Biomedical Research 31 (6) 401-411, 2010
Mutant p53 R248Q but not R248W enhances in vitro invasiveness of human
lung cancer NCI-H1299 cells
Kazuhito Yoshikawa
1, 2
, Jun-ichi Hamada
2
, Mitsuhiro Tada
2
, Takeshi Kameyama
2, 3
, Koji Nakagawa
2, 4
, Yukiko
Suzuki
2
, Mayumi Ikawa
2
, Nur Mohammad Monsur Hassan
2
, Yoshimasa Kitagawa
1
, and Tetsuya Moriuchi
2
1
Oral Diagnosis and Oral Medicine, Department of Oral Pathological Science, Graduate School of Dental Medicine, Hokkaido University,
Kita-13, Nishi-7, Kita-ku, Sapporo 060-8586; 2
Division of Cancer-Related Genes, Institute for Genetic Medicine, Hokkaido University,
Kita-15, Nishi-7, Kita-ku, Sapporo 060-0815; 3
Geriatric Stomatology, Department of Oral Pathological Science, Graduate School of
Dental Medicine, Hokkaido University, Kita-13, Nishi-7, Kita-ku, Sapporo 060-8586; and 4
Department of Pathophysiology and Therapeutics,
Graduate School of Pharmaceutical Science, Hokkaido University, Kita-12, Nishi-7, Kita-ku, Sapporo 060-0812, Japan
(Received 6 October 2010; and accepted 15 October 2010)
ABSTRACT
More than half of all human cancers are associated with mutations of the TP53 gene. In regard to
the functional interaction with the remaining wild-type (WT) p53 allele, p53 mutations are classified
into two types, recessive and dominant-negative (DN) mutations. The latter mutant protein
has a DN activity over the remaining WT allele. We previously showed that the DN p53 mutant
was useful as a predictor of poor outcome or a risk factor for metastatic recurrence in patients
with some types of cancers, regardless of the presence or absence of loss of heterozygosity (LOH)
of WT p53, suggesting that the DN p53 had ‘gain-of-function (GOF)’ activity besides the transdominance
function. In this study, we investigated GOF activity of two DN p53 mutants which
had a point mutation at codon 248 (R248Q and R248W), one of the hot spots, by transfecting
them respectively into H1299 cells which originally expressed no p53 protein. Growth activity of
the transfectants with the two mutants was not different from that of parent or Mock transfectants.
Meanwhile, in vitro invasions of Matrigel and type I collagen gel by R248Q-transfectants were
significantly higher than those by R248W-transfectants or the control cells. However, there were
no differences in cell motile activities, expressions of extracellular matrix-degradative enzymes
such as matrix metalloproteinases, urokinase-type plasminogen activator and heparanase, and their
inhibitors, between R248Q- and R248W-transfectants. These findings indicate that the p53 mutants
have a different quality in GOF activities even if the mutantions occurred at the same codon. And
detailed information of the status of p53, including transdominancy and GOF activity, is expected
to be useful for diagnosis and therapeutic strategy fitting the individual patients.
TP53 tumor suppressor gene encodes a transcription
factor (p53), which forms homotetramer and binds
to DNA in a sequence-specific manner to transcribe
target genes. It is well known that genotoxic stress
induces the stabilization and activation of the p53
protein, resulting in apoptosis, inhibition of cellcycle
progression, differentiation, senescence, or accelerated
rates of DNA repair (18). More than half
of all human cancers are associated with alterations
of the TP53 gene (7). Most TP53 alterations are
missense mutations, localized in the DNA-binding
domain, and abolish the transcriptional activity via
p53-responsive element. The residues such as R175,
G245, R248, R249, R273 and R282 in the p53 protein
are frequently mutated, which called “hot spots”
(7). In their functional interactions with the remainAddress
correspondence to: Jun-ichi Hamada, Division
of Cancer-Related Genes, Institute for Genetic Medicine,
Hokkaido University, Kita-15, Nishi-7, Kita-ku,
Sapporo 060-0815, Japan
E-mail: jhamada@igm.hokudai.ac.jp
K. Yoshikawa et al.402
F-12) containing 10% fetal bovine serum (FBS).
The cell lines were cultured in CO2 incubator (5%
CO2 and 95% air).
