S2012
Applying Mendel’s Laws of
Genetics to Plant Biology
Helene ROBERT BOISIVON
helene.robert.boisivon@ceitec.muni.cz
Shekufeh EBRAHIMI NAGHANI
shekoufeh.naghani@ceitec.muni.cz
Juan Francisco SANCHEZ LOPEZ
sanchez.lopez@ceitec.muni.cz
CEITEC – Central European Institute
of Technology Masaryk University
www.ceitec.eu
Lecture and
Practical book
Autumn semester
2019
Room 222, Building A26
University Campus, Brno
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 2
Faculty of Science
Applying Mendel’s laws of genetics to plant biology in the lab
S2012
Lecture and Practical book
Semester Autumn 2019
Location: University Campus – Bohunice
Faculty of Sciences
Masaryk University
Building A26
Kamenice 753/5
625 00 Brno
Teachers: Helene ROBERT BOISIVON
helene.robert.boisivon@ceitec.muni.cz
Room 2.17
Phone 549 49 8421
Shekufeh EBRAHIMI NAGHANI
shekoufeh.naghani@ceitec.muni.cz
Juan Francisco SANCHEZ LOPEZ
sanchez.lopez@ceitec.muni.cz
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 3
Program
Tue. 8/10 10.00 A26, 2.22 Theory part 1
- Role of auxin for plant development
- Auxin signalling and auxin transport
- pin1 and monopteros mutants
Fri. 11/10 9.00 A26, 2.22 Preparative lecture – Experiment flow
Practical – Preparation of seeds and plates
Mon. 14/10 - A26 Practical – Transfer plates to growth chambers
Thu. 17/10 9.00 A26, 2.22 Theory part 1
- Mendel’s law of genetics
- Molecular genetics in Arabidopsis thaliana
Tue. 22/10 9.00 A26 Practical – Phenotyping; sample collecting; DNA
extraction
Wed. 23/10 9.00 A26 Practical – PCR reactions (genotyping)
Thu. 24/10 9.00 A26 Practical – Electrophoresis and evaluation
Thu. 31/10 9.00 A26, 2.22 Theory part 2
- Root development
- Preparative lecture – Effects of auxin for root growth
Wed. 6/11 13.00 A26 Practical – Preparation of the plates and Sowing seeds
Sat. 9/11 - A26 Practical –Transfer plates to growth chambers (I’ll go
it)
Wed. 13/11 10.00 A26 Practical – Scanning plates at T=4 DAG
Practical (part 1) – Phenotyping; sample collecting;
DNA extraction
Thu. 14/11 10.00 A26 Practical (part 1) – PCR reactions
Fri. 15/11 10.00 A26 Practical - Scanning plates at T=6 DAG
Practical (part 1) – Electrophoresis and evaluation
Wed. 20/11 9.00 A26 Practical - Scanning plates at T=11 DAG; GUS
staining
Practical (part 1) – Analysis
Thu. 21/11 9.00 A26 Practical – Expression analysis
Fri. 22/11 9.00 A26, 2.22 Practical – Results analysis
Mon. 16/12 A26 Report handling
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 4
TABLE OF CONTENTS
1. AUXIN	AND	ITS	ROLE	IN	PLANTS	 6
1.1. Plant hormones 6
1.2. Auxin 6
Early studies on auxin 6
Polar auxin transport 8
Auxin signalling pathway 10
Case studies: pin1 and monopteros 11
2. MENDEL’S	LAW	OF	GENETICS	 13
2.1. Plant as model for studying the genetics 13
2.2. Analysis of segregation of characters 14
2.3. Cellular and molecular basis of the Mendelian genetics 17
2.4. Predicting progeny of crosses using the Mendelian ratios 17
2.5. Using 𝜒2(Chi-square)	test	on	Mendelian	ratios 18
3. MOLECULAR	GENETICS	IN	ARABIDOPSIS	THALIANA	(MUTATIONS	AND	THEIR	
USE)	 20
3.1. Mutations – definition 20
3.2. Mutations – insertion of a transgene 21
3.3. Mutations – detection 23
Detection of point mutation by restriction site differences 23
Detection of T-DNA 23
3.4. Forward and Reversed genetics 24
Forward genetics 24
Reverse genetics 25
4. PRACTICAL	1	–	GENOTYPE	TO	PHENOTYPE:	CASE	STUDIES	OF	PIN1	AND	
MONOPTEROS	 26
4.1. Materials 26
Seeds 26
Material 26
Solutions 26
4.2. Experiment 27
Timetable 27
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 5
Sowing 27
Data collection – mp part 28
DNA extraction 28
Genotyping 29
Data collection – pin1 part 30
DNA extraction 31
Genotyping 31
5. ROOT	DEVELOPMENT	 33
5.1. Root system architecture 33
Root architecture correlates with soil composition 33
Monocots versus dicots 34
Root structure 35
Embryonic origin of the Arabidopsis root 37
Lateral root formation 37
5.2. Root development and the role of auxin 38
6. PRACTICAL	2	–	THE	ROLE	OF	AUXIN	IN	ROOT	DEVELOPMENT	 39
	
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 6
1. Auxin and its role in plants
1.1. Plant hormones
Hormones are chemical messengers that coordinate the cellular functions of multicellular organisms.
