The Plant Journal (2004) 40, 428-438 doi: 10.1111/J.1365-313X.2004.02219.X TECHNICAL ADVANCE Visualization of protein interactions in living plant cells using bimolecular fluorescence complementation Michael Walter1, Christina Chaban2, Katia Schütze2, Oliver Bat ist ic1, Katrin Weckermann3, Christian Näke2, Dragica Blazevic1, Christopher Grefen2, Karin Schumacher3, Claudia (Decking3, Klaus Harter2'* and Jörg Kudla1 * Institut für Botanik und Botanischer Garten, Molekulare Entwicklungsbiologie der Pflanzen, Universität Münster, Schlossplatz 4, 48149 Münster, Germany, 2Botanisches Institut, Universität zu Köln, Gyrhofstr. 15, 50931 Köln, Germany, and 3ZMBP, Pflanzenphysiologie, Universität Tübingen, Auf der Morgenstelle 1, 72076 Tübingen, Germany Received 24 June 2004; revised 6 August 2004; accepted 12 August 2004. "For correspondence (fax +49 251 83 23311; e-mail jkudla@uni-muenster.de: fax +49 221 470 7765; e-mail klaus.harter@uni-koeln.de). Dynamic networks of protein-protein interactions regulate numerous cellular processes and determine the ability to respond appropriately to environmental stimuli. However, the investigation of protein complex formation in living plant cells by methods such as fluorescence resonance energy transfer has remained experimentally difficult, time consuming and requires sophisticated technical equipment. Here, we report the implementation of a bimolecular fluorescence complementation (BiFC) technique for visualization of protein-protein interactions in plant cells. This approach relies on the formation of a fluorescent complex by two non-fluorescent fragments of the yellow fluorescent protein brought together by association of interacting proteins fused to these fragments (Hu et a/., 2002). To enable BiFC analyses in plant cells, we generated different complementary sets of expression vectors, which enable protein interaction studies in transiently or stably transformed cells. These vectors were used to investigate and visualize homodimerization of the basic leucine zipper (bZIP) transcription factor bZIP63 and the zinc finger protein lesion simulating disease 1 (LSD1) from Arabidopsis as well as the dimer formation of the tobacco 14-3-3 protein T14-3c. The interaction analyses of these model proteins established the feasibility of BiFC analyses for efficient visualization of structurally distinct proteins in different cellular compartments. Our investigations revealed a remarkable signal fluorescence intensity of interacting protein complexes as well as a high reproducibility and technical simplicity of the method in different plant systems. Consequently, the BiFC approach should significantly facilitate the visualization of the subcellular sites of protein interactions under conditions that closely reflect the normal physiological environment. Keywords: bimolecular fluorescence complementation, protein-protein interaction, intracellular localization, bZIP transcription factor, 14-3-3 proteins, LSD1. Summary Introduction The regulation and execution of biological processes requires specific interactions of numerous proteins. Tightly regulated protein interaction networks mediate cellular responses to environmental cues and direct the implementation of developmental programs. The selectivity of protein-protein interactions and their appropriate temporal and spatial regulation determine the developmental potential of the cell and its response to endogenous and exogenous signals. On the molecular level differential protein-protein interactions are thought to determine the operation of complex regulatory circuits and signal transduction systems. The complete sequencing of an increasing number of eukaryotic genomes has provided a wealth of information about the number and complexity of protein functions 428 © 2004 Blackwell Publishing Ltd Protein interaction in plant cells 429 required to build up an organism. However, the regulation and interplays of these proteins remain to become explored in order to appreciate the molecular mechanisms of their action. Several methods have been developed to identify, examine and visualize protein interactions and protein complexes in living cells. Among them, the yeast two-hybrid system has significantly advanced the speed and extent of protein interaction studies. However, this system bears intrinsic limitations as for example systematic'false-positive' and 'false-negative' interactions and, moreover, usually combines protein pairs in a heterologous environment (Field and Song, 1989; Stephens and Banting, 2000). The most widely used approach for the visualization of protein interactions in living cells is fluorescence resonance energy transfer (FRET) between spectral variants of the green fluorescence protein (GFP) fused to the associating proteins (Chen et al., 2003; Periasamy, 2000). However, to enable observation and quantification of small alterations in fluorescence emission, the GFP fluorophores have to join in close spatial proximity and the fusion proteins generally have to be expressed in high levels. Furthermore, verification, whether changes in fluorescence emission are caused by energy transfer, requires complicated irreversible photobleaching or fluorescence lifetime imaging techniques (Chen et al., 2003; Periasamy, 2000). However, the instrumental equipment necessary for these techniques is not widely available and FRET requires intensive methodical training. For these reasons reports about FRET-based protein-protein interaction investigations in living cells have remained rare especially in plant science (Immink et al., 2002; Mas et al., 2000; Shah et al., 2002; Vermeer et al., 2004). Alternatively, protein interactions can also be investigated in vivo if the protein complex formation can be visualized by the restoration of a detectable