
complex) (43) (Lower). (D) Cartoon representation of A1492 and A1493 as
shown in C, Lower, together with the antibiotics paramomycin (green) (32),
viomycin (red), and capreomycin (cyan) (31).
20966 | www.pnas.org/cgi/doi/10.1073/pnas.1320387110 Ramrath et al.
domain IV. Like a hand with two protruding fingers, domain IV
uses loop I and loop II to establish simultaneous protein–RNA
minor groove interactions with the codon-anticodon RNA triplet, as
well as with h34. These data reveal how EF-G stabilizes the synchronous
movement of the ap/P-tRNA anticodon, its corresponding
mRNA codon, and the associated swiveling of the 30S
head in the course of translocation. In addition, in agreement
with observations coming from a high-resolution X-ray structure
of a 70S•EF-G complex (13) and related data from a 80S•eEF2
complexes at intermediate resolution (28), the present data
suggest that EF-G might trigger conformational changes within
the 30S decoding center (Fig. 2 C and D and Fig. S4). These
changes may include reorientation of A1492 and lead to destabilization
of its interaction with the minor groove of the codon-anticodon
helix. Such an interpretation would be consistent
with the results of presteady-state kinetics studies (29) and may
explain the inhibitory effects of the antibiotics paromomycin and
viomycin, which reduce the rate of translocation by about 160- and
>10,000-fold, respectively (30). Both antibiotics bind around h44
and stabilize the flipped-out positions of A1492 and A1493 (31,
32) (Fig. 2D). In particular, the presence of viomycin prevents
such a proposed reorientation, as it would sterically clash with
a reoriented A1492 (31) (Fig. 2D). This suggested mechanism
would be consistent with kinetic and FRET studies, both of which
describe translocation intermediates that can be stalled by viomycin
(33, 34). Factor-induced rearrangements within the small subunitdecoding
center residues were also observed during eukaryotic
translation initiation (35). In the context of these structural data
(13, 28, 29, 33–35) the small subunit-decoding center may be seen
as a general pivotal element of the ribosome, whose flexibility is
precisely controlled by external factors to coordinate several steps
during different phases of translation.
tRNA Compaction. Comparison of the present tRNAs in their
intrasubunit ap/P and pe/E hybrid states with tRNAs in classic A,
P, and E sites using a 50S alignment (36) reveals a gap between
the ASLs of the pe/E- and E-site tRNAs, placing the pe/E-tRNA
ASL 4 Å closer to the P site (Fig. 3). The cognate E-site tRNA
was selected for the present comparison because it directly
interacts with the corresponding mRNA E site codon and creates
at least one base pair of the codon-anticodon triplet (36, 37).
However, the observed pe/E-tRNA superimposes closely on the
pe*/E-tRNA bound to 70S•EF-G complex in an overall similar
conformation (GDPNP-II) (10). Accordingly, the detected 4 Å
gap indicates that the movement of the tRNA from the P to the
E site is not fully completed during the FA-stalled TIPOST
state
formation. Apparently, a further movement of the tRNA must
occur during the final step of translocation: that is, the release of
EF-G•GDP and reverse rotation of the 30S subunit head. Such
an interpretation would be compatible with the reported presteady-state
kinetic model (26). Although the used biochemical
system does not provide a resolution to describe such small-scale
tRNA movements, the derived model indicates that translocation
is completed by rearrangements within EF-G and the
ribosome (26). Furthermore, we observe compaction of the
tRNA pair during the translocation reaction. TIPOST
formation
moves the P-site tRNA ASL by about 20 Å from its classic
position into the pe/E state (measuring the distance between their
respective nucleotides at position 31). In contrast, the A-site
tRNA moves by about 32 Å into the ap/P state and is thus pushed
against the pe/E-tRNA ASL, presumably stabilized by its interaction
with EF-G domain IV. Thus, the two tRNA ASLs move
closer together, as indicated by the 20 Å distance between their
apical base pairs and may even allow tRNA–tRNA contact in this
state (Fig. 3A). In contrast, much larger equivalent distances of
32.5 Å and 24 Å are observed between adjacent tRNAs occupying
classic A and P or P and E sites, respectively (Fig. 3D).
Ribosome–tRNA Interactions. Interestingly, the present reconstruction
shows very tight interactions between the 30S subunit
and the two tRNAs that involve canonical P-site contacts in
both cases. In the 30S platform, A790 contacts the “downstream”
ap/P-tRNA, whereas around the 30S head G1338/A1339 contacts
the “upstream” pe/E-tRNA (Fig. 4 A and B). Thus, the Psite
interactions are partitioned between the two tRNAs in their
observed transit states. Furthermore, the reconstruction suggests
that both tRNAs maintain tight interactions with their corresponding
mRNA codons (Fig. 4C). Close interaction between
the pe/E-tRNA anticodon and mRNA codon created by three
base pairs was also observed in the overall similar 70S•EF-G
(GDPNP-II) structure with a single bound pe*/E-tRNA (10).