Animals produce many chemical hormones, each of which usually targets a small number of cells and
triggers a specific response. By contrast, plant hormones (phytohormones) are fewer in number,
usually affect most if not all cells, and trigger diverse responses. Furthermore, the accumulation and
effects of each phytohormone are modulated by environmental and developmental influences as well
as the activities of other phytohormones. Unravelling the complex networks of hormonal action and
signaling pathways in plants is ongoing; several hormone receptors have only recently been identified,
and many signaling components are still unidentified.
In their 1937 book Phytohormones, Frits Went and Kenneth Thimann define a hormone as “a substance
which, being produced in any one part of the organism, is transferred to another part and there
influences a specific physiological process.” They emphasize the functional aspect of hormones, stating
that “these hormones are characterized by the property of serving as chemical messengers, by which
the activity of certain organs is coordinated with that of others.”
The plant hormones (auxin, cytokinin, gibberellins, brassinosteroids, ethylene, abscisic acid,
jasmonates, and salicylates) are active during the plant’s life, from seed-to-seed. The five classical
hormones are auxin (isolated in 1926 by F. Went), cytokinins (1950s, F. Skoog), ethylene (1901, D.
Neljubow), gibberellins (1926, E. Kurosawa), and abscisic acid (ABA; 1950s, T. Bennett-Clark and N.
Kefford). Within the past 50 years or so, several other compounds have been identified that meet the
criteria of hormones. Five of the more recently identified types of hormones are brassinosteroids (BRs),
jasmonates, salicylates, and strigolactones.
The functions of plant hormones are diverse, but all have profound effects on growth and
development. Hormones affect all phases of the plant lifecycle from seed to seed, and their responses
to environmental stresses, both biotic (from a living organism) and abiotic (from the physical
environment). Because of their pleiotropic effects, unravelling the functions of plant hormones has
been challenging and continues to be one of the most active areas of plant biology research. Because
of their fundamental roles as integrators and regulators, the study of plant hormones and the genes
that control their synthesis, transport, and downstream effects has identified many new tools for
agricultural improvements.
1.2. Auxin
Early studies on auxin
Auxin is a remarkable small molecule that plays a role in nearly every aspect of plant growth and
development. No mutants have been identified that can growth without auxin. It appears to be
absolutely required for plant survival. Auxin is universally present in all plants and is found in green
algae as well as the more distantly related red and brown algae, although its function in these
organisms is not well characterized. In angiosperms, auxin synthesis or signaling mutants are
frequently small, underscoring auxin’s role as a growth promoter. However, auxin’s role is much more
that a growth promoter; it is also necessary for the specification and maintenance of the root apical
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 7
meristem, the initiation of lateral roots and leaves, and the formation of developmental patterns.
Auxin was the first plant hormone isolated, and it is probably the most thoroughly studied of all plant
growth regulators. Early botanists carefully described plant growth, development, and movement and
even proposed the existence of mobile signals to coordinate these activities. In the late 19th and early
20th centuries, a series of elegant experiments into the nature of shoot phototropism (moving toward
light) led directly to the identification of auxin as a mobile signal regulating cell elongation. Most
famously, Charles Darwin and his son Francis studied phototropism in coleoptiles, a tissue in monocots
that protects young leaves during germination. In 1880, they determined that light given from one side
is perceived at the coleoptile tip but that “some influence is transmitted from the upper to the lower
part, causing the latter to bend.” In 1913, Peter Boysen-Jensen furthered these studies, observing and
that the “influence” can move through an agar block but not a solid substance (Figure 1). Subsequently,
Arpad Paal (1919) showed that removing the tip of a dark-grown coleoptile and replacing the tip
asymmetrically onto the coleoptile base could induce curvature in the absence of a light stimulus.
Building upon these studies, Frits Went placed coleoptile tips onto agar blocks and showed that these
treated blocks were capable of promoting growth; they had captured the growth-promoting substance
(Figure 1.2). Went’s experiments led to the purification and identification of the auxin indole-3-acetic
acid (IAA). Auxins in fact are a family of related compounds, some of which are entirely synthetic but
mimic auxin effects, whereas others are low-abundance compounds or found in only some plant
families. In most discussions, auxin is used synonymously with IAA, which is the most abundant
naturally occurring auxin.
Once it was available in purified form, auxin’s contributions to root initiation, fruit development, cell
elongation, and the suppression of lateral buds by the shoot apex (apical dominance) were recognized,
as were some of the fundamental properties that contribute to auxin action. In the 1930s, Kenneth
Thimann observed that different tissues differ in their sensitivity to auxin (Figure 3).
