# Jak pracovat s timto ukolem: # How work with this homework:
# Dle zadani dopiste funkcionalitu k jednotlivym funkcem.
# Write functionality for each function based on description.
# Napriklad nasledujici funkce bude vracet v kazdem pripade True.
# For example next function called show_case must return True in any case.
# Pokud bude pouzivat funkci print pro odladovani kodu, nezapomnte ji pak pred odevzdanim smazat.
# If you use function print to tune your code, don't forget removing it from code before submitting.
def show_case():
    return False

#
# Domaci ukol 04
# Homework 04
#

# Funkce custom_sum() vrati soucet dvou parametru a, b nebo 0, pokud je soucet zaporny.
# Parametry a, b jsou cela nebo realna cisla.
#
# Function custom_sum returns sum of two parameters a, b or 0, when the sum is negative.
# Parameters a,b are integer or real numbers.
#
# custom_sum(5, 10) => 15
# custom_sum(-5, 2) => 0
#
# 1 bod # 1 point
def custom_sum(a, b):
    return 0

# Funkce min_abs() vrati ze zadaneho listu nejmensi absolutni hodnotu.
#
# Function min_abs() return minimal absolute value from parameters list.
#
# [-5, -2, 3, 8] => 2
# [-10, 1+1j, 2] => 1.4142135623730951
#
# 1 bod # 1 point
def min_abs(list):
    return 0

# Funkce remove_unique odstrani ze zadaneho listu unikatni hodnoty a vrati novy list.
#
# Function remove_unique remove from list unique value and return this new list.
#
# [1, 1, 2, 3] => [1, 1]
# [2, 3, 4, 3, 4, 8, 9, 0, 3, 9, 8] => [3, 4, 3, 4, 8, 9, 3, 9]
#
# 2 body # 2 points
def remove_unique(list):
    return []

# Funkce weighted_mean pocita vazeny prumer ze zadaneho listu, tak ze prvni prvek je do prumeru zapocitan s vahou weight.
# Pro list [1, 2, 3] a weight 2 to znamena, ze 1 je zapocitana dvakrat a pocet prvku je tedy 4.
#
# Function weighted_mean calculate weighted mean from list, that first item from list is weighted by parameter weight.
# For list [1, 2, 3] and weight 2 it means, that 1 is counted two times and length of list is 4.
#
# [1, 2, 3], 2 => 1.75
# [2.3, 5.6, 1.2], 5 => 2.6142857142857143
#
# 2 body # 2 points
def weighted_mean(list, weight):
    return 0.0

# Funkce goto prejde na zadanou pozici position a prochazene prvky umisti na konec.
#
# Function goto passes to entered position and brosing value move to end of list.
#
# [1, 2, 3, 4, 5], 4 => [4, 5, 1, 2, 3]
# ['A', 'B', 'Q', 'Z'], 3 => ['Q', 'Z', 'A', 'B']
#
# 2 body # 2 points
def goto(list, position):
    return []

#
# Domaci ukol 05
# Homework 05
#
# 8 bodu # 8 point
#

def is_dna_sequence(sequence):
    return True

def reverse_complement_sequence(seqeunce):
    pass

def reading_frames(sequence):
    # HINT: use function reverse_complement_sequence
    return ["AGTAGTAGT", "GTAGTAGT", "TAGTAGT", "ACTACTACT", "CTACTACT", "TACTACT"]

def translate_codon(codon):
    codon_dictionaty = {
        'ACT': 'T',
        'AGT': 'S',
        'CTA': 'L',
        'GTA': 'V',
        'TAC': 'Y',
        'TAG': '-'
    }
    if codon_dictionaty.has_key(codon):
        return codon_dictionaty[codon]
    return "?"

def translate(sequence):
    if not is_dna_sequence(sequence):
        return None
    protein_sequences = []
    for frame in reading_frames(sequence):
        protein_sequence = ""
        i = 0
        while i+3 <= len(frame):
            codon = frame[i:i+3].upper()
            protein_sequence += translate_codon(codon)
            i += 3
        protein_sequences.append(protein_sequence)
    return protein_sequences

### KONEC ### END
# Neupravujte nasledujici kod. Don't update following code.

correct = 0
wrong = 0

print("Testing functions:")
print("-"*40)

if show_case() :
    print("{:37} {}".format("Function #0 (show_case):", "ok *"))
else:
    print("{:37} {}".format("Function #0 (show_case):", "ko -"))

if custom_sum(10, 5) == 15 and custom_sum(-5, 2) == 0:
    print("{:37} {}".format("Function #1 (custom_sum):", "ok *"))
    correct += 1
else:
    print("{:37} {}".format("Function #1 (custom_sum):", "ko -"))
    wrong += 1
    
if min_abs([-5, -2, 3, 8]) == 2 and min_abs([-10, 1+1j, 2]) == 1.4142135623730951:
    print("{:37} {}".format("Function #2 (min_abs):", "ok *"))
    correct += 1
else:
    print("{:37} {}".format("Function #2 (min_abs):", "ko -"))
    wrong += 1
if remove_unique([1, 1, 2, 3]) == [1, 1] and remove_unique([2, 3, 4, 3, 4, 8, 9, 0, 3, 9, 8]) == [3, 4, 3, 4, 8, 9, 3, 9, 8]:
    print("{:37} {}".format("Function #3 (remove_unique):", "ok *"))
    correct += 1
else:
    print("{:37} {}".format("Function #3 (remove_unique):", "ko -"))
    wrong += 1
if weighted_mean([1, 2, 3], 2) == 1.75 and weighted_mean([2.3, 5.6, 1.2], 5) == 2.6142857142857143:
    print("{:37} {}".format("Function #4 (weighted_mean):", "ok *"))
    correct += 1
else:
    print("{:37} {}".format("Function #4 (weighted_mean):", "ko -"))
    wrong += 1
if goto([1, 2, 3, 4, 5], 4) == [4, 5, 1, 2, 3] and goto(['A', 'B', 'Q', 'Z'], 3) == ['Q', 'Z', 'A', 'B']:
    print("{:37} {}".format("Function #5 (goto):", "ok *"))
    correct += 1
else:
    print("{:37} {}".format("Function #5 (goto):", "ko -"))
    wrong += 1
seq1 = 'agtagtagt'
result1 = translate(seq1)
if result1 == ['SSS', 'VV', '--', 'TTT', 'LL', 'YY']:
    print("{:37} {}".format("Function #6 (translate) test 1:", "ok *"))
    correct += 1
else:
    print("{:37} {}".format("Function #6 (translate) test 1:", "ko -"))
    wrong += 1
seq2 = 'GACGCAGTGGATCCGTACAATAG'
result2 = translate(seq2)
if result2 == ['DAVDPYN', 'TQWIRTI', 'RSGSVQ-', 'LLYGSTA', 'YCTDPLR', 'IVRIHCV']:
    print("{:37} {}".format("Function #6 (translate) test 2:", "ok *"))
    correct += 1
else:
    print("{:37} {}".format("Function #6 (translate) test 2:", "ko -"))
    wrong += 1

print("-"*40)
print(seq1)    
print(result1)
print(seq2)
print(result2)

print("-"*40)
print("Spravne/correct: {}".format(correct))
print("Spatne/wrong: {}".format(wrong))