activity. In this regard, the principle of intragenic complementation of the lacZ locus from Escherichia co//was adapted to detect protein interactions (Rossi etal, 1997; Ullmann et al, 1967). In this experimental system the detection of protein-protein interactions by restoration of p-galactosidase activity was enabled by using p-galactosidase fragments, which could associate only when fused to interacting proteins. Similarly, fragments of the dihydrofolate reductase have been used in protein interaction studies based on complementation of protein function (Pelletier etal., 1998). However, these techniques require the application of extrinsic fluorophores to visualize the complex formation. An alternative experimental approach for the visualization of protein interactions is based on the formation of a fluorescent complex by fragments of the enhanced yellow fluorescent protein (YFP) when brought together by the interaction of two associating partners fused to these fragments. Recently, Kerppola and colleagues (2002) reported a proof-of-concept for such an approach for the investigation of protein interactions in living mammalian cells and designa- ted this technique as bimolecular fluorescence complementation (BiFC). The unique characteristic of the BiFC approach is that the bright intrinsic fluorescence of the bimolecular complex allows direct visualization of the complex formation in living mammalian cells. Moreover, by analyzing the interactions between members of the basic leucine zipper (bZIP) and Rel transcription factor families, the BiFC approach provided direct evidence of the intracellular locations where the protein association occurs (Hu et al., 2002). The application of the BiFC approach has recently been extended to the investigation of the interaction pattern and intracellular localization of G-protein complexes in mammalian cells and Dictyostelium discoideum (Hynes et al., 2004) and to the visualization of 1-aminocyclopropane-1-carboxylase synthase heterodimer formation in E. coli (Tsuchisaka and Theologis, 2004). Furthermore, by introducing a large number of different GFP variants the technique was extended to multicolor BiFC, which allows the direct visualization of multiple protein interactions within the same cell (Grinberg et al., 2004; Hu and Kerppola, 2003). In this report we describe the generation of several sets of plant-compatible BiFC vectors. We used these vectors for investigating the interaction of plant nuclear and cytoplasmic proteins in different plant systems. Our study attests the general applicability of the BiFC technique and that this assay represents an efficient and convenient tool to investigate protein-protein interactions in living plant cells. Results Generation of plant-compatible BiFC transformation vectors To develop the BiFC technology for the visualization of protein-protein interactions in living plant cells, we constructed four pairs of vectors (Figure 1; for further details see Experimental procedures and Supplementary material). These vectors have been designated pSPYNE and pSPYCE (for split YFP N-terminal/C-terminal fragment expression) respectively. Each vector pair enables the expression of proteins of interest fused either to the N-terminal 155 amino acids (YFPN) or to the C-terminal 86 amino acids of YFP (YFPC; Hu et al., 2002). Moreover the plasmids contain either a c-myc (pSPYNE) or HA (pSPYCE) affinity tag for detection of fusion protein expression in cell extracts (Figure 1). The binary pSPYNE-KAN and pSPYCE-BAR vectors enable the expression of YFP fragment-fused genomic DNA or of YFP-fragment constructs driven by any promoter of interest (Figure 1). Strong and constitutive expression of fusion proteins in plant cells is ensured by the binary pSPYNE-35S and pSPYCE-35S plasmids which contain the 35S promoter of the cauliflower mosaic virus. For selection of transgenic plants pSPYNE-KAN and pSPYNE-35S carry a nos promoter-driven kanamycin resistance gene (nptll), whereas pSPYCE-BAR and pSPYCE-35S harbor the bar gene conferring © Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 428-438 430 Michael Walter et al. (a) pSPYNE-Kan pSPYCE-Bar c-myc MCS MCS [ HA [ YFP' (aa 1-155) NosT YFP (aa 156-239) NosT (b) pSPYNE-35S/pUC-SPYNE c-myc 35S MCS I YFP' (aa 1-155) NosT pSPYCE-35S/pUC-SPYCE HA ^ 35S j MCsJ YFP (aa 156-239) NosT (C) pUC-SPYNE0 ss ^35S pUC-SPYCEG __ 35S ľpulOI ACC65I ^mal ^3tul AscI |SpeI pamHI plal |SalI |XhoI | |KpnI | ^Smal CTCTÄGAGTTAÄCCGGGCTCAGGCCTGGCGCGCCÄCTAGTGGATCCÄTCGATAGTACTGTCGACCTCGAGGGTACCGCTCCCGGGATG SRVNRAQAWRAT SGS IDS TVDLEGTAPGM attR1 cdB c-myc attR2 YFP (aa 1-155) NosT attR 1 - &cdB HA attR2 YFP" (aa 156-239) NosT Figure 1. Schematic representation of plant-compatible BiFC vectors. (a) pSPYNE-Kan and pSPYCE-Bar. (b) pSPYNE-35S/pUC-SPYNE and pSPYCE-35S/pUC-SPYCE. (c) pUC-SPYNEG and pUC-SPYCEG. Details of the plasmid construction and vector back bones are given in Experimental procedures and in Figures S1 and S2. c-myc, c-myc affinity tag; HA, hemagglutinin affinity tag; MCS, multi-cloning site; 35S, 35S promoter of the cauliflower mosaic virus; NosT, terminator of the A/osgene; YFPN, N-terminal fragment of YFP reaching from amino acid (aa) 1 to 155; YFPC, C-terminal fragment of YFP reaching from amino acid 156 to 239; attR1-CmR-ccdB-attR2, Gateway conversion cassette. insensitivity to the herbicide glufosinate (Figure 1). In addition, we generated two additional sets of vectors based on pUC19 that are specially designed for transient plant cell transformation approaches. pUC-SPYNE and pUC-SPYCE contain the entire expression cassette of pSPYNE-35S or pSPYCE-35S, respectively, and harbor a more variable multi-cloning site (MCS) (Figure 1). Furthermore, in a second set the entire MCSs of pUC-SPYNE and pUC-SPYCE were replaced by the Gateway conversion