EMBO
reports
416 EMBO Reports vol. 1 | no. 5 | pp 416–421 | 2000 © 2000 European Molecular Biology Organization
Genome-wide insertional mutagenesis in human
cells by the Drosophila mobile element Minos
Apostolos G. Klinakis1,2, Laskaro Zagoraiou1,3, Demetrios K. Vassilatis3 and
Charalambos Savakis1,3,+
1Institute of Molecular Biology and Biotechnology, Foundation for Research and Technology, Hellas, Heraklion 71110, 2Department of Biology, University of
Crete, Heraklion and 3Medical School, University of Crete, Heraklion, Crete, Greece
Received June 27, 2000; revised September 11, 2000; accepted September 12, 2000
The development of efficient non-viral methodologies for
genome-wide insertional mutagenesis and gene tagging in
mammalian cells is highly desirable for functional genomic
analysis. Here we describe transposon mediated mutagenesis
(TRAMM), using naked DNA vectors based on the Drosophila
hydei transposable element Minos. By simple transfections of
plasmid Minos vectors in HeLa cells, we have achieved high
frequency generation of cell lines, each containing one or
more stable chromosomal integrations. The Minos-derived
vectors insert in different locations in the mammalian genome.
Genome-wide mutagenesis in HeLa cells was demonstrated
by using a Minos transposon containing a lacZ–neo gene-trap
fusion to generate a HeLa cell library of at least 105 transposon
insertions in active genes. Multiple gene traps for six out of 12
active genes were detected in this library. Possible applications
of Minos-based TRAMM in functional genomics are discussed.
INTRODUCTION
The complete sequence of the human genome is expected to be
available soon and a versatile method for large scale insertional
mutagenesis will be a sine qua non for its functional analysis.
Insertional mutagenesis and gene trapping with plasmid or retroviral
vectors has been successfully applied in mammalian
cultured cells (Gossler et al., 1989; Friedrich and Soriano, 1991;
Wurst et al., 1995; Hicks et al., 1997; Bonaldo et al., 1998;
Whitney et al., 1998; Zambrowicz et al., 1998; Wiles et al.,
2000). The efficiency of plasmid vectors is limited by low insertion
rates, while retroviral vectors are relatively difficult to
manipulate. Transposable elements present an attractive alternative.
Transposable elements have been used previously as
vectors for gene and enhancer trapping in various complex
organisms, but not in mammals (Bier et al., 1989; Bellen et al.,
1989; Wilson et al., 1989; Parinov and Sundaresan, 2000;
Walbot, 2000). Most elements are mobilized through a cut-andpaste
process catalysed by an element-encoded transposase that
excises the element from its original plasmid or chromosomal
site and re-integrates it elsewhere in the genome. Minos (Franz
and Savakis, 1991) belongs to the Tc1/mariner superfamily of
transposable elements (Franz et al., 1994), members of which
are active in a wide range of species from protozoa to mammals
(Gueiros-Filho and Beverley, 1997; Ivics et al., 1997; Schouten
et al., 1998; Luo et al., 1998; Zhang et al., 1998; Yant et al.,
2000). Transposition of Minos in cultured cells or embryos of
several insect species suggests that this element may serve as a
universal gene transfer and mutagenesis vector in insects
(Loukeris et al., 1995a,b; Catteruccia et al., 2000a,b; Klinakis et
al., 2000; Shimizu et al., 2000). Here we show that Minos is
functional in human HeLa cells and that Minos-based vectors
can be used for genome-wide mutagenesis and functional
genomic analysis. We propose that Minos-based TRAMM (transposon
mediated mutagenesis) may be a powerful tool for functional
analysis of the human genome.