Plasmid construction. Mutant TP53-expressing plasmids
were made by inserting a fragment of the coding
region of TP53 with point mutation into the
pIRES2-AcGFP1 plasmid vector (Clontech, Mountain
View, CA). First, the insert (fragment of p53
codon 1 to 99) was amplified by PCR using pSS16wild
type TP53 (10) template with addition of NheI
and XhoI restriction sites to primers matching those
found in the pIRES2-AcGFP1 vector. The following
primers were used: forward, 5’-TATGCTAGCATG
GAGGAGCCGCAGTC-3’ and reverse, 5’-ATACT
CGAGGAAGGGACAGAAGATGACAGG-3’. Restriction
digest with NheI and XhoI enzymes was
performed on both the insert and vector, followed
by ligation with T4 DNA ligase (pIRES2-AcGFP1
p53 (1-99)). Next, the other insert (fragment of p53
codon 82 to 394) was excised from pSS16 R248Q
(10) and pSS16 R248W (10) respectively by restriction
digest with SgrAI and SacI enzymes. The insert
was ligated into pIRES2-AcGFP1 p53 (1-99) which
had been digested with SgrAI and SacI enzymes
(pIRES2-AcGFP1 p53 R248Q and pIRES2-AcGFP1
p53 R248W). The control vector to pIRES2AcGFP1
p53 R248Q and pIRES2-AcGFP1 p53
R248W was constructed as follows: The DNA fragment
composed of sense DNA (5’-CCGGCGTGAG
CGCCTCCATGAGAGCT-3’) and antisense DNA
(5’-CTCATGGAGGCGCTCACG-3’) was inserted
into pIRES2-AcGFP1 p53 (1-99) which had been
digested with both SgrAI and SacI enzymes. This
control vector was designed to express stop codon
at 84th codon (pIRES2-AcGFP1 p53 (1-83)).
Transfection and cell cloning. H1299 cells were
transfected with pIRES2-AcGFP1 p53 R248Q,
pIRES2-AcGFP1 p53 R248W, or pIRES2-AcGFP1
p53 (1-83) by using Lipofectamine 2000 reagent
(Invitrogen, Carlsbad, CA) according to manufacturer’s
instructions. The stably transfected cells were
selected in the medium containing 250 μg/mL G418
sulfate (Cellgro, Herndon, VA). Cell cloning of the
stable transfectants was performed by picking up a
single grown colony with a small piece of filter paper
containing trypsin/EDTA.
Yeast p53 functional assay. The yeast functional assay
was performed according to our previous method
(5, 24). Colorimetric evaluation of yeast colonies
(red or white colonies) was done after 48 h culture.
ing wild-type (WT) p53 allele, the p53 mutations
are classified into two types, recessive (R) and dominant-negative
(DN) mutations. DN p53 mutants inactivate
the endogenous WT p53 protein in a DN
fashion by forming heterotetramer complex (12, 13).
We previously reported that the DN p53 mutant was
available as a predictor of poor outcome in cancer
patients. For example, in endometrial cancers of
uterus, DN p53 mutation is a strong predictor of
survival of patients since it is often found in advanced
stages and aggressive histologic subtypes
(21). DN p53 mutations are related to early onset of
glioblastoma multiforme (10), and also a risk factor
for metastatic recurrence in patients with oral squamous
cell carcinomas (8). Such correlations between
DN p53 mutations and poor prognosis are found
even in the absence of the WT p53 allele due to
loss of heterozygosity (LOH). These findings suggest
that DN p53 mutations acquire new functions
(“gain-of-function”, GOF) related to malignancy
other than transdominance over WT p53 function.
Indeed, some DN p53 mutants are known to bind to
other transcription factors and to transactivate or repress
specific target genes, such as MYC (6), MDR-1
(22), CD95 (Fas/APO-1) (26), EGR1 (25), and so
on. It is important to understand malignant properties
acquired by GOF activity in each mutation so
that we could make better use of genetic information
for diagnosis and therapy.
　R248 is localized in DNA-binding domain, and is
well known as one of the targets of hot spot mutations.
It is converted into three kinds of amino acid,
R248Q, R248W and R248L, by point mutation in a
variety of cancers (20). Although each of the mutants
is known to inactivate the transactivational
functions of WT p53, its GOF in tumor malignancy
remains obscure. In this study, we enforced the expression
of R248Q or R248W in p53-null human
cancer cells (NCI-H1299) and compared the in vitro
malignant behaviors, especially metastasis-related
properties, between them.
MATERIALS AND METHODS
Cell lines and cell culture. Human non-small cell
lung cancer NCI-H1299 cells were purchased from
American Type Culture Collection (ATCC, Chicago,
IL). Human choriocarcinoma BeWo cells and human
skin squamous cell carcinoma HSC-1 cells were obtained
from Health Science Research Resource Bank
(Sennan, Osaka, Japan). The cells were grown on
Dulbecco’s modified Eagle’s minimum essential medium
and Ham’s F12 medium (D-MEM/Ham’s
Invasion-related p53 mutant 403
Before the assay, Matrigel was rehydrated by adding
D-MEM/Ham’s F-12 into upper and lower compartments
of the invasion chambers for 2 h. The medium
in the upper compartment was replaced into
500 μL of cell suspension (4 × 104
/mL, D-MEM/
Ham’s F-12 supplemented with 10% FBS). Into
the lower compartment of the chamber, 750 μL of
D-MEM/Ham’s F-12 supplemented with 10% FBS
was placed. After 24 h- or 48 h-incubation, each
membrane was fixed with 10% neutral-buffered formalin
and stained in Giemsa solution. After the cells
attached to the upper side of the membrane were removed
by wiping with a cotton swab, those attached
to the lower side of the membrane were counted under
a microscope. Invasiveness of the cells was
evaluated by the number of the cells penetrating the
membrane. Each data was represented as the mean
± SD of triplicate wells. Invasion of type I collagen
gel by tumor cells was performed by using Transwell
chambers with 8 μm pore-membrane (Corning,
Corning, NY). Type I collagen solution (Cellmatrix
type I-A; Nitta Gelatin, Yao, Japan), 10-fold concentrated
D-MEM, NaHCO3/HEPES and FBS were
mixed in volume at 9 : 1 : 1 : 0.5, respectively. The
mixed collagen solution (600 μL) was placed in
each well of 24-well plates, and a Transwell was
placed onto each well. The Transwells were pressed
down to make sure their tight contact with the collagen
solution. After gelation in a CO2 incubator,
100 μL of cell suspension (2 × 105
/mL, D-MEM/F12
containing 10% FBS) was placed into the upper
compartment of each Transwell. After 24 h-incubation
in a CO2 incubator, the Transwell was removed
and the cells in the collagen gel were observed under
an inverted phase-contrast microscope. Invasiveness
was evaluated from the number of cells per
field (× 200). Each data was represented as the
mean ± SD of total 10 fields.
