ORIGINAL PAPER
Native-sized spider silk proteins synthesized
in planta via intein-based multimerization
Valeska Hauptmann • Nicola Weichert • Matthias Menzel •
Dominic Knoch • Norman Paege • Ju¨rgen Scheller •
Uwe Spohn • Udo Conrad • Mario Gils
Received: 20 July 2012 / Accepted: 5 September 2012
Ó Springer Science+Business Media B.V. 2012
Abstract The synthesis of native-sized proteins is a
pre-requisite for exploiting the potential of spider silk
as a bio-based material. The unique properties of
spider silk, such as extraordinary tensile strength and
elasticity, result from the highly repetitive nature of
spider silk protein motifs. The present report describes
the combination of spider silk flagelliform protein
(FLAG) production in the endoplasmic reticulum of
tobacco plant leaf cells with an intein-based posttranslational
protein fusion technology. The repeated
ligation of FLAG monomers resulted in the formation
of large multimers. This method avoids the need for
highly repetitive transgenes, which may result in a
higher genetic and transcriptional stability. Here we
show, for the first time, the production of synthetic, high
molecular weight spider silk proteins larger than
250 kDa based on the assembly of protein monomers
via intein-mediated trans-splicing in planta. The
resulting multimeric structures form microfibers, thereby
demonstrating their great potential as a biomaterial.
Keywords Spider silk Á Flagelliform protein Á
Intein Á Protein trans-splicing Á Microfibers Á Tobacco
Introduction
Spiders have evolved to produce a variety of proteinbased
silk materials, which are characterized by
remarkable levels of toughness, tensile strength and
elasticity (Craig 2004; Vollrath and Knight 2001).
Capture spiral (or flagelliform) silk is composed
exclusively of the FLAG protein. It can be stretched
to at least double its length before rupture, thereby
providing the high level of elasticity required to assure
prey capture (Vollrath and Edmonds 1989; Ko¨hler and
Vollrath 1995). Therefore, flagelliform silk perfectly
dissipates the kinetic impact energy of flying prey and
withstands the massive impact caused by the relative
high velocity of prey insects (Ro¨mer and Scheibel
2008). The elastic nature of the FLAG protein is based
on the presence of particular GPGGX repeats. The
protein is also characterized by helical GGX repeats.
The non-repetitive spacer elements provide the
necessary intra-molecular alignment of crystalline
Electronic supplementary material The online version of
this article (doi:10.1007/s11248-012-9655-6) contains
supplementary material, which is available to authorized users.
V. Hauptmann Á N. Weichert Á D. Knoch Á
N. Paege Á U. Conrad (&) Á M. Gils
Leibniz Institute of Plant Genetics and Crop Plant
Research (IPK), Corrensstrasse 3, 06466 Stadt Seeland,
OT Gatersleben, Germany
e-mail: conradu@ipk-gatersleben.de
M. Menzel Á U. Spohn
Fraunhofer Institute for Mechanics of Materials,
Walter-Hu¨lse-Strasse 1, 06120 Halle, Saale, Germany
J. Scheller
Medical Faculty, Institute of Biochemistry and Molecular
Biology II, Heinrich-Heine-University,
Universita¨tsstrasse 1, 40225 Du¨sseldorf, Germany
123
Transgenic Res
DOI 10.1007/s11248-012-9655-6
and other regions, which is required to present a
surface able to interact with other silk components
(Hayashi et al. 1999; Hayashi and Lewis 2000). The
size of spider silk proteins is assumed to be a key
determinant of the fiber’s mechanical properties, as all
native spider silks characterized to date contain
proteins larger than 250 kDa (Ayoub et al. 2007;
Sponner et al. 2005). Two additional essential characteristics
of large spider silk proteins are the high
frequency of motifs conducive for inter- and intrachain
interactions and the small number of chain end
defects. Recombinant spider silk proteins of native
size would extend the use of the structures derived
thereof, i.e., in medicine for the enhancement of
axonal regeneration and for the production of artificial
skin, as demonstrated for native silk fibers (Radtke et al.
2011; Wendt et al. 2011). The availability of suitable
cDNA sequences is crucial for the production of spider
silk proteins in any heterologous expression system. To
date, only two spider silk sequences are completely
known:theFLAGproteinofNephilaclavipesandamajor
ampullary silk protein of Latrodectus hesperus (Hayashi
and Lewis 2000; Ayoub et al. 2007; Ayoub and Hayashi
2008). In the present study, we used the FLAG protein of
Nephila clavipes to examine a plant expression approach.