Figure 1.1 - A mobile molecule for the bending response
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 8
Polar auxin transport
Many hormones can be translocated through the plant by way of the xylem or phloem, but the
directional movement of auxin between cells and tissues is particularly well described. Polar auxin
transport is fundamental to many of its functions in pattern formation, organogenesis, and directional
growth responses. The Cholodny-Went theory proposed in the 1930s as the chemi-osmotic model
postulated that the asymmetries in growth rate in light- or gravity-responding organs are caused by an
auxin gradient. After many years, this theory is now widely accepted, largely because of our ability to
detect the proposed auxin gradient, and the identification of the chemical and cellular basis by which
the auxin gradients are established and maintained.
Because IAA is a weak acid, it exists in a charged anionic form (IAA)
in the neutral pH of the cytoplasm
(pH ~7). In the more acidic cell wall environment (pH ~5.5), ~15% of the molecules are in the
protonated form (IAAH), which can transit through the plasma membrane. The pH differential between
the cytoplasm and wall means that auxin can move into (as IAAH) but not out of plant cells. Plants
employ specific transport proteins to move auxin precisely (Figure 4).
Many auxin transporter proteins were identified through genetic screens for abnormal auxin
responses, including agravitropism. The extremely agravitropic aux1 mutant is deficient in polar auxin
transport. AUX1 encodes an auxin influx carrier that augments auxin’s chemiosmotic influx into cells.
AUX1 and its related LIKE-AUX1 genes seem to be particularly important for auxin influx in conditions
when auxin efflux rates are high.
The ATP Binding Cassette subgroup B (ABCB) transporters belong to a family of 21 proteins that
contributes to auxin transport in diverse ways; some function in auxin influx and some in auxin efflux.
Unlike PIN proteins, their cellular position seems to be relatively stable and they may interact with and
Figure 1.2 - Isolation of the moving substance
Figure 1.3 - Tissue-sensitivity to auxin
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 9
stabilize PIN proteins at specific microdomains of the membrane. These transporters may link auxin
responses and stress responses.
The PIN genes (named for the pin-formed mutant) encode auxin efflux carriers with asymmetric, polar
distributions on cell membranes. Through their polarity, PIN proteins contribute to the highly
directional, polar transport of auxin that underlies developmental patterning and differential growth
responses. In Arabidopsis, there are eight PIN genes with different tissue-specific expression patterns.
Furthermore, the individual PIN proteins themselves can have different cellular distributions within
cells. To some extent, these different family members are specialized for specific functions. For
example, PIN1 is expressed in the xylem parenchyma throughout the plant and has a major role in the
polar transport of auxin from shoot tip to root tip. PIN2 plays a key role in root gravitropism; loss-offunction
mutants have a strongly agravitropic phenotype. Localization of the PIN3 protein changes
upon a change in light or gravity orientation and is important for establishing the auxin gradients that
mediate tropic growth responses, and PIN5 and PIN8 are localized to the endoplasmic reticulum and
thought to be involved in intracellular active auxin transport.
PIN protein redistribution is critical for the movement of auxin that regulates
pattern formation and organogenesis at the shoot apical meristem and during
embryogenesis. It is thought that the localization of PIN proteins at the plasma
membranes are indicative of the direction of the auxin flow. Auxin maxima are
required for and precede the initiation of lateral roots, leaves, and flowers at the
shoot apical meristem and the embryonic formation of the radicle (embryonic
root) meristem and cotyledons (Figure 5).
Figure 1.4 - Polar auxin transport and its transporters
Figure 1.5 - The pin1
mutant
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 10
Auxin signalling pathway
In 2005, the protein TRANSPORT INHIBITOR RESPONSE1 (TIR1) was identified as an auxin receptor,
connecting auxin with the regulated proteolysis (= protein degradation) of auxin response repressors.
TIR1 is an F-box protein, a component of an SCF (SKP1, CUL1, and F-box protein) ubiquitin ligase
complex. Ubiquitin is a small protein that is conjugated to other proteins by ubiquitin ligase complexes,
including SCFTIR1
. Because the F-box protein confers specificity to this complex by binding to the target
proteins, SCF complexes are identified by their specific F-box protein component as indicated.
Ubiquitinated proteins are proteolyzed by the 26S proteasome, which selectively degrades proteins.