RESULTS AND DISCUSSION
To test for transposase-catalysed chromosomal integration of
Minos in human cells, two circular Minos-based plasmids were
co-transfected into HeLa cells: a helper plasmid (pEF1/ILMi)
carrying the Minos transposase gene driven by the human EF1α
(elongation factor 1α) promoter, and a donor plasmid
(pMiLRneo) bearing a neomycin resistance gene driven by the
SV40 promoter and flanked by Minos inverted repeats (Figure 1).
Approximately 4% of the cells from each co-transfection,
+Corresponding author. Tel: +30 81 391114; Fax: +30 81 391950; E-mail: savakis@imbb.forth.gr
EMBO Reports vol. 1 | no. 5 | 2000 417
Transposon mediated mutagenesis in human cells
scientific reports
corresponding to 105 clones, were stably transformed to G418
resistance. A reduction ranging between 9- and 50-fold was
observed in the absence of helper plasmid or in transfections
with helper and pMiLneo, a ‘wings clipped’ donor lacking one
of the two inverted repeats (Table I). These differences were
reproducible and independent of transfection efficiencies, as
indicated by transient expression of a co-transfected CMV/GFP
construct.
Genomic analysis of randomly selected clones derived from
pMiLRneo and pEF1/ILMi co-transfection, indicated that single
copies of the transposon had integrated at different genomic
positions (Figure 2A). Restriction analysis failed to detect diagnostic
fragments derived from integration of the entire donor
plasmid (Figure 2A, triple digest). Absence of plasmid vector
sequences was confirmed by re-probing the blots with an appropriate
probe (data not shown). Analysis of 30 clones showed
between one and seven insertions per clone, with a mean of 2.1.
As with all Tc1/mariner elements, Minos insertions invariably
disrupt a TA dinucleotide, which is duplicated upon insertion
(Loukeris et al., 1995a). We determined the DNA sequences
Fig. 1. Minos-derived vectors. Minos inverted terminal repeats are shown as
block arrows. Arrowheads indicate the direction of transcription of the
transposase (Tra) and neo genes. pA is polyadenylation signal; ori and S-P are
the SV40 origin of replication and promoter, respectively.
Fig. 2. MiLRneo insertions in individual HeLa clones. (A) Southern blot analysis of individual colonies. Genomic DNA (10 µg) was digested with the enzymes
indicated before electrophoresis. The probe used is indicated by a grey bar. Arrowheads indicate the expected positions of diagnostic fragments derived from
plasmid vector sequences. Lane H is from non-transfected cells. (B) Sequences flanking MiLRneo insertions. Transposon sequences and the target TA dinucleotide
are in upper case.
Table I. G418-resistant HeLa colonies generated after transfection with
Minos plasmids.
Numbers are averages of two duplicate transfections.
Plasmids used in transfection Experiment 1 Experiment 2
pMiLRneo + EF1 3350 6240
pMiLRneo + EF1/ILMi 32 600 102 960
pMiLneo + EF1/ILMi 3400 2040
418 EMBO Reports vol. 1 | no. 5 | 2000
A.G. Klinakis et al.
scientific reports
flanking the MiLRneo transposon of three different clones
bearing single insertions. All insertions had occurred at a TA
dinucleotide and the flanking sequences were different from the
original Minos flanks. In clone 3, the pre-insertion site was
cloned and sequenced; the TA duplication was the only alteration
introduced (Figure 2B).
The observed high integration frequencies suggested that
genome-wide gene trapping is possible. A Minos-based genetrap
construct (pMiLRgeo) was used, utilizing the first splice
acceptor and part of exon 2 of the mouse Engrailed-2 gene fused
in-frame to an AUG-less lacZ–neo fusion (geo, Figure 3A). Upon
insertion of geo vectors into introns of active genes in the appropriate
orientation, in-frame splicing of the geo fusion to the
upstream exon confers resistance to G418 and occasionally
gives detectable galactosidase activity. Co-transfection of HeLa
cells with pMiLRgeo plus pEF1/ILMi resulted in 10- to 100-fold
lower frequency of G418-resistant clones compared with
pMiLRneo. Transposase-induced insertions were 10-fold more
frequent than in the absence of transposase. Southern blot
analysis of five randomly chosen clones indicates that insertions
occured in different genomic positions, varying in number from
1 to 10 per clone (Figure 3B). From 16 individual G418-resistant
clones, eight were positive for β-galactosidase activity (data not
shown). As in all random mutagenesis schemes, occurrence of
multiple hits can complicate downstream analysis. This problem
is of lesser concern in gene trap experiments, since gene traps
are identified at the level of cDNA rather than at the genomic
level.