In former studies, the heterologous production of
high molecular weight spider silk proteins has been
performed in E. coli. The material produced with this
technology could be spun out from hexafluoroisopropanol-solubilized
native-sized spider silk proteins.
However, its production requires the host to generate a
rapid and high supply of glycyl-t-RNA and optimized
synthesis of glycine (Xia et al. 2010). Therefore, less
rapidly growing organisms, such as transgenic plants,
have been selected as a promising alternative production
system to overcome the limitations associated
with t-RNA and amino acid synthesis. Recently, plantbased
protein expression via Agrobacterium-mediated
plant transformation resulted in the expression of
spider silk proteins and spider silk-ELP fusion proteins
of approximately 100 kDa in size (Scheller et al. 2001;
Scheller et al. 2004).
We aimed to develop a solution for the expression
of native-sized spider silk proteins and high molecular
weight repetitive proteins in general. Protein-splicing
by inteins has been demonstrated as a tool to assemble
protein subunits in planta (Yang et al. 2003). Inteins
are intervening protein elements that are autocatalytically
excised from precursor molecules and covalently
ligate the flanking protein sequences (exteins) via a
process termed protein splicing (Perler 1998). Inteins
catalyze cis-splicing reactions but are also able to
catalyze trans-splicing events between non-covalently
linked protein fragments (Saleh and Perler 2006). Here
we demonstrated that multimers of the FLAG spider
silk protein (of at least native size) could be produced
in plant systems and that the products can be
efficiently purified and characterized. We conclude
that posttranslational intein-mediated fusion of precursor
molecules is a suitable solution to circumvent
the problems of gene and mRNA instability that are
encountered in the synthesis of highly repetitive
recombinant proteins.
Materials and methods
Design of synthetic constructs
The synthetic InteinC::Flag::InteinN (IntC::Flag::IntN)
gene constructs [IntC::Flag(c-myc)::IntN, IntC::
Flag(His)::IntN] and an IntC::609 ELP::IntN construct
were generated by GENEART AG, Munich,
Germany. The FLAG gene motifs were selected from
public Nephila clavipes cDNAs (GenBank accession
nos. AF027972 and AF027973). For protein detection,
either a c-myc (Munro and Pelham 1986) or a His tag
was incorporated. The N- and C-terminal intein
sequences and short extein stretches were those
present in the Synechocystis sp. gene DnaB (UniProtKB/Swiss-Prot
accession no. Q55418). Additionally,
a flexible triple GGGGS linker was inserted as
described previously (Kempe et al. 2009). For the
IntC::609 ELP::IntN construct, a specific ELP
sequence (VPGXG)60 was designed, in which X
represents a random amino acid other than proline.
The number of VPGXG pentapeptides was selected
based on previous experiments using ELPylated
proteins (Conley et al. 2009; Scheller et al. 2004).
All constructs described in this paper were verified
by DNA sequencing.
PCR site-directed mutagenesis
To exchange the protein splicing key residues, sitedirected
mutagenesis was performed with the IntC::
Flag(c-myc)::IntN construct using a QuikChange II-E
Site-Directed Mutagenesis kit (Agilent Technologies,
Transgenic Res
123
Santa Clara, CA, USA). Two Ala residues were
introduced to replace DnaB (Asn?154
) and the following
amino acid residue of the c-terminal extein (Ser?1
)
using the primers IntCNSAA-FII (50
-CGATA
TTATCGTGCACGCCGCCATTGAGCAAGATGG)
and IntCNSAA-RII (50
-CCATCTTGCTCAATGGCG
GCGTGCACGATAATATCG). A third Ala was introduced
to replace the N-terminal amino acid of DnaB
intein (Cys?1
) using the primers CAIntN-F (50
-AGG
ATCTCAACAGAGAGTCCGGTGCTATTTCTGG
TGATTCTC and CAIntN-R (50
-GAGAATCACCA
GAAATAGCACCGGACTCTCTGTTGAGATCCTC).
The altered sequences are underlined.
Construction of expression cassettes
The different sequences of the IntC::Flag::IntN and
IntC::609 ELP::IntNconstructswereindividuallyintroduced
into the NcoI and BamHI restriction sites of a
pRTRA15 vector (Artsaenko et al. 1995) to incorporate
theCaMV35Spromoter,aLeB4leguminsignalpeptide,a
KDEL coding sequence and a CaMV35S terminator. For
the transformation of tobacco plants, the expression
cassettes were excised using the HindIII enzyme and
transferred into the pCB301-based binary vector, pCB301Kan
(Xiang et al. 1999; Gahrtz and Conrad 2009).