cassette providing the attR1 and attR2 recombination sites for use with the Gateway cloning system (pUC-SPYNEG, pUC-SPYCĚ3, Figure 1). BiFC analysis of Arabidopsis nuclear bZIP63 To address the feasibility of BiFC for visualization of protein-protein interaction in living plant cells we first choose a member of the Arabidopsis bZIP factor family (bZIP63, AGI: At5g28770) as a model protein. bZIP63 belongs to subfamily C of Arabidopsis bZIP factors (Jakoby et al., 2002). This transcription factor binds to promoter elements containing the CACGTG or GACGTC sequence in w'froand is localized to the nucleus of plant cells (Nake, 2001). Moreover, bZIP transcription factors are known to form homodimers and heterodimers via the C-terminal leucine zipper domain (Siberil et al., 2001). To first investigate the interaction potential of bZIP63 by an independent experimental approach, we performed an interaction analysis in the yeast two-hybrid system. As shown in Figure 2, bZIP63 formed homodimers in vivo as demonstrated by the growth of transformants on interaction selective medium and induction of p-galactosidase reporter activity above background level. To corroborate that the © Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 428-438 Protein interaction in plant cells 431 I II O 0 5 1 0 1,5 2-0 2.5 3,0 3.5 4,0 CSM - L, W CSNI - L, W, A gal actos Was« acti vi ty (un its) Figure 2. Homodimerization of bZIP63 and bZIP63 in yeast. The indicated Gal4 DNA-binding domain (BD) and activation domain (AD) constructs were transformed into yeast strain PJ69-4A. Transformants were assayed for the activity of protein-protein interaction reporting genes either by growth in decreasing densities (narrowing triangle) on selective medium (I: CSM-L,W,A) or determination of p-galactosidase activity (II). CSM-L,W(I) depicts a dilution series on non-selective control plates. bZIP63pp represents a mutated version of bZIP63 in which Leu188 and Leu195 have been mutated to Pro. homodimer formation is mediated by the leucine zipper we introduced two point mutations in the bZIP63 sequence which changed Leu188 and Leu195 into Pro. Leu188 and Leu195 are the first two hydrophobic amino acids in the C-terminal zipper-forming amphipathic a-helix of the bZIP63 monomers. Therefore, conversion of these positions into prolines is likely to interfere with the dimerization potential of the protein (Siberil et al., 2001). The combination of wild type bZIP63 with the mutated version (bZIP63pp) reduced expression of the reporter genes (Figure 2). It is noteworthy that in yeast mutation of Leu188 and Leu195 to proline does not completely abolish homodimerization of bZIP63 (Figure 2). In summary, these data indicate that the leucine zipper domain is predominantly responsible for bZIP homodimer formation in yeast. We next attempted the direct visualization of homodimerization in living plant cells. To this end, we transiently transfected Arabidopsiscell culture protoplasts with various pUC-SPYNE/pUC-SPYCE constructs of bZIP63 and, in addition to microscopic analysis, quantified the fluorescence intensity. Whereas cells transfected with single plasmids and any combination with empty vectors produced no or only background fluorescence, a strong signal was observed when bZIP63-YFPN was co-expressed with bZIP63-YFPc (Figure 3a,b). Significantly weaker fluorescence signals were observed when combinations of bZIP63pp with wild type bZIP63were transfected, thereby reflecting reduction in homodimerization by these mutations (Figure 3a,b). Generally the number of BiFC signal-emitting protoplasts was about the half compared with cells expressing full-length GFP fusion proteins. This difference corresponds to the reduced efficiency when more than one construct is used for transfection. To test the functionality of the binary BiFC vectors in planta, the wild type bZIP63 and bZIP63pp cDNAs were cloned into pSPYNE-35Sand pSPYCE-35S, respectively. The constructs were delivered into leaf cells of tobacco (Nicoti-ana benthamiana) by Agrobacterium infiltration (Voinnet et al., 2003; Witte et al., 2004). Similar to the situation in Arabidopsis protoplasts strong YFP fluorescence was observed when wild type combinations of bZIP63 were expressed (Figure 4a, panels I, II). Pairwise expression of bZIP63 and bZIP63pp, bZIP63pp alone or in combination with the YFP fragments induced no or only weak fluorescence signals (Figure 4a, panels I, II and data not shown). Using HA- and c-myc-tag-specific antibodies the expression of all fusion proteins in tobacco cells was demonstrated (Figure 4a, panel III). Notably, we observed that the transformation efficiency of /4grobacfer/um-infiltrated tobacco cells strongly depends on the constructs used. For instance, whereas 80% of epidermal cells which have been infiltrated with bZIP63-YFPN and bZIP63-YFPc-carrying Agrobacteria © Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 428-438 432 Michael Walter et al. bzi p&app-yfpn*zi pea pp-yfp0 t*-% Trk'%. -5, bZIP63-VFPNJbZl P63pp-Y FPC • •*1 t)ZIP63PP-GFF • II Figure 3. BiFC visualization of bZIP63 dimeriza-tion in transiently transfected Arabidopsis thali-ana cell culture protoplasts. (a) Epifluorescence (I) and bright field images (II) images of Arabidopsis cell culture protoplasts co-transfected with constructs encoding the indicated fusion proteins. (b) Quantification of fluorescence intensities in transiently transfected Arabidopsis cell culture protoplasts. Fluorescence intensity (arbitrary units) was determined using the Metamorph software. The mean and standard deviation of three independent measurements are shown. (c) bZIP63-GFP and bZIP63pp-GFP are localized to the nucleus. Epifluorescence (I) and bright field (II) images of protoplasts transfected with constructs expressing the indicated fusion proteins. Scale bars, 20 (jm. t>ZIPe3-GFP vfp%zip63-yfpc showed BiFC-induced fluorescence, LSD1 homodimer formation (see Figure 7) was observed in only 20% of the cells. In transfected Arabidopsis protoplasts and infiltrated tobacco leaves the homodimerization-induced YFP fluorescence appeared exclusively inside the nucleus which is in agreement with the observation that bZIP63-GFP and bZIP63pp-GFP are nuclear proteins (Figures 3c and 4b). BiFC analysis of proteins in the cytoplasm of plant cells To further extend the applicability of BiFC beyond bZIP transcription factors we analyzed a 14-3-3 protein (isoform T14-3c from N. tabacum; GenBank: NTU91724) and the zinc finger protein LSD1 from Arabidopsis thaliana (Dietrich et al., 1997) by BiFC analyses in Arabidopsis protoplasts and /4grobacfer/um-infiltrated tobacco leaves respectively. 