Notably, our data suggest that consecutive codon–anticodon
interactions are maintained in both chimeric ap/P and pe/E
tRNA binding sites (Fig. 4C). The anticodon loop positions of
the pe/E-and P-site tRNA closely overlap using a 30S-head
alignment (Fig. 4D), suggesting that the interactions with G1338/
A1339 provide the major contribution in shaping the binding
pocket of the pe/E-tRNA anticodon loop.
Discussion
Coordinated Movement of tRNAs and mRNA. During the translocation
reaction, the ribosome—together with its bound ligands—must
ensure stringent coupling of the movement of the two tRNAs together
with their associated mRNA so that the mRNA advances
by exactly one codon. The structure of the present authentic
TIPOST
complex reveals two tRNAs bound in chimeric intrasubunit
ap/P and pe/E binding states trapped in an intermediate state of
translocation. In these positions, both tRNAs appear to interact
with their mRNA codons. We note that at the present resolution,
it cannot be concluded with absolute certainty that the mRNA has
moved along with the tRNAs and that the codon/anticodon densities
represent canonical pairs. Nevertheless, a toe-printing study
of an equivalent complex indicated that mRNA movement had
already occurred in the FA-stalled state (25), although our structure
Fig. 3. Ligand positions within the authentic TIPOST
complex. (A) Cryo-EM
density for the ligands within the presented authentic TIPOST
complex in
a transparent surface representation together with docked models of EF-G
(red), ap/P-tRNA (green), pe/E-tRNA (orange), and mRNA (magenta). (B)
Superimposition of the ligands (as shown in A) together with tRNAs bound
to classic A, P, and E sites (transparent gray) (23) upon a 50S alignment. (C
and D) Ribbon representation of the ribosomal ligands within the present
authentic TIPOST
complex (C), and an unrotated ribosomal complex with
classic A, P, and E-tRNAs (23) (D). Highlighted are the distances between the
last base pair within ASL of bound tRNAs.
Ramrath et al. PNAS | December 24, 2013 | vol. 110 | no. 52 | 20967
BIOCHEMISTRY
demonstrates that translocation is not yet completed. Maintaining
consecutive codon–anticodon interactions during translocation could
explain how both tRNAs contribute to avoid a frameshift event.
In addition, the present structure suggests how coupling of the
movement of mRNA and tRNAs is promoted by the ribosome
and EF-G during TIPOST
formation. Around the ribosomal A site,
synchronous movement of the mRNA codon and tRNA anticodon
is mediated via interactions with a loop (loop I) that protrudes
from the tip of domain IV of EF-G and inserts into the minor
groove of the codon-anticodon helix (Figs. 2 and 4). A second loop
(loop II) protruding from the tip of domain IV inserts into the
minor groove of h34 of 16S rRNA in the head of the 30S subunit.
In this way, domain IV of EF-G interconnects the downstream ap/
P-tRNA and its A-site codon with the head of the ribosomal 30S
subunit. If these interactions form before movement of the mRNA
and tRNA ASLs, they would link the swiveling of the 30S head to
movement of the tRNA2•mRNA module. Around the ribosomal
E site, the 16S rRNA residues G1338 and A1339 of the 30S head
appear to maintain a tight grip on the upstream pe/E-tRNA,
leading to a precise positioning of the tRNA ASL (Fig. 4). Movement
of the downstream ap/P-tRNA toward the pe/E-tRNA ASL
then results in compaction of the tRNA pair (Fig. 3).
In agreement with our recent suggested model (6), the present
work suggests that the ASLs of both tRNAs are moved from the
A/P and P/E states within a rotated pretranslocated complex to
the chimeric ap/P and pe/E states of the TIPOST
. This movement
is accompanied by a swiveling movement of the 30S head from
∼5–7.5° to ∼18° and the back rotation of the 30S body/platform
from presumably ∼7–9° to the observed ∼2.5°. Key interactions
for synchronization of head-swiveling with tRNA and mRNA
movement appear to be G1338 and A1339 for the pe/E-tRNA
and coupling of ap/P-tRNA and mRNA to h34 by domain IV of
EF-G (Figs. 2 and 4). After the back rotation of the 30S body/
platform and the EF-G–stabilized compaction of the tRNA pair,
the ap/P-tRNA creates a tight interaction with the 16S rRNA
residue A790 within the 30S body/platform (Fig. 4). Because of
this interaction, the ap/P-tRNA and the 30S body/platform stabilize
each other in the respective observed positions. This observation
complements related findings coming from the X-ray structure of
a 70S•EF-G complex (GDPNP-II) in an overall similar conformation
(10). This X-ray structure showed intercalation of
the universally conserved 16S rRNA bases C1397 and A1503
in the body of the 30S subunit between mRNA bases. By defining
the first nucleotide of the P-site codon as +1, C1397
intercalates between positions +9 and +10 mRNA nucleotides
and A1503 between −1 and −2; it was suggested that they
could potentially act as molecular pawls to prevent slippage
of the mRNA during reverse rotation of the 30S head. The ap/
P-tRNA–A790 interaction may stabilize a specific conformation
of the 30S body/platform after its back rotation from ∼7–9°
to ∼2.5°. The EF-G–stabilized compaction of the tRNA pair may
be coupled via the ap/P-tRNA–A790 contact to the positioning of
the 30S body/platform, including the bases C1397 and A1503. By
this mechanism, the positions of both intercalated bases (C1397 and
A1503) relative to the mRNA would be stabilized after tRNA
compaction and associated movement of the mRNA.
