Rapid detection and differentiation of the exfoliative toxin A-producing
Staphylococcus aureus strains based on ϕETA prophage polymorphisms
Pavla Holochováa
, Vladislava Růžičkováa,⁎, Lucie Dostálováa
, Roman Pantůčeka
,
Petr Petrášb
, Jiří Doškařa
a
Faculty of Science, Department of Genetics and Molecular Biology, Institute of Experimental Biology, Masaryk University, 611 37 Brno, Czech Republic
b
Reference Laboratory for Staphylococci, National Institute of Public Health, 100 42 Prague, Czech Republic
Received 9 June 2009; accepted 7 October 2009
Abstract
The exfoliative toxin A (ETA) is encoded by the gene located on Staphylococcus aureus prophages. We have developed a single-reaction
multiplex polymerase chain reaction (PCR) assay for rapid and specific detection of various ϕETA prophages of serogroup B responsible for
dissemination of eta gene and ETA production in clinical strains. This PCR strategy enabled to classify the ETA-positive strains into 6
groups designated ETA-B1, ETA-B2, ETA-B3, ETA-B4, ETA-B5, and ETA-B6. The method was tested on a diverse set of 101 ETA and/or
ETB-positive S. aureus strains isolated in 22 Czech maternity hospitals and 1 Slovak maternity hospital between 1998 and 2009. This novel
PCR strategy is reliable in the rapid identification of yet undescribed ETA-converting B prophages and differentiation of the closely related
ETA-positive strains, and it is a convenient tool for hospital epidermolytic infection control.
© 2010 Elsevier Inc. All rights reserved.
Keywords: Staphylococcus aureus; Pemphigus neonatorum; Exfoliative toxin A; Prophages; Multiplex PCR
1. Introduction
Exfoliative toxin (ET) produced by Staphylococcus
aureus strains is the major causative agent of blistering
skin disorders, the most severe of them being staphylococcal
scalded skin syndrome (SSSS) that primarily affects
neonates and young children (Ladhani et al., 1999; Plano,
2004). Serologically, this toxin isolated from human strains
has been divided into 3 isoforms, the most frequently
occurring ETA and ETB toxins (Kondo et al., 1975;
Růžičková et al., 2003) and much less frequently occurring
ETD toxin (Yamaguchi et al., 2002). A fourth ETC was
isolated from a horse strain of S. aureus (Sato et al., 1994);
however, it has not been associated with human disease. The
eta gene encoding ETA is located on a prophage that is
integrated into the S. aureus chromosome. To date, a few
ETA phages have been induced from bacterial cells and
found capable of transferring the eta gene into a prophageless
strain (Endo et al., 2003; Yamaguchi et al., 2000;
Yoshizawa et al., 2000).
Between 1998 and 1999, the ETA-producing S. aureus
strains responsible for 2 outbreaks of pemphigus neonatorum
in the Czech maternity hospitals were genotyped and
examined for the content of prophages of serogroups A, B,
and F. Analysis of the prophage carriage revealed the
presence of at least 1 prophage in all strains (Růžičková et
al., 2003). Prophages of serogroup B significantly predominated
over the other prophages. Identification of
several monolysogenic ETA-positive strains harboring
single B prophage indicates that the eta gene is carried by
a B phage. Because closely related strains can contain
different ETA-converting prophages, their detection and
characterization is very important for diagnostics of the
strains responsible for outbreaks of SSSS or other forms of
toxic epidermolytic diseases.
There have been several reports describing the use of
molecular typing methods for characterization of ETAvailable
online at www.sciencedirect.com
Diagnostic Microbiology and Infectious Disease 66 (2010) 248–252
www.elsevier.com/locate/diagmicrobio
⁎ Corresponding author. Tel.: +420-5-49496827; fax: +420-5-
49492570.
E-mail address: vladkar@sci.muni.cz (V. Růžičková).
0732-8893/$ – see front matter © 2010 Elsevier Inc. All rights reserved.
doi:10.1016/j.diagmicrobio.2009.10.008
positive S. aureus strains (Dave et al., 1994; Mackenzie
et al., 1995; Růžičková et al., 2003; Saiman et al., 1998) and
polymerase chain reaction (PCR) for detection of 3 ET genes
(Mehrotra et al., 2000; Růžičková et al., 2005). PCRs have
been used to determine the genetic changes of strains
lysogenized by ETA-converting phages (Endo et al., 2003;
Yamaguchi et al., 2000), but rapid PCR genotyping of strains
based on detection of the different eta gene-positive B
prophages has not yet been described.