14-3-3 proteins form a conserved family of eukaryotic polypeptides that were the first signaling molecules identified as discrete phosphoserine/phosphothreonine-binding modules. They associate to homodimers or heterodimers with a saddle-shaped structure, with each monomer forming an extended groove that allows binding of the phosphoryl-ated sequence motif (Rittinger et al., 1999; Wurtele et al., 2003). Dimerization of 14-3-3 proteins occurs via their N-terminal region. Accordingly, yeast two-hybrid analyses revealed that an N-terminally truncated version of T14-3c is © Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 428-438 Protein interaction in plant cells 433 (a) i li \\i bzipsa bz i pea- YFPt>*Vbzi pea- yfp" bZI PSS^-YFP be/bZ IP63-YFP" bZIP63-YFPbc/YFPN 1 - ■ * bZIP63::qfp bZIP63pp;:GFP Figure 4. BiFC visualization of bZIP63 dimerization in Agrobacterium-infiltrated tobacco {Nicotiana benthamiana) leaves. (a) Epifluorescence (I) and bright field (II) images of epidermal leaf cells infiltrated with a mixture of Agrobacterium suspensions harboring constructs encoding the indicated fusion proteins. In addition, the second panel from above shows a confocal image of BiFC-induced bZIP63 dimerization. For technical details of infiltration see Experimental procedures. The expression of the proteins (III) is demonstrated by immunodetection with anti-HA (a-HA) antibodies for YFPC fusions and anti-c-myc (a-c-myc) for YFPN fusions. *, degradation product. (b) bZIP63-GFP and bZIP63pp-GFP are both localized to the nucleus of plant cells. Epifluorescence images of Agrolbacfer/um-infiltrated tobacco (A/, benthamiana) epidermal cells are shown. Scale bars, 50 (jm. no longer able to homodimerize (Jaspert and Oecking, 2002). For BiFC studies the cDNAs encoding wild type T14-3c (T14) and the mutant version (THAN) were cloned into pUC-SPYNE and pUC-SPYCE or pSPYNE-35S and pSPYCE-35S, respectively, and transformed into either Arabidopsis protoplasts or tobacco leaf cells. Upon co-expression of T14- (a) T144N-YFPN/ T14-YFPN/ T14AN-YFPN/ T14-YFP"V T14AN-YFPC T14-YFPC T14-YFF« T14AN-YFPC (b) £c) TI4-3C-GFP kDa 1 ft Figure 5. The tobacco 14-3-3 protein T14-3c interacts in Arabidopsis cell culture protoplasts. (a) Bright field (I) and epifluorescence (II) images of Arabidopsis cell culture protoplasts co-transfected with constructs encoding the indicated fusion proteins. (b) T14-3c-GFP is localized to the cytoplasm and nucleus. Bright field (I) and epifluorescence (II) images of protoplasts transfected with a construct expressing T14-3c-GFP are depicted. (c) Demonstration of protein expression by immunodetection with anti-HA (a-HA) antibodies for YFPC fusions and anti-c-myc (a-c-myc) for YFPN fusions. Extracts from protoplasts co-transfected with the constructs indicated in (a) are shown (lanes 1-4). Scale bars, 20 (jm. YFPN and T14-YFPC, strong YFP fl uorescence was detected throughout the cytoplasm and the nucleus in both systems indicating that homodimerization occurs in both compartments (Figures 5a and 6a). In transformed epidermal cells of tobacco the cytoplasmic fluorescence typically appears as a thin area between the cell wall and the turgescent vacuole. Plasmolysis of the cells by treatment with 500 mwi mannitol demonstrated the localization of the BiFC signal in the cytoplasm (data not shown). Importantly, the localization of homodimer formation corresponds to the subcellular distribution of T14-3c, when expressed as GFP fusion in protoplasts or tobacco leaf cells under the control of the 35S promoter (Figures 5b and 6b). In contrast, expression of neither the N-terminal truncated form THAN fused to the YFP fragments nor any combination of wild type with the truncated version resulted in a YFP signal (Figures 5a and 6a). Western blot analysis confirmed that the expression of © Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 428-438 434 Michael Walteret al. (a) T14~YFPM/ T14AN-YFPfV (b) T14- yfpc T14A n-yfpc T14-3c-g fp Figure 6. BiFC visualization of T14-3c dimerization in tobacco leaves. (a) Confocal (I) and bright field (II) images of epidermal leaf cells from Nicotiana benthamiana infiltrated with a mixture of Agrobacterium suspensions harboring constructs encoding the indicated fusion proteins. For technical details of infiltration see Experimental procedures. (b) T14-3c-GFP is localized to the cytoplasm and nucleus. Confocal (I) and bright field (II) images of stably transformed N. tabacum epidermal cells are depicted. (c) Demonstration of protein expression by immunodetection with anti-HA (a-HA) antibodies for YFPC fusions and anti-c-myc (a-c-myc) for YFPN fusions. Extracts from tissue co-transformed with constructs co-expressing either T14-YFPN and T14-YFPC (lane 1) or T14AN-YFPN and T14AN-YFPC (lane 2) are shown. the non-interacting T14-3c fusion proteins was comparable with the expression of the interacting form of T14-3c (Figures 5c and 6c). LSD1 is a small zinc finger protein that