A fusion transcript from clone T4 was recovered by 5′ RACE
and the sequence of the splice junction was determined. Integration
had occurred into the fourth intron of the monocarboxylate
transporter 3 (MCT3) gene. Analysis of the insertion sequence
showed that the transposon had inserted at a TA ∼1.7 kb
upstream from exon 5, generating the characteristic target TA
duplication (Figure 3C).
The restriction patterns shown in Figures 2 and 3 were
unchanged after >50 passages, indicating that Minos insertions
in HeLa cells are stable (data not shown).
Using standard protocols, transfection of 106 cells can yield
∼4 × 104 clones carrying Minos insertions. Since the average
number of insertions per clone is ∼2 (Figure 2A), this corresponds
to a total number of 8 × 104 individual insertions per 106
transfected cells. Therefore, a library containing 3 × 106 insertions
can be generated from 4 × 107 cells. Such a library should
contain, on average, one insertion per kb. To further challenge
Minos as a tool for genome-wide gene trapping, 4 × 107 HeLa
cells distributed in twenty 100 mm tissue culture dishes were
co-transfected with gene trap vector pMiLRgeo and helper pEF1/
ILMi. G418 selection yielded ∼105 G418-resistant colonies.
Given that only a fraction of genes should be active in HeLa
cells, Minos insertions should have occurred in the majority of
active genes. To test this, five sets of four plates each were
pooled to create sub-libraries of ∼2 × 104 clones each. Poly(A)+
RNA was isolated from each pool, and was used to detect genetrap
fusions of 12 genes whose intron–exon structure is known,
and which have been reported or are expected to be active in
HeLa cells (Ryo et al, 1998; see legend to Figure 4). Fusion RT–
PCR products were detectable for six of these genes without the
need to optimize PCR conditions or use alternate primers. Four
of the genes were hit in more than one pool and two were hit in
more than one intron (Figure 4 and Table II). It is notable that
only two of the nine exon traps detected were in-frame. This
suggests that the remaining fusions represent ‘by-standers’,
i.e. that the respective cells may carry at least one other gene
trap that confers G418 resistance. Considering the limitations of
RT–PCR, that HeLa cells are largely polyploid, and taking into
Fig. 3. MiLRgeo gene-trap insertions. (A) The gene-trap construct MiLRgeo. The probe used for Southern blotting is indicated by a grey bar. (B) Southern blot
analysis of individual HeLa lines stably transfected with MiLRgeo. Ten micrograms of DNA were digested with EcoRV. Lane H is from non-transfected cells.
(C) Fusion cDNA and flanking intron sequences of a gene-trap insertion from clone T4. Transposon sequences and the target TA dinucleotide are in upper case.
EMBO Reports vol. 1 | no. 5 | 2000 419
Transposon mediated mutagenesis in human cells
scientific reports
account that our sample (12 genes) is rather small, our experiments
indicate that at least 50% of the genes that are active in
HeLa cells have been tagged. Further experiments are required
to determine whether the element inserts preferentially into transcriptionally
active regions of the genome.
We show for the first time that a transposable element can
potentially tag all genes of the human genome. Furthermore, we
demonstrate that Minos-based TRAMM can be used for high
efficiency gene trapping in a human cell line. Biological
phenomena such as differentiation, response to external stimuli,
and disease, frequently involve alterations of transcriptional
levels of specific genes. This work opens the way to use Minosbased
TRAMM for efficient genome-wide functional identification
of transcriptionally modulated genes in cell lines. Minosbased
TRAMM could also be useful for high-throughput
screening of ES cells for potential knockouts.