In this article, we report the novel multiplex PCR assay
for detection of the 6 types of B prophages carrying the eta
gene. The ability of this PCR assay was verified on a set of
101 ET-producing clinical S. aureus strains, which were
isolated in 22 Czech maternity hospitals and 1 Slovak
maternity hospital. Our objective was to make up a multiplex
PCR method allowing a rapid genotyping of S. aureus
strains containing different ETA-converting prophages.
2. Materials and methods
2.1. Bacterial strains and culture conditions
A collection of 101 ET-positive S. aureus strains (72
isolates from skin blisters, 3 from stool of neonatal patients;
5 from expectant mothers; 14 of nurse hands; 7 from
hospital equipment) were isolated in the 23 maternity
hospitals in which cases of mass pemphigus neonatorum
have occurred. These strains were collected by the National
Reference Laboratory for Staphylococci, Prague, Czech
Republic, in which they had been previously defined by
virtue of their respective ET production by Reverse Passive
Latex Agglutination Kit (Denka Seiken for Unipath, Tokyo,
Japan). Seventy strains were ETA producers, 19 produced
both ETA and ETB, and 12 of the strains synthesized only
ETB. The following reference S. aureus strains were used:
ETA-producing strains CCM 2330 (prophage ETA-B4
positive) and CCM 7057 (ETA-B1 positive), ETA- and
ETB-producing strain CCM 7056 (ETA-B1 positive), and
ETA- and ETD-producing strain CCM 2331 (ETA-B6
positive). The strains S. aureus NCTC 8325 and the
prophageless S. aureus 1039 were used as the eta genenegative
controls. All the reference CCM strains were
obtained from the Czech Collection of Microorganisms,
Brno, Czech Republic. The strain NCTC 8325 was obtained
from Prof P.A. Pattee, of the Iowa State University in
Ames, IA, and the strain S. aureus 1039 from Dr Y.
Yoshizawa (Jikei University School of Medicine, Tokyo,
Japan). A collection of 30 methicillin-resistant S. aureus
strains (all containing the eta gene-negative prophage of
serogroup B) that emerged as dangerous nosocomial
pathogens in high numbers at the burn department in a
teaching hospital in Brno were examined. In addition, 5
previously genotyped monolysogenic (seh gene-positive)
strains containing a prophage of serogroup B (Růžičková et
al., 2008) were used.
For nucleic acid isolation, all the strains were subcultured
in brain heart infusion broth (HiMedia, Mumbai, India) and
incubated overnight with shaking at 37 °C.
2.2. DNA isolation from culture samples
DNA for PCRs was obtained from lysostaphin-treated
cells, formerly pelleted from a 6-mL overnight culture with
108
to 109
CFU in 1 mL by centrifugation for 15 min at
8000 × g, and purified with the High Pure PCR Template
Preparation Kit (Roche Diagnostics, Berlin, Germany),
which was used according to the manufacturer's instructions.
2.3. Pulsed field gel electrophoresis
Genomic DNA was prepared as described previously
(Pantůček et al., 1996). SmaI macrorestriction fragments
were separated with a CHEF Mapper (Bio-Rad Laboratories,
Hercules, CA) under the following conditions: 1.2% agarose
in 1× Tris-acetate-EDTA (TAE) electrophoresis buffer (0.04
mol/L Tris/acetate, 0.001 mol/L EDTA, pH 8.2) at 14 °C, 6
V cm−1
, pulse times of 1 to 55 s for 24 h. Pulsed field gel
electrophoresis (PFGE) types were determined according to
Růžičková et al. (2003).
2.4. PCR experiments
2.4.1. Lysogenic typing
Multiplex PCR detection of prophage content of
serogroups A, B, Fa, and Fb in the strains under study was
performed as described by Pantůček et al. (2004).