This sequence of events may also explain the process of programmed
+1 frameshifts, which were shown to occur in vitro (38)
and in vivo (39) and suppressed by frameshift-suppressor tRNAs
that contain an extra base in their anticodon loops. Structural
studies have demonstrated that such tRNAs use anticodons
loops with a special architecture and may span a four-base
mRNA quadruplet around the ribosomal A site, but still allow
the formation of the regular minor groove geometry required for
decoding (40). Accordingly, during translocation such a quadruplet
codon may passively follow the frameshift-suppressor tRNA
codon into the ribosomal ap/P-site stabilized by loop I within
EF-G domain IV. The +1 frameshift can then be manifested
by intercalation of C1397 between +10 and +11 and of A1503
between −1 and −2.
These structural observations may also rationalize why two
tRNAs (or minimally, a P-site tRNA and an ASL bound to the A
site) are required for effective translocation (41). The intrasubunit
chimeric pe/E state state can be occupied by a single-bound tRNA
as visualized by cryo-EM (6) and X-ray crystallography (10). If
such a single-bound pe/E-tRNA maintained its tight interactions
with the 30S head during the final steps of translocation (i.e., reverse
rotation of the head and release of EF-G•GDP), it would be
repositioned in the classic 30S P site rather than being moved into
the posttranslocated 30S E-site in the absence of a second tRNA.
However, reaccess to the classic 30S P site would be prevented by
steric clash with an ap/P-tRNA, which is stabilized by interactions
with A790 and possibly EF-G domain-IV.
Conclusion
The structure presented here represents a previously undescribed
visualization of a translocation intermediate containing
two tRNAs. This visualization suggests that EF-G stabilizes the
swiveling movement of the 30S head, the synchronous movement
of mRNA and tRNA through the A site, and compaction of the
tRNA pair. The ribosome can be described as a bimodular
molecular ratchet that can undergo intrasubunit (30S head
swivel) and intersubunit rotations. The canonical P-site contacts
(A790 within the body and G1338/A1339 within the head)
may act as molecular pawls to couple these reciprocal rotations
to the coordinated and synchronous movement of tRNAs
and mRNA.
Materials and Methods
Pretranslocational ribosomal complexes were prepared carrying an mRNA,
a tRNAfMet
, and a Val-tRNAVal
in the P and A site, respectively. Such pretranslocational
complexes were incubated with EF-G in the presence of
Fig. 4. Ribosome–tRNA interactions. (A) Cryo-EM density for the 30S and
ligands within the presented authentic TIPOST
complex in a transparent gray
surface representation together with docked models of the 30S (yellow), ap/
P-tRNA (green), pe/E-tRNA (orange), and EF-G (red). (B) Schematic of the 30S
subunit and bound ligands [EF-G (red), ap/P-tRNA (green) and pe/E-tRNA
(orange)] from the presented authentic TIPOST
. (C) Cryo-EM density of the
ligands within the presented authentic TIPOST
(transparent gray surface) together
with docked models of EF-G, pe/E-tRNA, ap/P-tRNA, and mRNA
(colored as in A). (D) Superimposition of the ligands from the present authentic
TIPOST
complex with either tRNAs in classic A, P, and E-site (23)
(transparent gray) upon a 30S head alignment.
20968 | www.pnas.org/cgi/doi/10.1073/pnas.1320387110 Ramrath et al.
FA and GTP. The obtained complex was flash-frozen in liquid ethane. Subsequently,
cryo-EM data were collected using a Tecnai G2
Polara Microscope
(FEI) and scanned using a D8200 Primscan drum scanner (Heidelberger
Druckmaschinen). Digitized data were processed using multiparticle classification
protocols (23) implemented with SPIDER (42). Further details are
presented in SI Materials and Methods.
ACKNOWLEDGMENTS. We thank J. Buerger for his assistance during the
cryo-EM data collection, Lucas Horan for the double-mutant ribosome
construct, and D. Ermolenko for critical discussions. This work was supported
by a grant from the Federation of European Biochemical Societies LongTerm
Fellowship (to D.J.F.R.); National Institutes of Health Grants GM-17129
and GM-59140 (to H.F.N.); and Deutsche Forschungsgemeinschaft Grants
FOR 1805 and SFB 740 (to C.M.T.S.).
1. Yusupov MM, et al. (2001) Crystal structure of the ribosome at 5.5 A resolution. Science
292(5518):883–896.
2. Moazed D, Noller HF (1989) Intermediate states in the movement of transfer RNA in
the ribosome. Nature 342(6246):142–148.
3. Blanchard SC, Kim HD, Gonzalez RL, Jr., Puglisi JD, Chu S (2004) tRNA dynamics on the
ribosome during translation. Proc Natl Acad Sci USA 101(35):12893–12898.
