SURVEY AND SUMMARY
Natural and engineered nicking endonucleases—
from cleavage mechanism to engineering of
strand-specificity
Siu-Hong Chan1,
*, Barry L. Stoddard2
and Shuang-yong Xu1
1
New England Biolabs, Inc. 240 County Road, Ipswich, MA 01938 and 2
Division of Basic Sciences, Fred
Hutchinson Cancer Research Center, 1100 Fairview Avenue N. A3-025, Seattle, WA 98109, USA
Received July 15, 2010; Revised July 30, 2010; Accepted August 5, 2010
ABSTRACT
Restriction endonucleases (REases) are highly
specific DNA scissors that have facilitated the development
of modern molecular biology. Intensive
studies of double strand (ds) cleavage activity of
Type IIP REases, which recognize 4–8 bp palindromic
sequences, have revealed a variety of mechanisms
of molecular recognition and catalysis. Less
well-studied are REases which cleave only one of
the strands of dsDNA, creating a nick instead of a
ds break. Naturally occurring nicking endonucleases
(NEases) range from frequent cutters such as
Nt.CviPII (^CCD; ^ denotes the cleavage site) to
rare-cutting homing endonucleases (HEases) such
as I-HmuI. In addition to these bona fida NEases,
individual subunits of some heterodimeric Type
IIS REases have recently been shown to be natural
NEases. The discovery and characterization of more
REases that recognize asymmetric sequences, particularly
Types IIS and IIA REases, has revealed recognition
and cleavage mechanisms drastically
different from the canonical Type IIP mechanisms,
and has allowed researchers to engineer highly
strand-specific NEases. Monomeric LAGLIDADG
HEases use two separate catalytic sites for
cleavage. Exploitation of this characteristic has
also resulted in useful nicking HEases. This review
aims at providing an overview of the cleavage mechanisms
of Types IIS and IIA REases and LAGLIDADG
HEases, the engineering of their nicking variants,
and the applications of NEases and nicking
HEases.
A BRIEF INTRODUCTION TO RESTRICTION
ENDONUCLEASES
Restriction endonucleases (REases) are an indispensable
tool for DNA manipulation in molecular biology. From
routine DNA cloning to detection of DNA sequence polymorphism
(1,2) to CpG methylation profiling (3), analyses
of gene expression in serial analysis of gene expression
(SAGE) (4,5) and most recently sample preparation for
high-throughput DNA sequencing (6,7), molecular biologists
need REases. The discovery of these useful enzymes
can be traced back to the research into the physiology of
bacteriophage infection in the 1950s where bacteriophage
isolated from one Escherichea coli strain were ‘restricted’
from infecting another (8,9). Many of the first REases to
be discovered, such as EcoKI and EcoBI, have not become
widely used in the manipulation of DNA because they are
Type I REases that recognize bipartite sequences
separated by 6–8 nt and cleave anywhere near the recognition
site to thousands of nucleotides away. Instead, it
was the characterization of first few Type IIP REases such
as HpaI, HpaII (10–12), EcoRI (13) and HindIII (14) in
the early 1970s that allowed the cleavage of DNA in a
predictable and consistent manner. The commercial availability
of more REases that followed jump-started the
modern era of molecular biology (15).
The number of characterized REases of all types has
increased greatly since the 1980s in the midst of
advances in DNA sequencing technologies and exogenous
expression systems in E. coli (Figure 1). Many endonucleases
are now classified as REases based on their specific
recognition sequences and their catalytic activity, without
verification of their phage-restricting activity in the host
cells. When experimental characterization is absent, ORFs
that contains conserved REases catalytic motifs and are
located in the vicinity of an ORF that shows homology to
*To whom correspondence should be addressed. Tel: +1 978 380 7267; Fax: +1 978 921 1350; Email: chan@neb.com
Published online 30 August 2010 Nucleic Acids Research, 2011, Vol. 39, No. 1 1–18
doi:10.1093/nar/gkq742
ß The Author(s) 2010. Published by Oxford University Press.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/
by-nc/2.5), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
characterized MTases (for Type II REases) or that contain
conserved motifs (such as specificity domain of Types I
and III) are annotated as putative REases in
REBASE (16).
Almost every newly sequenced microbial genome
contains ORFs that show notable homology to existing
R-M systems. REases are found to have different molecular
architectures, sequence requirements for recognition,
modes of cleavage and cofactor requirements. They are classified
into four main types: Type I through IV (17). Type IIP
is the best studied and most widely used type of REases
because of their palindromic DNA-recognition sequences
andtheirability togenerate consistentproductendsthatcan
be modified or ligated together. There are presently 304
known, distinct Type II specificities (as of June, 2010) represented
by 3800 characterized ORFs registered in
REBASE. More than 3000 putative genes are yet to be
characterized [(16); http://rebase.neb.com/cgi-bin/statlist].
Type IIP REases recognize and cleave within palindromic
dsDNA sequences that are usually 4–8 bp in
length. These enzymes are usually homodimers where
each of two subunits recognizes a single half-site of the
DNA target. Therefore, Type IIP REases always recognize
palindromic sequences. Related Type IIF enzymes are
tetramers (i.e. dimers of dimers) that display similar
binding of individual DNA half-sites by individual
protein subunits and cleavage of palindromes. Unlike
Type IIP enzymes that bind one site at a time, these tetrameric
REases usually bind two target sites, cleaving one or
both in an allosteric or cooperative manner. In either case,
residues that are responsible for target sequence recognition
are embedded within the DNA cleavage site, such
that cleavage always occurs within the recognition
sequence [reviewed extensively in (15,18–22)].
There are, however, naturally occurring endonucleases
that make single-strand breaks. These nicking endonucleases
(NEases) invariably recognize non-palindromes. They
can be bona fide nicking enzymes, such as frequent cutter
Nt.CviPII (6
CCD; D = A, G or T; 6
denotes the
cleavage site) (23) and Nt.CviQII (R6
AG; R = A or G)
(24), or rare-cutting homing endonucleases (HEases)
I-BasI and I-HmuI, both of which recognize a degenerate
24-bp sequence (25–27). As well, isolated large subunits of
heterodimeric Type IIS REases such as BtsI, BsrDI (28)
and BstNBI/BspD6I (29–32) display nicking activity.
NEases have historically been less well-studied and exploited
than their ds-cleaving cousins, because they can
escape detection by conventional methodologies for
screening REases using long but linear DNA substrates
(such as  DNA). Nevertheless, there has been continuous
progress in the discovery of natural NEases and engineering
of NEases from Types IIS and IIA REases and
LAGLIDADG HEases. That has also led to discoveries
of different cleavage mechanisms of these interesting
enzymes.
TYPES IIS AND IIA REases
The discovery of Type II REases that cleave outside of
their recognition sites led to the designation of the ‘S’
subtype which refers to ‘shifted cleavage’ (33). The definition
was later revised to ‘asymmetric recognition and
cleavage sites’ to highlight the asymmetric nature of the
recognition sites. There are, however, Type IIA REases
that recognize asymmetric sequence but cleave symmetrically
within the recognition sequences (BbvCI cleaves 2 nt
downstream of the 50
-end of each strand of CCTCAGC)
(17). Studies of these REases that recognize asymmetric
sequences have revealed cleavage mechanisms drastically
different from those of Type IIP REases. Many Type IIS
REases contain separated DNA-binding domain and
DNA-cleavage domain, as has been illustrated in the
case of FokI (34,35), BfiI (36,37) and MnlI (38). Unlike
most Type IIP REases that possess the canonical PD-(D/
Figure 1. Cumulative number of putative and non-putative R and fused RM genes from 1969 to 2009. The red shaded region indicates the
cumulative number of non-putative R and fused RM genes; the blue shaded region indicates the cumulative number of putative genes.
2 Nucleic Acids Research, 2011, Vol. 39, No. 1
E)XK catalytic motif, the catalytic site of Type IIS REases
comes in a variety of flavors: bba-metal motifs similar to
those found in non-specific nucleases such as colicins and
Holliday junction resolving T4 endonuclease VII, a range
of variants of the canonical PD-(D/E)XK catalytic motif
and the phospholipase D motif that cleaves DNA without
the requirement of divalent metal ions. Whereas Type IIP
REases dimerize and bring two catalytic subunits together
to make a cut on each DNA strand close enough to result
in a ds break, Type IIS REases adopt different approaches
for DNA binding and cleavage. For example, the cleavage
of the two strands of the ds target sequences of some Type
IIS REases has been shown to be strictly sequential (e.g.
BfiI, Mva1269I and FokI). The following classification of
Type II REases that recognize asymmetric sequences is
made based on their molecular architecture and their
mode of ds cleavage (Figure 2; Table 1).
Class I: one catalytic site per protein chain; act as
homodimers
Examples of this class of enzymes are Type IIS REases
FokI, MlyI and AlwI. FokI is the prototypic Type IIS
REases due to its early discovery and extensive characterization.
FokI possesses a C-terminal PD-(D/E)XK catalytic
motif and an N-terminal DNA-binding domain.
FokI binds to the recognition site GGATG as a
monomer but transiently dimerizes via its DNA-cleavage
domain in order to make a ds break 9- and 13-bp downstream
at the top and bottom strand, respectively (39–41).
In this mode of cleavage, the DNA recognition domain of
one of the monomers is bound to its recognition sequence,
while the recruited monomer does not have to be
(Figure 2). Evident suggested that free FokI molecules in
solution display a higher affinity toward DNA-bound
FokI monomers than towards unbound recognition
sites, so that a bound FokI monomer efficiently recruits
a second monomer to make a ds break even at a low
enzyme to substrate ratio (42). On the other hand, the
cleavage rate of a two-site substrate is over 10-fold
faster than a one-site substrate, suggesting that two
FokI monomers bound to separate sites in the same
DNA molecule associate with each other even more
readily than one bound and one free monomer (42). In a
two-site substrate, one of the sites is cleaved more efficiently
than the other, suggesting a regulatory role of the
slow cleavage site (42).
By mutating residues in the DNA-binding domain and
the DNA-cleavage domain, Halford and colleagues
recently showed that the monomer bounds to the top
strand of the target sequence cleaves the bottom strand
and the recruited monomer cleaves the top strand (43).
When Asn13 of the DNA cleavage domain is mutated to
tyrosine and Asp450 of the DNA-binding domain to
alanine, a mixture of this N13Y/D450A mutant with a
stochiometric ratio of wild-type FokI becomes more efficient
in nicking the bottom-strand than making a ds break
(Figure 2). The top strand is still cleaved at a lower rate,
because homodimerization of the wild-type FokI leads to
cleavage of the second strand. On the other hand, when
the DNA-cleavage domain mutant (N13Y) was mixed
with the DNA-binding domain mutant (D450A), only
the top strand is cleaved (43), generating a useful
top-strand nicking enzyme (Figure 2).
Disruption of dimerization can also result in nicking
variants of Class I enzymes. Existing as monomer in the
absence of target DNA, MlyI dimerizes on the target
DNA to make a blunt end ds cleavage 5-nt downstream
of GAGTC (30). Mutations that abolish the dimerization
of MlyI results in a variant that nicks the top strand of the
substrate (44). Similarly, impairing dimerization of AlwI
(GGATC 4/5) by swapping the C-terminal amino acid
sequence with that of Nt.BstNBI results in a top-strand
nicking AlwI variant (45).
Class II: two catalytic sites per protein chain; act as
monomers
Type IIS REases Mva1269I, BsrI, BsmI and BtsCI are
examples of this class of enzymes. Mva1269I (GAATGC
1/À1) contains a canonical PD-(D/E)XK and a
non-canonical PD-Xn-E-X12-QR catalytic site and exists
as a monomer in both solution and DNA-bound form.