2.4.2. Primer design and multiplex PCR assay
Specific PCR primers ETA-66F and ETA-66R for the eta
gene were derived from the sequence of phage ϕETA reported
by Yamaguchi et al. (2000). Primers SAU1 and SAU2, to
detect 217-bp S. aureus species-specific sequence derived
from the methyltransferase gene (GenBank accession no.
AJ132803), were reported previously (Pantůček et al., 2004;
Štěpán et al., 2001). They were added to the multiplex PCR as
an internal control. The novel 9 specific primers targeting the
variable genomic regions of eta gene-positive B prophages
(Table 1) were designed based on multiple alignment of entire
genomic sequences of the following eta gene-positive phages:
ϕETA (GenBank accession no. AP001553), ϕETA2
(AP008953), and the ϕETA3 (AP008954) showing sequence
similarity from 46% to 63% (http://www.ncbi.nlm.nih.gov/
genomes/). The conditions of the reactions were optimized
according to Henegariu et al. (1997).
PCR amplification was performed as follows: 3 μL of
DNA (50–100 ng) sample was added to 22 μL of PCR
mixture consisting of 20 mmol/L Tris–HCl (pH 8.4), 50
mmol/L KCl, 4 mmol/L MgCl2, and 200 μmol/L each of
dNTPs, 1 μmol/L each of ETA1-02 and ETA1-06, 0.8
μmol/L each of ETA3xis-1 and ETA3xis-2, 0.6 μmol/L each
of ETA2-11, ETA2-14, ETA3-14, ETA66F, and ETA66R,
0.2 μmol/L each of SAU-1 and SAU-2 primers, and 1.25 U
of Taq DNA polymerase (Invitrogen Life Technologies,
249P. Holochová et al. / Diagnostic Microbiology and Infectious Disease 66 (2010) 248–252
Carlsbad, CA). Thermal cycling parameters consisting of an
initial denaturation step (3 min, 94 °C), 30 cycles of
amplification including denaturation (45 s, 94 °C), annealing
for 60 s at 56 °C, DNA chain extension for 90 s at 72 °C; and
a final extension at 72 °C for 7 min were performed in a
DNA thermal cycler (model Tgradient, Biometra, Germany).
After amplification, 10 μL of PCR samples was mixed
with 3 μL of loading buffer (10% wt/vol Ficoll 400, 10
mmol/L Tris–HCl, pH 7.5, 50 mmol/L EDTA, and 0.25%
bromphenol blue) and electrophoresed in a 2.5% (wt/vol)
agarose gel (SERVA Electrophoresis, Heidelberg, Germany)
for 3.5 h at 5 V cm−1
in 1 × TAE buffer (0.04 mol/L Tris–
acetate, 1 mmol/L EDTA). Ethidium bromide (0.5 μg mL−1
of TAE)-stained DNA amplicons were then visualized on a
ultraviolet transilluminator at 302 nm. A 100-bp molecular
weight marker (New England Biolabs, Ipswich, MA) was
used to estimate the size of the PCR products. The prophage
types were proposed according to 6 patterns of PCR products
as shown in the Table 1 and Fig. 1.
3. Results and discussion
One hundred one clinical ETA- and ETB-positive isolates
of S. aureus (of which 12 were only ETB producers) and the
6 reference strains were tested for presence of the eta gene
encoding the ETA. Eighty-nine ETA-positive strains of
which 72 isolates were the causative agents of skin blistering
epidermolysis in neonates harbored eta gene-positive
prophage of serogroup B.
We developed a novel multiplex PCR assay for detection
of the DNA sequences unique to the eta gene-positive B
prophages harbored by S. aureus strains. First of all,
specificity of the primer pairs was verified on genomic
sequences of phages ϕETA, ϕETA2, and ϕETA3 in silico
and in single PCR reactions in the 4 reference ETA-positive
strains: CCM 2330, CCM 2331, CCM 7056, and CCM 7057.