Chemotaxis assay. Chemotaxis assay was performed
by using Transwell chambers. In the lower compartment
of the Transwell chambers, 600 μL of D-MEM/
Ham’s F-12 containing (1) 1 mg/mL of BSA and
10 μg/mL of bovine plasma fibronectin (Sigma, St.
Louis, MO), (2) 1 mg/mL of BSA and 10 μg/mL of
bovine plasma vitronectin (Yagai, Yamagata, Japan),
or (3) 1 mg/mL of BSA and 10 μg/mL of mouse
laminin-1 (Gibco BRL, Grand Island, NY) was
placed, and then 100 μL of cell suspension (2 × 105
/
mL, D-MEM/Ham’s F-12 containing 1 mg/mL of
BSA) was placed into the upper compartment. After
6-h incubation, the assay was terminated, and cell
migratory activity was evaluated in the same manTo
confirm mutations, we collected the pSS16 plasmids
containing a mutant TP53 from red yeast colonies,
and then transfected the plasmids into XL-1
blue E. coli by electroporation. The plasmids were
recovered, purified, and sequenced with BigDye®
Terminator 3.1 Cycle Sequencing Kit (Applied
Biosystems, Foster city, CA) on ABI PRISMS
3100-avant genetic analyzer (Applied Biosystems).
Immunofluorescence. Tumor cells (2.5 × 104
/well)
were seeded on an 8-well chamber slide (Iwaki,
Nagoya, Japan). After overnight incubation, the cells
were fixed in 4% paraformaldehyde for 15 min at
room temperature, permeabilized with 0.1% Triton
X-100 for 5 min, and incubated for blocking with
3% BSA for 10 min. They were sequentially incubated
with a mouse monoclonal antibody to p53
(DO-1; MBL, Nagoya, Japan) for 30 min at room
temperature and with Alexa Fluor 568 goat antimouse
IgG (Invitrogen) as a secondary antibody.
After nuclear staining with DAPI (WAKO, Osaka,
Japan), the cells were analyzed with a Fluoview
FV5000 laser scanning confocal microscope (Olympus,
Melville, NY).
Cell proliferation assay. Cell proliferation assay was
performed by using a colorimetric crystal violetstaining
procedure (9) with modification. Tumor
cells were seeded on a 96-well plate in D-MEM/
Ham’s F-12 supplemented with 10% FBS. One and
3 days after the cell seeding, the medium was removed
and all the wells were washed twice with
50 μL/well PBS. The cells were then fixed with
50 μL/well 5% glutaraldehyde for 30 min. The fixative
was removed and the cells were stained with
50 μL/well 50 mM 3-Cyclohexylamino-1-propanesulfonic
acid (CAPS) buffered solution containing
0.1% crystal violet for 30 min. The wells were then
washed with MilliQ water, dried, and the stained
cells were solubilized with 50 μL/well 10% acetic
acid for 15 min. For determining the cell number
the absorbance of each well was measured at 590 nm
on Microplate reader (Bio-Rad Laboratory, Hercules,
CA). Each data was represented as the mean ± SD
of triplicate wells. Absorbance values obtained by
crystal violet assay were linearly correlated with
cell numbers within a range from 100 cells/well to
20,000 cells/well.
In vitro invasion assay. We carried out two types of
in vitro invasion assays in this study (14). Matrigel
invasion assay was performed by using a Matrigel
invasion chamber (BD Biosciences, Bedford, MA).
K. Yoshikawa et al.404
ysis (95°C for 15 s, 60°C for 15 s 95°C 15 s) was
performed at the end of the 40 cycles to verify the
PCR product identity. Data were collected and analyzed
with Sequence Detector Systems version 2.0
software (Applied Biosystems). The relative mRNA
expression data were normalized to β-actin. The sequences
of primers for MMPs, TIMPs, and RECK
were as previously reported (1).