When bound to auxin, TIR1 also specifically binds to Aux/IAA repressor proteins with the auxin holding
the proteins together like a molecular glue, targeting them for proteolysis. Genes encoding Aux/IAA
proteins were identified in the 1980s and were among the first auxin-induced genes to be identified
through the newly developed tools of molecular biology. Aux/IAA proteins are short-lived, nuclearlocalized
proteins, whose rate of degradation is enhanced by auxin. Aux/IAA proteins have four
conserved domains. A short amino acid sequence in domain II was identified as the “degron” and is
necessary for auxin-induced instability. In the early 1990s, several research groups identified dominant,
gain-of-function mutants in Aux/IAA genes; these mutations were mapped to amino acid changes in
the degron that interfere with auxin-induced protein degradation. Auxin signaling is dependent on the
degradation of the Aux/IAA repressors and that stabilized mutant proteins confer an auxin-resistant
phenotype because they are resistant to degradation.
Analysis of the promoters of several auxin-induced genes led to the identification of the auxin response
element and a family of proteins that specifically bind to the auxin response element called auxin
response factors (ARFs). Arabidopsis has 23 ARF encoding genes. All ARFs have DNA binding domains;
some have a transcriptional activation domain and function as transcriptional activators, whereas
others function as transcriptional repressors.
Figure 1.1.6 - Auxin signaling pathway
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 11
Case studies: pin1 and monopteros
Auxin is presented in nearly all aspects of plant development, from germinating seed to seed
development, through all the development steps of the plant. Within this practical work we will use
two mutants, pin1 and monopteros (mp). PIN1 is one of the auxin efflux transporters described above.
And MONOPTEROS is ARF5, one of the auxin response factors, activating transcription of genes after
the activation of the signaling pathway.
Both MP and PIN1 act during the early phases of embryo development, in seeds, when a zygote will
form an embryonic version of a plant (Figure 1.7).
PIN1 is important for of auxin and the formation of the two embryonic leaves, the cotyledons. In a pin1
mutant, auxin does not flow properly to the cotyledons, and the germinating seedlings will have
defects in the number of cotyledons. PIN1 is also important for the formation and distribution of
flowers along the stem (Figure 1.8). In a pin1 mutant, nearly no flowers are formed. Therefore, the
mutant line is maintained as heterozygous (see next chapter for the definition).
MP is transducing the auxin signal to trigger developmental program. During embryo development,
MP is involved in the formation of a root. Therefore, when MP is absent (as in the mp mutant), the
seedling won’t have a proper root (Figure 1.8). Here again the mutant line is maintained as
heterozygous.
Within the practical work, you will germinate seeds of the mp mutant, score the phenotype of seedling.
Then you will extract the DNA of individual seedling, and genotype it for the presence of the mutation.
You will interpret your data using the information given in Chapters 1, 2 and 3.
In addition, you will have flowering plants of the pin1 mutant. You will perform similar experiments:
Figure 1.7 - Embryo development
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 12
scoring the phenotypes, extraction the DNA, genotyping for the mutation, interpreting the data.
Figure 1.8 - The pin1 and mp mutants
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 13
2. Mendel’s law of genetics
2.1. Plant as model for studying the genetics
The concept of genes and characters that are hereditary (inherited by the parents) has been initiated
by Gregor Mendel in 1865. His observations have been done from crosses experiments in peas (Pisum
sativum). Plants can be either self-pollinated or cross-pollinated. Self-pollination is obtained by the
production of seeds with fertilization of ovules, inside the ovaries or carpel, female part of the flower,
by its own pollen, inside the male parts of the flower or anthers. The pollen, male part of the flower,
contains the sperm cells, fall on the stigma of its own flower, germinate a pollen tube which brings the
sperm cells to the ovule (Figure 2.1). The experimenter can cross two plants (from the same species)
by removing the anthers from one plant before they shed their pollen (emasculation), to prevent selfpollination.
Pollen from another plant is then transferred to the stigma of the first plant.
After crosses of two pea family with different characters or variants (colour of the seeds, shape of the
seeds, colour of the flowers), Mendel observed that the characters were inherited in the next
generations. He noticed that the segregation of these characters (distribution of the parental variants
within the progeny through several generations) follows a strict inheritance pattern. For each of the
tested characters, Mendel firstly obtained pure lines, a population of breeds for a particular character
that show no variation for multiple generation. With the observations of the segregation of the
characters in the progeny a cross came the notion of dominant and recessive of a character when it
will be observed or not in the first cross generation (F1). In genetics, the observation of a character is
called phenotype, word derived from Greek meaning “form that is shown”. This phenotype is given by
the genetic information, the genes. Each gene is represented by two alleles, a gene pair. Each copy or
allele is given by the gametes, one allele from the gamete of the mother (ovule), and one allele from
the gamete of the father (sperm). If the organism resulting for the cross is diploid (2 alleles of one
gene), the gametes are haploid (one copy of each gene). This allows the succession of generation
between vegetative growth as diploid and the reproductive growth with the formation of gametes as
haploid cells. Fusion of the two haploid gametes (fertilization) produces a new diploid organism, with
a mixture of the genetic information from the two parents, a segregation of the alleles and the
characters.