Transient expression in Nicotiana benthamiana
For transient assays, intact leaves of N. benthamiana
plants were infiltrated with the Agrobacterium
tumefaciens strain C58C1 (harboring the vector
pGV2260) (Deblaere et al. 1985) as previously
described (Gahrtz and Conrad 2009; Kapila et al.
1997). The plant leaves were co-infiltrated with
HcPro, a suppressor of gene silencing that has been
found to significantly increase the expression levels of
recombinant protein in plant cells (Conley et al. 2009;
Sudarshana et al. 2006). Infiltrated plants were grown
in the greenhouse. The maximum levels of product
accumulation in leaves were observed after 5–6 days
as determined by Western blot analysis.
Stable transformation of Nicotiana tabacum
The binary vectors were introduced into Agrobacterium
by electroporation and introduced into Nicotiana
tabacum cv. Samsun NN (SNN) leaf discs by agroinfiltration
according to a previously described protocol
(Floss and Conrad 2010; Horsch et al. 1985). The
transgenic plants were cultured on MS agar containing
50 mg/L kanamycin and analyzed by Western blot
using either an anti-c-myc or anti-His monoclonal
antibody. High expressing T0-tobacco plants were
selected and further propagated.
Production of rabbit sera
The InteinN-encoding sequence from the Synechocystis
sp. gene DnaB (UniProtKB/Swiss-Prot accession
no. Q55418) was introduced into the vector pET23a
(Novagen, Merck KGaA, Darmstadt, Germany),
resulting in an expression vector, designated as IntNpET23a.
The recombinant protein was produced in
E. coli BL21 according to the standard protocol and
purified by Ni–NTA affinity chromatography. Rabbits
were immunized with 1 mg antigen and complete
Freund’s adjuvants (Difco, USA), and animals were
boostered twice with 500 lg antigen and incomplete
Freund’s adjuvants. Sera were collected 1 week after
the last immunization, enriched by ammonium sulphate
precipitation and used in appropriate dilutions
for Western blot analysis.
SDS Page and Western Blotting
Leaf material was powdered in liquid nitrogen and
suspended in 72 mM Tris, 10 % v/v glycerine, 2 %
w/v SDS, 5 % w/v 2-mercaptoethanol and 0.0025 mM
bromophenol blue, pH 6.8. The homogenate was
incubated for 10 min at 95 °C and cleared by centrifugation
(30 min, 4 °C, 36,000g). The concentration
of the total soluble protein was determined using
the Bradford assay (Bio-Rad, Munich, Germany).
A 40 lg sample of extracted protein was separated by
3–10 % SDS-PAGE at reducing conditions and electroblotted
onto a nitrocellulose membrane (Whatman
GmbH, GE Healthcare, Dassel, Germany) using
25 mM Tris, 0.1 % w/v SDS, 192 mM glycine and
20 % v/v methanol. For detection of the transgenic
product, the membranes were blocked for 2 h in 5 %
w/v fat-free dry milk in 180 mM NaCl and 20 mM
Tris, pH 7.8. The membranes were probed with either
the anti-c-myc or the anti-His monoclonal antibody
and subsequently incubated with an anti-mouse peroxidase
conjugate. Signals were detected by enhanced
chemiluminescence (Amersham ECL Plus TM
, GE
Healthcare UK Ltd., UK).
Transgenic Res
123
Heterologous protein expression in E. coli
The mutated intc::flag(c-myc)::intn sequence was
introduced into the BamHI-NcoI restriction sites of a
pET16b plasmid and expressed in the cytosol of the
E. coli strain BL21 (Novagen, Merck KGaA, Darmstadt,
Germany). An extract of induced cells was
denatured at 95 °C, separated by 12 % SDS-PAGE,
electroblotted, incubated first with an anti-c-myc
monoclonal antibody and then with an anti-mouse
peroxidase conjugate. Protein expression was detected
by enhanced chemiluminescence (Amersham ECL
Plus TM
, GE Healthcare UK Ltd., UK).
Purification of His-tagged spider silk protein
Frozen leaf material was ground in liquid nitrogen and
extracted with 50 mM phosphate buffer pH 6.8
containing 0.05 % v/v Triton X-100. After extraction,
1.32 g ascorbic acid per 100 g leaf was added. After
2 h of shaking at 4 °C, the extracts were cleared by
centrifugation followed by filtration through a fine
gauze. The subsequent protein purification via affinity
chromatography was based on Ni–NTA agarose as
described (QIAGEN, Hilden, Germany). No imidazole
was included in the binding step, and 50 mM was
used for the washing step. The proteins were eluted by
flushing first with 100 mM and then with 200 mM
imidazole. Diafiltration was performed using a
150-kDa filter (PierceR
Concentrator, Thermo Scientific,
Rockford, USA) and centrifugation at 5,0009g
followed by re-dilution in Millipore water; the process
was repeated five times. The protein product was then
lyophilized.