PCR primers designed for detection of the 6 various types
of staphylococcal eta gene-positive B prophages were used
in multiplex PCR assay to obtain amplicons differing in size
and characteristic for each of the prophage types (Table 1;
Fig. 1). Primers ETA1-02 and ETA1-06 were designed to
amplify the 1200-bp sequence specific for the genomic
Table 1
Primers used for multiplex PCR assay
Primer name Nucleotide sequence (5′→ 3′) Location Primer specificity Product
size (bp)
Amplicon specificity
for the prophage types
ETA1-02 AAATTAGGTCTAGCTGCGTCAGT 1488–1501a
ϕETA: orf02–orf06 1200 ETA-B1
ETA1-06 TAATGTCAATGGTTGCGTCTCT 2666–2688a
ETA2-14 CGTATTTCTTCATCGCAGACA 6855–6876b
ϕETA2: orf11–orf14
(ETA2-11; ETA2-14)
753 ETA-B2
ETA3-14 TCTGATGCCATATCTAAGTC 7092–7111a
; 6948–6967c
ϕETA: orf13–orf15
(ETA2-11; ETA3-14)
ϕETA3: orf11–orf14
(ETA2-11; ETA3-14)
537
844
ETA-B1, ETA-B4, ETA-B5
ETA-B3
ETA2-11 GGATACATTGCGATACGAGGCAG 6575–6597a
; 6124–6147b,c
ETA-66F ATACAGATGATAACGGTAATACT 42264–42286a
ϕETA: orf66d
425 ETA-B1, ETA-B2,
ETA-B3, ETA-B4,
ETA-B5, ETA-B6
ETA-66R ATAATTCCCAATACCAACAC 42669–42689a
ETA3xis-1 ACGTTTGTTATTACCGTATA 1022–1041c
ϕETA3: orf01–orf02 380 ETA-B2, ETA-B3, ETA-B4
ETA3xis-2 GACGAAATAGCTAAGCTGT 1383–1402c
SAU1 GACGGCTTTGATGGCTAGTGG 460940–460960e
S. aureusf
217 All S. aureus isolates
SAU2 AGTTAATTCACGCCCTAGTG 461137–461156e
a
Location of primer sequence within ϕETA genome using the nucleotide numbering indicated in GenBank accession no. AP001553.
b
Location of primer sequence within genome of ϕETA2 using the nucleotide numbering indicated in GenBank accession no. AP008953.
c
Location of primer sequence within genome of ϕETA3 using the nucleotide numbering indicated in GenBank accession no. AP008954.
d
The orf66 of ϕETA containing the eta gene sequence.
e
Location of primer sequence within NCTC 8325 genome using the nucleotide numbering indicated in GenBank accession no. NC_007795.
f
S. aureus internal control.
Fig. 1. Agarose gel electrophoresis of the multiplex PCR amplification
products obtained from analysis of tested strains. MW = molecular weight
marker 100 bp ladder (New England Biolabs). 217-bp amplicon represents
species-specific sequence Sa 2052 in all S. aureus strains. Lane 1, ETA-B1;
lane 2, ETA-B2; lane 3, ETA-B3; lane 4, ETA-B4; lane 5, ETA-B5; lane 6,
ETA-B6 prophage type, respectively; lane 7, S. aureus 1039 (non-ETA
producer). Amplicon specificity for the prophage types is shown in Table 1.
250 P. Holochová et al. / Diagnostic Microbiology and Infectious Disease 66 (2010) 248–252
region containing 5 ORFs (the ORF2, ORF3, ORF4, and
ORF5 encoding the hypothetic protein of unknown function
and ORF6 encoding a repressor) of phage ϕETA (Yamaguchi
et al., 2000). Primers ETA2-11 and ETA2-14
identified the 753-bp sequence of the ORF11, ORF12,
ORF13, and ORF14 present in module for replication of the
ϕETA2 (GenBank accession no. AP008953). Primers
ETA2-11 and ETA3-14 amplified the respective 844-bp
sequence of genomic DNA, corresponding to ORF11,
ORF12, ORF13, and ORF14, located within replication
module of ϕETA3 (AP008954), as well as the 537-bp
sequences of the ORF13, ORF14, and ORF15 that occurred
on the ϕETA. The 537-bp sequence was amplified in all
strains carrying the B prophages of types ETA-B1, ETA-B4,
and ETA-B5. The pair of primers ETA3xis-1 and ETA3xis-
2, which was designed to amplify the 380-bp sequence
located within a part of ORF1 and ORF2 of the ϕETA3,
detected the genes for integrase (int) and excisionase (xis),
respectively. This DNA amplicon was common to B
prophages of types ETA-B2, ETA-B3, and ETA-B4.