Figure 2.1 - The pollen tube journey from stigma to synergid. (a) In
Arabidopsis thaliana, pollen grainsare deposited on the stigmaand
germinate a pollen tube that enters the transmitting tissue of the
style before exiting onto the interior surfaces of the ovary. The
pollen tube then enters an ovule and contacts the female
gametophyte. (b) The pollen tube (male gametophyte) grows along
the surface of the funiculus and is attracted into the
micropyle by the synergid cells. The male gametophyte consists of
haploid pollen and sperm cells, both of which are derived from a
single meiotic product. In addition to the synergid cells, the female
gametophyte consists of an egg, a central cell, and three antipodal
cells. The female gametophyte develops within the inner and outer
integument cell layers of the ovule. The female gametophyte cells
are haploid. Approximate scale bars are given.
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 14
2.2. Analysis of segregation of characters
In one of his experiments, Mendel crossed two types of pea plants, one with yellow wrinkled seeds
(P1), and one with green round seeds (P2), the parental generation P. The progeny of this cross is called
filial generation (F). One plant is used as female (♀) and one as male (♂). The seeds of the obtained
by this cross (F1 generation) were yellow and round (Figure 2.2). We can conclude that the yellow
colour is a dominant character and that the green colour character is recessive. The phenotype of a F1
established by intercrossing two pure lines and identical to one of the parental phenotypes is defined
as dominant. Similarly, the round aspect of the seed is a dominant character and the wrinkled aspect
of the seed is a recessive character. The F1 plants were self-pollinated to produce seeds in F2
generation. It can be observed that the recessive characters became visible again. The recessive
character was unexpressed in the F1, masked by the dominant character. Mendel counted the number
of F2 plants with each phenotype (Table 2.1) and quantification of the inheritance of the phenotypes
in the F2 generation proposed a 3:1 segregation ratio (Table 2.1). The ratio in F2 generation for each
character was always a 3:1 ratio, with 3/4 seeds with the dominant character and 1/4 seeds with the
recessive character. We can also notice that the two types of characters (colour and aspect) are
segregating independently always as a 3:1 ratio. A F2 generation will be producing a ratio 9:3:3:1; 9
round yellow seeds (both dominant characters): 3 round green seeds (dominant recessive): 3 wrinkled
yellow seeds (recessive dominant): 1 wrinkled green seeds (both recessive).
Figure 2.2 - Analysis of segregation of two unlinked characters
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 15
cross ♀parent ♂parent F1 phenotypes F2 phenotypes F2 ratio
1 Round Wrinkled seeds All round 5 474 round; 1 850 wrinkled 2.96:1
2 Yellow Green seeds All yellow 6 022 yellow; 2 001 green 3.01:1
3 Purple White petals All purple 705 purple; 224 white 3.15:1
4 Inflate Pinched pods All inflated 882 inflated; 299 pinched 2.95:1
5 Green Yellows pods All green 428 green; 152 yellow 2.82:1
6 Axial Terminal flowers All axial 651 axial; 207 terminal 3.14:1
7 Long Short stems All long 787 long; 277 short 2.84:1
Table 2.1 – Results of all Mendel’s cross in which parents differed in one character.
Further analysis testing a F2 segregation (cross on one character, the seed colour), Mendel took a
sample of 519 yellow F2 peas and grew plants. These yellow-pea F2 plants were selfed individually and
colour of peas of F3 generation were scored. Mendel found that 166 F2 plants carried yellow peas and
that 353 remained F2 plants carried a mixture of yellow and green peas with a 3:1 ratio. Plants from
green F2 peas were also grown and selfed and found to bear only green peas. All F2 green peas were
pure-breeding. But of the F2 yellow peas, 2/3 is like F1 yellow peas (producing yellow and green peas
in a 3:1 ratio) and 1/3 are pure-breeding yellow parent. This study of individual selfings revealed that
the 3:1 ratio is in fact a 1:2:1 ratio.
F1 all yellow (selfed)
F2 3/4 yellow à F3 (selfed) 1/4 green (pure-breeding)
3/4 yellow (1/4 pure breeding; 2/4 segregating)
1/4 green à F3 (selfed) all green (pure breeding)
A 1:2:1 ratio is explained by the existence of genes, carrying the genetic information responsible for
the inheritance of the characters and the phenotypic differences. The genes are in pairs. Each gene
may have different forms, each corresponding to an alternative phenotype of a character. The different
forms of one type of gene are called alleles (point 1, Figure 2.4). Each type of gene is present twice in
each cell, constituting a gene pair (point 2, Figure 2.4). In different plants, the gene pair can be of the
same alleles or of different alleles of that gene. The F1 plants, have one allele that is responsible for the
dominant phenotype and another allele that is responsible for the recessive phenotype that will be
Figure 2.3 - Characters tested in Mendel's crosses
(After S. Singer and H. Hilgard, The Biology of People.
Copyright 1978 by W. H. Freeman and Company.]