Mutagenesis experiments have identified two catalytic
sites where the N-terminal non-canonical catalytic site
cleaves the bottom strand and the C-terminal canonical
catalytic site cleaves the top strand of the target sequence
(Figure 2). In addition, cleavage of the bottom strand is a
prerequisite for the cleavage of the top strand, as substitution
of the scissile phosphodiester bond at the bottom
strand with phosphorothioate linkage attenuates the
cleavage of the top strand but not vice versa (46). This
nick-induced cleavage of the opposite strand has also
been reported in Holliday junction-resolving T7 endonuclease
I (47,48) and BfiI (ACTGGG 5/4) (49,50),
although little homology is found between Mva1269I
and T7 endonuclease I, and a completely different catalytic
mechanism is employed by BfiI (see below).
Sequence alignment has revealed the homologous catalytic
sites BsrI (ACTGG 1/-1), BsmI (GAATGC 1/–1) and
BtsCI (GGATG 2/0). By optimization of mutations at
each of the catalytic sites, BtsCI mutants that efficiently
nick the top or the bottom strand specifically have been
created (51).
Three thermostable Type IIS enzymes that recognize
related sequences [BsaI (GGTCTC 1/5), BsmAI GTCTC
(1/5) and BsmBI CGTCTC (1/5)] have also been proposed
to contain two separate catalytic sites (52). By a combination
of random mutagenesis and selection, top-strand
(R236D) and bottom-strand nicking variants (N441D/
R442G) of BsaI have been created with negligible
ds-cleavage activity (52). Equivalent mutations have been
incorporated into BsmAI and BsmBI. For BsmBI, variant
R233D is a top-stranded nicking enzyme with a low level of
ds-cleavage activity. Variant R438D nicks the bottom
strand with no observable ds-cleavage activity. For
BsmAI, variant R221D is a top-strand nicking without
observable ds-cleavage activity. However, the
bottom-nicking BsmAI variant created by replicating
the bottom-strand nicking mutations of BsaI still exhibited
substantial ds-cleavage activity. Additional mutagenesis
had only yielded top-strand nicking enzyme variants. On
Nucleic Acids Research, 2011, Vol. 39, No. 1 3
the hand, by using a randomized mutagenesis approach in
combination with a stand-specific nicking activity selection
methodology, top- and bottom-strand nicking variants of
SapI (GCTCTTC 1/4) have been identified (see below)
(53). Similar amino acid substitutions introduced into
BspQI, a thermostable isoschizomer of SapI, have
resulted in BspQI nicking variants (54).
Class III: one catalytic site per protein chain; act as
heterodimers; the large subunit is active in the absence
of the small subunit
Biochemically characterized examples include Type IIS
enzymes BtsI, BsrDI, BspD6I and BstNBI. BtsI (CGAG
TG 2/0) and BsrDI (GCAATG 2/0) recognize similar
target sequences and cleave at the same position. They
possess the same catalytic sites as the Class II enzymes
Mva1269I, BsrI and BsmI, but in separate protein
subunits (Figure 2). The large subunits contain a canonical
PD-(D/E)XK catalytic motif similar to the C-terminal
domain of Mva1269I, whereas the small subunits contain
a non-canonical PD-Xn-E-X12-QR catalytic motif that resembles
the N-terminal catalytic site of Mva1269I (28).
These Type IIS REases are also classified as Type IIT
because of their heterodimeric architecture. In the
heterodimeric state, BsrDI and BtsI cleave their target sequences
on both strands. Intriguingly, the isolated large
Figure 2. Five classes of restriction endonucleases that recognize asymmetric sequences and their nicking variants. Class I: homodimeric with one
catalytic site per protein chain. Class II: monomeric with two catalytic sites per protein chain. Class III: heterodimeric with one catalytic site per
protein chain; the large subunit is active in the absence of the small subunit. Class IV: heterodimeric with one catalytic site per protein chain; the two
subunits are of comparable size and none of the monomers is active in the absence of the partner. Class V: homodimeric with a half catalytic site
(phospholipase D-type) per protein chain. In Classes II and IV, information on the segregation of the DNA-binding domain and the DNA-cleavage
domain is not available. Therefore, single semicircles are used to represent a combined DNA binding/cleavage domain. In all cases, mutations that
inactivate the cleavage activity are indicated.
4 Nucleic Acids Research, 2011, Vol. 39, No. 1
subunits of both enzymes nick the bottom strands of their
target sites efficiently (28). The large subunits of BtsI and
BsrDI are therefore named Nb.BtsI and Nb.BsrDI, respectively.
Interestingly, the isolated small subunits of
both enzymes do not display any nicking activity (28).
In an attempt to show that the small subunits actually
carry an active DNA cleavage site and to develop top
strand-nicking enzymes, the catalytic site of the large
subunits of both BtsI and BsrDI were inactivated
through mutagenesis. The reconstituted heterodimers,
consisting of the wild-type small subunits and
cleavage-deficient large subunits (LÀ
S+
) nick the top
strand specifically, resulting in top strand-nicking
Nt.BsrDI (GCAATG 2/À) and Nt.BtsI (GCAGTG 2/À)
(28). It also shows that each of the large and small
subunits of BtsI and BsrDI carry an active
DNA-cleavage site that cleaves the bottom and the top
strand, respectively.
A similar molecular architecture has been reported in
the heterodimeric BstNBI/BspD6I (GAGTC 4/6)
REases, which are identical proteins described by two
independent groups. In both cases, the large subunits
were initially identified as top-strand nicking enzymes
(29–31), while later reports indicated that the presence
of a smaller protein encoded by the adjacent ORF
resulted in ds cleavage activity (32) (G. Wilson and H.
Kong, personal communication). Similar to BsrDI/BtsI,
the small subunit possesses a catalytic site that is only
functional when complexed with the large-nicking
subunit. The crystal structures of Nt.BspD6I and its
small subunit (ssBspD6I) show that although overall
sequence similarity is low, the DNA-binding domain of
Nt.BspD6I is structurally homologous to that of FokI
(55). More interestingly, the ssBspD6I has relatively
high-sequence similarity and structure homology to the
catalytic domain of the large nicking subunit (55),
suggesting two possible routes of evolution of BspD6I:
(i) duplication of the catalytic domain as the small
subunit; (ii) deletion of the DNA-binding domain of
one of the subunits of an ancestral homodimeric
BspD6I REase; followed by additional selective
pressure that optimized the amino acid sequence of the
small subunit for dimerization and second-strand
cleavage activity. Resolution of more atomic structures of
this class of heterodimeric Type IIS REases will tell
if this apparent domain duplication phenomenon is
typical.
Class IV: one catalytic site per protein chain; act
as heterodimers; neither of the monomers is active
in the absence of its partner
Type IIA BbvCI REase (CCTCAGC À5/À2) has an interesting
variation of the heterodimeric molecular architecture.
Unlike Type IIS BtsI and BsrDI, where the subunits
differ in size substantially (38 kDa versus 18 kDa in BtsI,
56 kDa versus 25 kDa in BsrDI), the two subunits of
BbvCI are comparable in size (31 and 32 kDa, respectively).
Neither isolated subunit of BbvCI can nick DNA
(Figure 2). However, when rendered catalytically
inactive by mutagenesis, the R1À
R2+
heterodimers nick
the top strand of the target sequence, while R1+
R2À
heterodimers nick the bottom strand only (56,57). This
indicates that each of the R1 and R2 subunits contain a
catalytic site that cleaves the bottom and top strand of the
target sequence, respectively. It also implies that each
subunit has its own DNA-binding domain that recognizes
half of the recognition site. Cleavage within the recognition
sequence suggests that the amino acid residues responsible
for DNA recognition and cleavage are not
separated into different domains—much like the canonical
Type IIP REases. The REase Bpu10I (CCTNAGC
À5/À2) that recognizes a highly similar target sequence
and adopts a similar molecular architecture (58) is
amenable to similar manipulations for the generation of
strand-specific nicking variants. BseYI (CCCAGC À5/À2)
contains two subunits with 58.3 and 37.1 kDa, respectively,
and recognize a target sequence similar to
BbvCI’s. It is likely that BseYI also belongs to this class
of Type IIA REases (R. Morgan and X. Y. Xu, unpublished
data).
Class V: half of a catalytic site (phospholipase D-type)
per protein chain; act as homodimers on each
strand sequentially
In Mva1269I, nicking of the bottom strand is a prerequisite
for cleavage of the top strand. This nick-dependent
cleavage of the second strand has also been observed in
BfiI (ACTGGG 5/4) (49,50). BfiI and its isoschizomer
BmrI, contains the phospholipase D (PLD) catalytic
motif (37). By attacking the scissile phosphodiester bond
directly with a nucleophilic histidine, the PLD-type nucleases
do not require metal ions for cleavage. The catalytic
site consists of two copies of the HXK motif, where the
histidine from one motif acts as a nucleophile that attacks
the scissile phosphodiester bond directly, and the histidine
from the other HXK motif acts as a proton donor to
Table 1. Classes of Type II restriction endonucleases that recognize
asymmetric sequences and examples
Class I (one catalytic site per protein chain; act as homodimers)
FokI GGATG 9/13
MlyI GAGTC 5/5
AlwI GGATC 4/5
Class II (two catalytic sites per protein chain; act as monomers)
Mva1269I GAATGC 1/–1
BsrI ACTGG 1/–1
BsmI GAATGC 1/–1
BtsCI GGATG 2/0
Class III (one catalytic site per protein chain; act as heterodimers;
the large subunit is active in the absence of the small subunit)
BtsI GCAGTG 2/0
BsrDI GCAATG 2/0
BstNBI/BspD6I GAGTC 4/6
Class IV (one catalytic site per protein chain; act as heterodimers;
neither of the monomers is active in the absence of the other
subunit)
BbvCI CCTCAGC –5/–2
Bpu10I CCTNAGC –5/–2
Class V [half of a catalytic site (phospholipase D-type) per protein
chain; act as homodimers on each strand sequentially]
BfiI/BmrI ACTGGG 5/4
Nucleic Acids Research, 2011, Vol. 39, No. 1 5
protonate the 30
leaving group (59). In BfiI/BmrI, only one
HXK motif is present per protein chain. Therefore, dimerization
is needed to generate a complete catalytic site at
the dimerization interface (Figure 2). The cleavage of the
two strands of ds-DNA is strictly sequential: the bottom
strand is cleaved before the top strand (50,60). The possibility
of oligomerization and hairpin formation for
second-strand cleavage has been ruled out, suggesting
that ds cleavage is achieved by protein and/or DNA conformation
rearrangement. As in other PLD nucleases, the
cleavage reaction of BfiI proceeds through a covalent
phosphohistidine intermediate where the nucleophilic histidine
(His105) from one subunit attacks and is covalently
linked to the 50
-phosphate of the cleaved strand, while the
histidine from another subunit protonates the hydroxyl of
the 30
-leaving group. The covalent phosphohistidine is
then attacked by a nucleophilic water molecule activated
by His105 of the other subunit to complete the hydrolysis
(49). Whether the histidine from both subunits takes on a
different role by chance or each of them serves a specific
role was unknown until recently. By creating heterodimeric
BfiI variants of WT/H105A and their
N-terminal truncations, it was shown that the His105 of
the subunit not bound to the recognition sequence acts as
a nucleophile to attack both strands, whereas His105 of
the subunit bound to the recognition sequence protonates
the leaving 30
-group and activates a water molecule to
hydrolyze the phosphohistidine intermediate for both
strands (61), implying a change of orientation of the
protein between the two cleavage events. Inhibition of
this re-orientation mechanism will confirm this hypothesis
and probably facilitate the creation of bottom-strand
nicking BfiI variants.