METHODS
Plasmids. Helper plasmid pEF1/ILMi was constructed by
inserting the spliced transposase coding region (Klinakis et al.,
2000) into the ClaI–XbaI sites of plasmid pEF-BOS (Goldman et
al., 1996). Donor plasmid pMiLRneo was constructed by
Fig. 4. Trapping of six genes in HeLa cells with MiLRgeo. Each panel shows agarose gel electrophoresis separated, ethidium bromide stained RT–PCR products
that were recovered from five independent pools (A–E) of G418-resistant clones. The control lane corresponds to a reaction without template. The panels
correspond to genes (accession numbers in brackets): elongation factor 1γ (EF1γ) (Z11531); ribosomal protein 18 (rs18) (X69150); DNA replication licensing
factor homolog (hRlf) (D39073); G1 to S phase transition protein 1 homolog (GSPT1) (X17644); heterogeneous nuclear ribonucleoprotein A2/B1 (hnRNP)
(D28877); ATP synthase c-subunit (ATP-c) (X69908). Genes that were not detected are: thymidine kinase (M15205), ATP synthase γ-subunit (D16561), F-actin
capping protein (U03271), a putative protein kinase C inhibitor (U51004), hypoxantine phosphoribosyltransferase 1 (NM_000194) and cytochrome c core I protein
(L16842).
Table II. Sequences of gene-trap chimeric cDNAs.
aTrapped exon sequences are in lower case; the first eight En-2 exon 2 bases are in upper case. Codons are separated by spaces.
Gene Exon
trapped
No. of hits Approx. intron
size (kb)
Sequencea
EF1γ 4 1 3.4 …gct gac atc aca gtt gtc tgc acc ctg ttg tgg ctc tat aag cag GT CCC AGG…
EF1γ 5 2 0.4 …tc ttg ggg gaa gtg aaa ctg tgt gag aag atg gcc cag ttt gat gGT CCC AGG…
EF1γ 6 2 5.7 …gct gag ccc aag gcc aag gac ccc ttc gct cac ctg ccc aag ag GT CCC AGG…
rs18 1 2 3.0 …att gat ggg cgg cgg aaa ata gcc ttt gcc atc act gcc att aag GT CCC AGG…
hRlf 9 1 2.3 …gcc cgc tgc agt gtt ttg gca gct gcc aac cct gtc tac ggc agg GT CCC AGG…
GSPT1 9 1 5.4 …gga tct att tgt aaa ggc cag cag ctt gtg atg atg cca aac aag GT CCC AGG…
GSPT1 13 1 2.5 …tt aaa gac ttc cct cag atg ggt cgt ttc acc tta aga gatgag gGT CCC AGG…
hnRNP 1 3 2.7 …ga aat cgg gct gaa gcg act gag tcc gcg atg gag GT CCC AGG…
ATP-c 4 1 3.7 …tgg gat tgg aac tgt gtt tgg gag cct cat cat tgg tta tgc cag GT CCC AGG…
420 EMBO Reports vol. 1 | no. 5 | 2000
A.G. Klinakis et al.
scientific reports
replacing the tetracycline resistance gene in pMiLRTetR
(Klinakis et al., 2000) by a SV40-neo cassette (pRcCMV,
Invitrogen). ‘Wings-clipped’ pMiLneo is pMiLRneo lacking a
SacII–SacI fragment containing the Minos right-hand inverted
repeat. The gene-trap plasmid vector pMiLRgeo was constructed
by replacing the SV40-neo cassette from pMiLRneo with an
EcoRI–HindIII geo cassette from plasmid pGT1.8geo (Skarnes et
al., 1995).
