Chromozomy - jak zjistit kolik má daný druh chromozomů? http://ccdb.tau.ac.il/home/ Index to plant chromosome numbers 1998-2000 (J^,,„.,„w— Index to plant chromosome' Index to plant cl 11*01110 MOlll f #f.X Off journal ot the international association for plant taxonomy Chrrklitt of AlMlri.n V.ic.Ur Plann numbers numbers -|»r.VO|»llv4 O 2004-2006 Chromosome Atlas of Flowering Plants of the Indian Subcon " Index to plant chromosome numbers 1990-1991 Nein e ůt e & © jSÍ legacy'.tropicos.org/Project/IPCN tt Vyhledat O" Nejnavštěvovaněji;!' @ Jakzačít © V negativním :lova .. \ Iii Web of Knowledge ... Electronic library. Dow... 3 Vysledek obräzku pro J lll\ ED • O • = » Q Ostatní záložky IPCN Chromosome Reports Tropicos Names Specimens References Projects Images Morew TooIst MOBOT Sign In | Login | $ Home Name Search Browse Families Browse Genera Browse Species Choose Projects English-* t£J|*£JLL Index to Plant Chromosome Numbers (IPCN) The Index to Plant Chromosome Numbers was an NSF funded project that aims to extract and index original plant chromosome numbers of naturally occurring and cultivated plants published throughout the world. A committee of voluntary contributing editors, located in various parts of the world, reviews sets of serial titles assigned to them and returns the information to the editors for collation in the Index and database. Chromosome indexes were published at two or three year intervals, The Index to Plant Chromosome Numbers project was based at the Missouri Botanical Garden since 1978. Data from published indexes from 1979 onward are available for consultation through this facility. For additional information, see the last supplement by Goldblatt & Johnson 2006. Index to Plant Chromosome Numbers 2001-2003. Monographs in Systematic Botany from the Missouri Botanical Garden 106. An Index covering the years 2004-2006 was published in 2D10 as: Goldblatt & Johnson (eds) 2010. Index to Plant Chromosome Numbers 2004-2006. Regmum Vegetable. Vol. 152. Many but not all data in the printed version of the Index to Plant Chromosome Numbers (1979-- ) are available on the Web in the IPCN database. The printed indexes and the database provide references to chromosome counts reported in the original literature. We therefore request that the IPCN database itself not be cited as the source for chromosome counts. If there is a need to cite the IPCN database, we recommend the following: Index to plant chromosome numbers. 1979-How to use the Chromosome Index. P. Goldblatt & D. E. Johnson, eds. Missouri Botanical Garden, St. Louis. The chromosome data is available in several different ways. First information is available on the Name screens as a tab for any taxon with counts - click on the 'chromosome counts' tab and see the reported counts with reference. Second, under the System project tab (top yellow banner) there is a link to "IPCN Chromosome Reports" that provides a name search for direct display of counts for each taxon and Browse links for families, genera. The Family and genera browse options provide links to included taxa on the page under 'lower taxa' (genera for families and species for genera) with counts. Click on the taxon link and see all of the species with counts - click on the taxon to see all of the counts for that taxon. The species browse screen provides an alphabetical list of species in the project and the link to displays the counts and references. Last, next to each family/genus on the browse list or at the bottom of the lower taxa lists under families/genera is an (export) link. This will download a complete list of all the included taxa with counts and references, to the user pc. This \dat' file is a tab delimited ascii file that can be saved and/or opened with Excel (or other similar programs) that can be used for searches or sorting on the users pc. Note that this may be a very large file if for example one exports all of the counts for Asteraceae rather than only the genera or species that are needed. @ 2021 Missouri