forms homodimers in vivo and functions as a negative regulator of programmed cell death in plants (Dietrich et al., 1997; Epple et al., 2003). As observed for the T14-3c homodimer, co-expression of LSD1-YFPN and LSD1-YFPC induced strong fluorescence in the cytoplasm and the nucleus of infiltrated tobacco cells, whereas control pairs gave no or only a very weak YFP signal (Figure 7a and data not shown). Again, the location of LSD1 homodimer formation is identical to the localization of LSD1-YFP when expressed under the control of the 35S promoter in transgenic Arabidopsis plants (Figure 7b). To test the specificity of LSD1 protein association, we analyzed the interaction of bZIP63 and LSD1 in co-transformed tobacco leaf cells. This protein pair was chosen because in the yeast two-hybrid system bZIP63 does not interact with LSD1 (Nake, 2001). As shown in Figure 7, co-expression of bZIP63 and LSD1 in any combination revealed no fluorescence, although the fusion proteins were expressed. II III LSD1 LSD1-YFP^/LSD1-YFPC LSD1-YFPN/bZIP63-YFPc & < c 1 5 * LSD1-YFP Figure 7. LSD1 forms homodimers in planta but does not interact with bZIP63. (a) Epifluorescence (I) and bright field (II) images of epidermal leaf cells infiltrated with a mixture of Agrobacterium suspensions harboring constructs encoding the indicated fusion proteins. For technical details of infiltration see Experimental procedures. The expression of the proteins (III) is demonstrated by immunodetection with anti-HA (a-HA) antibodies for YFPC fusions and anti-c-myc (a-c-myc) for YFPN fusions. (b) LSD1-YFP is localized to the nucleus and cytoplasm of Arabidopsis cells. Epifluorescence (I) and bright field (II) images of hypocotyl cells from transgenic Arabidopsis plants which express LSD1-YFP are depicted. Scale bars, 50 (jm. Discussion In this report we establish BiFC as a very efficient technology for the analysis of protein-protein interactions in living plants cells. The vectors described are readily suitable for BiFC analyses in Arabidopsis protoplasts and /4grobacfer/um-infiltrated tobacco leaves. They also allow determination of protein expression levels by Western blot analysis. The binary BiFC vectors will also enable interaction and protein complex formation studies in transgenic plants. However, at high expression levels the free YFP fragments sometimes tend to associate non-specifically, thereby © Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 428-438 Protein interaction in plant cells 435 generating background fluorescence (Figure 3a,b). This problem can be circumvented, when a non-interacting fusion protein is used in the control experiments as exemplarily shown for the THAN and bZIP63/LSD1 pairs, or if the expression level is reduced by the use of a less active promoter. Our BiFC analyses of interactions among bZIP63, T14-3c and LSD1 in living plant cells illustrate several significant advantages of this technique (Hu et al., 2002). (i) Protein interactions using BiFC are visualized in the normal environment of the plant cell. Several restrictions inherent to interaction approaches in heterologous systems (e.g. yeast), as for instance missing plant-specific post-translational protein modifications or incorrect subcellular localization, are overcome by BiFC. From a technical point of view the detection of BiFC-generated interactions does not require accessibility of the protein complex to extrinsic fluorophores and does not require the instrumental equipment necessary for FRET including subsequent complex data processing, (ii) Compared with published FRET data (Immink et al., 2002; Mas et al., 2000; Shah et al., 2002; Vermeer et al., 2004) the BiFC signals observed in our study using the strong viral 35S promoter for the expression of the fusion proteins appear to be very intense. Comparison of the microscopic exposure times suggest that for a given protein interaction the BiFC fluorescence intensity can reach about 30% of the signal intensity of the corresponding full-length GFP. From these data we conclude that BiFC is very sensitive and may allow the detection of interactions when the proteins are expressed at lower levels under the control of native promoters. As demonstrated by our study and recent reports (Grinberg et al., 2004; Hynes et al., 2004) BiFC-generated fluorescence signals can also be quantified. Thus, the ability of a protein to form different complexes with different interaction partners can be quantitatively determined at the cellular or even the subcellular level (Grinberg et al., 2004). (iii) The most appealing advantage of BiFC is that protein interaction occurs in the genuine compartment of the proteins examined. Arabidopsis bZIP63 is a nuclear transcriptional regulator and homodimer formation is exclusively detected by BiFC inside the nucleus. When expressed under the control of the viral 35S promoter, tobacco T14-3c and Arabidopsis LSD1 accumulate in the cytoplasm and in the nucleus. Again, BiFC dimer formation strictly coincides with observed localization in these compartments. This should enable the identification of the subcellular distribution of interaction between regulatory proteins like transcription factors and signaling components and may immediately provide information about the functional role of the association. For instance, in mammalian HEK-293 cells BiFC analyses revealed that the different p subunits of G proteins direct the corresponding p-y signaling complexes to alternative subcellular locations (Hynes et al., 2004). Furthermore in, mammalian cell lines using BiFC Kerppola and colleagues demonstrated that the cytoplasmic transcription factor Mad4 was recruited to the nucleus through dimeriza-tion with Max (Grinberg et al., 2004) and were able to identify the intramolecular region responsible for the