The obtained PCR band patterns (Fig. 1) enabled to
distinguish 6 B prophage types, and the ETA-positive S.
aureus strains could be classified into 6 different groups
(Table 2). PCR analysis of DNA from all strains known to
produce ETA showed 2 amplicons: one specific for S.
aureus (217 bp), and the second 425-bp band indicated the
eta gene. The strains yielding additional PCR products of
1200 and 537 bp in size were classified into the ETA-B1
group and the strains showing the 753-bp together with 380bp
amplicon into the ETA-B2 group. The 844- and 380-bp
PCR products were detected in the strains of the ETA-B3
group, and the 537- and 380-bp amplicons occurred in the
strains assigned to ETA-B4 group. Strains generating the
537-bp PCR products were classified into the ETA-B5
group. Strains yielding only the 425- and 217-bp amplification
products were affiliated with the ETA-B6 group.
These results illustrate that more than 1 type of the eta genepositive
B prophages can be detected specifically in 1
reaction without any cross-reaction between primers. They
also indicate that yet undescribed prophages, other than
those of ETA-B1, ETA-B2, ETA-B3, ETA-B4, ETA-B5 and
ETA-B6 types, can occur in clinical ETA-producing strains.
PCR assay results indicated that the ETA-B2 and ETAB6
prophage types were closely associated with a single
genotype. Genotyping based on PFGE and prophage content
revealed that among the 89 ETA-positive strains tested in
this study, the most frequently found were the following
genotypes: G-7 and G-9 (20% and 18%, respectively)
followed by G-1 (12%), G-4 (10%), and G-6 (8% strains).
Despite the similarity in the SmaI macrorestriction patterns
and prophage content, each of the ETA-producing strains
examined was simply identified by its ETA-B-PCR profile.
As can be seen from Table 2, the strains of predominating
genotype G-7 harbored prophages of types either ETA-B3 or
ETA-B4, the strains of genotype G-6 contained prophages
either ETA-B1 or ETA-B4, the strains of genotype G-9
included ETA-B4 or ETA-B6 prophages, and the strains of
genotype G-10 carried prophages of either ETA-B3 or ETAB4
types. Analysis of the geographic distribution of
genotyped S. aureus isolates revealed that the strains of
genotype G-1, harboring prophages of type ETA-B1,
occurred in 5 distant hospitals between 1998 and 2003. The
strains containing prophages of type ETA-B4 were isolated in
7 hospitals. However, the strains classified into the groups
ETA-B2 and ETA-B6 occurred only in 2 hospitals.
In addition to ETA-producing S. aureus strains containing
the B prophage, we have analyzed several eta gene-negative
strains (harboring B prophages) originated from other
sources than impetigo to verify the specificity of developed
PCR strategy. Amplification of DNA from the screened 30
methicillin-resistant S. aureus and 5 monolysogenic seh
gene-positive strains (isolates from foodstuffs) resulted in
production of the 217-bp PCR band typically indicative of S.
aureus DNA Sa2052 sequence, but they did not produce any
of the amplicons detected in the eta gene-positive B
Table 2
Analysis of B prophage type occurrence in ETA-positive S. aureus strains
recovered in 20 Czech maternity hospitals and 1 Slovak maternity hospital
ETA-B
prophage
types
Genotypea
PFGE
typeb
Prophage
carriage
Hospital/year
of isolation
(no. of strains)
ETA-B1 G-1 ET1a ABFb Hosp 1/1998 (7)
Hosp 4/1999 (1)
Hosp 5/2001 (1); 2008 (1)
Hosp 7/2002 (1)
Hosp 8/2003 (1)
G-2 ET1b ABFb Hosp 1/1998 (1)
Hosp 8/2004 (1)
G-6 ET2 B Hosp 2/1998 (5)
ETA-B2 G-11 ET5 BFb Hosp 15/2007 (5)
Hosp 21/2003 (5); 2006 (3);
2007 (2)
ETA-B3 G-7 ET2 AB Hosp 11/2003 (7)
Hosp 12/2002 (4)
G-10 ET4 ABFa Hosp 9/2002 (3)
ETA-B4 G-7 ET2 AB Hosp 6/2001 (5)
Hosp 8/2008 (1)
Hosp 19/2008 (1)
G-6 ET2 B Hosp 10/2008 (2)
G-10 ET4 ABFa Hosp 3/1998 (1)
G-9 ET4 BFa Hosp 1/1998 (1)
Hosp 3/1998 (1)
G-8 ET4 B Hosp 14/2007 (1)
ETA-B5 G-3 ET1c BFb Hosp 7/2001 (1)
Hosp 8/2001 (1)
G-4 ET1d BFb Hosp 13/2004 (2)
Hosp 14/2007 (4)
Hosp 16/2008 (1)
Hosp 20/2007 (2)
G-5 ET1f BFb Hosp 17/2006 (2); 2007 (1)
ETA-B6 G-9 ET4 BFa Hosp 9/2003 (5); 2004 (2)
Hosp 18/2008 (2); 2009 (5)
a
Genotype based on PFGE and content of the prophages of serogroup
A, B, Fa, and Fb.