The sequential cleavage of the two strands has allowed
for verification of the presence of substrate-assisted catalysis
(62). Using bottom-strand nicked substrate with or
without the 50
-phosphate at the nicked site, Siksnys and
co-workers showed that at pH < 8.5, the cleavage of the
top strand is highly reduced in the presence of the
50
-phosphate (50). The absence of 50
-phosphate resulted
in a overall low cleavage of the top strand. Therefore, it
was concluded that the deprotonation of the 50
-phosphate
of the bottom strand is required for the cleavage of the
top strand, consistent to the substrate-assisted catalysis
model (62).
Homing endonucleases
Homing is the process by which mobile microbial
intervening genetic sequences—groups I or II introns or
inteins—are duplicated into host genes that lack such a
sequence (63–67). This process is induced by a site-specific
endonuclease encoded by an ORF harbored within the
intervening sequence (68). The endonuclease specifically
recognizes a target sequence corresponding to the intron
insertion site and usually generates a double-strand break
that is repaired by the cellular DNA-repair machinery,
leading to the duplication of the intron and the endonuclease
ORF into the target site. However, in the case
of both certain naturally occurring and engineered
HEases, the generation of a single-strand break appears
to be sufficient for homing and/or targeted homologous
recombination.
HEase genes are widespread and found within introns
and inteins in all biological super-kingdoms; each is
associated with a unique host genome (ranging from
phage, to cyanobacteria and eubacteria, to single-cell eukaryotes)
(69). In order to promote precise intron transfer
and avoid deleterious cleavage of their host genomes,
HEases are highly specific to their homing site by
recognizing longer DNA sequences (15–37 bp). However,
they exhibit sufficient site recognition flexibility to retain
genetic mobility in the face of target site variation across
diverging host strains. Unlike REases that make
side-chain-base contacts to every base within a recognition
site, HEases use a strategy in which variable numbers of
contacts are made to individual base pairs across a
long-target site to achieve overall high specificity but
variable recognition fidelity across the site (70). Target
site polymorphism that are tolerated by HEases are
strongly correlated with the polymorphism of the
sequence of the host target site (71). In an extreme case,
the nicking HEase I-BasI from Bacillus phage Bastille can
bind to and nick the intronless site of the DNApolymerase
gene of both Bastille and SPO1 strain, even
though the sequence of the two strains are very
different (27).
HEases can be classified into four major classes based
on their structural folds: bba-metal (includes HNH
and His–Cys HEases), GIY-YIG, LAGLIDADG and
PD-(D/E)XK. bba-metal and GIY-YIG HEases are
found in both free-standing and intron-associated
HEases in phage and in many cases generate single-strand
nicks in their DNA target sites (69). These two folds
have also been found and studied in Type IIP REases
(Figure 3A) (72–75) (Mak et al., in press). Although
having a different structure fold, the catalytic residues of
the bba-metal and GIY-YIG endonucleases are spatially
conserved and these enzymes appear to share a very
similar single-metal hydrolytic mechanism where a
tyrosine or histidine residue acts as an activated base to
generate a nucleophilic hydroxylate ion from a water
molecule (Figure 3B).
The bba-metal, GIY-YIG and LAGLIDADG catalytic
motifs, in the absence of structural embellishments or
accessory domains, are relatively non-specific endonucleases,
often put to use by phage and bacteria as
part of an arsenal of degradative enzymes that can
assist in invasion or cellular defense (76,77). In the case
of HEases, the nuclease domains are generally tethered
to additional DNA-binding regions (78,79), and may also
contain additional inserted sequence motifs that facilitate
target specificity (80). The presence of the PD-(D/E)XK
motif commonly used by REases in HEases is only
become apparent recently with the resolution of the
crystal structure of I-Ssp6803I in the presence of its
target DNA (81). The structure shows that I-Ssp6803I
adapts a tetrameric configuration for binding to the
long-homing site but only uses two of the subunits for
cleavage of the target homing site.
6 Nucleic Acids Research, 2011, Vol. 39, No. 1
Naturally occurring nicking HNH HEases
The HNH enzymes I-HmuI and I-BasI (isoschizomers
encoded within Bacillus phage SPO1 and Bastille,
respectively) have been studied using a combination of
mutagenic, biochemical and structural analyses
(27,79,82–85). These proteins bind to the same DNA sequences
and nick the coding strand at the identical
position, 3 nt downstream of the eventual intron insertion
site: AACGCTCAGCAATTCCCACGT (none/À18)
(84,85).
Although I-HmuI and I-BsaI are isoschizomers, the
relative specificities of I-HmuI and I-BasI are slightly different
(27): I-HmuI nicks both intron-minus and intronplus
target sequences from its own genome (SPO1 phage)
with a preference for the intron-minus substrate. In
contrast, I-BasI is able to nick the intron-minus target
from both host genomes, although the actual homing
sites are very difference in sequence (27). In both cases,
it is assumed that the eventual resolution of the enzymeinduced
nick, which leads to intron homing, may require
DNA replication in order to convert the initial nick into a
double-strand break. However, as discussed below, recent
studies with engineered LAGLIDADG HEases may
indicate that a single-strand break can be recombinogenic
under certain conditions.
Sequential cleavage of GIY-YIG HEases
The GIY-YIG HEase such as I-TevI possesses one catalytic
site per protein chain and largely appears to generate
ds breaks. This requires the enzyme to form a transient
dimer to create two adjacent active sites (as in Type IIS
FokI) or reposition a single-active site on each strand
during a single-binding event with its cognate target site
(86,87) (similar to Type IIS BfiI). Both I-TevI and I-BmoI
have been reported to undergo a sequential cleavage
mechanism where the bottom strand is nicked first,
bending the DNA at the nicked site to facilitate the
nicking of the top strand (88,89). By using a bioinformatics
and mutagenesis approach to identify highly
co-evolved residues, a residue that is involved in the
second-cleavage event has been identified in I-BmoI—
mutation of Ile70 to Asn leads to the accumulation of a
nicked intermediate, which is eventually converted to
ds cleavage product over time (90). More research is
needed to understand the role of this residue and the
mechanism of sequential cleavage of GIY-YIG HEases
in general.
LAGLIDADG HEases and nicking variants
LAGLIDADG endonucleases contain two similar core
folds of mixed a/b topology, with their namesake
Figure 3. Comparison of two endonuclease motifs that are heavily represented by monomeric endonuclease domains with significant nicking activity.
(A) On the left is the DNA-bound catalytic site of the GIY-YIG endonuclease R.Eco29kI; on the right is the DNA-bound catalytic site of the HNH
endonuclease R.Hpy99I. The proposed mechanism and overall catalytic architecture is largely the same (with the exception of the substitution of a
tyrosine for a histidine for general base), but are grafted onto two completely separate protein fold topologies. The large purple spheres in the
structures are bound magnesium ions; the small light blue spheres are the nucleophilic water molecules. (B) Postulated mechanisms of phosphodiester
bond hydrolysis by the GIY-YIG (left) and HNH (right) nuclease active sites.
Nucleic Acids Research, 2011, Vol. 39, No. 1 7
sequence motifs forming two a-helices that are packed
together at the domain or subunit interface, where they
each contribute a catalytic residue to an active site (69).
Two distinct subfamilies of LAGLIDADG endonucleases
have been identified. Those that contain a single
LAGLIDADG motif per protein chain (such as I-CreI)
form homodimers that recognize palindromic and
pseudo-palindromic target sites. In contrast, enzymes
that contain two motifs per protein chain form asymmetric
monomers that recognize correspondingly asymmetric
homing sites, with each domain cleaving each of the two
strands (Figure 4A). Both subclasses of these endonucleases
display a canonical two-metal ion mechanism for
phosphodiester hydrolysis, with a metal-bound water
molecule in each active site appropriately positioned for
an in-line hydrolytic attack on the scissile phosphate
group (Figure 4B) (91). As well, the two active sites
found in the LAGLIDADG enzymes are very closely
juxtaposed, and in many cases appear to physically
share one bound catalytic metal ion (out of three total)
(91–93).
Members of the monomeric LAGLIDADG enzyme
subfamily often display a significant asymmetry in their
rates of cleavage of individual DNA strands within their
target sites. The algal endonuclease I-CpaII preferentially
nicks the bottom strand of its target site at very low magnesium
(94). The yeast HEase I-SceI has a higher binding
affinity for the 30
-DNA half-site, leading to the accumulation
of nicked intermediates during the cleavage reaction
(95). The archaeal endonuclease I-DmoI and the fungal
enzyme I-AniI have both been shown to preferentially
cleave the coding strand of their target sites (96,97).
The natural tendency of monomeric LAGLIDADG
enzymes to cleave one DNA strand more efficiently
suggests that cleavage of the two strands is sequential. A
wealth of crystallographic and biochemical studies has
revealed information about the cleavage mechanism and
active-site architecture of LAGLIDADG enzymes. In
stark contrast to other endonuclease families, a wellordered
network of solvent molecules, that surround the
nucleophilic water moiety, is distributed in a large pocket
surrounding the DNA scissile phosphate group. These
ordered solvent molecules are positioned and coordinated
by several basic residues that line the periphery of the
active site. These residues, which appear to be involved
in solvent-mediated interactions and proton transfer, are
highly diverse chemically and structurally. Mutation
of the peripheral residues Gln47 and Lys98 of the
homodimeric I-CreI LAGLIDADG endonuclease causes
significant reductions in catalytic efficiency with little
effect on either overall substrate-binding affinity or the
structure of the enzyme-DNA complex (98). Similar
mutations of the monomeric I-AniI result in a variety of
catalytic effects, ranging from complete inactivation, to
accentuation of their natural tendency to cleave one
DNA strand more rapidly than its counterpart, to the
formation of highly active nicking enzymes (Figure 4C)
(99). Mutation of Lys227 to Met results in high nicking
activity, but no significant ds cleavage activity within the
experiment conditions (Figure 4C) (99).
The crystal structures of I-SceI with uncleaved and
bottom-nicked substrates suggest a sequential cleavage
mechanism that involves the recruitment of a fourth
metal ion for second-strand cleavage (100). Lys223 (corresponds
to Lys227 of I-AniI) in the C-terminal catalytic
site coordinates the nucleophilic water molecule for the
attack of the scissile phosphate of the bottom strand
(101). Lys122 is involved in the water network that coordinates
the fourth metal ion and the second nucleophilic
water molecule for the cleavage of the top strand
(93,100). Mutations of Lys122 and Lys223 to Ile result
in changes of the rate constant of the individual nicking
steps such that the K122I mutation suppresses top-strand
cleavage whereas the K223I mutation suppresses
bottom-strand cleavage, resulting in a bottom-strand
nicking and a top-strand nicking variant, respectively
(Figure 5) (101). Both mutants, however, generate ds
break products over extended reaction time.
Interactions at the interface of the two catalytic
domains also seem to play a role in the ds cleavage
activity of LAGLIDADG HEases. Mutation of the
domain interface residues of I-DmoI results in a preference
to nick than making ds breaks (102). Given the
loosely conserved nature of the peripheral residues in
LAGLIDADG active sites and the use of a solvent
network for the coordination and deprotonation of the
nucleophile rather than a single explicit protein side
chain, it seems clear that LAGLIDADG active sites
display variable amounts of mechanistic redundancy in
their ability to carry out acid/base catalysis.
Nonetheless, the overall mutagenic strategy to shift the
activity of LAGLIDADG enzymes from DNA cleavage
to DNA nicking by mutation of the peripheral and
domain interface residues may be generalizable across a
wide range of diverse protein scaffolds.