Conventional RT-PCR. Total RNA was extracted as
described above. PCR amplification was performed
in 20 μL reaction mixture containing 1 μL cDNA
sample, 4 μL 5 × Green Go Taq Reaction Buffer
2 μL, 2.5 mM dNTPs Mix, 0.1 μL Go Taq polymerase
(Promega, Madison, WI) and with specific
primer sets (5 μM each). PCR products were electrophoresed
in a 2% agarose gel and photographed
under ultraviolet light. Each primer was designed to
encompass an exon junction for prevention of templating
possibly contaminated genomic DNA. These
sense/antisense primers for PCR were designed as
follows; (a) urokinase-type plasminogen activator
(uPA), 5’-GCCATCCCGGACTATACAGA-3’/ 5’-G
TCAGCAGCACACAGCATTT-3’; (b) urokinasetype
plasminogen activator receptor (uPAR), 5’-TTA
CCTCGAATGCATTTCCT-3’/ 5’-TTGCACAGCC
TCTTACCATA-3’; (c) Plasminogen activator inhibitor-1
(PAI-1), 5’-CAGCAGATTCAAGCAGCTAT
G-3’/ 5’-TGTGTGTGTCTTCACCCAGTC-3’; (d)
Heparanase (HPSE), 5’- ACTGGCAATCTCAAGTC
AACCA -3’/ 5’- GCTCTCAACCACCTGGAAAAC
T-3’; (e) Glyceraldehyde-3-phosphate dehydrogenase
(G3PDH), 5’-TGAAGGTCGGAGTCAACGGAT
TTGGT-3’/5’-CATGTGGGCCATGAGGTCCAC
CAC-3’.
RESULTS
Establishment of DN mutant p53-expressing cell lines
To uncover the function of mutant TP53 in tumor
malignancy, we stably transfected NCI-H1299 cells
which expressed no p53 protein, with mutant TP53
expression vector, pIRES2-AcGFP1 p53 R248Q or
pIRES2-AcGFP1 p53 R248W. For control, the cell
line was transfected with pIRES2-AcGFP1 p53
(1-83) which encoded codon 1 to 83 of p53 protein.
These vectors contain the internal ribosome entry
sites (IRES) of the encephalomyocarditis virus between
the multi-cloning site and the AcGFP1 (green
fluorescence protein derived from Aequorea coeruelescens)
coding region, which permits both the gene
of p53 and the AcGFP1 gene to be translated from
a single bicistronic mRNA; therefore, the expression
ner as the invasion assay.
In vitro wound-healing assay. For measuring cell
migrating activity, in vitro wound-healing assay was
carried out according to the method described in our
previous report (17) with some modification. Briefly,
confluent cell monolayers were obtained after 36-h
culture in D-MEM/Ham’s F-12 supplemented with
10% FBS. They were gently scratched with a Gilson
pipette yellow tip, and extensively rinsed with
D-MEM to remove all cellular debris. This procedure
left a cell-free area of substratum (‘wound’).
Then the cultures were observed with a phasecontrast
inverted microscope and photographed.
Western blot analysis. Tumor cells were seeded at a
density of 5 × 105
/100-mm dish in D-MEM/Ham’s
F-12 supplemented with 10% FBS. After 24-h incubation,
the cells were washed with 10 mL of cold
PBS, and then harvested with a cell scraper in lysis
buffer [50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1%
NP40 containing 2% Complete mini (EDTA-free)
Protease inhibitor cocktail Tablets] (Roche, Indianapolis,
IN). The cell lysates were centrifuged at
17,400 × g for 15 min at 4°C. The supernatants were
collected, and subjected to SDS-PAGE in 10% polyacrylamide
gel and electrotransferred to Immobilon
membranes (Millipore, Bedford, MA). The membranes
were blocked in TBS-T (20 mM Tris-HCl,
pH 7.5, 137 mM NaCl, 0.6% Tween 20) with 10%
skim milk for 1 h at room temperature, and then incubated
with primary antibodies (p53 DO-1; MBL)
for 1 h at room temperature. The membrane was
next incubated with horseradish peroxidase (HRP)conjugated
antibody to mouse IgG for 1 h at room
temperature. Antigen-antibody complexes were visualized
with Chemiluminescent HRP Substrate (Mil-
lipore).
RNA preparation and quantative real-time RT-PCR.