Botanical Garden - 4344 Shaw Boulevard - Saint Louisr Missouri 63110 Send FeedbacklTerms Of Use |API | Linking to Tropicos | FAQ | Addition a|_Info_ Velikost genomu - jak velký genom má daný druh? https://cvalues.science.kew.org/ https://pladias.cz/taxon/ <- C tír O A h1tps://pladias.cz/1ař:ori/ O Nejnavštěvovaněji!' ©Jakznčit © V negativním slova...... £ ■" © Ů Q. Vyhledat ISIV-ebcfknc/.le:l:je. 5 Výsledek obrázku pro . Ill\ El * ® © = ř URL adresy ... » Q Ostatní"záložky <§& PLADIAS Informace o druzích Hledat Základnítaxony Lycopodiopsida Equisetopsida Psitotopsida Po lyp odiops :da Girkgoapsida ConHeropsida Magnoliopsida 1 Litiopsida Magnaliapsida 2 ©2014-2021 Pladias 9 Vegetace Určování'" Ke stažení'" Kontakty ^Přihlášení zadejtejméno plavu ně přes l ičky prutovky kapradi ny jinany jehličnany nížsí dvaudělozrié jednoděložné vyššídvouděložné Citace: Pladias- databáze ceskefloryavegetace.www.pladias.cz (ý-J -> C ©ft https://cvaluGS.science.kew.org 80% «• (vj £ Q, Vyhledat |l|\ (D * ® © = i} Nej navštěvovanější @ Jak začít (Jj) V negativním slova...... @ ISI Web of Knowledge.,, © Electronic library, Dow.,, G Výsledek obrázku pro J... Q Zkracovač URL adresy.,, » Q Ostatní záložky K&vscience DNA C-values Database \ Release 7.1, April 2019 Leitch IJ, Johnston E, Pellicer Jľ Hidalgo O, Bennett MD https://cvaluesscience.kew org/ Pteridophyte Bryophyte Alga The DNA amount in the unreplicated gametic nucleus of an organism is referred lo as its C-va!ue. irrespective of the ploidy level of the taxon The Plant DNA C-values Database currently contains C-value data for 12.273 species compnstng 10.770 angiosperms. 421 gymnosperms. 303 pteridophytes (246 ferns and fern allies and 57 lycophytes). 334 bryophytes and 445 If you have comments and/or suggestions contact dnac-value@kew.org Koval Botanic (iarilt-ns Terms and Conditions Cookie Policy Privacy Policy @ Copyright Board of Trustees of the Royal Botanic Gardens. Kew #Home Introduction Search All Plant C-values Angiosperm C-values Gymnosperm C-values Pteridophyte C-values Bryophyte C-values Algal C-values Release History Related Databases Contacts Velikost genomu - jak velký genom má daný druh? https://www.asteraceaegenomesize.com/ (D A https://www.aster oeaegenomesize.com ® — © Ů | ^ Vyhledat lll\ El *t ® <3 = ■íjř Nej navštěvovanější' ( ÍJatzačft © V negativním slov. ...... @ ISI Web of Knowledge ... © Electronic library. Dow... 3 Výsledek obrázku pro J... Q Zkracovat URL adresy... » Ö Ostatn záložky Home [litt rations Hdp Frotomte fi keagenta Líiík Submit fow data Contacts Commmb Hew to cite7 EtnoBjoRC [ Search... t^<^ □ Author □ Infrasp. authorD Chrom. nurnberD n/2n □ Life cycle □ Ploidy level □ Standard Achranced Optional iäenüftcacian-of sn-e user vourerriail@erriail.com Welcome to the GSAD: Genome Size in Asteraceae Database (Release 3.0) The GSAD is an exhaustive catalogue of genome size data for the family Asteraceae, Genome sizes are now available for 1,555 species based on 4,350 records from 193 publications released until July 201S. The current update represent; around 40% Increase of data entries with respect to release 2. There are 337 species [21.67W) and 46 genera (19,83W> recorded for the first time. The main goal of the database is to serve as a tool aiming to make Asteraceae genome size information accessible to scientists interested in genome characterisation and evolution with basic (e.g. plant molecular systematica, NGS programs, evo-devo research) or applied [e.g. barcoding. l:-ssc -g, ■■aces or raw material ideitificatioi] -"ocuses, The database holds data from papers already published or in press up to July 201S. Regular updates are planned, GS A O Genome size in Asteraceae database CTTG CTTGT G t-TGTA CT i AAA CT G CTT GTG AAG CTTCTCGTG AAA.TT AATG CTC GTGCTAAT G AAAA.T G AATCTA CTG AAG CTCTTG CT AATG AAA CTG C TTA~AT G G C~C C T A C- C AA T^C-TTCT^ — CTACTG AAAC- ľ- . 1 © Design and prcgr-mimin/j bi @igiicamaiceb ^bÍosaŤptsy£^jj^:,ir:'^-^~BioI^C-Plmita/EtiiabotCat-- fcSfclnsTUut « univiíhsitat... ■t^Jhotänii: -SF- „„..