differential intracellular distribution of ATF2/Jun heterodimers (Hu et al., 2002). (iv) Formation of the BiFC protein complex occurs through a multistep pathway in vitro and very likely in vivo (Hu et al., 2002). The initial steps are mediated by contacts between the proteins fused to the YFP fragments and are reversible. At this initial state complex formation can be competed by alternative interaction partners. Afterwards the initial complex is stabilized by the association of YFP fragments and further exchange of protein components is inhibited (Hu et al., 2002). Therefore, the kinetics of BiFC formation allows the detection of weak and transient protein complexes in vivo but has the disadvantage that shifts in the equilibrium between putative alternative complexes may hardly be detectable after initial formation. However, we expect that the dynamics of BiFC protein complex formation is still maintained or can be still modified by the cellular protein folding and degradation machinery, (v) The structural background of protein complex formation can likewise be investigated by BiFC. For instance, truncation of the N-terminal region of the tobacco T14-3c protein or point mutations within the C-terminal leucine zipper of Arabidopsis bZIP63 identified these domains to be responsible for homodimerization in plant cells, (vi) In perspective, the BiFC approach enables the identification of signals that induce the formation of protein complexes or modulate their intracellular distribution in planta. Accordingly, it has been shown that a BiFC complex consisting of the ATF2-Jun heterodimer is translocated into the nucleus of mammalian COS cells after expression of the stress-activated p38 SAPK protein kinase (van Dam et al., 1995; Hu et al., 2002). From the studies in mammalian cells using a set of different Jun-YFPN and Fos-YFPc fusion polypeptides, it has been estimated that fluorescence complementation may occur when the YFP fragments are separated by an average distance of greater than 100 A (Hu et al., 2002). A prerequisite for complementation over long distance is sufficient flexibility of the protein backbone, to which the fragments are fused. This then allows association of the YFP fragments to stabilize the initial BiFC complex. Therefore, the dynamics of BiFC complex formation in combination with sufficient complementation over long distance may enable the identification of novel protein interactions in plant cells by genetic screens based, for example, on high-efficiency protoplast transformation accompanied by fluorescence-activated cell sorting (Birnbaum et al., 2003; Galbraith, 2004). Furthermore, by generating large populations of transgenic plants expressing distinct YFPN or YFPC fusion proteins, interaction screens can also be performed on whole plant level by crossing individual lines. © Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 428-438 436 Michael Walteret al. Experimental procedures Generation of plant BiFC vectors and plant expression constructs Molecular techniques were performed using standard protocols according to Sambrook and Russell (2001) and Kudla et al. (1999). To generate the vector system for BiFC analysis we amplified fragments of eYFP coding for the N-terminal 155 and C-terminal 84 aa, thereby introducing Xmal and Sad restriction sites for cloning and sequences for c-myc and HA affinity tags respectively. The PCR products were cloned into the Xmal and Sad sites of pGPTVII.Kan and pGPTVII.Bar resulting in pSPYNE-Kan and pSPYCE-Bar. The same PCR products were cloned via Xma\/Sac\ into pGPTVII.GFP. Kan and pGPTVII.GFP.Bar resulting in pSPYNE-35S and pSPYCE-35S (for pGPTVII vector series see Figure S1 and S2). The pUC19 derivatives were generated by replacing the entire expression cassette of psmGFP4 with the expression cassettes of pSPYNE-35Sand pSPYCE-35S via H/ndlll and EcoRI, resulting in pUC-SPYNE and pUC-SPYCE. These vectors were further modified to obtain the Gateway-compatible vectors pUC-SPYNE0 and pUC-SPYCE0. To this end, the entire multiple cloning site of pUC-SPYNE and pUC-SPYCEwas excised with Xba\ and Smal, and after blunting replaced with the Gateway vector conversion cassette B (Invitrogen, Carlsbad, CA, USA). The cDNA regions encoding the proteins and polypeptides investigated in this study were amplified from plasmid templates containing the corresponding cDNA by PCR using gene-specific primers and cloned into pGEM-T (Promega, Madison. Wl, USA) or pBluescript (Stratagene, La Jolla, CA, USA) respectively. Site-directed mutagenesis of the bZIP63 cDNA was carried out using the Quick-Change Site-directed Mutagenesis Kit according to the manufacturer's protocol (Stratagene). Primer sequences can be obtained upon request. PCR products were verified by sequencing and subsequently cloned into each of the BiFC vectors, pUC-SPYNE/ pSPYNE-35S and pUC-SPYCE/pSPYCE-35S by using the BamHV Sma\ (T14-3c, N-terminal truncated 14-3c), BamH\/Xho\ (bZIP63, bZIP63pp) or Sma\/BamH\ (LSD1) restriction sites. For the generation of GFP fusion constructs, the coding region of T14-3c was cloned via Kpn\/BamH\ into pCF203, those of bZIP63 and bZIP63ppv\a BamHV Xho\ into pGPTVII-GFP, and that of LSD1 via BamH\/Sma\ into pPCVB-YFP. Protoplast transfection, plant transformation, microscopic techniques, and quantification of fluorescence intensity Protoplasts were generated from 1-week-old Arabidopsis Col-0 suspension cell culture (Liu et al., 2003). The cells were collected by centrifugation at 400 gfor 5 min and the pellet was washed with 25 ml of cell wall digestion buffer lacking the digestion enzymes. Protoplasts were prepared and transformed according to the protocols of Merkle et al. (1996) and Negrutiu et al. (1987). Protoplasts were assayed for fluorescence 12-18 h after transfection. For infiltration