Total RNA was extracted from 5 × 105
cells by using
TRIzol reagent (Invitrogen). Reverse transcription
was done for 1.5 μg total RNA, and the cDNA
was synthesized by using Taqman Reverse Transcription
Reagents (Applied Biosystems). Real-time
PCR amplification was performed on 10 μL reaction
mixture containing 1 μL cDNA sample, 5 μL Quanti
Fast SYBER Green Master Mix (QIAGEN, Valencia,
CA) and with specific primer sets. PCR was
carried out in a 7900 HT thermal cycler (Applied
Biosystems, Warrington, UK) under the following
conditions: 95°C for 5 min; then 40 cycles at 95°C
for 10 s, and 61°C for 30 s. Dissociation curve anal-
Invasion-related p53 mutant 405
Fig. 1　Expressions of mutant TP53 in H1299 cells transfected with mutant TP53 expression plasmid vectors. (A) Transfection
efficiency of the mutant TP53 expression vector (pTP53-R248Q or pTP53-R248W) or the control vector (pIRES2AcGFP1-Δp53)
into H1299 cells. The cells were observed under a phase contrast or a fluorescence inverted microscope
24 h after the transfection. The transfection efficiencies of pIRES2-AcGFP1-p53(1-83), pIRES2-AcGFP1 p53-R248Q and
pIRES2-AcGFP1 p53-R248W were 87.5%, 94.2% and 90.4%, respectively. Scale bars represent 400 μm. (B) Western blot
analysis of mutant TP53 expression in the transfected cells. Proteins were extracted from the cells 24 h after the transfection
with the expression vectors. (C) Yeast p53 functional assay of the cells transfected with pIRES2-AcGFP1 p53-R248Q or
pIRES2-AcGFP1 p53-R248W, BeWo cells with wild type TP53 and HSC-1 cells with mutant TP53. In this assay, yeast expressing
mutant TP53 forms red colonies whereas that expressing wild type TP53 forms white colonies. (D) Laser confocal
microscopic observation of mutant p53 proteins in the parental, Mock-transfectant, and mutant TP53 transfectant
NCI-H1299 cells. P53 proteins were visualized by indirect immunofluorescent staining using anti-p53 antibody and Alexa
Fluor 568-conjugated anti-mouse IgG antibody. P53 proteins were localized in nuclei of the cells transfected with pIRES2AcGFP1
p53-R248Q or pIRES2-AcGFP1 p53-R248W. Scale bars represent 10 μm.
K. Yoshikawa et al.406
of mutant TP53 can be monitored by observing
fluorescence of AcGFP1 under a fluorescence microscope.
As shown in Fig. 1a, AcGFP1-positive were
87.5% of the cells transfected with pIRES2-AcGFP1
p53 (1-83) (Mock-transfectant), 94.2% of those
transfected with pIRES2-AcGFP1 p53 R248Q
(R248Q-transfectant), and 90.4% of those transfected
with pIRES2-AcGFP1 p53 R248W (R248Wtransfectant),
indicating that these transfectants also
expressed mutant TP53 at similarly high rates. After
the transfection, the cells were cultured in the presence
of G418 sulfate for obtaining stably cloned
transfectants: two cell lines cloned from Mocktransfectants
were named Mock-3 and Mock-4; two
cell lines from R248Q-transfectants, R248Q-4 and
R248Q-7; two cell lines from R248W-transfectants,
R248W-5 and R248W-6. We next examined by
RT-PCR and Western blot analyses whether the
transfectants expressed TP53 gene. These analyses
showed that the transfectants with pIRES2-AcGFP1
p53 R248Q or pIRES2-AcGFP1 p53 R248W, but
neither parental nor the transfectants with pIRES2AcGFP1
p53 (1–83), expressed p53 protein (Fig. 1B).
We further analyzed by yeast p53 functional assay
to confirm that the former two transfectants produced
mutant p53 proteins. The yeast p53 functional
assay is a useful assay to evaluate the functional
status of p53 protein by colony color (14). Namely,
a yeast strain (yIG397) contains an integrated plasmid
with a p53-responsive promoter-driving ADE2
gene expression; this strain, containing wild-type
p53, activates ADE2 transcription and forms a white
colony whereas a strain containing mutant p53 fails
to activate ADE2 transcription and forms a red colony.
As shown in Fig. 1C, the yeast which was transformed
with plasmid containing cDNA obtained
from TP53 transcripts of the transfectants with
pIRES2-AcGFP1 p53 R248Q or pIRES2-AcGFP1
p53 R248W formed red colonies. We further confirmed
by sequence analysis that pSS16-based plasmids
obtained from the yeast forming red colonies
contained mutant TP53 R248Q or R248W (data not
shown).
Intracellular localization of p53 in R248Q cells and
R248W cells
We next observed intracellular localization of p53
mutant proteins in R248Q- and R248W-transfected
cells under a laser confocal microscope. Rightly,
p53 was not detected in parental H1299 cells or
Mock cells. In R248Q- and R248W-transfectants,
the p53 proteins were observed in nuclei (Fig. 1D).
Proliferative activity of NCI-H1299 cells expressing
mutant p53
We first investigated the proliferative activity of
NCI-H1299 cells expressing mutant p53 by using a
colorimetric crystal violet-staining method. The cells
were cultured in the presence of 1% or 10% FBS.
The assay was performed 1 and 3 days after the cell
seeding. There was no significant difference in proliferative
activity among the parent cells, the mocktransfectants,
R248Q-transfectants and R248Wtransfectants
regardless of the difference of FBS
concentration (Fig. 2).
Invasive activity of NCI-H1299 cells expressing mutant
p53
To examine whether mutant p53 affected the invasive
activity of H1299 cells, we carried out the in
vitro invasion assay using Matrigel invasion chambers.
Uncloned R248Q-transfectants showed significantly
high invasive activity compared to the parent
cells, mock-transfectants or R248W-transfectants in
assay of a 24 h-incubation (P < 0.01, by Student’s
t-test) (Fig. 3A). Cloned R248Q-transfectants also
Fig. 2　Mutant TP53 does not affect the proliferation of
NCI-H1299 cells. The cells (2 × 103
/well) were seeded on
96-well tissue culture plates. Cell proliferation assay was
performed 1 and 3 days after the cell seeding. Data represent
the mean ± SD of triplicate samples.