„ fC|r W BARCELONA ^ ÍW1 iVESST™ i-^lSí Visus srnce June2013: 00012632 Situs Velikost genomu - jak velký genom má daný druh? http://www.genomesize.com/ # 0» Vyhledat ÖJakzarit © Vnegativnírr lEl^eb cf Knc.-.lídae. ; library, De/.-,,, v; šleclek cbr?:l"u pře J„ | Zkracovat url adre El BoranischeWerkeür Uni- eräitätsbiMicthek ... ANTMAI fiFNOMF ST7F DATA RAS F lll\ o * * © = » B OstatnTialQiky Contact El - I_ni i im »in« I J!_!_ - '■ ' ' "I I a Tikifugu rvbnpěs C-value: 0 4Öpq Home Search Data Statistics FAQ References Submit Data Links gGipgory Lab HOME "II est hors de doute que 11 etude systematique, de la teneur absolue du noyau en acide desoxyribonucleique, a travers de nombreuses especes animales, puisse fournir des suggestions interessantes en ce qui concerns le probleme de 1r evolution." - Vendrely and Vendrely, 1950 Translate Welcome to the Animal Genome Size Database, Release 2.0, a comprehensive catalogue of animal genome size data. Haploid DNA contents (C-values, in picograms) are currently available for 6222 species (3793 vertebrates and 2429 non-vertebrates) based on S004 records from 786 published sources. You can navigate the database using the menu on the left. New features in Release 2.0 include enhanced browsing and search functions, data export capabilities, and up to the minute summaries of available data. UNIVERSITY VGUELPH BIO of Onlnrto mi EVI ■" C 1 fß tam Til Sekvence nukleotidů - jsou k dispozici pro daný druh? https://www.ncbi.nlm.nih.gov/ ©- 01*0 i S3 fl http5:/Avww.ncbi.nlrn.nih.gov ičit © V negativ.ii.-n slova...... @ ISI Web of Knowledge ... © Electronic i — ig ft i j Q, V NCBI Resources @ How To @ %NCBI :ional Ci technoli O Nucleotide m es ü BotamscheZetathrift... » Q Ostatní =á Sign in to NCBI Search National Center Tor Biotechnology Information COVID-19 Information □ Public health information fCDCt | Research information fNIH) | SARS-CoV-2 data fNCBI) | Prevention and treatment information tHHSt | Espanol UNITE A new NIH initiative to end structural racism and achieve racial equity in the biomedical research enterprise. LEARN MORE V Ending Structural Racism ED nih.gov/ending-ilru ctural-racism CCTCTTACTATAAATTTCATTGTTGTCGATATTGACATGTAGAATGGACTCTCTCTTTATTCTCGTTTGATTTAT CATCATTTTTTCAATCTAACAAATTCTATAATGAATAAAATAAATAGAATAAATTGATTACTAAAAATTGAGTTT TTTTCTCATTAAACTTCATATTTGAATCAATTTACCATAAATAATTCATAATTTATGGAATTCAAAAAAATTCCT GAATTTGCTATTCCATAATCATTGTCAATTTCTTTATTGACATGAAAAATATGATTTGATTGTTATTATGATCAA TCATTTGATCATTGAGTATATATACGTACGTCTTTTTTTGGTATAGACGGCTATCCTTTCTCTTATTTCGATAAA GATATTTTAGTAATGCAACATAATCAACTTTATTCGTTAGAAAAACTTCCATCGAGTCTCTGCACCTATCTTTA ATATTAGATAAGAAATATTTTATTTCTTATAATAAATAAGAGATATTTTATATCTCTCATTTTCTCAAAATGAAAG ATTTGGCTCAGGATTGCCCACTCTTAATTCCAGGGTTTCTCTGAATTTGGAAGTTAACACTTAGCAAGTTNCC ATACCAAGGCCAATCCAATGC http://blast.ncbi.nlm.nih.aov/Blast.cai?PROGRAM=blastn&PAGE TYPE=BlastSearch&LINK LOC=blasthome Resource List (A-Z) All Resources Chemicals & Bioassays Data & Software Domains & Structures Genes & Expression Genetics & Medicine Genomes & Maps Homology Sequence Analysis Taxonomy Training & Tutorials Variation Welcome to NCBI The National Center for Biotechnology Information advances science and health by providing access to biomedical and genomic information. About the NCBI | Mission | Organization | NCBI News & Bloq Submit Deposit data or manuscripts into NCBI databases Develop Use NCBI APIs and code libraries to build applications Download Transfer NCBI data to your computer Analyze Identify an NCBI tool for your data analysis task Learn Find help documents, attend a class or watch a tutorial Research Explore NCBI research and collaborative projects Popular Resources PubMed Bookshelf PubMed Central BLAST Nucleotide Genome SNP Gene Protein PubCheim NCBI News & Blog NCBI at CSHL Biology of Genomes, May 11 - 14, 2021 07 May 2021 NCBI staff will be presenting virtual r.ncti&r* at the> P.i-iliH fir.rinn Hsrhnr NCBI on YouTube: Tips for My Bibliography, Genome Data Viewer and more 06 May 2021