Cell culture and transfection. HeLa cells were cultured in
Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented
with 10% fetal calf serum and 50 µg/ml gentamycin at 37°C, 5%
CO2. Exponentially growing HeLa cells (6 × 105) were transfected
in 3 ml DMEM with 8 µg pMiLRneo or pMiLneo and 2 µg
pEF-BOS or pEF1/ILMi, using calcium phosphate precipitation.
One microgram of plasmid pQBI25 (Quantum) containing a
GFP gene under the control of the cytomegalovirus promoter
was included in all mixes for reference. Two days post-transfection,
the cells were transferred to medium containing 600 µg/ml
G418 (Gibco).
Amplification and cloning of the insertion sites. Genomic DNA
from three clones with single insertions was digested with EcoRV
and probed with a neo probe. The gel regions containing the
Minos flanks were cut out and DNA was isolated and digested
with either Sau3AI or AluI. The Sau3AI fragments were ligated to
vectorettes (Vectorette II kit, Genosys) and PCR was performed
with vectorette-specific primers and the Minos primers: IMio1
(5′-AAGAGAATAAAATTCTCTTTGAGACG-3′) for the first PCR
and IMio2 (5′-GATAATATAGTGTGTTAAACATTGCGC-3′) for
the ‘nested’ PCR. The AluI fragments were circularized after dilution
and inverse PCR was performed with Minos primers, IMio1
and IMii1 (5′-CAAAAATATGAGTAATTTATTCAAACGG-3′), followed
by a second round of ‘nested’ PCR with primers IMio2 and
IMii2 (5′-GCTTAAGAGATAAGAAAAAAGTGACC-3′). At least
one flank of each insertion was recovered. The ‘right-hand’ flank
from one of the clones (clone 3) was recovered by screening a
human genomic library with the left flank as probe and using the
sequence adjacent to the known flank for primer design. The preinsertion
site sequence of clone 3 was recovered from non-transfected
HeLa DNA by PCR.
Amplification and cloning of fusion cDNAs. A modification of
the 5′ RACE protocol (cRACE) was used to identify fusion cDNAs
(Maruyama et al., 1995). Total RNA was reverse transcribed with
AMV reverse transcriptase (Gibco) using the geo specific primer
ZRT (5′-GACCGTAATGGGATAGGTTAC-3′). The geo specific
primers used for inverse PCR were: ZF1 (5′-CAGTTGCGCAGCCTGAATGGG-3′)
and ZR1 (5′-CTTCGCTATTACGCCAGCTGG-
3′) for the first PCR; and ZF2 (5′-GCTGGCTGGAGTGCGATCTTC-3′)
and ZR2 (5′-CAGGGTTTTCCCAGTCACGAC-3′) for the
‘nested’ PCR. The right-hand flank of the insertion was isolated
by PCR using Minos primer IMio1 and MCT3 exon 5 primer
GGCTTCTTCCTAATGCAG. The left flank and the pre-insertion
site in the MCT3 intron were recovered as described above for
the MiLRneo insertion.
Identification of trapped genes by RT–PCR. Reverse transcription
was performed with the Superscript II system (Gibco) using
0.5 µg poly(A)+ RNA from each pool as template and primer
ZR1. Gene-trap insertions were identified using nested PCR with
two geo-specific primers (ZR2 for the first and TGCTCTGTCAGGTACCTGTTGG
for the second PCR) and two gene-specific
primers (sequences of gene-specific primers available upon
request). Amplification products were analysed by agarose gel
electrophoresis. Individual bands were eluted from the gel and
cloned in a TA vector (Promega T-easy).
ACKNOWLEDGEMENTS
We thank G. Vrentzos for technical help and S. Oehler for critically
reading the manuscript. This work was supported by a grant
from the European Union to C.S. (BIO4-CT98-0203) and a
Career Development Award grant from the Greek Secretariat for
Research and Technology to D.K.V.