Invasion-related p53 mutant 407
activity of the two R248Q-transfectants was not always
higher than that of any other cells (Fig. 5A
and 5B).
Expressions of extracellular matrix-degradative enzymes
and their inhibitors in NCI-H1299 cells expressing
mutant p53
We next analyzed the expressions of extracellular
matrix (ECM)-degradative enzymes and their inhibitors
to determine whether enhanced invasiveness of
R248Q-transfectants was due to alteration in those.
The expression levels of 14 matrix metalloproteinases
(MMPs), 4 tissue inhibitors of MMP (TIMP), and
reversion-inducing cysteine-rich protein with Kazal
motifs (RECK) were quantified by a real-time RT-PCR
method. As shown in Fig. 6A, there was no particular
gene of which expression was altered by p53
R248Q expression in NCI-H1299 cells. The expression
levels of ECM-degradative enzymes and their
inhibitors such as uPA, uPAR, PAI-1 and HPSE in
R248Q-transfectants did not differ from those in
parent cells or other transfectants (Fig. 6B).
showed higher invasiveness than the parent cells or
other transfectants (P < 0.01, by Student’s t-test)
(Fig. 3B). We next examined the invasion of type I
collagen gel by the mutant TP53-transfectants. As
shown in Fig. 3C and D, R248Q-transfectants had
high potential to invade type I collagen gel compared
to the parent cells or other transfectants regardless
of the presence or absence of FBS in the
assay system (P < 0.01, by Student’s t-test).
Migratory activity of NCI-H1299 cells expressing
mutant p53
Cell migratory activity and Matrigel degradation are
essential for the cells to invade Matrigel. Therefore,
we performed chemotaxis assay and in vitro wound
healing assay to determine whether enhanced invasiveness
of R248Q-transfectants was due to an
increase in cell migratory activity. There was no significant
difference in chemotactic activity between
the R248Q-transfectants and other cells regardless
of the chemoattractants (fibronectin, vitronectin, or
laminin-1) (Fig. 4A, 4B and 4C). The result of in vitro
wound healing assay showed that the migratory
Fig. 3　Invasiveness of parental H1299 cells and the transfectant cells. (A) Invasion of Matrigel by mutant TP53-transfected
cells prior to cell cloning. (B) Invasion of Matrigel by cloned cells transfected with mutant TP53. (C) Invasion of type I collagen
gel in the presence of 10% FBS by cloned cells transfected with mutant TP53. (D) Invasion of type I collagen gel in
the absence of FBS by cloned cells transfected with mutant TP53. *Statistically significant difference compared to the parental,
Mock-transfected and pIRES2-AcGFP1 p53-R248W-transfected cells (P < 0.01 by Student’s t-test).
K. Yoshikawa et al.408
different in vitro malignant properties.
　We have previously reported that both R248Q
and R248W p53 mutants lacked sequence-specific
DNA binding and inhibited transactivation of p73beta
which is one of p53 family members (10, 15). There
are some reports indicating that R248W mutant
reduced the transcriptional activity of p73alpha (4)
or p63 (23) although R248Q mutant was not examined
there. Thus there is no evidence, so far, to elucidate
the functional difference between R248Q and
R248W p53 mutants in H1299 transfectants. Noskov
et al. showed a difference of protein structure
between R248Q and R248W mutants by using molecular
dynamics simulations (16). They indicated
that R248Q did not bind to the DNA sequences recognized
by wild type p53 mainly due to the loss of
DISCUSSION
Mutations most frequently occur in the TP53 gene,
encoding the p53 tumor suppressor, in human cancers.
It is well known that p53 mutations result not
only in loss of anti-oncogenic activities but also in
trans-dominant inactivation of the remaining wildtype
p53 (19). In addition, several p53 mutants acquire
novel oncogenic functions (GOF) (3). In the
present study, we examined the contribution of p53
mutations occurred at codon 248 to in vitro malignant
properties of tumor cells through the GOF
properties. And we found that R248Q but not
R248W mutation conferred more invasive potential
on p53-null H1299 cells. It is for the first time to
reveal that the distinct mutations, even if the mutations
occurred at the same codon, gave tumor cells
Fig. 4　Migratory activities of parental and the transfectant
cells toward fibronectin, vitronectin or laminin-1 in a chemotaxis
assay. Chemotaxis assay was performed for 6 h by
using Transwell chambers. Chemotactic activity of the parental,
mutant TP53-transfected, and Mock-transfected cells
toward fibronectin (A), vitronectin (B) and laminin-1 (C).
Fig. 5　Migratory activities of parental H1299 cells and
transfectant cells in an in vitro wound-healing assay. (A) Microphotographs
of monolayer cultures of cloned R248Qtransfected
(R248Q-7), R248W-transfected (R248W-6) and
Mock-transfected (Mock-4), and parental cells at 0, 12 and
24 h after the scratching the monolayers with a pipet tip.