SELECTION METHODS FOR ISOLATION OF
NICKING ACTIVITIES
Enzymes that possess two readily identifiable catalytic
sites, such as LAGLIDADG HEases, Mva1269I and
BtsCI and their group members, are easier subjects for
engineering nicking activity. When little is known about
the identity of the functional residues, a good selection
system is perhaps the most important part of the engineering
and selection of nicking activity (and any desired
enzymatic properties). Nicked plasmid has a very different
electrophoretic mobility than the closed circular ones,
and E. coli appears to tolerate low-level expression of
some NEases in the absence of the cognate
methyltransferase (MTase). Nicking variants of SapI
have been selected by making use of these properties
(53). A SapI site and a BbvCI site are added to the expression
plasmid vector such that sequential nicking by
top-strand nicking variants of SapI and Nb.BbvCI will
result in a 10-nt 30
-recessive end for ligating to an
adaptor for amplification in PCR (Figure 6). Similarly,
sequential nicking by bottom-strand nicking variants of
SapI and Nt.BbvCI will result in a 4-base 50
-recessive end
available for ligation to an adaptor for amplification by
8 Nucleic Acids Research, 2011, Vol. 39, No. 1
PCR. A randomly mutated library of the sapIR gene was
subjected to transformation of the E. coli host cells
without the protection of the cognate MTases. The expression
plasmid DNA was nicked by the nicking SapI
variants in vivo. The nicked plasmid DNA was then
isolated, gel-purified and subjected to Nt.BbvCI or
Nb.BbvCI cleavage. After ligation with the appropriate
adaptor, the mutated ORF was amplified and re-cloned
into host cells with the cognate MTases. Nicking activity
of the SapI mutants were then assayed. Through this
selection process, residues that are important for the
cleavage of each strand of the ds-target sequence were
identified, and top- and bottom-strand nicking-SapI
variants were created (53). This selection method
should be generally applicable for engineering nicking
activity of other restriction/HEases.
Figure 4. LAGLIDADG endonucleases and engineered nicking I-AniI variant. (A) Members of the LAGLIDADG endonucleases exist both as
homodimers that recognize, bind and cleave palindromic and near-palindromic DNA-target sequences (such as I-CreI, left side) and monomeric,
pseudo-symmetric monomers that recognize and cleave asymmetric DNA-target sequences (such as I-AniI, right side). These latter monomeric
endonucleases often display considerable asymmetry in the relative rates of top versus bottom strand cleavage. (B) A canonical LAGLIDADG
catalytic site positions bound metal ions (green spheres labeled 10
and 2) within direct contact distance to the oxygen atoms of the scissile phosphate,
and then surrounds the nucleophilic water (red sphere) with a shell of ordered water molecules that are positioned, in part, through contacts with side
chains of peripheral residues. While the identity of those side chains are only moderately conserved, a glutamine residue and/or a lysine residue are
usually found to be involved in these contacts. (C) Mutation of these residues in I-AniI generate a variety of behaviors ranging from partial nicking
activity (Q171K), to complete conversion to strong nicking activity (K227M; boxed lanes) to a complete loss of endonuclease activity (Q171M/
K227M double mutation). Shown on the gel for comparison is activity on the same plasmid substrate by wild-type (WT) I-AniI (which generates a ds
break).
Figure 5. Rate constants of sequential cleavage of I-SceI WT, K122I and K223I mutant. The enzyme-substrate complex (ES) is converted to the
enzyme-bottom-nicked intermediate (ENb) at a rate constant of k1 and then to the enzyme-linear product (EL) at a rate constant of k3. The
enzyme-substrate can also be converted to the enzyme-top-nicked intermediate (ENt) at a rate constant of k2 and then to the enzyme-linear
product (EL) at a rate constant of k4. The rate constants for mutants K122I and K223I are represented as folds compared to those of the WT
enzyme.
Nucleic Acids Research, 2011, Vol. 39, No. 1 9
APPLICATION OF NEases
By cleaving a specific strand of dsDNA and leaving the
opposite strand intact, NEases open the door to applications
that cannot be achieved by ds breaking REases. In
conjunction with strand-displacing or nick-translating
DNA polymerases, which extend the 30
-recessive end of
the nicked site and regenerate the nicking site itself,
NEases can amplify specific segments of sample DNA
without the need of thermocycling as in EXPAR and
related amplification schemes. The same methodology
can also be used to introduce fluorescently labeled nucleotides
into long/chromosomal DNA in vitro for visualization.
The implementation of these sample and/or signal
amplification schemes can lead to simple but sensitive
and specific methods for the detection of target organisms
in the field. Finally, NEases can create nicked DNA for
in vivo gene targeting by inducing homologous recombination.
Gaps can be introduced into long DNA molecules
for the study of DNA repair and recombination, as well as
DNA translocases activity.
The applications described below were designed based
on the sequence and strand specificity of the
NEases being used. Nonetheless, these applications are
general and other NEases can be used as long as the
corresponding nicking site is properly located within
the DNA.
Amplification of DNA signal
NEases generate nicked DNA with 30
-recessive ends available
for extension by strand-displacing DNA polymerases.
The nicking site can then be regenerated for the next
round of nicking extension without the need of
thermocycling. The amplified DNA signal can then be
quantified by a variety of detection methods: capillary
electrophoresis (103); reverse-phase liquid chromatography
(104,105); real-time detection of the amplified
DNA using DNA-binding fluorescent dyes and real-time
thermocycler (106); or annealing the amplified DNA to
complementary sequences conjugated to colloidal gold
Figure 6. Selection for strand-specific SapI nicking variants. The T7 expression vector for sapIR (pSAPV6) was modified such that nicking by
Nt.SapI/Nb.BbvCI or Nb.SapI/Nt.BbvCI resulted in overhangs that can be ligated to adaptors for PCR amplification. A randomly mutated pSAPV6
sapIR library was isolated from an E. coli host without the protection from the cognate MTases so that the plasmid vectors that expressed nicking
variants of SapI were nicked in vivo. The nicked plasmid vector was gel-purified and further nicked by Nt.BbvCI or Nb.BbvCI, followed by ligation
to the appropriate ss adaptor (and fill-in for the Nb.SapI/Nt.BbvCI reaction). After PCR amplification, the mutated sapIR gene was re-cloned into
host cells pre-modified by SapI MTases. Nicking activity was then assayed from the crude extract of induced cultures. T7 promoter is in yellow color,
the sapIR gene in green, the SapI recognition site in blue and BbvCI recognition site in orange. The cleavage sites of SapI and BbvCI and their
nicking variants are indicated by arrows.
10 Nucleic Acids Research, 2011, Vol. 39, No. 1
particles (107). Several schemes have been developed to
amplify specific DNA segments.
In Exponential Amplification Reaction (EXPAR), a
short segment of the target analyte DNA (trigger) is
amplified using Nt.BstNBI and the strand-displacing
Bst DNA polymerase in a linear or exponential mode.
An amplification template that incorporates two copies
of the sequence complementary to the trigger separated
by a BstNBI site circumvents the need of a nicking site
in the trigger sequence (Figure 7A). The exponential
mode has been shown to achieve a >100-fold
amplification in under 5 min (105–108). EXPAR has
also been applied to the construction of DNA-based
logic gates and circuits (X. L. Wang, personal
communication).
NESA is designed to amplify ss DNA-target sequences.
A fluorescently labeled ss-oligonucleotide probe is
annealed to the heat-denatured genomic DNA target or
other ss DNA sources through prior multiple displacement
amplification (MDA) (103,109). Sequence- and
strand-specific nicking was carried out by Nt.AlwNI at
58
C such that the nicked probe dissociates from the
template and is subsequently detected by capillary electrophoresis.
NESA has been shown to efficiently detect
single-copy target from 10 fmol of DNA and distinguish
DNA isolated from similar Bacillus species (103). An
extended version of NESA incorporates rolling circle
amplification of the target DNA and amplification of
signal by the use of a molecular beacon (Figure 7B)
(110). The combined amplification has been shown
to bring about a detection limit in the femtomolar
range (110). NESA has also been adapted to detect
Streptococcus pyogenes (111). A signal amplification
method (without target sequence amplification) using
Nt.BspD6I and a molecular beacon has also been
reported (112). A NEases mediated DNA Amplification
scheme amplifies random ss-DNA fragments through the
continuous nicking and extension of nicked DNA by the
frequent NEase Nt.CviPII and Bst DNA–DNA polymerase
(23). The ss-DNA generated can be used as the
template for NESA.
The primer generation-rolling circle amplification (PGRCA)
scheme makes use of a circular ss DNA probe that
contains the complementary sequence of the target DNA
and a Nb.BsmI site (Figure 7C). Replication and nicking
of the target sequence by Vent (exoÀ
) DNA polymerase
and Nb.BsmI, respectively, has been shown to amplify the
target DNA sequence from $60 molecules of Listeria
monocytogenes genomic DNA (104).
A detection scheme for human herpes virus by extension
at the 30
-ends of vicinal nicks on the virus DNA by
Nb.BsmI and Nb.BsrDI has been reported. In this
scheme, the NEases generate gaps of 15–25 nt on the
target virus DNA. After annealing by gap-specific oligonucleotides
with a 30
-flap and immobilization, RCA is
used to amplify the signal (113). Such a detection
scheme has been shown to be sensitive and specific, and
is expected to be applicable to other viruses such as EBV
and HCMV.
In addition to DNA, sequence-specific detection of
RNA has also been reported. In this detection scheme, a
hairpin DNA probe is designed to open up when annealed
to the target RNA sequence. The opening of the probe
exposes a sequence complementary to a quenched fluorescent
probe with a 50
-fluorophore and a 30
-quencher.
Annealing with the quenched probe generates a
ds-BbvCI site such that Nb.BbvCI nicks the strand containing
quenched fluorescent probe and releases the
fluorophore from being quenched (114). This RNA detection
scheme has been shown to be quantitative and not
requiring purification of the RNA, and should be applicable
to the detection of ss DNA.
Chromosomal DNA bar coding (nanocoding)
Sequence-specific nicks generated by NEases can be
fluorescently labeled by incorporating fluorescent nucleotides
using a nick-translating DNA polymerase. The
labeled DNA is then stretched through a nanoslit
(115,116), on a modified glass surface (117) or on an
optical mapping surface (54) (Figure 8). Single DNA
molecule BbvCI maps of BAC (115),  DNA and
human adenovirus type 2 DNA (117), BsmI maps of
human rhinovirus 14 DNA and human rhinovirus 89
(117) and BspQI maps of T7 phage DNA (54) have been
produced. This NEase-based nanocoding methodology
can become a quick and highly sensitive method to
study SNP within nicking sites. For example, the nicking
variants of BtsCI (a neoschizomer of FokI) should be
useful in nanocoding the FokI polymorphism of the
vitamin D receptor in cancer risk assessment (118,119).
Gene targeting based on homologous recombination
The use of natural and designer zinc-finger nucleases
(ZFNs) for targeted in vivo deletion and insertion
through generation of ds breaks has been well studied
and exhibits big promise of practical use in gene targeting
(120–122). Recently, strand-specific nicks generated by
NEases have also been shown to induce homologous recombination
and hence gene insertion (99,123,124).