4. Munro JB, Altman RB, O’Connor N, Blanchard SC (2007) Identification of two distinct
hybrid state intermediates on the ribosome. Mol Cell 25(4):505–517.
5. Frank J, Agrawal RK (2000) A ratchet-like inter-subunit reorganization of the ribosome
during translocation. Nature 406(6793):318–322.
6. Ratje AH, et al. (2010) Head swivel on the ribosome facilitates translocation by means
of intra-subunit tRNA hybrid sites. Nature 468(7324):713–716.
7. Ermolenko DN, Noller HF (2011) mRNA translocation occurs during the second step of
ribosomal intersubunit rotation. Nat Struct Mol Biol 18(4):457–462.
8. Spahn CM, et al. (2004) Domain movements of elongation factor eEF2 and the eukaryotic
80S ribosome facilitate tRNA translocation. EMBO J 23(5):1008–1019.
9. Guo Z, Noller HF (2012) Rotation of the head of the 30S ribosomal subunit during
mRNA translocation. Proc Natl Acad Sci USA 109(50):20391–20394.
10. Zhou J, Lancaster L, Donohue JP, Noller HF (2013) Crystal structures of EF-G–ribosome
complexes trapped in intermediate states of translocation. Science 340(6140):
1236086.
11. Pulk A, Cate JH (2013) Control of ribosomal subunit rotation by elongation factor G.
Science 340(6140):1235970.
12. Tourigny DS, Fernández IS, Kelley AC, Ramakrishnan V (2013) Elongation factor G
bound to the ribosome in an intermediate state of translocation. Science 340(6140):
1235490.
13. Chen Y, Feng S, Kumar V, Ero R, Gao YG (2013) Structure of EF-G–ribosome complex
in a pretranslocation state. Nat Struct Mol Biol 20(9):1077–1084.
14. Agirrezabala X, et al. (2008) Visualization of the hybrid state of tRNA binding promoted
by spontaneous ratcheting of the ribosome. Mol Cell 32(2):190–197.
15. Julián P, et al. (2008) Structure of ratcheted ribosomes with tRNAs in hybrid states.
Proc Natl Acad Sci USA 105(44):16924–16927.
16. Fischer N, Konevega AL, Wintermeyer W, Rodnina MV, Stark H (2010) Ribosome dynamics
and tRNA movement by time-resolved electron cryomicroscopy. Nature
466(7304):329–333.
17. Budkevich T, et al. (2011) Structure and dynamics of the mammalian ribosomal pretranslocation
complex. Mol Cell 44(2):214–224.
18. Agirrezabala X, et al. (2012) Structural characterization of mRNA-tRNA translocation
intermediates. Proc Natl Acad Sci USA 109(16):6094–6099.
19. Schuwirth BS, et al. (2005) Structures of the bacterial ribosome at 3.5 A resolution.
Science 310(5749):827–834.
20. Valle M, et al. (2003) Locking and unlocking of ribosomal motions. Cell 114(1):
123–134.
21. Connell SR, et al. (2007) Structural basis for interaction of the ribosome with the
switch regions of GTP-bound elongation factors. Mol Cell 25(5):751–764.
22. Gao YG, et al. (2009) The structure of the ribosome with elongation factor G trapped
in the posttranslocational state. Science 326(5953):694–699.
23. Loerke J, Giesebrecht J, Spahn CM (2010) Multiparticle cryo-EM of ribosomes.
Methods Enzymol 483:161–177.
24. Wang L, Altman RB, Blanchard SC (2011) Insights into the molecular determinants of
EF-G catalyzed translocation. RNA 17(12):2189–2200.
25. Spiegel PC, Ermolenko DN, Noller HF (2007) Elongation factor G stabilizes the hybridstate
conformation of the 70S ribosome. RNA 13(9):1473–1482.
26. Savelsbergh A, et al. (2003) An elongation factor G-induced ribosome rearrangement
precedes tRNA-mRNA translocation. Mol Cell 11(6):1517–1523.
27. Matassova AB, Rodnina MV, Wintermeyer W (2001) Elongation factor G-induced
structural change in helix 34 of 16S rRNA related to translocation on the ribosome.
RNA 7(12):1879–1885.
28. Taylor DJ, et al. (2007) Structures of modified eEF2 80S ribosome complexes reveal the
role of GTP hydrolysis in translocation. EMBO J 26(9):2421–2431.
29. Khade PK, Joseph S (2011) Messenger RNA interactions in the decoding center control
the rate of translocation. Nat Struct Mol Biol 18(11):1300–1302.
30. Peske F, Savelsbergh A, Katunin VI, Rodnina MV, Wintermeyer W (2004) Conformational
changes of the small ribosomal subunit during elongation factor G-dependent
tRNA-mRNA translocation. J Mol Biol 343(5):1183–1194.
31. Stanley RE, Blaha G, Grodzicki RL, Strickler MD, Steitz TA (2010) The structures of the
anti-tuberculosis antibiotics viomycin and capreomycin bound to the 70S ribosome.