Scale bars represent 500 μm. (B) Chronological changes of
distances between two “wound” edges. Data represent the
mean ± SD of 10 sites where the distances were measured
with a micrometer.
Invasion-related p53 mutant 409
that each mutant regulates the transcription of different
kinds of genes, which results in the different
invasiveness.
　We speculated that the R248Q mutant acquired a
new function as a transcription factor which regulated
the expressions of invasion-related genes, since
the mutant protein was observed only in the nuclei
of H1299 transfectants. Therefore, we compared
major groove contacts from K120, besides due to
unfavorable interactions of D281, whereas R248W
did not mainly due to the loss of minor groove
contacts from the mutant residue itself. Recently
Merabet et al. also reported the structural and biochemical
difference between R248Q and R248W
(11). Such a difference of structural changes by substitution
of one amino acid indicates the possibility
Fig. 6　Expressions of matrix metalloproteinases (MMPs) and their inhibitors in parental H1299 cells and the transfectant
cells. (A) The relative levels of mRNA of MMPs and their inhibitors were determined by a real-time RT-PCR method. (B) Expression
levels of mRNA of urokinase-type plasminogen activator (uPA), uPA receptors (uPAR), plasminogen activator inhibitor-1
(PAI-1), heparanase (HPSE), and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) in parental H1299 cells and
the transfectant cells. The expression levels were analyzed by a RT-PCR method. The PCR products were electrophoresed
and stained with ethidium bromide. 1: parent, 2: Mock-3, 3: Mock-4, 4: R248Q-4, 5: R248Q-7, 6: R248W-5, 7: R248W-6.
K. Yoshikawa et al.410
changes of phenotypes and expressions of genes related
to invasion between R248Q- and R248Wtransfectants;
we analyzed especially cell motility
and the expressions of genes involved in degradation
of ECM. There was no difference between
R248Q- and R248W-transfectants in cell motility
which was measured by chemotaxis and wound
healing assays. It suggests that enhancement of invasiveness
by the expression of R248Q was not due
to an increase in cell motile activity. We next examined
the involvement of an increased ability to digest
the components of ECM in the invasiveness
enhanced by R248Q. Unfortunately, however, we
could not find R248Q-specific changes in the expressions
of the genes related to ECM-degradation
such as MMPs, uPA and heparanase, and their inhibitors
such as TIMPs, RECK and PAI-1. From
these findings, we cannot so far identify any specific
invasion-related molecules of which expressions or
functions are regulated by R248Q but not R248W.
It is further necessary to monitor effects of R248Qtransduction
on a global gene expression by using a
cDNA microarray or a tiling array combined with
chromatin-immunoprecipitation in order to discover
the molecules involved in R248Q-dependent invasion.
Overall, the findings here indicate that the activity
of GOF of p53 mutants is different even if the
mutations occur at the same codon and that the status
of p53 including the GOF activity as well as
transdominancy should be considered in diagnosis
and therapy.
Acknowledgement
The authors thank Ms. Yanome for her help in preparing
the manuscript. The authors have no financial
relationships to disclose.
REFERENCES
  1.	 Asano T, Tada M, Cheng S, Takemoto N, Kuramae T, Abe M,
Takahashi O, Miyamoto M, Hamada J, Moriuchi T and
Kondo S (2008) Prognostic values of matrix metalloproteinase
family expression in human colorectal carcinoma. J Surg
Res 146, 32–42.
  2.	 Brachmann RK, Vidal M and Boeke JD (1996) Dominantnegative
p53 mutations selected in yeast hit cancer hot spots.
Proc Natl Acad Sci USA 93, 4091–4095.
  3.	 Brosh R and Rotter V (2009) When mutants gain new powers:
news from the mutant p53 field. Nat Rev Cancer 9, 701–
713.
  4.	 Di Como CJ, Gaiddon C and Prives C (1999) p73 function is
inhibited by tumor-derived p53 mutants in mammalian cells.
Mol Cell Biol 19, 1438–1449.
  5.	 Flaman JM, Frebourg T, Moreau V, Charbonnier F, Martin C,
Chappuis P, Sappino AP, Limacher IM, Bron L, Benhattar J,
Tada M, VanMeir EG, Estreicheru A and Iggo RD (1995) A
simple p53 functional assay for screening cell lines, blood,
and tumors. Proc Natl Acad Sci USA 92: 3963–3967.
  6.	 Frazier MW, He X, Wang J, Gu Z, Cleveland JL and
Zambetti GP (1998) Activation of c-myc gene expression by
tumor-derived p53 mutants requires a discrete C-terminal domain.
Mol Cell Biol 18, 3735–3743.
  7.	 Hainaut P and Hollstein M (2000) p53 and human cancer:
the first ten thousand mutations. Adv Cancer Res 77, 81–137.
  8.	 Hassan NM, Tada M, Hamada J, Kashiwazaki H, Kameyama
T, Akhter R, Yamazaki Y, Yano M, Inoue N and Moriuchi T
(2008) Presence of dominant negative mutation of TP53 is a
risk of early recurrence in oral cancer. Cancer Lett 270, 108–
119.