of N. benthamiana, the Agrobacterium tumefaciens strain C58C1 carrying the pCH32 helper plasmid was infiltrated into the abaxial airspace of 2-4-week-old plants as described (Voinnet et al., 2003; Witte et al., 2004). The p19 protein of tomato bushy stunt virus was used to suppress gene silencing. Co-infiltration of Agrobacterium strains containing the BiFC constructs and the p19 silencing plasmid was carried out at OD6oo of 0.7:0.7:1.0. Epidermal cell layers of tobacco leaves were assayed for fluorescence 1-2 days after infiltration. Stable transformation of N. tabacum SNN and Arabidopsis thaliana (Col-0) with Agrobacterium was carried out as described previously (Bechthold era/., 1993; Martin era/., 1993). Microscopic techniques were performed according to Kircher et al. (1999) and images were processed using the Adobe Photoshop software package. Quantification of fluorescence signal intensity was carried out using the Metamorph software package (Universal Imaging Corporation Downington, PA, USA). Yeast two-hybrid interaction assays, protein extraction and assay, SDS-PAGE, Western blot and immunodetection Yeast two-hybrid interaction tests (in strain PJ69-4A) including growth and quantitative (3-galactosidase reporter gene assays were performed as described previously (Albrecht et al., 2001; Lohrmann et al., 2001). Transfected protoplasts and /4grot>acfer/um-infiltrated tobacco leaf discs were extracted under denaturing conditions using boiling SDS-sample buffer supplemented with 4 m urea (Harter et al., 1993). Protein assay, SDS-PAGE, Western blottransfer and immunodetection using HA- (Roche, Basel, Switzerland) and c-myc-specific (Sigma, St. Louis, MO, USA) antibodies has been described elsewhere (Harter era/., 1993). Acknowledgements We thank D. Baulcombe and T. Romeisfor the Agrobacterium strain C58C1, and the p19 construct and C. Frankhauser for the pCF203 plasmid. We are also very thankful to G. Freymark who introduced to us the Agrobacterium infiltration technique, to G. Fiene, C. Brancato, D. Kreuder, L. Rößner and C. Spitzer for excellent technical assistance and to D. Wanke for help in image processing. This work was supported by grants of the Deutsche Forschungsgemeinschaft to CO. (SFB 446), K.H. (SFB 635, HA 2146/3-2, 5-1) and to J.K. (931/4-1, 4-2). Note added in proof The usefulness of BiFC for in planta-protein interaction studies is also presented in the paper by Bracha-Drori et al. (2004), in this issue. Supplementary material The following material is available from http://www. blackwellpublishing.com/products/journals/suppmat/TPJ/TPJ2219/ TPJ2219sm.htm. Figure S1. (a) Schematic depiction of the series of pGPTVII vectors (kan, bar, hyg). Unique restriction sites are given in bold letter, others in italics. (b) Multiple cloning site of the pGPTVII vector series. Unique restriction sites (above the nucleotide sequence) are illustrated in normal letters. Restriction sites marked with * are not unique in pGPTVII.Bar. Figure S2. (a) Schematic depiction of the series of pGPTVII.GFP vectors (kan, bar, hyg). Unique restriction sites are given in bold letters, others in italics. (b) Multiple cloning site of pGPTVII. GFP vectors. Below the nucleotide sequence the amino acid sequence of the multiple cloning is illustrated, which is in frame to the first methionine of GFP (underlined). Unique restriction sites (above the nucleotide sequence) are illustrated in normal letters, others in italics. Restriction sites marked with * are not unique in pGPTVII.GFP.Bar. In pGPTVII.CFP and pGPTVII.YFP the GFP was replaced by the respective fluorescent marker proteins. © Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 428-438 Protein interaction in plant cells 437 References Albrecht, V., Ritz, 0., Under, S., Harter, K. and Kudla, J. (2001) The NAF domain defines a novel protein-protein interaction module conserved in Ca2+-regulated kinases. EMBO J. 20, 1051-1063. Bechthold, N., Ellis, J. and Pelletier, G. (1993) In planta Agrobac-fer/um-mediated gene transfer by infiltration of adult Arabid-opsis thaliana plants. CR. Acad. Sei. Paris Life Sei. 316, 1194-1199. Birnbaum, K., Shasha, D.E., Wang, J.Y., Jung, J.W., Lambert, G.M., Galbraith, D.W. and Benfey, P.N. (2003) A gene expression map of the Arabidopsis root. Science, 302, 1956-1960. Chen, Y., Mills, J.D. and Periasamy, A. (2003) Protein localization in living cells and tissues using FRET and FLIM. Differentiation, 71, 528-541. van Dam, H., Wilhelm, D., Herr, I., Steffen, A., Herrlich, P. and Angel, P. (1995) ATF-2 is preferentially activated by stress-activated protein kinases to mediate c-jun induction in response to geno-toxic agents. EMBO J, 14, 1798-1811. Dietrich, R.A., Richberg, M.H., Schmidt, R., Dean, C. and Dangl, J.L. (1997) A novel zinc finger protein is encoded by the Arabidopsis LDS1 gene and functions as negative regulator of plant cell death. Cell, 88, 685-694. Epple, P., Mack, A.A., Morris, V.R.F. and Dangl, J.L. (2003) Antagonistic control of oxidative cell death in Arabidopsis by two related, plant-specific zinc finger proteins. Proc. Natl Acad. Sei. USA, 100, 6831-6836. Field, S. and Song, O.K. (1989) A novel genetic system to detect protein-protein interactions. Nature, 340, 245-246. Galbraith, D.W. (2004) Cytometry and plant sciences: a personal retrospective. Cytometry, 58A, 37-44. Grinberg, A.V., Hu, C.-D. and Kerppola, T.K. (2004) Visualization of Myc/Max/Mad family dimers and the competition for dimeriza-tion in living cells. Mol. Cell. Biol. 24, 4294-4308. Harter, K., Talke-Messerer, C, Barz, W. and Schäfer, E. (1993) Light-and sucrose-dependent gene expression in photomixotrophic cell suspension cultures and protoplasts of rape (Brassica napus L). Plant J. 4, 507-516. Hu, C.