Nat Struct Mol Biol 17(3):289–293.
32. Ogle JM, Murphy FV, Tarry MJ, Ramakrishnan V (2002) Selection of tRNA by the ribosome
requires a transition from an open to a closed form. Cell 111(5):721–732.
33. Pan D, Kirillov SV, Cooperman BS (2007) Kinetically competent intermediates in the
translocation step of protein synthesis. Mol Cell 25(4):519–529.
34. Nguyen B, Ticu C, Wilson KS (2010) Intramolecular movements in EF-G, trapped at
different stages in its GTP hydrolytic cycle, probed by FRET. J Mol Biol 397(5):
1245–1260.
35. Weisser M, Voigts-Hoffmann F, Rabl J, Leibundgut M, Ban N (2013) The crystal
structure of the eukaryotic 40S ribosomal subunit in complex with eIF1 and eIF1A. Nat
Struct Mol Biol 20(8):1015–1017.
36. Jenner LB, Demeshkina N, Yusupova G, Yusupov M (2010) Structural aspects of
messenger RNA reading frame maintenance by the ribosome. Nat Struct Mol Biol
17(5):555–560.
37. Feng S, Chen Y, Gao YG (2013) Crystal structure of 70S ribosome with both cognate
tRNAs in the E and P sites representing an authentic elongation complex. PLoS ONE
8(3):e58829.
38. Hohsaka T, Taira H, Fukushima M, Sisido M (2001) Effect of single base insertion into
anticodon loop of frameshift suppressor tRNA. Nucleic Acids Res Suppl (1):189–190.
39. Pande S, Vimaladithan A, Zhao H, Farabaugh PJ (1995) Pulling the ribosome out of
frame by +1 at a programmed frameshift site by cognate binding of aminoacyl-tRNA.
Mol Cell Biol 15(1):298–304.
40. Dunham CM, et al. (2007) Structures of tRNAs with an expanded anticodon loop in
the decoding center of the 30S ribosomal subunit. RNA 13(6):817–823.
41. Joseph S, Noller HF (1998) EF-G–catalyzed translocation of anticodon stem-loop analogs
of transfer RNA in the ribosome. EMBO J 17(12):3478–3483.
42. Frank J, et al. (1996) SPIDER and WEB: Processing and visualization of images in 3D
electron microscopy and related fields. J Struct Biol 116(1):190–199.
43. Schmeing TM, et al. (2009) The crystal structure of the ribosome bound to EF-Tu
and aminoacyl-tRNA. Science 326(5953):688–694.
Ramrath et al. PNAS | December 24, 2013 | vol. 110 | no. 52 | 20969
BIOCHEMISTRY
Supporting Information
Ramrath et al. 10.1073/pnas.1320387110
SI Materials and Methods
Biochemical Methods. Escherichia coli elongation factor (EF)-G,
cloned into pET21b (Novagen), was expressed in strain BLR
(DE3) by growing cells at 37 °C in LB plus ampicillin (100 μg/
mL) to an A550
of 0.8, followed by induction with isopropyl-β-Dthiogalactopyranoside
(1-mM final concentration) and continued
growth for 3 h. Cells were lysed in 25 mM Tris·Cl (pH 7.5),
40 mM NH4Cl, and 5 mM βME, then centrifuged at 30,000 × g
for 20 min in a JA20 rotor. The supernatent containing soluble
EF-G (35 mL) was mixed with 6 g of DEAE-cellulose (Whatman
DE-52) pre-equilibrated in lysis buffer. After washing the resin
with 1 L of lysis buffer, proteins were eluted with 25 mM Tris·Cl
(pH 7.5), 300 mM NH4Cl, 5 mM βME, then dialyzed against
buffer A [25 mM Tris·Cl (pH 7.5), 60 mM NH4Cl, 5 mM βME].
EF-G was further purified by FPLC chromatography using a
6-mL Resource-Q anion-exchange column (Pharmacia) and
eluted with a 200-mL salt gradient from 60 to 300 mM NH4Cl in
buffer A. For further purification using a 10 mL Toyopearl Butyl-650S
(BTP) column, fractions containing EF-G were pooled
and one-third volume of 4 M ammonium sulfate (AS) was added
to bring the final concentration to 1 M AS. EF-G was eluted
from the BTP column with a 200-mL gradient of 1 M to 0 AS in
buffer A. EF-G–containing fractions were pooled, dialyzed into
buffer A, concentrated to less than 300 μL using an Amicon Ultra
15 (Millipore; 10,000 molecular-weight cutoff) concentrator, then
additionally purified on a 24 mL Superdex 75 gel filtration column
(Pharmacia) preequilibrated in buffer A. EF–G–containing aliquots
were flash-frozen in liquid nitrogen and stored at −80 °C.
Aminoacylation of transfer RNA (tRNA) (Sigma) was carried
out as described previously (1). Messenger RNA (mRNA) MV27
(GGCAAGGAGGUAAAAAUGGUAAAAAAA) (IDT) codes
for Met (AUG) in the P site and Val (GUA) in the A site.