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 16
visible in the later generation. In our example, the gene “colour” has two alleles “yellow” and “green”.
Each gamete carries only one member of each gene pair (point 3, Figure 2.4). The members of the gene
pairs segregate equally into the gametes – 50% of the gametes will carry one member of a gene pair
and 50% will carry the other (point 4, Figure 2.4). Fertilization of the gametes from each parent is
random (point 5, Figure 2.4).
Symbolically the dominant allele will be represented in upper case (A in Figure 2.4, Y in Figure 2.5), and
the allele responsive of the recessive phenotype will be represented in lower case (a, y). Therefore, an
F1 plant (cross of a yellow seed plant and a green seed plant, pure lines) crossed with a plant grown
from green seed, will produce an equal segregation (1:1) of yellow and green seeds.
Y/y individuals are called heterozygotes (also hybrids in agronomy), and Y/Y are homozygotes for the
Y allele, therefore pure line. Thus Y/Y are homozygous dominant, an y/y is homozygous for the
Figure 2.4 - Explanation of the 1:2:1 ratio
Figure 2.5 - Results of backcrossing
If Y stands for the allele that determines the
dominant phenotype (yellow seeds) and y for the
allele that determine the recessive phenotype (green
seeds), we can predict an equal segregation of Y:y as
1:1 ratio for an F1 plant crossed with the recessive
parental pure line. This demonstrate the equal
segregation of the alleles.
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 17
recessive allele. This is called a genotype. Note that a 3:1 phenotypic ratio in F2 is in fact a 1:2:1
genotypic ratio of Y/Y : Y/y : y/y.
2.3. Cellular and molecular basis of the Mendelian genetics
Different alleles of a gene can provide a different phenotype. When analysed at the DNA level, they
are generally found identical in most of the sequences and differ only at one or few nucleotides over
the thousands of nucleotides that form the gene. To study such variation, it is helpful to have a
standard. In genetics, this standard is the “wild-type” allele, the allele found in the wild, natural
population, as opposite to the mutant allele.
If we consider the gene affecting the colour of the pea petal, we can say that the purple colour of the
wild peas is caused by a pigment called anthocyanin, which is a chemical made in petal cells as the
series of chemical reactions. Each reaction requires a specific enzyme. The structure (amino acid
sequence) and activity of these enzymes are dictated by their nucleotide sequence of the respective
gene. If the nucleotide sequence of any of the genes coding for the enzymes of this pathway changes
as a result of a mutation, a new allele is created. These mutations can introduce more or less amino
acids, or induce a stop codon in the gene sequence, resulting in a shorter protein, or exchange an
amino acid. Any of these mutations may result in a loss of the enzyme function. If such mutant allele is
homozygous, the pathway may be blocked and no purple pigment will be produced in petals, which
then look white. If the plant is heterozygous, one functional copy remains to allow synthesis of enough
pigment.
A/A à active enzyme à purple pigment
A/a à active enzyme à purple pigment
a/a à no active enzyme à white
2.4. Predicting progeny of crosses using the Mendelian ratios
An important part of genetics is to predict the types of progeny that will emerge from a cross, calculate
their expected frequency and anticipate the number of plants that will need to be tested. We have
illustrated segregation for 1 and 2 characters (genes). And we used the Punnett squares to calculate it
(Figure 2.2). Punnet squares can be used to show hereditary patterns based on one gene pair, two
gene pairs or more, that independently segregate. Such grid is graphic and easy to visualize the data
up to 2 independent characters. But it may become laborious and time-consuming for more complex
analysis. or 1 character, the square is with 4 compartments (21
types of gametes), for 2 characters, 16
compartments (22
or 4, types of gametes), for 3 characters, 64
compartments (23
or 8 types of gametes). A branch diagram
may be then more appropriate and adaptable for phenotype,
genotype and gametic proportion analysis.
It illustrate the segregation of a 2-character segregation A/a ;
B/b. the dash (-) means that the allele is hidden and the
phenotype does not allow for knowing what is the second
allele, dominant or recessive. Two gene pairs give 32
, or 9,
genotypes.
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 18
A 3-character segregation will give 33
, or 27, genotypes (A, B, C) with 3 levels of branches.
If we consider an example of 5 characters. We have two plants of genotypes (A/a ; b/b ; C/c ; D/d ; E/e)
and (A/a ; B/b ; C/c ; d/d ; E/e). From a cross between these two plants, we wish to recover a progeny
plant of genotype (a/a ; b/b ; c/c ; d/d ; e/e), pentuple homozygous mutant. We wish to estimate the
number of progeny plants we need to grow to have a reasonable chance of obtained the desired
genotype. So, we need to calculate the proportion of progeny that is expected to be of that genotype.
We assume that all the gene pairs will segregate independently. Let’s consider the five pairs individually
as it is separate crosses, and then probabilities will be multiplied.