Adeno-associated virus (AAV) Rep78 and Rep68
proteins that introduce a sequence-specific nick in locus
AAVS1 on human chromosome 19 have been shown
to induce insertion of a functional 4.1-kb sequence into
HeLa cells through homologous recombination (124). The
nicking variant of I-AniI has been shown to stimulate
homologous recombination in human T293 cells at an
efficiency approximately one-fourth that of the wild-type
ds-breaking I-AniI enzyme, both when measuring transient
recombination in cis, and in assays of recombination
of a chromosomal target gene in trans (99). A more recent
study using an adenoviral delivery system showed that the
I-AniI nickase-induced recombination events do not
appear to require subsequent conversion to ds breaks
(M. J. Metzger, manuscript in preparation). These
nicking enzyme-induced recombination events do not
result in significant non-homologous end-joining (NHEJ)
events and appear to greatly reduce overall cell toxicity
when the protein is expressed.
Nucleic Acids Research, 2011, Vol. 39, No. 1 11
Figure 7. NEase-dependent amplification. (A) EXPAR. In EXPAR, the target analyte DNA (trigger; dark orange) anneals to a synthetic amplification
template that contains two copies of the sequence complementary to the target sequence (light orange) separated by a sequence complementary
to the BstNBI site (light blue). At an elevated temperature (60
C) Bst DNA polymerase large fragment extends at the 30
-end of the trigger DNA
and creates a ds-BtsNBI site (dark blue/light blue) followed by an extra copy of the trigger sequence. The thermostable Nt.BstNBI NEase then nicks
the top strand of the BstNBI site. By the combined action of the elevated temperature and the strand-displacing activity of Bst DNA polymerase, the
newly synthesized trigger sequence is detached from the amplification template and allows the next cycle of extension to proceed in the linear
amplification scheme. In the exponential amplification protocol, the extended-cleaved triggers are removed from the amplification template so that
the newly synthesized triggers can start a new cycle of extension-nicking. (B) In the extended NEase signal amplification (NESA) scheme that
involves multiple temperatures and steps, the initial target-analyte sequence (dark orange) was first amplified by annealing to a padlock DNA
designed to close at the target sequence (light blue), followed by ligation of the closed padlock DNA and rolling-circle amplification. The resulting
concantemers consist of a tandem repeat of the sequence complementary to a molecular beacon with a BstNBI site (red). The molecular beacon is
then allowed to anneal to the concantemers, creating a ds-BstNBI site where Nt.BstNBI nicks the molecular beacon and emits a fluorescent signal.
(C) Primer generation-rolling circle amplification (PG-RCA). Similar to EXPAR, the amplification template (light orange) consists of a nicking site
(red) sandwiched between two copies of the sequence complementary to the target analyte (dark orange). In this particular example, a BsmI site is
used. In PG-RCA, the amplification template is made circular for rolling circle amplification. After annealing of the analyte DNA, Vent (exoÀ
) DNA
polymerase extends the 30
-end and creates a concantemer of BsmI sites sandwiched between the analyte sequences. Multiple annealing of the circular
probe to the concatemers creates ds-strand BsmI sites. Nb.BsmI then nicks the concantemer strands and generates multiple copies of the analyte for
the next round of rolling circle amplification.
12 Nucleic Acids Research, 2011, Vol. 39, No. 1
Generation of nicked or gapped substrate for the study of
DNA recombination and translocation
Recombination initiated by nicks or gaps as opposed to ds
breaks has not been well-studied largely due to a paucity
of reagents that reliably nick DNA in a site-specific
fashion. The availability of nicking variants of Type IIS
and Type IIA REases and HEases makes it possible to
generate nicked or gapped DNA for mechanistic
analyses of DNA repair and recombination. By designing
two nicking sites close enough on the same strand, nicking
of the sites creates an intervening sequence that melts
away. Nicked and gapped DNA has been used in the
study of DNA mismatch repair mechanism in a mammalian
model system (125,126).
Gapped DNA has also become imperative in the study
of the helicase domain of EcoP124I. The ability to
generate long-DNA molecules with a ss-DNA gap has
facilitated the discrimination of the DNA translocation
activity from DNA unwinding activity of the Type I
REase (127). The availability of top- and bottom-nicking
variants of BbvCI makes it possible to generate identical
DNA molecules with a gap on either the 50
–30
or 30
–50
strand for the determination of strand dependence of
gap bypass of EcoP124I (127). These assays are believed
to be applicable to other helicases and translocases.
Other applications
The generation of extendable 30
-recessive ends with the
potential of creating long-single-stranded downstream
sequence on the opposite strand is a great asset of
NEases. By making use of this property, a new sample
preparation scheme has been reported for pyrosequencing
that allows quantitative genotyping of SNP and gene expression
analysis (128). Also, the 30
-end of the nicked
strand directs E. coli exonuclease III (Exo III) to
degrade the nicked strand specifically but leaving the
un-nicked strand intact. For example, pairs of top- and
bottom-strand nicking enzymes that recognize the same
target site, such as Nt.BspQI/Nb.BspQI and Nt.BtsCI/
Nb.BtsCI can generate either Watson or Crick strand
from the same plasmid construct in conjunction with
Exo III (54). A heteroduplex reporter plasmid for
mismatch repair has been created by this means (129).
Gapped DNA generated by multiple nicks on the same
DNA strand allows incorporation of modified nucleotides
anywhere within a long-DNA molecules (130). By putting
a nicking site and a restriction site in tandem, long-sticky
ends can be created for gene cloning without the need of
DNA ligase (131).
As a neoschizomer to FokI, sequential cleavage of
Nt.BtsCI or Nb.BtsCI with wild-type FokI can generate
11-nt 50
or 9-nt 30
overhangs, respectively. These overhangs
can be ligated to oligonucleotide duplexes that
carry single-strand regions complementary to the overhangs
for cloning and labeling (51). The 11-nt 30
-recessive
end can also be filled in with fluorescently labeled
nucleotides efficiently for the generation of fluorescent
probes (51).
The single-strand nicking activity, combined with the
annealing-denaturing with a complementary sequence,
has been exploited to create a molecular motor. A nanomotor
device that transports a single-stranded cargo DNA
along a ds-DNA track using Nb.BbvCI has been reported.
In this ‘burnt-bridge’ strategy, a double-strand DNA track
is lined with equally spaced single-stranded stators with
sequence complementary to the cargo DNA. Annealing
of the cargo DNA to the stators creates a ds-BbvCI site
(132). Nb.BbvCI nicks the stator strand and releases the
cargo DNA for annealing to the next stator along the
track. The transport is halted by a single-base mismatch
at the BbvCI site of the last stator such that the cargostator
is not nicked.
FUTURE CHALLENGES AND OPPORTUNITIES
So much has been learned about the cleavage mechanisms
of Types IIS and IIA REases and LAGLIDADG HEases,
yet there are still many unknowns. Class III enzymes, for
example, have a small subunit that exhibits cleavage
activity only in the presence of the large subunit. It
remains unclear how this switch happens. Similarly, it is
still unclear why the presence of both subunits of the
nicking variants of the Class IV BbvCI (a Type IIA
REase) is required for nicking to occur, even though
only one of them is catalytically active. More research is
needed to understand the intricate modulation of cleavage
activity of these enzymes.
Just like the ds-breaking parent enzymes, some engineered
NEases exhibit star activity. It will be interesting to
see if the mutations that bring about low star activity for
the parent REases can also lower the star activity of the
corresponding NEases.
Nanocoding in its current version can only achieve
0.5-kb resolution between two labeled nicked sites.
Improvement of fluorescence imaging techniques can
achieve higher resolution (<100 bp) for more precise determination
of genetic mutations and multiple nicking site
profiling.
The fusion of the methyl-binding domain (MBD) of
human MeCP2 (133–135) with the DNA-cleavage
domain of BmrI (Class V) or FokI (Class I) had been
shown to cleavage 5mCpG sequences preferentially over
unmodified DNA (136). This study suggests that it is
Figure 8. NEases dependent nanocoding. (Upper panel) A T7 bacteriophage
DNA molecule was nicked by Nt.BspQI. Alexa Fluor 647-dUTP
was incorporated by the nick-translating E. coli DNA polymerase I.
The DNA is stained by YOYO-1 (green) and the nick-translated sites
(red) are revealed by FRET signal from the Alexa fluorophore. The
white bar indicates 1 mm. (Lower panel) Scale for the T7 bacteriophage
DNA in kilobites. The red arrows indicate the orientation of the BspQI
sites and the direction of nick translation.
Nucleic Acids Research, 2011, Vol. 39, No. 1 13
possible to generate NEases specific to 5mCpG by
tethering the MBD of 5mCpG-binding proteins such as
hMeCP2 and MBD2b (137–139) to an active DNAnicking
domain, such as those from Class III enzymes
(i.e. Nb.BtsI, Nb.BsrDI). The availability of such
5mCpG-specific NEases will be of tremendous value in
the study of epigenetics as reagents for signal amplification
and nanocoding. The nicking domain of Class III enzymes
may also be tethered to DNA-recognition domains, such
as zinc fingers and transcription factors, to create customspecific
NEases that can make nicks close enough in vivo
to create ds breaks for gene targeting.
CONCLUDING REMARKS
Canonical Type IIP REases combine their DNA-binding
and DNA-cleavage residues into one catalytic domain.
Obligatory homodimerization results in cleavage of both
DNA strands of ds-DNA at the equivalent positions of
palindromic sequences. Type II REases that recognize
asymmetric sequences, Types IIS and IIA REases, in particular,
use a variety of strategies to recognize nonpalindromic
target sites and cleave at variable distances,
as revealed by intensive research in the last decade. These
include the use of two catalytic sites to cleave each of the
strands of ds-DNA and cleavage of each of the strands
sequentially using the same catalytic site. The study of the
cleavage mechanism of the former case has resulted in
useful NEases. LAGLIDADG HEases, such as I-SceI
and I-AniI, also use two catalytic sites for cleavage of
the each of two strands of ds-DNA target. Studies of
their cleavage mechanisms have also resulted in nicking
variants useful for gene targeting among others.
NEases open a new door of application not achievable
by REases that make ds breaks. The nicks created by
NEases can be directly fluorescently labeled by nick translation,
allowing for nanocoding of chromosomal and virus
DNA. Gaps created by multiple nicks can be used to incorporate
modified nucleotides into long DNA molecules.
Combined with strand-displacing DNA polymerases, such
as Bst DNA polymerase and f-29 DNA polymerase, the
nick generates a 30
-extendable end for the amplification of
target DNA in a sequence-specific or non-specific manner.
Lastly, NEases can also generate sequence-specific nicks
and gaps for the study of DNA repair and recombination
and DNA translocation.
NEases have only been commercially available in the
last few years and the selection of sequence specificity is
still limited. However, with the information already available
on the cleavage mechanisms of various classes of
Type IIS and Type IIA REases and LAGLIDADG
HEases, more engineering effort will result in a wider selection
of NEases specificity for a broader application in
molecular medicine and biotechnology.
ACKNOWLEDGEMENTS
We thank Richard Roberts, Bill Jack and Frederick
Gimble for commenting on the article and Geoff Wilson
for discussions, Don Comb and Jim Ellard for support
and encouragement.
FUNDING
National Institutes of Health (grants R01GM49857 and
NIH RL1 CA833133 to Stoddard laboratory). Funding
for open access charge: New England Biolabs, Inc.
Conflict of interest statement. None declared.
REFERENCES
1. Li,H., Stampfer,M.J., Hollis,J.B., Mucci,L.A., Gaziano,J.M.,
Hunter,D., Giovannucci,E.L. and Ma,J. (2007) A prospective
study of plasma vitamin D metabolites, vitamin D receptor
polymorphisms, and prostate cancer. PLoS Med., 4, e103.
2. Chang,H.W., Yang,C.H., Chang,P.L., Cheng,Y.H. and
Chuang,L.Y. (2006) SNP-RFLPing: restriction enzyme mining for
SNPs in genomes. BMC Genomics, 7, 30.