SEM
Purified, diafiltrated and desalted proteins were
lyophilized and fixed to a standard SEM holder. The
probe was exposed to 4 % w/v OsO4 vapor for 2 h and
then coated with a *5 nm carbon layer. The SEM
experiments were performed using a QuantaTM
FEG
3D electron microscope (FEI, Hillsboro, USA) in a
high vacuum using the secondary electron detection
mode. The image was recorded in a low acceleration
voltage at 5 kV. A magnification of 8,0009 was
adjusted at a working distance of 10.1 mm. Secondary
electrons were detected by an Everhart–Thornley
detector at a sample tilt angle of 0°.
Results
A plant expression vector was designed encoding a
fusion protein of the structure ‘‘IntC-FLAG-IntN’’
(Fig. 1A). The synthetic FLAG sequence is able to
multimerize due to an autocatalytical intein-mediated
trans-splicing reaction. FLAG typically contains the
GPGGX and GGX motifs and a non-repetitive spacer
element. At the 50
end of the FLAG-coding sequence, a
flexible 39 GGGGS linker was added to improve the
intein-based protein fusion in planta (Kempe et al.
2009). A tag suitable for both the detection of the
protein via Western blot analyses and affinity purification
(c-myc or 69 His) was fused to the C-terminus
of the synthetic FLAG protein (Fig. 1A, the sequences
are provided in the Supplementary Figure S1A, S1B).
The localization of the expressed proteins in the
endoplasmic reticulum (ER) was assured by an
N-terminal LeB4 signal peptide. A KDEL signal at
the C-terminus caused ER retention. This expression
cassette was introduced into a vector with the
CaMV35S promoter and stop signals for both transcription
and translation (Artsaenko et al. 1995). The
expression cassette was inserted into a pCB301-based
binary vector, pCB301-Kan (Gahrtz and Conrad
2009). The resulting vector was transformed in
agrobacteria and both transient and stable expression
experiments were performed using N. benthamiana
and N. tabacum, respectively.
The post-translational protein splicing triggered by
the terminal inteins was expected to generate FLAG
multimers of various distinct sizes, reflecting the
varying degrees of multimerization. Indeed, such band
patterns were detected in Western blot experiments
using protein extracts of transgenic tobacco plant
leaves (Fig. 1C). Strikingly, the molecular weights of
several bands were significantly higher than 250 kDa.
Similar profiles were generated regardless of whether
the construct contained the c-myc or the His-tag
coding sequences (Figs. 1C, S3). The post-translational
protein splicing reaction triggered by the
terminal inteins resulted in the introduction of a new
extein element (FLAG) and the removal of the
flanking N- and C-intein parts (Fig. 1B). This was
expected to generate *54 kDa FLAG dimers, which
include each one of the flanking intein sequences at the
N and C termini (Supplementary Figure S1C). However,
the molecular weight of each of the putative
multimers appeared to be higher than expected (Fig. 1C).
Transgenic Res
123
We believe that thisis most likely attributed tothe specific
structural properties of the FLAG protein. In particular,
the GPGGX motif readily forms b-turns, which are
associated with a substantial level of conformational
variability in the case of elastin-like polypeptides
(ELPs) (Ohgo et al. 2006). It is well known that the
glycosylation status of a protein strongly influences its
migration behavior in SDS-PAGE gels. Hence, we
performed an in silico N- and O-glycosylation site
analyses (www.cbs.dtu.dk/services/NetNGlyc; www.
cbs.dtu.dk/services/NetOGlyc) and identified several
potential o-glycosylation sites within the FLAG
KDEL
multimerized sequenceIntC IntNSPCaMV35S
designed synthetic FLAG
(GPGGX)22 Spacer (GPGGX)8GGX
c-myc or 6xHis(GGGGS)3
IntC synthetic FLAG IntN
IntC synthetic FLAG IntN
synthetic FLAG IntNIntC synthetic FLAG
synthetic FLAGIntC synthetic FLAG synthetic FLAG synthetic FLAG IntN
IntC
IntN
kDa
500
250
164
130
100
95
72
55
36
28
2mer
3mer
4mer
5mer
6mer
7mer
8mer
9mer
10mer
hypothetic
A
B
C
Fig. 1 Design of the
expression cassette and the
principle of intein-mediated
assembly of FLAG
multimers. A Schematic
overview of the expression
cassette. Abbreviations:
CaMV35S, cauliflower
mosaic virus 35S
constitutive promoter; SP,
legumin B4 signal peptide;
KDEL, ER retention
sequence; IntN/IntC, C- and
N-terminal intein sequences
of the Synechocystis sp.