b
The macrorestriction patterns of the PFGE types are shown in the
dendrogram reported by Růžičková et al. (2003).
251P. Holochová et al. / Diagnostic Microbiology and Infectious Disease 66 (2010) 248–252
prophages. No PCR product corresponding to B prophage
sequences was obtained with the 12 ETB-producing strains
harboring a prophage of serogroup F.
Bioinformatic analysis of genome sequenced S. aureus
strains reveals that eta gene-negative prophages JH1, JH9,
Mu3, Mu50, and phiPV83 (http://www.ncbi.nlm.nih.gov/
genomes/) contain the 844-bp sequence, and genome of the
sequenced phages ϕ80α, ϕ69, and ϕ11 carry the 380-bp
sequence. However, both the sequences corresponding to the
PCR products obtained in the multiplex PCR (either 844-bp
of ETA-B3 or 380-bp of ETA-B2, ETA-B3, and ETA-B4
prophage types) do not interfere with the developed
multiplex PCR strategy in any case.
Having tested the developed PCR on a wide range of
isolates from different localities and sources, we can
recommend its use as a confirmatory test for the presence
of ETA-converting B prophages. Our results indicate that the
specific sequences localized in the lysogeny and replication
modules of the different eta gene carrying prophages raise
the possibility of establishment of a multiplex PCR assay.
Polymorphisms of ETA phage sequences used for the
development of a novel PCR assay enhanced the differentiation
of ETA-producing S. aureus isolates. In combination
with the simple DNA extraction procedure, the application of
the single multiplex PCR, used in this work, should enable
more samples to be simultaneously characterized in detail. In
comparison with procedure based on PCR detection of the
eta, etb, and etd genes previously reported by Růžičková et
al. (2005) which enables only identification of the ETencoding
genes, this new approach offers classification of
the closely related ETA-producing S. aureus strains.
This work has produced a multiplex PCR system that
reliably and rapidly detects virulent S. aureus strains
carrying different ETA-converting B prophages, which are
the major mediators of the eta gene transfer between
staphylococci. These features allow this procedure to be
applied in clinical settings for hospital epidermolytic
infection control. This efficient method could also facilitate
the identification of additional yet undescribed ETAconverting
phages.
Acknowledgments
This work was supported by grants from the Czech
Science Foundation (310/09/0459), the European Union
(LSHM-CT-2006-019064), and the Ministry of Education,
Youth and Sports of the Czech Republic (MSM0021622415).
We also thank Dr Y. Yoshizawa (Jikei University School of
Medicine, Tokyo, Japan) for kindly providing the strain S.
aureus 1039 used in this work.
References
Dave J, Reith S, Nash JQ, Marples RR, Dulake C (1994) A double outbreak
of exfoliative toxin-producing strains of Staphylococcus aureus in a
maternity unit. Epidemiol Infect 112:103–114.
Endo Y, Yamada T, Matsunaga K, Hayakawa Y, Kaidoh T, Takeuchi
S (2003) Phage conversion of exfoliative toxin A in Staphylococcus
aureus isolated from cows with mastitis. Vet Microbiol 96:
81–90.
Henegariu O, Heerema NA, Dlouhy SR, Vance GH, Vogt PH (1997)
Multiplex PCR: critical parameters and step-by-step protocol. Biotechniques
23:504–511.