In the course of the described work we also analyzed 70S-EF-G
complexes carrying an intersubunit disulfide cross-link. The aim
was to analyze the influence of such a cross-link onto the conformational
modes of the ribosomal complex. Ribosomes containing
an intersubunit disulphide cross-link between ribosomal
proteins S6 and L2 were purified as described previously (2).
Ribosomes were heat-activated and the intersubunit disulphide
cross-link was reduced by incubating in buffer B [80 mM KHepes
(pH 7.5), 75 mM NH4Cl, 20 mM MgCl2] with the addition of 100
mM βME, at 42 °C for 10 min. Next, 15 pmol of ribosomes, 30
pmol of mRNA MV27, and 30 pmol of deacylated tRNAfMet
were
incubated at 37 °C for 15 min in buffer B in a total volume of
14 μL. Then, 20 pmol of Val-tRNAVal
(1.1 μL) were added and
the reaction was incubated an additional 30 min at 37 °C; 60 pmol
of EF-G, 0.4 mM fusidic acid (FA) and 1 mM GTP were incubated
for 5 min at 37 °C in buffer B in a total volume of 15 μL,
before adding to the ribosome complex (total volume 30 μL), and
incubating at room temperature for 20 min in 80 mM KHepes
(pH 7.5), 75 mM NH4Cl, 10 mM MgCl2, and 6 mM βME. Fivemicroliter
aliquots were flash-frozen in liquid nitrogen and stored
at −80 °C.
Cryo-EM and Image Processing. Ribosomal complexes were diluted to
a final concentration of 30 nM and subsequently flash-frozen onto
Quantifoil grids using a Vitrobot (FEI) device. Micrographs were
recorded on film (Kodak-SO163) under low-dose conditions (20
e−
·Å−2
·s−1
) using a Tecnai G2
Polara (FEI) cryo electron microscope
operated at 300 kV and a magnification of 39,000×. Micrographs
were collected at an underfocus that ranged from 2 to 5 μm
and subsequently scanned using a D8200 Primscan drum scanner
(Heidelberger Druckmaschinen) with a step size of 4.758 μm, corresponding
to 1.26 Å on the object scale.
The contrast transfer function defocus values for the micrographs
were determined using CTFind (3). Candidates for projection
images of the ribosome were automatically identified
using Signature (4) and subsequently screened. All steps of image
processing were performed using the SPIDER software
package (5). Multiparticle refinement was carried out as described
previously (6). Particle images belonging to subpopulations of ribosomal
particles that did not contain EF-G were selected out
and not used for a further analysis. Finally 279,309 particle images
derived from 308 micrographs were used to reconstruct the
70S•tRNA2•mRNA•EF-G•GDP•FA complex. At the final rounds
of the refinement, high-spatial frequencies were enhanced using the
power spectrum derived from an atomic model of a 70S ribosomal
complex (7) as reference. Subsequently the reconstructed map was
low-pass filtered according to the current resolution estimate, which
finally reached a value of 6.8 Å using the 0.5 Fourier shell correlation
(FSC) criteria (Fig. S1).
Generation of Pseudoatomic Models. Rigid-body docking of highresolution
X-ray structures of the ribosomal 50S subunit [PDB ID
code 4KIX (8)], 30S-head, and 30S-body/platform [PDB ID code
4KIY (8)] was performed using University of California at San
Francisco chimera (9). A model of the pe/E-tRNAfMet
was generated
on the basis of pe/E*-tRNAMet
[PDB ID code 4KBT (10)]
crystal structure by docking the anticodon stem loop of the
tRNAMet
(nucleotides U27–A43) together with the corresponding
mRNA codon, as well as the acceptor stem, TΨC- and D-loop of
the pe/E*-tRNAMet
(nucleotides C1–G26 and A44–A76). Both
elements were docked individually into the observed pe/E-tRNA
density and subsequently combined by allowing flexibility in the
C25–G30 and C40–C48 region. Flexibility around this region of
a tRNA was also observed when a tRNA adopts an A/T state (A
site on 30S and EF-Tu-bound on the 50S subunit) or P/E state of
binding as seen by X-ray crystallography (10, 11), as well as cryoEM
(12, 13). A model of the tRNAVal
was generated by using a P
site bound tRNAfMet
together with the corresponding mRNA
codon [PDB ID code 2WRI (14)]. To match the used experimental
conditions, the sequences of the mRNA codon and
tRNA anticodon were changed (i.e., a U34-A35-C36 tRNAVal
anticodon was inserted into the docked P-tRNAfMet
, which is
complementary to the used GUA mRNA codon). Both docked
mRNA codons were combined and the mRNA was extended in
both (3′ and 5′) directions as long as assigned cryo-EM density
was visible.
SI Results and Discussion
Unique Intersubunit Bridge Between the A Site Finger, L5, and S19.