From A/a x A/a, 1/4 of the progeny will be a/a (see Mendelian ratio, part 2.2).
From b/b x B/b, 1/2 of the progeny will be b/b.
From C/c x C/c, 1/4 of the progeny will be c/c.
From D/d x d/d, 1/2 of the progeny will be d/d.
From E/e x E/e, 1/4 of the progeny will be e/e.
Therefore the overall probability of progeny of genotype a/a ; b/b ; c/c ; d/d ; e/e will be 1/4 x 1/2 x
1/4 x 1/2 x 1/4 = 1/256. We would need to examine ± 300 progeny to stand a chance to obtain one of
the desired genotypes.
2.5. Using 𝜒2(Chi-square)	test	on	Mendelian	ratios	
In practice, an experimenter is often confronted with results that are close but not identical with the
expected ratio. But is it close enough? A statistical test to check such ratios against expectation is the
𝜒2
(Chi-square) test.
In this test, we compare the observed number of items per categories to the numbers expected in
those categories based on the hypothesis they follow a Mendelian segregation. The 𝜒2
(Chi-square)
test quantifies the various deviations expected by chance of the hypothesis is true. The formula is:
Χ9
= Σ
(𝑜𝑏𝑠𝑒𝑟𝑣𝑒𝑑	𝑛𝑢𝑚𝑏𝑒𝑟	𝑝𝑒𝑟	𝑐𝑎𝑡𝑒𝑔𝑜𝑟𝑦	 − 𝑒𝑥𝑝𝑒𝑐𝑡𝑒𝑑	𝑛𝑢𝑚𝑏𝑒𝑟	𝑝𝑒𝑟	𝑐𝑎𝑡𝑒𝑔𝑜𝑟𝑦)9
𝑒𝑥𝑝𝑒𝑐𝑡𝑒𝑑	𝑛𝑢𝑚𝑏𝑒𝑟	𝑝𝑒𝑟	𝑐𝑎𝑡𝑒𝑔𝑜𝑟𝑦
Even if the hypothesis is true, we don’t always expect an exact 1:1 ratio. However, if all levels of
deviation are expected with different probabilities even if the hypothesis is true, how can we ever
reject a hypothesis? The general scientific convention is if there is a probability of less than 5% of
observing a deviation from expectations, then the hypothesis will be rejected as false. We estimate
that 5% of the time we will mistakenly reject the hypothesis even if the hypothesis is true.
In practice, let’s test the hypothesis that a plant is heterozygote. A stands in that case for red petals
and a for white petals. We did a testcross of a presumed heterozygote plant with a homozygote mutant
line (a/a) and based on the hypothesis. Mendel’s law predicts that 50% is A/a and 50% a/a. Let’s
assume that the result of this cross gave 55 red and 65 white petal plants on a progeny of 120. These
numbers differ from the precise expectations, which would have been 60 red and 60 white. The
calculation is summarized in this table
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 19
Class Observed Expected (O-E)2
(O-E)2
/E =
Red 55 60 25 25/60 0.42
White 65 60 25 25/60 0.42
𝜒2
= 0.84
The 𝜒2
value is to compare to a table, which will give us the probability value we want. The lines in the
table represent the different values of degree of freedom (df). The number of degrees of freedom is
the number of independent variables in the data. In our example, it is the number of phenotypic classes
minus 1. So here df = 2-1 = 1. Looking at the 1 df line, we see that our 𝜒2
value of 0.84 lies somewhere
between the columns marked 0.5 and 0.1; in other words, 50% and 10%. This probability value is much
greater than the cut-off value of 5%, so we would accept the observed value as being compatible with
the hypothesis.
What does the probability value actually mean? It is the probability of observing a deviation from the
expected results at least this large on the basis of chance, if the hypothesis is correct. Now that the
above results have “passed” the chi-square test because p > 0.05, it does not mean that the hypothesis
is true, merely that the results are compatible with that hypothesis. However, if we had obtained a p
value of < 0.05, we would have been forced to reject the hypothesis. We must be careful about the
wording of the hypothesis, because often there are tacit assumptions buried within it. The present
hypothesis is a case in point; if we were to carefully state it, we would have to say it is that the
“individual under test is a heterozygote A/a and the A/a and a/a progeny are of equal viability.” We
must keep in mind that differences in survival would affect the sizes of the various classes (a mutation
is lethal). The problem is that if we reject a hypothesis that has hidden components, we do not know
which of the components we are rejecting. The outcome of the chi-square test is heavily dependent
on sample sizes (numbers in the classes). Hence the test must use actual numbers, not proportions or
percentages. Also, the larger the samples, the more reliable is the test.
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 20
3. Molecular genetics in Arabidopsis thaliana (mutations and their use)
I’ll assume you know what a gene is, a promoter, how gene are transcribed and translated into
proteins. If you need to refresh your memory, please consult “An introduction to the Genetic Analysis”
by Griffiths et al. The book can be found at the MUNI library (https://bit.ly/2HjXmSl). I will upload the
8th
edition in IS (or link: https://bit.ly/2MtiMR5).