DnaB gene; GPGGXn;
GGX/spacer, motifs in wild
type FLAG sequences;
(GGGGS)3, flexible spacer;
c-myc-tag (detection) or
6xHis-tag (purification).
B Multimerization of
synthetic FLAG monomers
via intein-mediated protein
splicing. C Western blot
analysis of extracts of
tobacco leaves
overexpressing the IntCFLAG(c-myc)-IntN
protein.
Plant leaf extracts were
separated by 3–13 % SDSPAGE
and electroblotted,
and distinct FLAG
multimers were detected by
enhanced
chemiluminescence (ECL)
based on the presence of the
c-myc tag
Transgenic Res
123
sequence. Furthermore, a recombinant, IntC-FLAGIntN
protein (including the plant signal peptide; Supplementary
Figure S1D) was produced in E. coli to
prevent glycosylation and to minimize the effects of
posttranslational protein modification on the electrophoretic
properties. In fact, we were able to produce a
recombinant protein of the expected molecular weight
(39.3 kDa; Supplementary Figure S2).
A control experiment was performed to prove that
intein-mediated trans-splicing fosters the assembly of
high molecular FLAG proteins. Key residues located
at the extein-intein border that are known to be
essential for rearrangement during splicing were
altered by site-directed mutagenesis. The C-terminal
amino acid of the DnaB Intein (Asn154
), the following
amino acid of the C-terminal extein stretch (Ser?1
)
and the N-terminal amino acid (Cys?1
) were replaced
by alanine residues (Fig. 2A, Supplemental Figure
S1E). The mutated expression cassette was introduced
into the shuttle vector, and the transgenic tobacco
plants were then produced and examined by Western
blot analysis. The independent transgenic tobacco
lines failed to produce multimerized, synthetic FLAG
protein. These results clearly demonstrated that a
trans-splicing mechanism is responsible for multimerization
of the IntC-FLAG-IntN protein. Strikingly,
the FLAG monomer differed from the theoretical
molecular weight of 36.7 kDa (Fig. 2B). This observation
is in accordance with the size-deviation
detected in the case of FLAG-multimers (Fig. 1C).
FLAG multimers, transiently expressed in
N. benthamiana leaves, were affinity-purified using
Ni–NTA agarose. The purified spider silk multimers
were dialyzed against water and concentrated by
diafiltration in which the fraction larger than 90 kDa
was enriched by applying a cut-off of 150 kDa, as
demonstrated by Western blot analysis based on the
His-tag (Fig. 3A). The diafiltrated proteins were
subsequently lyophilized and the weight was quantified.
1.8 mg spider silk multimers were thus isolated
from 50 g leaf material. The material was further
analyzed via Scanning Electron Microscopy (SEM).
The SEM image shows fibrillae with drop-shaped ends
up to 500 lm in length and diameters ranging from 1
to 2 lm (Fig. 3B). The appearance of these fibers
demonstrates the self-organizing capacity of FLAG
intein multimers.
After successfully applying the intein-technique for
large spider silk protein production, we aimed to
demonstrate that other interesting repetitive proteins
could be multimerized by a trans-splicing mechanism.
We selected elastin-like peptides (ELPs) as they
provide a suitable feedstock for designing materials
for nanotechnology (Arias et al. 2006), for the
expression enhancement of fusion proteins in plants
and for the purification via Inverse Transition Cycling
(ITC) (Floss and Conrad 2010). An expression cassette
for the production of multimers of 609 ELP was
designed (Fig. 4A, Supplementary Figure S1F). The
sequence of the monomers is VPGXG, in which X
represents any amino acid other than proline (Scheller
et al. 2004). This sequence was introduced into a
shuttle vector similar as described for the synthetic
FLAG proteins. The vector provides both stable
constitutive expression in plant leaves through
CaMV35S promoter-control and ER retention of the
protein. Transient expression experiments in N. benthamiana
leaves were performed, and the products were
analyzed by Western blot experiments using a specific
anti-InteinN antibody produced from rabbits. We were
able to detect distinct bands covering a range from
47 kDa (monomer) to 250 kDa (Fig. 4B). Thus, inteinbased
multimerization represents a feasible method for
the production of multimerized ELPs.
Discussion
Here we have demonstrated that high molecular
weight spider silk multimers of native size can be
produced in planta using intein-mediated protein
splicing. The multimerization leads to very high
molecular weight, plant-expressed spider silk proteins.