The position of the swiveled head as it is observed in the
present authentic TIPOST
is stabilized by the formation of
a unique intersubunit contact (Fig. S2). On the basis of
docked models, the new bridge is created between protein L5
within the central protuberance, the tip of Helix-38 [also
termed A-site finger (ASF)] and the ribosomal protein S19
within the swiveled head (Fig. S2A). The cryo-EM reconstruction
displays a well-defined and continuous density
between the C-terminal part of L5 (presumably around Arg-
177 and Lys-178), the tip of the ASF, and a central loop of
protein S19 (around Lys-27 and Lys-28) (Fig. S2A). These
structural data reveal that the conformational changes underlying
TIPOST
-formation are also located within the large
Ramrath et al. www.pnas.org/cgi/content/short/1320387110 1 of 4
ribosomal subunit. In comparison with the conformation of
a pretranslocational ribosomal complex with classic bound tRNAs
(15), the ASF is undergoing a conformational change during
translocation intermediate (TI) TIPOST
-formation, which shifts
its tip over a distance of ∼10 Å (Fig. S2 B and C). Movement of
the ASF was also observed in parallel studies analyzing the
translocation of the large tmRNA (16) and the different subconformations
of a mammalian pretranslocational 80S ribosomal
complex (17). However, certain differences can be observed
regarding the directions and magnitudes of these movements of
the dynamic ASF.
Tentative Assignment of the Configurations of A1492 and A1493 and
Their Potential Role During Translocation. In addition to the described
interactions between EF-G, the ap/P-tRNA, mRNA,
and h34 of the swiveled 30S-head the highly conserved EF-G
residues Ser589 and Glu590 (E. coli nomenclature) located
around the N terminus of helix α-13 make a tentative contact
with the adenosine base of the flipped-out A1493. This interaction
was also observed in the crystal structure of the
posttranslocational 70S•EF-G•GDP•FA complex (14). Similarly,
the presented reconstruction of the authentic TIPOST
indicates
the presence of a gap within the cryo-EM density of h44,
which corresponds to the helical position of A1493 (Fig. S4).
However, the reconstruction also shows well-defined density in the
close vicinity of the helical position of A1493, which corresponds
to the A1492 position (Fig. S4). Both of these two rRNA residues
of the 30S-decoding center are known to be flexible and different
possible orientations and positions of both residues were reported
by X-ray crystallography (14, 18–20). In view of the
given resolution of 6.8 Å, the best apparent agreement between
three different orientations and the present cryo-EM density can
be observed by an orthogonal orientation of both residues (orthogonal
orientation of A1492 relative to flipped-out A1493)
(Fig. S4C). Such a configuration was also observed in the
crystal structure of a 70S•EF-G complex (21). A flipped-out
position for both bases, A1492 as well as A1493, was suggested
by cryo-EM maps of 80S•eEF2 complexes at intermediate
resolutions (22).
Presteady-state kinetic measurements revealed that during
translocation an EF-G, induced ribosome rearrangement precedes
the tRNA2•mRNA movement and represents the ratelimiting
step of the entire reaction (23). In line with this observation,
more recent data revealed that the destabilization of the
minor groove interactions between the A site mRNA codon and
in particular A1492 lead to a significant increase in the overall
rate of translocation (24). During the elongation cycle, translocation
follows the delivery of an aminoacyl-tRNA (decoding)
and the subsequent peptidyl transfer. In the process of decoding,
both rRNA residues A1492 and A1493 adopt flipped-out positions
(as shown in Fig. S4A) and interact with the minor groove
of the codon-anticodon triplet around the A site (18, 19).
Accordingly, the suggested position of A1492 (orthogonal
configuration relative to A1493) indicated by the present reconstruction
of the authentic TIPOST
(Fig. S4C) might correspond
to the ribosomal conformation triggered by EF-G. Thus,
the data suggest that an EF-G induced reorientation of A1492 is
part of the rate-limiting ribosome rearrangement, which is consistent
with the reported presteady-state kinetics (23, 24).
1. Lancaster L, Noller HF (2005) Involvement of 16S rRNA nucleotides G1338 and A1339
in discrimination of initiator tRNA. Mol Cell 20(4):623–632.
2. Horan LH, Noller HF (2007) Intersubunit movement is required for ribosomal
translocation. Proc Natl Acad Sci USA 104(12):4881–4885.
3. Mindell JA, Grigorieff N (2003) Accurate determination of local defocus and specimen
tilt in electron microscopy. J Struct Biol 142(3):334–347.
4. Chen JZ, Grigorieff N (2007) SIGNATURE: A single-particle selection system for
molecular electron microscopy. J Struct Biol 157(1):168–173.
5. Frank J, et al. (1996) SPIDER and WEB: Processing and visualization of images in 3D
electron microscopy and related fields. J Struct Biol 116(1):190–199.
6. Loerke J, Giesebrecht J, Spahn CM (2010) Multiparticle cryo-EM of ribosomes.
Methods Enzymol 483:161–177.
7. Selmer M, et al. (2006) Structure of the 70S ribosome complexed with mRNA and
tRNA. Science 313(5795):1935–1942.
8. Pulk A, Cate JH (2013) Control of ribosomal subunit rotation by elongation factor G.
Science 340(6140):1235970.