3. Zilberman,D. and Henikoff,S. (2007) Genome-wide analysis of
DNA methylation patterns. Development, 134, 3959–3965.
4. Nielsen,K.L. (2008) DeepSAGE: higher sensitivity and
multiplexing of samples using a simpler experimental protocol.
Methods Mol. Biol., 387, 81–94.
5. Porter,D., Yao,J. and Polyak,K. (2006) SAGE and related
approaches for cancer target identification. Drug Discov. Today,
11, 110–118.
6. Sorber,K., Chiu,C., Webster,D., Dimon,M., Ruby,J.G., Hekele,A.
and DeRisi,J.L. (2008) The long march: a sample preparation
technique that enhances contig length and coverage by
high-throughput short-read sequencing. PLoS One, 3, e3495.
7. Kim,S., Kim,Y., Liang,T., Sinsheimer,J.S. and Chow,S.A. (2006)
A high-throughput method for cloning and sequencing human
immunodeficiency virus type 1 integration sites. J. Virol., 80,
11313–11321.
8. Luria,S.E. and Human,M.L. (1952) A nonhereditary, host-induced
variation of bacterial viruses. J. Bacteriol., 64, 557–569.
9. Bertani,G. and Weigle,J.J. (1953) Host controlled variation in
bacterial viruses. J. Bacteriol., 65, 113–121.
10. Sharp,P.A., Sugden,B. and Sambrook,J. (1973) Detection of two
restriction endonuclease activities in Haemophilus parainfluenzae
using analytical agarose–ethidium bromide electrophoresis.
Biochemistry, 12, 3055–3063.
11. Garfin,D.E. and Goodman,H.M. (1974) Nucleotide sequences at
the cleavage sites of two restriction endonucleases from
Hemophilus parainfluenzae. Biochem. Biophys. Res. Commun., 59,
108–116.
12. Smith,H.O. and Wilcox,K.W. (1970) A restriction enzyme from
Hemophilus influenzae. I. Purification and general properties.
J. Mol. Biol., 51, 379–391.
13. Goldstein,L., Thomas,M. and Davis,R.W. (1975) EcoRI
endonuclease cleavage map of bacteriophage P4-DNA. Virology,
66, 420–427.
14. von Gabain,A., Hayward,G.S. and Bujard,H. (1976) Physical
mapping of the HindIII, EcoRI, Sal and Sma restriction
endonuclease cleavage fragments from bacteriophage T5 DNA.
Mol. Gen Genet., 143, 279–290.
15. Roberts,R.J. (2005) How restriction enzymes became the
workhorses of molecular biology. Proc. Natl Acad. Sci. USA, 102,
5905–5908.
16. Roberts,R.J., Vincze,T., Posfai,J. and Macelis,D. (2010)
REBASE–a database for DNA restriction and modification:
enzymes, genes and genomes. Nucleic Acids Res., 38, D234–D236.
17. Roberts,R.J., Belfort,M., Bestor,T., Bhagwat,A.S., Bickle,T.A.,
Bitinaite,J., Blumenthal,R.M., Degtyarev,S., Dryden,D.T.,
Dybvig,K. et al. (2003) A nomenclature for restriction enzymes,
DNA methyltransferases, homing endonucleases and their genes.
Nucleic Acids Res., 31, 1805–1812.
14 Nucleic Acids Research, 2011, Vol. 39, No. 1
18. Vanamee,E.S. and Aggarwal,A.K. (2004) In Messerschmidt,A.,
Bode,W. and Cygler,M. (eds), Handbook of Metalloproteins,
Vol. 3. John Wiley & Sons, Ltd., Chichester, pp. 742–756.
19. Galburt,E.A. and Stoddard,B.L. (2002) Catalytic mechanisms of
restriction and homing endonucleases. Biochemistry, 41,
13851–13860.
20. Grigorescu,A., Horvath,M., Wilkosz,P.A., Chandrasekhar,K. and
Rosenberg,J.M. (2004) In Pingoud,A. (ed.), Restriction
Endonucleases, Vol. 14. Springer, New York, pp. 137–177.
21. Cowan,J.A. (2004) In Pingoud,A. (ed.), Restriction Endonucleases,
Vol. 14. Springer, New York, pp. 339–360.
22. Horton,J.R., Blumenthal,R.M. and Cheng,X. (2004)
In Pingoud,A. (ed.), Restriction Endonucleases. Springer,
New York, pp. 316–392.
23. Chan,S.H., Zhu,Z., Van Etten,J.L. and Xu,S.Y. (2004) Cloning of
CviPII nicking and modification system from chlorella virus
NYs-1 and application of Nt.CviPII in random DNA
amplification. Nucleic Acids Res., 32, 6187–6199.
24. Chan,S.H., Zhu,Z., Dunigan,D.D., Van Etten,J.L. and Xu,S.Y.
(2006) Cloning of Nt.CviQII nicking endonuclease and its cognate
methyltransferase: M.CviQII methylates AG sequences. Protein
Expr. Purif., 49, 138–150.
25. Landthaler,M. and Shub,D.A. (2003) The nicking homing
endonuclease I-BasI is encoded by a group I intron in the DNA
polymerase gene of the Bacillus thuringiensis phage Bastille.
Nucleic Acids Res., 31, 3071–3077.
26. Landthaler,M., Lau,N.C. and Shub,D.A. (2004) Group I intron
homing in Bacillus phages SPO1 and SP82: a gene conversion
event initiated by a nicking homing endonuclease. J. Bacteriol.,
186, 4307–4314.
27. Landthaler,M., Shen,B.W., Stoddard,B.L. and Shub,D.A. (2006)
I-BasI and I-HmuI: two phage intron-encoded endonucleases with
homologous DNA recognition sequences but distinct DNA
specificities. J. Mol. Biol., 358, 1137–1151.
28. Xu,S.Y., Zhu,Z., Zhang,P., Chan,S.H., Samuelson,J.C., Xiao,J.,
Ingalls,D. and Wilson,G.G. (2007) Discovery of natural
nicking endonucleases Nb.BsrDI and Nb.BtsI and engineering
of top-strand nicking variants from BsrDI and BtsI.
Nucleic Acids Res., 35, 4608–4618.
29. Morgan,R.D., Calvet,C., Demeter,M., Agra,R. and Kong,H.
(2000) Characterization of the specific DNA nicking activity of
restriction endonuclease N.BstNBI. Biol. Chem, 381, 1123–1125.
30. Higgins,L.S., Besnier,C. and Kong,H. (2001) The nicking
endonuclease N.BstNBI is closely related to type IIs restriction
endonucleases MlyI and PleI. Nucleic Acids Res., 29, 2492–2501.
31. Perevyazova,T.A., Rogulin,E.A., Zheleznaya,L.A. and
Matvienko,N.I. (2003) Cloning and sequencing of the gene of
site-specific nickase N.BspD6I. Biochemistry, 68, 984–987.
32. Yunusova,A.K., Rogulin,E.A., Artyukh,R.I., Zheleznaya,L.A. and
Matvienko,N.I. (2006) Nickase and a protein encoded by an open
reading frame downstream from the nickase BspD6I gene form a
restriction endonuclease complex. Biochemistry, 71, 815–820.
33. Szybalski,W., Kim,S.C., Hasan,N. and Podhajska,A.J. (1991)
Class-IIS restriction enzymes–a review. Gene, 100, 13–26.
34. Wah,D.A., Hirsch,J.A., Dorner,L.F., Schildkraut,I. and
Aggarwal,A.K. (1997) Structure of the multimodular endonuclease
FokI bound to DNA. Nature, 388, 97–100.
35. Wah,D.A., Bitinaite,J., Schildkraut,I. and Aggarwal,A.K. (1998)
Structure of FokI has implications for DNA cleavage.
Proc. Natl Acad. Sci. USA, 95, 10564–10569.
36. Zaremba,M., Urbanke,C., Halford,S.E. and Siksnys,V. (2004)
Generation of the BfiI restriction endonuclease from the
fusion of a DNA recognition domain to a non-specific
nuclease from the phospholipase D superfamily. J. Mol. Biol.,
336, 81–92.
37. Grazulis,S., Manakova,E., Roessle,M., Bochtler,M.,
Tamulaitiene,G., Huber,R. and Siksnys,V. (2005) Structure of
the metal-independent restriction enzyme BfiI reveals fusion of
a specific DNA-binding domain with a nonspecific nuclease.
Proc. Natl Acad. Sci. USA, 102, 15797–15802.
38. Kriukiene,E. (2006) Domain organization and metal ion
requirement of the Type IIS restriction endonuclease MnlI.
FEBS Lett., 580, 6115–6122.
39. Bitinaite,J., Wah,D.A., Aggarwal,A.K. and Schildkraut,I. (1998)
FokI dimerization is required for DNA cleavage. Proc. Natl
Acad. Sci. USA, 95, 10570–10575.
40. Vanamee,E.S., Santagata,S. and Aggarwal,A.K. (2001) FokI
requires two specific DNA sites for cleavage. J. Mol. Biol., 309,
69–78.
41. Skowron,P., Kaczorowski,T., Tucholski,J. and Podhajska,A.J.
(1993) Atypical DNA-binding properties of class-IIS restriction
endonucleases: evidence for recognition of the cognate sequence
by a FokI monomer. Gene, 125, 1–10.
42. Bath,A.J., Milsom,S.E., Gormley,N.A. and Halford,S.E. (2002)
Many type IIs restriction endonucleases interact with two
recognition sites before cleaving DNA. J. Biol. Chem., 277,
4024–4033.
43. Sanders,K.L., Catto,L.E., Bellamy,S.R. and Halford,S.E. (2009)
Targeting individual subunits of the FokI restriction endonuclease
to specific DNA strands. Nucleic Acids Res., 37, 2105–2115.
44. Besnier,C.E. and Kong,H. (2001) Converting MlyI endonuclease
into a nicking enzyme by changing its oligomerization state.
EMBO Rep., 2, 782–786.
45. Xu,Y., Lunnen,K.D. and Kong,H. (2001) Engineering a nicking
endonuclease N.AlwI by domain swapping. Proc. Natl Acad. Sci.
USA, 98, 12990–12995.
46. Armalyte,E., Bujnicki,J.M., Giedriene,J., Gasiunas,G., Kosinski,J.
and Lubys,A. (2005) Mva1269I: a monomeric type IIS restriction
endonuclease from Micrococcus varians with two EcoRI- and
FokI-like catalytic domains. J. Biol. Chem., 280, 41584–41594.
47. Guan,C. and Kumar,S. (2005) A single catalytic domain of the
junction-resolving enzyme T7 endonuclease I is a non-specific
nicking endonuclease. Nucleic Acids Res., 33, 6225–6234.
48. Guan,C., Kumar,S., Kucera,R. and Ewel,A. (2004) Changing
the enzymatic activity of T7 endonuclease by mutations at the
beta-bridge site: alteration of substrate specificity profile and
metal ion requirements by mutation distant from the catalytic
domain. Biochemistry, 43, 4313–4322.
49. Sasnauskas,G., Connolly,B.A., Halford,S.E. and Siksnys,V. (2007)
Site-specific DNA transesterification catalyzed by a restriction
enzyme. Proc. Natl Acad. Sci. USA, 104, 2115–2120.
50. Sasnauskas,G., Halford,S.E. and Siksnys,V. (2003) How the BfiI
restriction enzyme uses one active site to cut two DNA strands.
Proc. Natl Acad. Sci. USA, 100, 6410–6415.