The extraordinary size of spider silk proteins is
thought to be a key determinant of the spider silk
fiber’s excellent mechanical properties (Ayoub et al.
2007; Sponner et al. 2005). The specificity of the
splicing reaction was verified by the site-specific
mutagenesis of key amino acids, which prevents the
multimerization of FLAG proteins in several independent
transgenic tobacco lines.
In E. coli, native sized spider silk proteins were only
produced by the specific design of host strains to
generate a large supply of glycyl-t-RNA and optimized
glycine synthesis (Xia et al. 2010). We believe that the
general approach that we developed will allow for the
production of a broad range of different repetitive
multimerized proteins of high value. We demonstrated
Transgenic Res
123
this by the successful posttranslational multimerization
of 609 ELP, a highly repetitive artificial protein
designed from human elastin sequences (Floss and
Conrad 2010; Urry et al. 1991). The great potential of
repetitive proteins, such as spider silk proteins and
IIVHAAIEQD
KDEL
IIVHNSIEQD
RESGAISG
synthetic FLAGIntC IntNSPCaMV35S
170
55
130
70
100
40
35
25
1
FLAG monomer
splicing site splicing site
2 3 4 5 6 7 8 9 10 11 12 C+
RESGCISG
kDa
A
B
Fig. 2 Mutagenesis of key
residues for trans-splicing
prevents FLAGmultimerization.
A Three
conserved residues that are
essential for the inteinmediated
trans-splicing
reaction were changed to
alanines (in red), extein
stretches were labeled in
gray. B FLAG proteins from
tobacco leaf extracts from
twelve independent
transgenic T0 plants
transformed with mutated
intein key residues were
separated by 10 % SDSPAGE.
Only FLAG
monomers and no
multimeric proteins were
identified by Western blot
analysis. c?, Western blot
standard
250
130
95
72
55
28
kDa
A B
Fig. 3 Purification and characterization of FLAG multimers.
A Transiently expressed FLAG intein multimers were purified
from plant extracts via His-tag affinity chromatography,
concentrated and diafiltrated against water, applying a cut-off
of 150 kDa. The proteins were separated by 3–10 % SDSPAGE
and visualized by Western blotting using a His-tag
antibody. The resulting protein product sizes ranged from [72
to [250 kDa. B SEM image of in planta-produced FLAG
multimers. Fibrillae with a diameter ranging from approximately
1–2 lm and a length up to 500 lm are visible
kDa
36
250
148
98
64
50
KDEL
60xELPIntC IntNSPCaMV35S
c-myc
A
B
Fig. 4 Heterologous production of c-myc-tagged ELP multimers
in stably transformed tobacco leaves. A Expression vector
used for the production of 609 ELP multimerized by inteinbased
assembly (for sequence see Supplementary Figure S1).
B Western blot analysis of extracts of N. benthamiana leaves
transiently overexpressing the IntC::609 ELP::IntN protein.
Plant leaf extracts were separated by 3–13 % SDS-PAGE and
electroblotted, and distinct FLAG multimers were detected via
ECL using a rabbit anti-InteinN antibody
Transgenic Res
123
ELPs, to form nanospheres, hydrogels or different
fibers has been discussed in detail (Ro¨mer and Scheibel
2008; Vendrely et al. 2008). In planta expression offers
the possibility to produce a plethora of heterogeneous
artificial multimers via the simple procedure of intercrossing
a pair of distinct transgenic plant lines. In this
way, composite materials such as spider silk and ELP
can be synthesized. Spider silk-ELP fusion proteins
have been demonstrated to enhance the viability of
human chondrocytes and to prevent the dedifferentiation
of these cells (Scheller et al. 2004). By intercrossing
several pairs of transgenic lines expressing
two different repetitive proteins at different expression
levels, varieties of mixed proteins could be designed
and synthesized.
However, an extended application of the approach
reported here requires further detailed analysis of
several technical aspects. For example, it must be
examined whether multimerization by intein-based
protein splicing in plants also causes cyclization. Here,
specific antibodies against InteinN and InteinC may
demonstrate the absence of these intein parts, thus
supporting the presence of circles. Although our
analysis is not comprehensive, the detection of ELP
monomers using anti InteinN antibodies indicate the
presence of linear monomers (Fig. 4B) because
circular products are expected to contain no inteins
as a result of protein trans-splicing.
Intermolecular hybrids could be detected by crossing
lines expressing various repetitive proteins labeled with
different tags. The use of ELPylation for simpler
purification via ITC (at best membrane-based ITC;
(Phan and Conrad 2011) requires detailed analyses of
both the size and extension of the ELP portion.