9. Pettersen EF, et al. (2004) UCSF Chimera—A visualization system for exploratory
research and analysis. J Comput Chem 25(13):1605–1612.
10. Zhou J, Lancaster L, Donohue JP, Noller HF (2013) Crystal structures of EF-G–ribosome
complexes trapped in intermediate states of translocation. Science 340(6140):1236086.
11. Schmeing TM, et al. (2009) The crystal structure of the ribosome bound to EF-Tu and
aminoacyl-tRNA. Science 326(5953):688–694.
12. Ratje AH, et al. (2010) Head swivel on the ribosome facilitates translocation by means
of intra-subunit tRNA hybrid sites. Nature 468(7324):713–716.
13. Schuette JC, et al. (2009) GTPase activation of elongation factor EF-Tu by the
ribosome during decoding. EMBO J 28(6):755–765.
14. Gao YG, et al. (2009) The structure of the ribosome with elongation factor G trapped
in the posttranslocational state. Science 326(5953):694–699.
15. Agirrezabala X, et al. (2008) Visualization of the hybrid state of tRNA binding
promoted by spontaneous ratcheting of the ribosome. Mol Cell 32(2):190–197.
16. Ramrath DJF, et al. (2012) The complex of tmRNA-SmpB and EF-G on translocating
ribosomes. Nature 485(7399):526–529.
17. Budkevich T, et al. (2011) Structure and dynamics of the mammalian ribosomal
pretranslocation complex. Mol Cell 44(2):214–224.
18. Ogle JM, et al. (2001) Recognition of cognate transfer RNA by the 30S ribosomal
subunit. Science 292(5518):897–902.
19. Ogle JM, Murphy FV, Tarry MJ, Ramakrishnan V (2002) Selection of tRNA by the
ribosome requires a transition from an open to a closed form. Cell 111(5):721–732.
20. Berk V, Zhang W, Pai RD, Cate JH (2006) Structural basis for mRNA and tRNA
positioning on the ribosome. Proc Natl Acad Sci USA 103(43):15830–15834.
21. Chen Y, Feng S, Kumar V, Ero R, Gao YG (2013) Structure of EF-G–ribosome complex
in a pretranslocation state. Nat Struct Mol Biol 20(9):1077–1084.
22. Taylor DJ, et al. (2007) Structures of modified eEF2 80S ribosome complexes reveal the
role of GTP hydrolysis in translocation. EMBO J 26(9):2421–2431.
23. Savelsbergh A, et al. (2003) An elongation factor G-induced ribosome rearrangement
precedes tRNA-mRNA translocation. Mol Cell 11(6):1517–1523.
24. Khade PK, Joseph S (2011) Messenger RNA interactions in the decoding center control
the rate of translocation. Nat Struct Mol Biol 18(11):1300–1302.
25. Yusupov MM, et al. (2001) Crystal structure of the ribosome at 5.5 A resolution.
Science 292(5518):883–896.
Ramrath et al. www.pnas.org/cgi/content/short/1320387110 2 of 4
Fig. S1. Resolution curves of the authentic TIPOST
. According to the 0.5 FSC cut-off, the resolution of the authentic TIPOST
complex is 6.8 Å.
Fig. S2. Formation of a unique intersubunit bridge. (A) Cryo-EM density of the authentic TIPOST
shown as gray transparent surface with docked models of the
ribosome [30S (yellow), 50S (blue), S13 (cyan), S19 (magenta)], EF-G (red), and tRNAs [ap/P-tRNA (green), pe/E-tRNA (orange)]. The map displays a continuous
density between L5 (red), the ASF (dark blue), and S19 (magenta). (B) Cartoon representation of the ribosomal conformation in the classic unrotated classic
pretranslocational state (15) with an opened L1-stalk indicating the contact between the ASF and S13. (C) Cartoon representation of the authentic TIPOST
indicating the structural changes of the 30S-head, ASF, and L1-stalk. The positions of L1-stalk and ASF as shown in B are displayed in transparent gray.
Ramrath et al. www.pnas.org/cgi/content/short/1320387110 3 of 4
Fig. S3. Interactions of the 30S subunit and different bound tRNAs. Ribbon representation of the tRNA binding region on the 30S subunit. Residues that
contact tRNAs in the A (magenta), P (blue), and E site (red) (25) are shown as spheres together with two tRNAs in chimeric intrasubunit (ap/P and pe/E), classic
(A/A andP/P), intersubunit hybrid (A/P and P/E), or classic posttranslcoated (P/P and E/E) tRNA binding sites (14, 15).
Fig. S4. Comparison of different orientations of A1492 and A1493 and the presented cryo-EM reconstruction. View from the intersubunit space onto the cryoEM
density for the 30S decoding center from the presented authentic TIPOST
(transparent gray) together with docked models from Gao et al. (14) (A), Pulk and
Cate (8) (B), and Berk et al. (20) (C) showing different observed orientations of A1492 relative to A1493.
Ramrath et al. www.pnas.org/cgi/content/short/1320387110 4 of 4