51. Too,P.H., Zhu,Z., Chan,S.H. and Xu,S.Y. (2010) Engineering
Nt.BtsCI and Nb.BtsCI nicking enzymes and applications in
generating long overhangs. Nucleic Acids Res., 38, 1294–1303.
52. Zhu,Z., Samuelson,J.C., Zhou,J., Dore,A. and Xu,S.Y. (2004)
Engineering strand-specific DNA nicking enzymes from the type
IIS restriction endonucleases BsaI, BsmBI, and BsmAI. J. Mol.
Biol., 337, 573–583.
53. Samuelson,J.C., Zhu,Z. and Xu,S.Y. (2004) The isolation of
strand-specific nicking endonucleases from a randomized SapI
expression library. Nucleic Acids Res., 32, 3661–3671.
54. Zhang,P., Too,P.H., Samuelson,J.C., Chan,S.H., Vincze,T.,
Doucette,S., Backstrom,S., Potamousis,K.D., Schramm,T.M.,
Forrest,D. et al. Engineering BspQI nicking enzymes and
application of N.BspQI in DNA labeling and production of
single-strand DNA. Protein Expr. Purif., 69, 226–234.
55. Kachalova,G.S., Rogulin,E.A., Yunusova,A.K., Artyukh,R.I.,
Perevyazova,T.A., Matvienko,N.I., Zheleznaya,L.A. and
Bartunik,H.D. (2008) Structural analysis of the heterodimeric
type IIS restriction endonuclease R.BspD6I acting as a
complex between a monomeric site-specific nickase and a
catalytic subunit. J. Mol. Biol., 384, 489–502.
56. Bellamy,S.R., Milsom,S.E., Scott,D.J., Daniels,L.E., Wilson,G.G.
and Halford,S.E. (2005) Cleavage of individual DNA strands by
the different subunits of the heterodimeric restriction
endonuclease BbvCI. J. Mol. Biol., 348, 641–653.
57. Heiter,D.F., Lunnen,K.D. and Wilson,G.G. (2005) Site-specific
DNA-nicking mutants of the heterodimeric restriction
endonuclease R.BbvCI. J. Mol. Biol., 348, 631–640.
58. Stankevicius,K., Lubys,A., Timinskas,A., Vaitkevicius,D. and
Janulaitis,A. (1998) Cloning and analysis of the four genes coding
for Bpu10I restriction-modification enzymes. Nucleic Acids Res.,
26, 1084–1091.
Nucleic Acids Research, 2011, Vol. 39, No. 1 15
59. Stuckey,J.A. and Dixon,J.E. (1999) Crystal structure of a
phospholipase D family member. Nat. Struct. Biol., 6, 278–284.
60. Lagunavicius,A., Sasnauskas,G., Halford,S.E. and Siksnys,V.
(2003) The metal-independent type IIs restriction enzyme BfiI is a
dimer that binds two DNA sites but has only one catalytic
centre. J. Mol. Biol., 326, 1051–1064.
61. Sasnauskas,G., Zakrys,L., Zaremba,M., Cosstick,R., Gaynor,J.W.,
Halford,S.E. and Siksnys,V. (2010) A novel mechanism for the
scission of double-stranded DNA: BfiI cuts both 30
-50
and 50
-30
strands by rotating a single active site. Nucleic Acids Res., 38,
2399–2410.
62. Jeltsch,A., Alves,J., Wolfes,H., Maass,G. and Pingoud,A. (1993)
Substrate-assisted catalysis in the cleavage of DNA by the EcoRI
and EcoRV restriction enzymes. Proc. Natl Acad. Sci. USA, 90,
8499–8503.
63. Dujon,B. (1989) Group I introns as mobile genetic elements: facts
and mechanistic speculations—a review. Gene, 82, 91–114.
64. Lambowitz,A.M. and Belfort,M. (1993) Introns as mobile genetic
elements. Annu. Rev. Biochem., 62, 587–622.
65. Belfort,M. and Perlman,P.S. (1995) Mechanisms of intron
mobility. J. Biol. Chem., 270, 30237–30240.
66. Belfort,M. and Roberts,R.J. (1997) Homing endonucleases keeping
the house in order. Nucleic Acids Res., 25, 3379–3388.
67. Chevalier,B.S. and Stoddard,B.L. (2001) Homing endonucleases:
structural and functional insight into the catalysts of intron/intein
mobility. Nucleic Acids Res., 29, 3757–3774.
68. Jacquier,A. and Dujon,B. (1985) An intron-encoded protein is
active in a gene conversion process that spreads an intron into a
mitochondrial gene. Cell, 41, 383–394.
69. Stoddard,B.L. (2005) Homing endonuclease structure and
function. Q. Rev. Biophys., 38, 49–95.
70. Chevalier,B., Turmel,M., Lemieux,C., Monnat,R.J. and
Stoddard,B.L. (2003) Flexible DNA target site recognition by
divergent homing endonuclease isoschizomers I-CreI and I-MsoI.
J. Mol. Biol., 329, 253–269.
71. Scalley-Kim,M., McConnell-Smith,A. and Stoddard,B.L. (2007)
Coevolution of homing endonuclease specificity and its host
target sequence. J. Mol. Biol., 372, 1305–1319.
72. Sokolowska,M., Czapinska,H. and Bochtler,M. (2009) Crystal
structure of the beta beta alpha-Me type II restriction
endonuclease Hpy99I with target DNA. Nucleic Acids Res., 37,
3799–3810.
73. Saravanan,M., Bujnicki,J.M., Cymerman,I.A., Rao,D.N. and
Nagaraja,V. (2004) Type II restriction endonuclease R.KpnI is a
member of the HNH nuclease superfamily. Nucleic Acids Res.,
32, 6129–6135.
74. Kaminska,K.H., Kawai,M., Boniecki,M., Kobayashi,I. and
Bujnicki,J.M. (2008) Type II restriction endonuclease R.Hpy188I
belongs to the GIY-YIG nuclease superfamily, but exhibits an
unusual active site. BMC Struct. Biol., 8, 48.
75. Ibryashkina,E.M., Zakharova,M.V., Baskunov,V.B.,
Bogdanova,E.S., Nagornykh,M.O., Den’mukhamedov,M.M.,
Melnik,B.S., Kolinski,A., Gront,D., Feder,M. et al. (2007)
Type II restriction endonuclease R.Eco29kI is a
member of the GIY-YIG nuclease superfamily. BMC Struct.
Biol., 7, 48.
76. Carlson,K. and Wiberg,J.S. (1983) In vivo cleavage of
cytosine-containing bacteriophage T4 DNA to genetically distinct,
discretely sized fragments. J. Virol., 48, 18–30.
77. Kleanthous,C., Kuhlmann,U.C., Pommer,A.J., Ferguson,N.,
Radford,S.E., Moore,G.R., James,R. and Hemmings,A.M. (1999)
Structural and mechanistic basis of immunity toward
endonuclease colicins. Nat. Struct. Biol., 6, 243–252.
78. VanRoey,P., Waddling,C.A., Fox,K.M., Belfort,M. and
Derbyshire,V. (2001) Intertwined structure of the DNA-binding
domain of intron endonuclease I-TevI with its substrate. EMBO
J., 20, 3631–3637.
79. Shen,B.W., Landthaler,M., Shub,D.A. and Stoddard,B.L. (2004)
DNA binding and cleavage by the HNH homing endonuclease
I-HmuI. J. Mol. Biol., 342, 43–56.
80. Mehta,P., Katta,K. and Krishnaswamy,S. (2004) HNH family
subclassification leads to identification of commonality in the
His-Me endonuclease superfamily. Protein Sci., 13, 295–300.
81. Zhao,L., Bonocora,R.P., Shub,D.A. and Stoddard,B.L. (2007)
The restriction fold turns to the dark side: a bacterial homing
endonuclease with a PD-(D/E)-XK motif. EMBO J., 26,
2432–2442.
82. Goodrich-Blair,H., Scarlato,V., Gott,J.M., Xu,M.Q. and
Shub,D.A. (1990) A self-splicing group I intron in the DNA
polymerase gene of Bacillus subtilis bacteriophage SP01. Cell, 63,
417–424.
83. Goodrich-Blair,H. and Shub,D.A. (1996) Beyond homing:
competition between intron endonucleases confers a selective
advantage on flanking genetic markers. Cell, 84, 211–221.
84. Landthaler,M.L. and Shub,D.A. (2003) The nicking homing
endonuclease I-BasI is encoded by a group I intron in the DNA
polymerase gene of the Bacillus thuringiensis phage Bastille.
Nucleic Acids Res., 31, 3071–3077.
85. Landthaler,M., Lau,N.C. and Shub,D.A. (2004) Group I intron
homing in Bacillus phages SP01 and SP82: a gene conversion
event initiated by a nicking homing endonuclease. J. Bacteriol.,
186, 4307–4314.
86. Mueller,J., Smith,D., Bryk,M. and Belfort,M. (1995)
Intron-encoded endonuclease I-TevI binds as a monomer to effect
sequential cleavage via conformational changes in the td homing
site. EMBO J., 14, 5724–5735.
87. VanRoey,P., Meehan,L., Kowalski,J.C., Belfort,M. and
Derbyshire,V. (2002) Catalytic domain structure and hypothesis
for function of GIY-YIG intron endonuclease I-TevI. Nat. Struct.
Biol., 9, 806–811.
88. Mueller,J.E., Smith,D., Bryk,M. and Belfort,M. (1995)
Intron-encoded endonuclease I-TevI binds as a monomer to effect
sequential cleavage via conformational changes in the td homing
site. EMBO J., 14, 5724–5735.
89. Carter,J.M., Friedrich,N.C., Kleinstiver,B. and Edgell,D.R. (2007)
Strand-specific contacts and divalent metal ion regulate
double-strand break formation by the GIY-YIG homing
endonuclease I-BmoI. J. Mol. Biol., 374, 306–321.
90. Kleinstiver,B.P., Fernandes,A.D., Gloor,G.B. and Edgell,D.R.
(2010) A unified genetic, computational and experimental
framework identifies functionally relevant residues of the homing
endonuclease I-BmoI. Nucleic Acids Res., 38, 2411–2427.
91. Chevalier,B., Sussman,D., Otis,C., Noel,A.J., Turmel,M.,
Lemieux,C., Stephens,K., Monnat,R.J. Jr and Stoddard,B.L.
(2004) Metal-dependent DNA cleavage mechanism of the I-CreI
LAGLIDADG homing endonuclease. Biochemistry, 43,
14015–14026.
92. Chevalier,B.S., Monnat,R.J. Jr and Stoddard,B.L. (2001) The
homing endonuclease I-CreI uses three metals, one of which is
shared between the two active sites. Nat. Struct. Biol., 8, 312–316.
93. Moure,C.M., Gimble,F.S. and Quiocho,F.A. (2003) The crystal
structure of the gene targeting homing endonuclease I-SceI reveals
the origins of its target site specificity. J. Mol. Biol., 334,
685–695.
94. Turmel,M., Mercier,J.P., Cote,V., Otis,C. and Lemieux,C. (1995)
The site-specific DNA endonuclease encoded by a group I intron
in the Chlamydomonas pallidostigmatica chloroplast small
subunit rRNA gene introduces a single-strand break at low
concentrations of Mg2+. Nucleic Acids Res., 23, 2519–2525.
95. Perrin,A., Buckle,M. and Dujon,B. (1993) Asymmetrical
recognition and activity of the I-SceI endonuclease on its site
and on intron-exon junctions. EMBO J., 12, 2939–2947.
96. Geese,W.J., Kwon,Y.K., Wen,X. and Waring,R.B. (2003)
In vitro analysis of the relationship between endonuclease and
maturase activities in the bi-functional group I intron-encoded
protein, I-AniI. Eur. J. Biochem., 270, 1543–1554.