Furthermore, the mechanical analyses of the material
produced by intein-based protein splicing should be
extended to electrospinning, production of layers and
nanospheres,detailed nanomechanical analyses, such as
nanointendation and single molecule force microscopy.
Scale-up and the optimization of the purification
procedure will in future provide sufficient amounts of
spider silk multimers as an essential base of these
investigations. The data revealed by such experiments
would help to fully explore the potential of this
technique for nanotechnology and medicine.
Acknowledgments The technical assistance of Christine
Helmold, Isolde Tillack, Ingrid Pfort, Ulrike Gresch and Silke
Krause is greatfully acknowledged. The authors also thank Phan
Trong Hoang for his help with mITC and the members of
the Cost Action FA0804, Molecular Pharming, for helpful
discussion.
References
Arias FJ, Reboto V, Martin S, Lopez I, Rodriguez-Cabello JC
(2006) Tailored recombinant elastin-like polymers for
advanced biomedical and nano(bio)technological applications.
Biotechnol Lett 28(10):687–695. doi:10.1007/s
10529-006-9045-3
Artsaenko O, Peisker M, zur Nieden U, Fiedler U, Weiler EW,
Muntz K, Conrad U (1995) Expression of a single-chain Fv
antibody against abscisic acid creates a wilty phenotype in
transgenic tobacco. Plant J 8(5):745–750
Ayoub NA, Hayashi CY (2008) Multiple recombining loci
encode MaSp1, the primary constituent of dragline silk, in
widow spiders (Latrodectus: Theridiidae). Mol Biol Evol
25(2):277–286. doi:10.1093/molbev/msm246
Ayoub NA, Garb JE, Tinghitella RM, Collin MA, Hayashi CY
(2007) Blueprint for a high-performance biomaterial: fulllength
spider dragline silk genes. PLoS ONE 2(6):e514.
doi:10.1371/journal.pone.0000514
Conley AJ, Joensuu JJ, Jevnikar AM, Menassa R, Brandle JE
(2009) Optimization of elastin-like polypeptide fusions for
expression and purification of recombinant proteins in
plants. Biotechnol Bioeng 103(3):562–573. doi:10.1002/
bit.22278
Craig CL (2004) Broad patterns of speciation are correlated with
the evolution of new silk proteins in spiders but not in the
lepidoptera. Biomacromolecules 5(3):739–743. doi:
10.1021/bm034351s
Deblaere R, Bytebier B, De Greve H, Deboeck F, Schell J, Van
Montagu M, Leemans J (1985) Efficient octopine Ti plasmid-derived
vectors for Agrobacterium-mediated gene
transfer to plants. Nucleic Acids Res 13(13):4777–4788
Floss DM, Conrad U (2010) Expression of complete antibodies
in transgenic plants. In: Kontermann R, Du¨bel S (eds)
Antibody engineering. Springer, Berlin, pp 489–502. doi:
10.1007/978-3-642-01144-3_31
Gahrtz M, Conrad U (2009) Immunomodulation of plant function
by in vitro selected single-chain Fv intrabodies. Methods
Mol Biol 483:289–312. doi:10.1007/978-1-59745-407-0_17
Hayashi CY, Lewis RV (2000) Molecular architecture and
evolution of a modular spider silk protein gene. Science
287(5457):1477–1479
Hayashi CY, Shipley NH, Lewis RV (1999) Hypotheses that
correlate the sequence, structure, and mechanical properties
of spider silk proteins. Int J Biol Macromol 24(2–3):
271–275
Horsch RB, Fry JE, Hoffmann NL, Eichholtz D, Rogers SG,
Fraley RT (1985) A simple and general method for transferring
genes into plants. Science 227(4691):1229–1231.
doi:10.1126/science.227.4691.1229
Kapila J, De Rycke R, Van Montagu M, Angenon G (1997) An
Agrobacterium-mediated transient gene expression system
for intact leaves. Plant Sci 122(1):101–108
Transgenic Res
123
Kempe K, Rubtsova M, Gils M (2009) Intein-mediated protein
assembly in transgenic wheat: production of active barnase
and acetolactate synthase from split genes. Plant Biotechnol
J 7(3):283–297. doi:10.1111/j.1467-7652.2008.00399.x
Ko¨hler T, Vollrath F (1995) Thread biomechanics in the Tcwo
Orb-weaving spiders Araneus diadematus (Araneae, Araneidae)
and Uloborus walckenaerius (Araneae, Uloboridae).