  9.	 Kueng W, Silber E and Eppenberger U (1989) Quantification
of cells cultured on 96-well plates. Anal Biochem 182, 16–
19.
10.	 Marutani M, Tonoki H, Tada M, Takahashi M, Kashiwazaki H,
Hida Y, Hamada J, Asaka M and Moriuchi T (1999) Dominant-negative
mutations of the tumor suppressor p53 relating
to early onset of glioblastoma multiforme. Cancer Res 59,
4765–4769.
11.	 Merabet A, Houlleberghs H, Maclagan K, Akanho E, Bui TT,
Pagano B, Drake AF, Fraternali F and Nikolova PV (2010)
Mutants of the tumour suppressor p53 L1 loop as second-site
suppressors for restoring DNA binding to oncogenic p53 mutations:
structural and biochemical insights. Biochem J 427,
225–236
12.	 Milner J and Medcalf EA (1991) Cotranslation of activated
mutant p53 with wild type drives the wild-type p53 protein
into the mutant conformation. Cell 65, 765–774.
13.	 Milner J, Medcalf EA and Cook AC (1991) Tumor suppressor
p53: analysis of wild-type and mutant p53 complexes.
Mol Cell Biol 11, 12–19.
14.	 Miyazaki YJ, Hamada J, Tada M, Furuuchi K, Takahashi Y,
Kondo S, Katoh H and Moriuchi T (2002) HOXD3 enhances
motility and invasiveness through the TGF-beta-dependent
and -independent pathways in A549 cells. Oncogene 21,
798–808.
15.	 Monti P, Campomenosi P, Ciribilli Y, Iannone R, Aprile A,
Inga A, Tada M, Menichini P, Abbondandolo A and Fronza
G (2003) Characterization of the p53 mutants ability to
inhibit p73 beta transactivation using a yeast-based functional
assay. Oncogene 22, 5252–5260.
16.	 Noskov SY, Wright JD and Lim C (2002) Long-range effects
of mutating R248 to Q/W in the p53 core domain. J Phys
Chem 106, 13047–13057.
17.	 Ohta H, Hamada J, Tada M, Aoyama T, Furuuchi K,
Takahashi Y, Totsuka Y and Moriuchi T (2006) HOXD3overexpression
increases integrin alpha v beta 3 expression
and deprives E-cadherin while it enhances cell motility in
A549 cells. Clin Exp Metastasis 23, 381–390.
18.	 Oren M (2003) Decision making by p53: life, death and cancer.
Cell Death Differ 10, 431–442.
19.	 Petitjean A, Achatz MI, Borresen-Dale AL, Hainaut P and
Olivier M (2007) TP53 mutations in human cancers: functional
selection and impact on cancer prognosis and outcomes.
Oncogene 26, 2157–2165.
20.	 Petitjean A, Mathe E, Kato S, Ishioka C, Tavtigian SV,
Hainaut P and Olivier M (2007) Impact of mutant p53 functional
properties on TP53 mutation patterns and tumor phenotype:
lessons from recent developments in the IARC TP53
database. Hum Mutat 28, 622–629.
21.	 Sakuragi N, Watari H, Ebina Y, Yamamoto R, Steiner E,
Invasion-related p53 mutant 411
Koelbl H, Yano M, Tada M and Moriuchi T (2005) Functional
analysis of p53 gene and the prognostic impact of dominant-negative
p53 mutation in endometrial cancer. Int J
Cancer 116, 514–519.
22.	 Sampath J, Sun D, Kidd VJ, Grenet J, Gandhi A, Shapiro
LH, Wang Q, Zambetti GP and Schuetz JD (2001) Mutant
p53 cooperates with ETS and selectively up-regulates human
MDR1 not MRP1. J Biol Chem 276, 39359–39367.
23.	 Strano S, Fontemaggi G, Costanzo A, Rizzo MG, Monti O,
Baccarini A, Del Sal G, Levrero M, Sacchi A, Oren M and
Blandino G (2002) Physical interaction with human tumorderived
p53 mutants inhibits p63 activities. J Biol Chem 277,
18817–18826.
24.	 Tada M, Iggo RD, Ishii N, Shinohe Y, Sakuma S, Estreicher A,
Sawamura Y and Abe H (1996) Clonality and stability of the
p53 gene in human astrocytic tumor cells: quantitative analysis
of p53 gene mutations by yeast functional assay. Int J
Cancer 67, 447–450.
25.	 Weisz L, Zalcenstein A, Stambolsky P, Cohen Y, Goldfinger N,
Oren M and Rotter V (2004) Transactivation of the EGR1
gene contributes to mutant p53 gain of function. Cancer Res
64, 8318–8327.
26.	 Zalcenstein A, Stambolsky P, Weisz L, Müller M, Wallach D,
Goncharov TM, Krammer PH, Rotter V and Oren M (2003)
Mutant p53 gain of function: repression of CD95(Fas/APO-1)
gene expression by tumor-associated p53 mutants. Oncogene
22, 5667–5676.