97. Silva,G.H. and Belfort,M. (2004) Analysis of the LAGLIDADG
interface of the monomeric homing endonuclease I-DmoI.
Nucleic Acids Res., 32, 3156–3168.
98. Chevalier,B., Sussman,D., Otis,C., Noel,A.J., Turmel,M.,
Lemieux,C., Stephens,K.R.J., Monnat,J. and Stoddard,B.L.
(2004) Analysis of the symmetric metal-dependent I-CreI homing
endonuclease mechanism. Biochemistry, 43, 4015–4026.
99. McConnell Smith,A., Takeuchi,R., Pellenz,S., Davis,L.,
Maizels,N., Monnat,R.J. Jr. and Stoddard,B.L. (2009)
Generation of a nicking enzyme that stimulates site-specific gene
16 Nucleic Acids Research, 2011, Vol. 39, No. 1
conversion from the I-AniI LAGLIDADG homing
endonuclease. Proc. Natl Acad. Sci. USA, 106, 5099–5104.
100. Moure,C.M., Gimble,F.S. and Quiocho,F.A. (2008) Crystal
structures of I-SceI complexed to nicked DNA substrates:
snapshots of intermediates along the DNA cleavage reaction
pathway. Nucleic Acids Res., 36, 3287–3296.
101. Niu,Y., Tenney,K., Li,H. and Gimble,F.S. (2008) Engineering
variants of the I-SceI homing endonuclease with strand-specific
and site-specific DNA-nicking activity. J. Mol. Biol., 382,
188–202.
102. Silva,G.H. and Belfort,M. (2004) Analysis of the LAGLIDADG
interface of the monomeric homing endonuclease I-DmoI.
Nucleic Acids Res., 32, 3156–3168.
103. Kiesling,T., Cox,K., Davidson,E.A., Dretchen,K., Grater,G.,
Hibbard,S., Lasken,R.S., Leshin,J., Skowronski,E. and
Danielsen,M. (2007) Sequence specific detection of DNA using
nicking endonuclease signal amplification (NESA). Nucleic Acids
Res., 35, e117.
104. Murakami,T., Sumaoka,J. and Komiyama,M. (2009) Sensitive
isothermal detection of nucleic-acid sequence by primer
generation-rolling circle amplification. Nucleic Acids Res., 37,
e19.
105. Van Ness,J., Van Ness,L.K. and Galas,D.J. (2003) Isothermal
reactions for the amplification of oligonucleotides. Proc. Natl
Acad. Sci. USA, 100, 4504–4509.
106. Tan,E., Erwin,B., Dames,S., Ferguson,T., Buechel,M., Irvine,B.,
Voelkerding,K. and Niemz,A. (2008) Specific versus
nonspecific isothermal DNA amplification through
thermophilic polymerase and nicking enzyme activities.
Biochemistry, 47, 9987–9999.
107. Tan,E., Erwin,B., Dames,S., Voelkerding,K. and Niemz,A.
(2007) Isothermal DNA amplification with gold
nanosphere-based visual colorimetric readout for herpes simplex
virus detection. Clin. Chem., 53, 2017–2020.
108. Tan,E., Wong,J., Nguyen,D., Zhang,Y., Erwin,B., Van
Ness,L.K., Baker,S.M., Galas,D.J. and Niemz,A. (2005)
Isothermal DNA amplification coupled with DNA
nanosphere-based colorimetric detection. Anal. Chem., 77,
7984–7992.
109. Dean,F.B., Hosono,S., Fang,L., Wu,X., Faruqi,A.F.,
Bray-Ward,P., Sun,Z., Zong,Q., Du,Y., Du,J. et al. (2002)
Comprehensive human genome amplification using multiple
displacement amplification. Proc. Natl Acad. Sci. USA, 99,
5261–5266.
110. Li,J.J., Chu,Y., Lee,B.Y. and Xie,X.S. (2008) Enzymatic signal
amplification of molecular beacons for sensitive DNA detection.
Nucleic Acids Res., 36, e36.
111. Dawson,E.D., Taylor,A.W., Smagala,J.A. and Rowlen,K.L.
(2009) Molecular detection of Streptococcus pyogenes and
Streptococcus dysgalactiae subsp. equisimilis. Mol. Biotechnol.,
42, 117–127.
112. Zheleznaya,L.A., Kopein,D.S., Rogulin,E.A., Gubanov,S.I. and
Matvienko,N.I. (2006) Significant enhancement of fluorescence
on hybridization of a molecular beacon to a target DNA in the
presence of a site-specific DNA nickase. Anal. Biochem., 348,
123–126.
113. Kuhn,H. and Frank-Kamenetskii,M.D. (2008) Labeling of
unique sequences in double-stranded DNA at sites of vicinal
nicks generated by nicking endonucleases. Nucleic Acids Res., 36,
e40.
114. Hosoda,K., Matsuura,T., Kita,H., Ichihashi,N., Tsukada,K.,
Urabe,I. and Yomo,T. (2008) A novel sequence-specific RNA
quantification method using nicking endonuclease, dual-labeled
fluorescent DNA probe, and conformation-interchangeable
oligo-DNA. RNA, 14, 584–592.
115. Jo,K., Dhingra,D.M., Odijk,T., de Pablo,J.J., Graham,M.D.,
Runnheim,R., Forrest,D. and Schwartz,D.C. (2007) A
single-molecule barcoding system using nanoslits for DNA
analysis. Proc. Natl Acad. Sci. USA, 104, 2673–2678.
116. Jo,K., Schramm,T.M. and Schwartz,D.C. (2009) A
single-molecule barcoding system using nanoslits for DNA
analysis: nanocoding. Methods Mol. Biol., 544, 29–42.
117. Xiao,M., Phong,A., Ha,C., Chan,T.F., Cai,D., Leung,L.,
Wan,E., Kistler,A.L., DeRisi,J.L., Selvin,P.R. et al. (2007)
Rapid DNA mapping by fluorescent single molecule detection.
Nucleic Acids Res., 35, e16.
118. Raimondi,S., Johansson,H., Maisonneuve,P. and Gandini,S.
(2009) Review and meta-analysis on vitamin D
receptor polymorphisms and cancer risk. Carcinogenesis, 30,
1170–1180.
119. Mocellin,S. and Nitti,D. (2008) Vitamin D receptor
polymorphisms and the risk of cutaneous melanoma: a
systematic review and meta-analysis. Cancer, 113, 2398–2407.
120. Le Provost,F., Lillico,S., Passet,B., Young,R., Whitelaw,B. and
Vilotte,J.L. (2010) Zinc finger nuclease technology heralds a
new era in mammalian transgenesis. Trends Biotechnol., 28,
134–141.
121. Katada,H. and Komiyama,M. (2009) Artificial restriction DNA
cutters as new tools for gene manipulation. Chembiochem, 10,
1279–1288.
122. Miller,J.C., Holmes,M.C., Wang,J., Guschin,D.Y., Lee,Y.L.,
Rupniewski,I., Beausejour,C.M., Waite,A.J., Wang,N.S.,
Kim,K.A. et al. (2007) An improved zinc-finger nuclease
architecture for highly specific genome editing. Nat. Biotechnol.,
25, 778–785.
123. Lee,G.S., Neiditch,M.B., Salus,S.S. and Roth,D.B. (2004) RAG
proteins shepherd double-strand breaks to a specific pathway,
suppressing error-prone repair, but RAG nicking initiates
homologous recombination. Cell, 117, 171–184.
124. van Nierop,G.P., de Vries,A.A., Holkers,M., Vrijsen,K.R. and
Goncalves,M.A. (2009) Stimulation of homology-directed gene
targeting at an endogenous human locus by a nicking
endonuclease. Nucleic Acids Res., 37, 5725–5736.
125. Wang,H. and Hays,J.B. (2001) Simple and rapid preparation of
gapped plasmid DNA for incorporation of oligomers containing
specific DNA lesions. Mol. Biotechnol., 19, 133–140.
126. Wang,H. and Hays,J.B. (2002) Mismatch repair in human
nuclear extracts. Quantitative analyses of excision of nicked
circular mismatched DNA substrates, constructed by a new
technique employing synthetic oligonucleotides. J. Biol. Chem.,
277, 26136–26142.
127. Stanley,L.K., Seidel,R., van der Scheer,C., Dekker,N.H.,
Szczelkun,M.D. and Dekker,C. (2006) When a helicase is not a
helicase: dsDNA tracking by the motor protein EcoR124I.
EMBO J., 25, 2230–2239.
128. Song,Q., Wu,H., Feng,F., Zhou,G., Kajiyama,T. and
Kambara,H. (2010) Pyrosequencing on nicked dsDNA generated
by nicking endonucleases. Anal. Chem., 82, 2074–2081.
129. Zhou,B., Huang,C., Yang,J., Lu,J., Dong,Q. and Sun,L.Z.
(2009) Preparation of heteroduplex enhanced green fluorescent
protein plasmid for in vivo mismatch repair activity assay.
Anal. Biochem., 388, 167–169.
130. Ang,W.H., Brown,W.W. and Lippard,S.J. (2009) Preparation of
mammalian expression vectors incorporating site-specifically
platinated-DNA lesions. Bioconjug. Chem., 20, 1058–1063.
131. Bitinaite,J., Rubino,M., Varma,K.H., Schildkraut,I., Vaisvila,R.
and Vaiskunaite,R. (2007) USER friendly DNA engineering and
cloning method by uracil excision. Nucleic Acids Res., 35,
1992–2002.
132. Bath,J., Green,S.J. and Turberfield,A.J. (2005) A free-running
DNA motor powered by a nicking enzyme. Angew. Chem. Int.
Ed. Engl., 44, 4358–4361.
133. Ho,K.L., McNae,I.W., Schmiedeberg,L., Klose,R.J., Bird,A.P.
and Walkinshaw,M.D. (2008) MeCP2 binding to DNA depends
upon hydration at methyl-CpG. Mol. Cell, 29, 525–531.
134. Meehan,R.R., Lewis,J.D. and Bird,A.P. (1992) Characterization
of MeCP2, a vertebrate DNA binding protein with affinity for
methylated DNA. Nucleic Acids Res., 20, 5085–5092.
135. Nan,X., Campoy,F.J. and Bird,A. (1997) MeCP2 is a
transcriptional repressor with abundant binding sites in genomic
chromatin. Cell, 88, 471–481.
136. Fomenkov,A., Too,P.H., Chan,S.H., Vaisvila,R., Cantin,B.A.,
Mazzola,L., Tam,V. and Xu,S.Y. (2008) Targeting DNA
5mCpG sites with chimeric endonucleases. Anal. Biochem., 381,
135–141.
Nucleic Acids Research, 2011, Vol. 39, No. 1 17
137. Rauch,T. and Pfeifer,G.P. (2005) Methylated-CpG
island recovery assay: a new technique for the rapid detection
of methylated-CpG islands in cancer. Lab. Invest., 85,
1172–1180.
138. Fodermayr,M., Proll,J., Zach,O., Wechselberger,C. and Lutz,D.
(2009) In vitro detection of methylated DNA via recombinant
protein MBD2b. Mol. Biol. Rep., 36, 1859–1862.
139. Boeke,J., Ammerpohl,O., Kegel,S., Moehren,U. and
Renkawitz,R. (2000) The minimal repression domain of MBD2b
overlaps with the methyl-CpG-binding domain and binds directly
to Sin3A. J. Biol. Chem., 275, 34963–34967.
18 Nucleic Acids Research, 2011, Vol. 39, No. 1