J Exp Zool 271:1–17
Munro S, Pelham HR (1986) An Hsp70-like protein in the ER:
identity with the 78 kd glucose-regulated protein and
immunoglobulin heavy chain binding protein. Cell
46(2):291–300
Ohgo K, Kawase T, Ashida J, Asakura T (2006) Solid-state NMR
analysis of a peptide (Gly-Pro-Gly–Gly-Ala)6-Gly derived
from a flagelliform silk sequence of Nephila clavipes. Biomacromolecules
7(4):1210–1214. doi:10.1021/bm0600522
Perler FB (1998) Protein splicing of inteins and hedgehog
autoproteolysis: structure, function, and evolution. Cell
92(1):1–4
Phan HT, Conrad U (2011) Membrane-based inverse transition
cycling: an improved means for purifying plant-derived
recombinant protein-elastin-like polypeptide fusions. Int J
Mol Sci 12(5):2808–2821. doi:10.3390/ijms12052808
Radtke C, Allmeling C, Waldmann KH, Reimers K, Thies K,
Schenk HC, Hillmer A, Guggenheim M, Brandes G, Vogt
PM (2011) Spider silk constructs enhance axonal regeneration
and remyelination in long nerve defects in sheep. PLoS
ONE 6(2):e16990. doi:10.1371/journal.pone.0016990
Ro¨mer L, Scheibel T (2008) The elaborate structure of spider
silk: structure and function of a natural high performance
fiber. Prion 2(4):154–161
Saleh L, Perler FB (2006) Protein splicing in cis and in trans.
Chem Rec 6(4):183–193. doi:10.1002/tcr.20082
Scheller J, Guhrs KH, Grosse F, Conrad U (2004) Production of
spider silk proteins in tobacco and potato. Nat Biotechnol
19(6):573–577. doi:10.1038/89335
Scheller J, Henggeler D, Viviani A, Conrad U (2004) Purification
of spider silk-elastin from transgenic plants and
application for human chondrocyte proliferation. Transgenic
Res 13(1):51–57
Sponner A, Schlott B, Vollrath F, Unger E, Grosse F, Weisshart K
(2005) Characterization of the protein components of
Nephila clavipes Dragline Silk . Biochemistry 44(12):
4727–4736. doi:10.1021/bi047671k
Sudarshana MR, Plesha MA, Uratsu SL, Falk BW, Dandekar AM,
Huang TK, McDonald KA (2006) A chemically inducible
cucumber mosaic virus amplicon system for expression of
heterologous proteins in plant tissues. Plant Biotechnol J
4(5):551–559. doi:10.1111/j.1467-7652.2006.00202.x
Urry DW, Parker TM, Reid MC, Gowda DC (1991) Biocompatibility
of the bioelastic materials, poly(GVGVP) and its
gamma irradiation cross-linked matrix—summary of generic
biological test results. J Bioact Compat Polym 6(3):
263–282
Vendrely C, Ackerschott C, Ro¨mer L, Scheibel T (2008)
Molecular design of performance proteins with repetitive
sequences: recombinant flagelliform spider silk as basis for
biomaterials. Methods Mol Biol 474:3–14. doi:10.1007/
978-1-59745-480-3_1
Vollrath F, Edmonds DT (1989) Modulation of the mechanical
properties of spider silk by coating with water. Nature
340(6231):305–307
Vollrath F,Knight DP (2001) Liquidcrystalline spinning of spider
silk. Nature 410(6828):541–548. doi:10.1038/35069000
Wendt H, Hillmer A, Reimers K, Kuhbier JW, Schafer-Nolte F,
Allmeling C, Kasper C, Vogt PM (2011) Artificial skinculturing
of different skin cell lines for generating an
artificial skin substitute on cross-weaved spider silk fibres.
PLoS ONE 6(7):e21833. doi:10.1371/journal.pone.002
1833
Xia XX, Qian ZG, Ki CS, Park YH, Kaplan DL, Lee SY (2010)
Native-sized recombinant spider silk protein produced in
metabolically engineered Escherichia coli results in a strong
fiber. Proc Natl Acad Sci USA 107(32):14059–14063. doi:
10.1073/pnas.1003366107
Xiang C, Han P, Lutziger I, Wang K, Oliver DJ (1999) A mini
binary vector series for plant transformation. Plant Mol
Biol 40(4):711–717
Yang J, Fox GC Jr, Henry-Smith TV (2003) Intein-mediated
assembly of a functional beta-glucuronidase in transgenic
plants. Proc Natl Acad Sci USA 100(6):3513–3518. doi:
10.1073/pnas.0635899100
Transgenic Res
123