-D. and Kerppola, T.K. (2003) Simultaneous visualization of multiple protein interactions in living cells using multicolour fluorescence complementation analysis. Nat. Biotechnol. 21,539-545. Hu, C.-D., Chinenov, Y. and Kerppola, T.K. (2002) Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation. Mol. Cell, 9, 789-798. Hynes, T.R., Tang, L, Mervine, S.M., Sabo, J.L., Yost, E.A., Devre-otes, P.N. and Berlot, C.H. (2004) Visualization of G protein ßy dimmers using bimolecular fluorescence complementation demonstrates roles for both ß and y in subcellular targeting. J. Biol. Chem. 279, 30279-30286. Immink, R.G.H., Gadella, T.W.J., Jr, Ferrario, S., Busscher, M. and Angenent, G.C. (2002) Analysis of MADS box protein-protein interactions in living plant cells. Proc. Natl Acad. Sei. USA, 99, 2416-2421. Jakoby, M., Weisshaar, B., Dröge-Laser, W., Vicente-Carbajosa, J., Tiedemann, J., Kroi, T. and Parcey, F. (2002) bZIP transcription factors in Arabidopsis. Trends Plant Sei. 7, 106-112. Jaspert, N. and Oecking, C. (2002) Regulatory 14-3-3 proteins bind the atypical motif within the C-terminus of the plant plasma membrane H+-ATPase via their typical amphipathic groove. Planta, 216, 136-139. Kircher, S., Wellmer, F., Nick, P., Rügner, A., Schäfer, E. and Harter, K. (1999) Nuclear import of the parsley bZIP transcription factor CPRF2 is regulated by phytochrome photoreceptors. J. Cell Biol. 144, 201-211. Kudla, J., Xu, Q., Harter, K., Gruissem, W. and Luan, S. (1999) Genes for calcineurin B-like proteins in Arabidopsis are differentially regulated by stress signals. Proc. Natl Acad. Sei. USA, 96, 4718-4723. Liu, LH., Ludewig, U., Frommer, W.B. and von Wiren, N. (2003) AtDUR3 encodes a new type of high-affinity urea/H+symporter in Arabidopsis. Plant Cell, 15, 790-800. Lohrmann, J., Sweere, U., Zabaleta, E., Bäurle, I., Keitel, C, Kozma-Bognar, L., Brennicke, A., Schäfer, E., Kudla, J. and Harter, K. (2001) The response regulator ARR2: a pollen-specific transcription factor involved in the expression of nuclear genes for components of mitochondrial complex I in Arabidopsis. Mol. Genet. Genomics, 265, 2-13. Martin, T., Frommer, W.B., Salanoubat, M. and Willmitzer, L (1993) Expression of an Arabidopsis sucrose synthase gene indicates a role in metabolization of sucrose both during phloem loading and in sink organs. Plant J. 4, 367-377. Mas, P., Devlin, P.F., Panda, S. and Kay, S.A. (2000) Functional interaction of phytochrome B and cryptochrome 2. Nature, 408, 207-211. Merkle, T., Ledere, D., Marshallsay, C. and Nagy, F. (1996) A plant in vitro system for the nuclear import of proteins. Plant J. 10, 1177-1186. Näke, C. (2001) Charakterisierung von CPRF2-homologen bZIP-Proteinen aus Arabidopsis thaliana unter besonderer Berücksichtigung ihrer intrazellulären Verteilung. Inaugural Dissertation. Biologische Fakultät, Universität Freiburg, Germany. Negrutiu, I., Shillito, R., Potrykus, I., Biasini, G. and Sala, F. (1987) Hybrid genes in the analysis of transformation conditions. Plant Mol. Biol. 8, 363-373. Pelletier, J.N., Campbell-Valois, F.X. and Michnick, S.W. (1998) Oligomerization domain-directed reassembly of active dihydrof-olate reductase from rationally designed fragments. Proc. Natl Acad. Sei. USA, 95, 12141-12146. Periasamy, A. (2000) Fluorescence resonance energy transfer microscopy: a mini review. J. Biomed. Opt. 6, 287-291. Rittinger, K., Budman, J., Xu, J., Volinia, S., Cantley, L.C., Smerdon, S.J., Gamblin, S.J. and Yaffe, M.B. (1999) Structural analysis of 14-3-3 phosphopeptide complexes identifies a dual role for the nuclear export signal of 14-3-3 in ligand binding. Mol. Cell, 4,153-166. Rossi, F., Charlton, C.A. and Blau, H.M. (1997) Monitoring protein-protein interactions in intact eukaryotic cells by ß-galactosidase complementation. Proc. Natl Acad. Sei. USA, 94, 8405-8410. Sambrook, J. and Russell, D.W. (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press. Shah, K., Russinova, E., Gadella, T.W.J., Willemse, J. and de Vries, S.C. (2002) Arabidopsis kinase-associated protein phosphatase controls internalization of the somatic embryogenesis receptor kinase 1. Genes Dev. 16, 1707-1720. Siberil, Y., Doireau, P. and Gantet, P. (2001) Plant bZIP G-box binding factors: modular structure and activation mechanisms. Eur. J. Biochem. 268, 5655-5666. Stephens, D.J. and Banting, G. (2000) The use of yeast two-hybrid screens in studies of protein:protein interactions involved in trafficking. Traffic, 1,763-768. Tsuchisaka, A. and Theologis, A. (2004) Heterodimeric interactions among the 1-amino-cyclopropane-1-carboxylate synthase polypeptides encoded by the Arabidopsis gene family. Proc. Natl Acad. Sei. USA, 101, 2275-2280. © Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 428-438 438 Michael Walteret al. Ullmann, A., Jacob, F. and Monod, J. (1967) Characterization by in vitro complementation of a peptide corresponding to an operator-proximal segment of the ß-galactosidase structural gene of Escherichia coli. J. Mol. Biol. 24, 339-343. Vermeer, J.E.M., Van Munster, E.B., Vischer, N.O. and Gadella, T.W.J., Jr (2004) Probing plasma membrane microdomains in cowpea protoplasts using lapidated GFP-fusion proteins and multimode FRET microscopy. J. Microsc. 214, 190-200. Voinnet, O., Rivas, S., Mestre, P. and Baulcombe, D. (2003) An enhanced transient expression system in plants based on sup- pression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J. 33, 949-956. Witte, C.-P., Noel, L.D., Gielbert, J., Parker, J.E. and Romeis, T. (2004) Rapid one-step purification from plant material using the eight-amino acid Strepll epitope. Plant Mol. Biol, (in press). WLirtele, M., Jelich-Ottmann, C, Wittinghofer, A. and Oecking, C. (2003) Structural view of a fungal toxin acting on a 14-3-3 regulatory complex. EMBO J. 22, 987-994. © Blackwell Publishing Ltd, The Plant Journal, (2004), 40, 428-438