REFERENCES
Bellen, H.J., O’Kane, C.J., Wilson, C., Grossniklaus, U., Pearson, R.K. and
Gehring, W.J. (1989) P-element-mediated enhancer detection: a versatile
method to study development in Drosophila. Genes Dev., 3, 1288–1300.
Bier, E. et al. (1989) Searching for pattern and mutation in the Drosophila
genome with a P-lacZ vector. Genes Dev., 3, 1273–1287.
Bonaldo, P., Chowdhury, K., Stoykova, A., Torres, M. and Gruss, P. (1998)
Efficient gene trap screening for novel developmental genes using IRES β
geo vector and in vitro preselection. Exp. Cell Res., 244, 125–136.
Catteruccia, F., Nolan, T., Blass, C., Muller, H.M., Crisanti, A., Kafatos, F.C.
and Loukeris, T.G. (2000a) Toward Anopheles transformation: Minos
element activity in anopheline cells and embryos. Proc. Natl Acad. Sci.
USA, 97, 2157–2162.
Catteruccia, F., Nolan, T., Loukeris, T.G., Blass, Savakis, C., Kafatos, F.C.
and Crisanti, A. (2000b) Stable germline transformation of the malaria
mosquito Anopheles stephensi. Nature, 405, 959–962
Franz, G. and Savakis, C. (1991) Minos, a new transposable element from
Drosophila hydei, is a member of the Tc1-like family of transposons.
Nucleic Acids Res., 19, 6646.
Franz, G., Loukeris, T.G., Dialektaki, G., Thompson, C.R. and Savakis, C.
(1994) Mobile Minos elements from Drosophila hydei encode a two-exon
transposase with similarity to the paired DNA-binding domain. Proc.
Natl Acad. Sci. USA, 91, 4746–4750.
Friedrich, G. and Soriano, P. (1991) Promoter traps in embryonic stem cells:
a genetic screen to identify and mutate developmental genes in mice.
Genes Dev., 5, 1513–1523.
Goldman, L.A., Cutrone, E.C., Kotenko, S.V., Krause, C.D. and Langer, J.A.
(1996) Modifications of vectors pEF-BOS, pcDNA1 and pcDNA3 result
in improved convenience and expression. Biotechniques, 21, 1013–1015.
Gossler, A., Joyner, A.L., Rossant, J. and Skarnes, W.C. (1989) Mouse
embryonic stem cells and reporter constructs to detect developmentally
regulated genes. Science, 244, 463–465.
Gueiros-Filho, F.J. and Beverley, S.M. (1997) Trans-kingdom transposition
of the Drosophila element mariner within the protozoan Leishmania.
Science, 276, 1716–1719.
Hicks, G.G., Shi, E.G., Li, X.M, Li, C.H., Pawlak, M. and Ruley, H.E. (1997)
Functional genomics in mice by tagged sequence mutagenesis. Nature
Genet., 16, 338–244.
Ivics, Z., Hackett, P.B., Plasterk, R.H. and Izsvak, Z. (1997) Molecular
reconstruction of Sleeping Beauty, a Tc1-like transposon from fish, and its
transposition in human cells. Cell, 91, 501–510.
Klinakis, A.G., Loukeris, T.G., Pavlopoulos, A. and Savakis, C. (2000)
Mobility assays confirm the broad host range activity of the Minos
transposable element and validate new transformation tools. Insect Mol.
Biol., 9, 269–275.
Loukeris, T.G., Arca, B., Livadaras, I., Dialektaki, G. and Savakis, C. (1995a)
Introduction of the transposable element Minos into the germ line of
Drosophila melanogaster. Proc. Natl Acad. Sci. USA, 92, 9485–9489.
Loukeris, T.G., Livadaras, I., Arca, B., Zabalou, S. and Savakis, C. (1995b)
Gene transfer into the medfly, Ceratitis capitata, with a Drosophila hydei
transposable element. Science, 270, 2002–2005.