Kondo I, Sakurai S, Sarai Y, Futaki S (1975) Two serotypes of exfoliation
and their distribution in staphylococcal strains isolated from patients
with scalded-skin syndrome. J Clin Microbiol 1:394–400.
Ladhani S, Joannou CL, Lochrie DP, Evans RW, Poston SM (1999)
Clinical, microbial, and biochemical aspects of the exfoliative toxins
causing staphylococcal scalded-skin syndrome. Clin Microbiol Rev 12:
224–242.
Mackenzie A, Johnson W, Heyes B, Norrish B, Jamieson F (1995) A
prolonged outbreak of exfoliative toxin A-producing Staphylococcus
aureus in a newborn nursery. Diagn Microbiol Infect Dis 21:
69–75.
Mehrotra M, Wang G, Johnson WM (2000) Multiplex PCR for detection of
genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxin
shock syndrome toxin 1, and methicillin resistance. J Clin Microbiol 38:
1032–1035.
Pantůček R, Götz F, Doškař J, Rosypal S (1996) Genomic variability of
Staphylococcus aureus and the other coagulase-positive Staphylococcus
species estimated by macrorestriction analysis using pulsed-field gel
electrophoresis. Int J Syst Bacteriol 46:216–222.
Pantůček R, Doškař J, Růžičková V, Kašpárek P, Oráčová E,
Kvardová V, Rosypal S (2004) Identification of bacteriophage
types and their carriage in Staphylococcus aureus. Arch Virol 149:
1689–1703.
Plano LR (2004) Staphylococcus aureus exfoliative toxins: how they cause
disease. J Invest Dermatol 122:1070–1077.
Růžičková V, Pantůček R, Petráš P, Doškař J, Sedláček I, Rosypal S (2003)
Molecular typing of exfoliative toxin-producing Staphylococcus aureus
strains involved in epidermolytic infections. Int J Med Microbiol 292:
541–545.
Růžičková V, Voller J, Pantůček R, Petráš P, Doškař J (2005) Multiplex
PCR for detection of three exfoliative toxin serotype genes in Staphylococcus
aureus. Folia Microbiol 50:499–502.
Růžičková V, Karpíšková R, Pantůček R, Pospíšilová M, Černíková P,
Doškař J (2008) Genotype analysis of enterotoxin H-positive Staphylococcus
aureus strains isolated from food samples in the Czech
Republic. Int J Food Microbiol 121:60–65.
Saiman L, Jakob K, Holmes KW, Whittier S, Garzon MC, Rago JV,
Schlievert PM, Della-Latta P (1998) Molecular epidemiology of
staphylococcal scalded skin syndrome in premature infants. Pediatr
Infect Dis 17:329–334.
Sato H, Matsumori Y, Tanabe T, Saito H, Shimizu A, Kawano J (1994) A
new type of staphylococcal exfoliative toxin from a Staphylococcus
aureus strain isolated from a horse with phlegmon. Infect Immun 62:
3780–3785.
Štěpán J, Pantůček R, Růžičková V, Rosypal S, Hájek V, Doškař J (2001)
Identification of Staphylococcus aureus based on PCR amplification of
specific genomic 826 bp sequence derived from a common 44-kb SmaI
restriction fragment. Mol Cell Probes 15:249–257.
Yamaguchi T, Hayashi T, Takami H, Nakasone K, Ohnishi M, Nakayama
K, Yamada S, Komatsuzawa H, Sugai M (2000) Phage conversion of
exfoliative toxin A production in Staphylococcus aureus. Mol Microbiol
38:694–705.
Yamaguchi T, Nishifuji K, Sasaki M, Fudaba Y, Aepfelbacher M, Takata T,
Ohara M, Komatsuzawa H, Amagai M, Sugai M (2002) Identification of
the Staphylococcus aureus etd pathogenicity island which encodes a
novel exfoliative toxin, ETD, and EDIN-B. Infect Immun 70:
5835–5845.
Yoshizawa Y, Sakurada J, Sakurai S, Machida K, Kondo I, Masuda S (2000)
An exfoliative toxin A-converting phage isolated from Staphylococcus
aureus strain ZM. Microbiol Immunol 44:189–191.
252 P. Holochová et al. / Diagnostic Microbiology and Infectious Disease 66 (2010) 248–252