EMBO Reports vol. 1 | no. 5 | 2000 421
Transposon mediated mutagenesis in human cells
scientific reports
Luo, G., Ivics, Z., Izsvak, Z. and Bradley, A. (1998) Chromosomal
transposition of a Tc1/mariner-like element in mouse embryonic stem
cells. Proc. Natl Acad. Sci. USA, 95, 10769–10773.
Maruyama, I.N., Rakow, T.L. and Maruyama. H.I. (1995) cRACE: a simple
method for identification of the 5′ end of mRNAs. Nucleic Acids Res., 23,
3796–3797.
Parinov, S and Sundaresan, V. (2000) Functional genomics in arabidopsis:
large-scale insertional mutagenesis complements the genome sequencing
project. Curr. Opin. Biotechnol., 11, 157–161.
Ryo, A., Kondoh, N., Wakatsuki, T., Hada, A., Yamamoto, N. and
Yamamoto, M. (1998) A method for analysing the qualitative and
quantitative aspects of gene expression: a transcriptional profile revealed
for HeLa cells. Nucleic Acids Res., 26, 2586–2592.
Schouten, G.J., van Luenen, H.G., Verra, N.C., Valerio, D. and Plasterk, R.H.
(1998) Transposon Tc1 of the nematode Caenorhabditis elegans jumps in
human cells. Nucleic Acids Res., 26, 3013–3017.
Shimizu, K., Kamba, M., Sonobe, H., Kanda, T., Klinakis, A.G., Savakis, C.
and Tamura, T. (2000) Extrachromosomal transposition of the
transposable element Minos occurs in embryos of the silkworm Bombyx
mori. Insect Mol. Biol., 9, 277–281.
Skarnes, W.C., Moss, J.E., Hurtley, S.M. and Beddington, R.S. (1995)
Capturing genes encoding membrane and secreted proteins important for
mouse development. Proc. Natl Acad. Sci. USA, 92, 6592–6596.
Walbot, V. (2000) Saturation mutagenesis using maize transposons. Curr.
Opin. Plant Biol., 3, 103–107.
Whitney, M., Rockenstein, E., Cantin, G., Knapp, T., Zlokarnik, G., Sanders,
P., Durick, K., Craig, F.F. and Negulescu, P.A. (1998) A genome-wide
functional assay of signal transduction in living mammalian cells. Nature
Biotechnol., 16, 1329–1333.
Wiles, M.V.et al. (2000) Establishment of a gene-trap sequence tag library to
generate mutant mice from embryonic stem cells. Nature Genet., 24, 13–
14.
Wilson, C., Pearson, R.K., Bellen, H.J., O’Kane, C.J., Grossniklaus, U. and
Gehring, W.J. (1989) P-element-mediated enhancer detection: an
efficient method for isolating and characterizing developmentally
regulated genes in Drosophila. Genes Dev., 3, 1301–1313.
Wurst, W. et al. (1995) A large-scale gene-trap screen for insertional
mutations in developmentally regulated genes in mice. Genetics, 139,
889–899.
Yant, S.R., Meuse, L., Chiu, W., Ivics, Z., Izsvak, Z. and Kay, M.A. (2000)
Somatic integration and long-term transgene expression in normal and
haemophilic mice using a DNA transposon system. Nature Genet., 25,
35–41.
Zambrowicz, B.P., Friedrich, G.A., Buxton, E.C., Lilleberg, S.L., Person, C.,
and Sands, A.T. (1998) Disruption and sequence identification of 2000
genes in mouse embryonic stem cells. Nature, 392, 608–611.
Zhang, L., Sankar, U., Lampe, D.J., Robertson, H.M., and Graham, F.L.
(1998) The Himar1 mariner transposase cloned in a recombinant
adenovirus vector is functional in mammalian cells. Nucleic Acids Res.,
26, 3687–93.
DOI: 10.1093/embo-reports/kvd089