3.1. Mutations – definition
Mutations of DNA can be obtained by various mutagen agents (irradiation [UV, X-ray, gamma rays],
chemicals [EMS, ethyl methane sulphonate], insertion of pieces of DNA such as T-DNA and transposon
[biotechnology, use of agrobacterium]). These mutations can introduce various modifications of the
DNA structure: small or large deletion or insertions (indels), exchange of nucleotides, having
consequences for the cellular function (Figure 3.1). If these modifications occur within the gene, they
can be anonymous, meaning the change at the DNA level did not affect the sequence of the protein,
either because it happens in introns or the codon change is synonymous or the amino acid that was
exchange is not important for the protein function (silent mutation). It can lead to unfunctional
protein, because it introduces a stop codon (nonsense mutation), it exchanges an important amino
acid (missense mutation), or the indel indices a frameshift, and disturbs the function, stability or
behavior of the protein (null mutation). Mutations can also happen in non-coding regions, such as the
promoters. In that case, it may change the regulation of the expression of the gene (level and pattern
– when and where).
Some mutations may create recessive lethal alleles, meaning that the homozygote mutant for this
allele is not viable. No progeny will be produced. This can happen at fertilization, or later during embryo
development (stops the growth and seed aborted) and during vegetative growth (no growth after
germination or no progress to the next generation). In that can the recessive lethal alleles are
maintained as heterozygotes.
The hypothesis of “one gene – one enzyme” established by the study of Beadle and Tatum in the 1940s
clarifying the role of genes and for which they obtain a Nobel prize, is based on their work on the
Figure 3.1 - Representative position of
mutation sites and their functional
consequences
m5 – silent mutation, does not results in a
defective protein and produce a wild-type
phenotype
m1-3, m6 – null mutations, the encoded
proteins is nonfunctional or the protein is
not produced
m5 – leaky mutation, the protein has a
remaining function (low level)
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 21
haploid fungus Neurospora. They first irradiated Neurospora to produce mutations and tested the
cultures from ascospores for interesting mutant phenotypes. They isolated many auxotrophic mutants
(Figure 3.2). Each mutation that generated the auxotrophic need was inherited by a single-gene
mutation because of a wild-type backcross ratio of 1:1.
3.2. Mutations – insertion of a transgene
Genetic engineering of plants, and thus the introduction of genetically modified organisms (GMOs),
has been made possible with the identification of the infection mechanisms of a soil bacterium,
Figure 3.2- Experimental approach used by Beadle and Tatum for generating large number of mutants in Neurospora
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 22
Agrobacterium tumefaciens. This bacterium causes what is known as crown gall disease (Figure 3.3).
Infected plant produces tumor (or galls) by uncontrolled growth, at the base of the stem of the plant.
To produce this tumor, the bacterium has a large circular DNA plasmid, the Ti (tumor-inducing) plasmid.
When the bacterium infects the plant, a part of the Ti plasmid, a region called the T-DNA (transfer
DNA) is transferred to plant cells and integrated to the genomic DNA of the host plant. The insertion is
± random. In its native form, the genes present in the T-DNA enabling the tumor growth, encode
enzymes for the production of opines (important for bacteria growth) and for the production of two
plant hormones, auxin and cytokinins (for production of the tumor).
The Ti plasmid has been used as a vector for plant genetic engineering. From the Ti plasmid, we use
the T-DNA transfer functions to incorporate a piece of DNA flanked by sequences of the T-DNA borders
into the plant genome (disarmed Ti plasmid). The piece of DNA in the T-DNA may contain a selection
marker (antibiotic) and any other genetic material that the researcher would need to be integrated
into the plant genome. The selection marker serves to detect the plants would have been transformed.
Typically, the transgenic plants grown on medium containing the antibiotic would contain the T-DNA.
Segregation of the T-DNA follows a Mendelian segregation (Figure 3.4).
Figure 3.3 - Infection by agrobacterium
Figure 3.4 - Generation of
transgenic plant and
segregation of the T-DNA
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 23
Collection of insertional mutant lines have been generated where the T-DNA was randomly integrated.
This T-DNA would contain mainly an antibiotic selection marker and, in some collection, a ubiquitous
promoter that would promote the expression of the gene in proximity of the T-DNA (enhancer trap
lines). The insertion of the T-DNA in the coding region of some genes or in the promoter of these genes
may result in null allele by disturbing the gene sequence and therefore the formation of the coding
protein.
3.3. Mutations – detection
Detection of point mutation by restriction site differences
Point mutation, indel mutation, ..., alter the sequence of the DNA by creating a SNP (short nucleotide
polymorphism). If lucky, this change may delete or create a restriction site recognized by a restriction
endonuclease enzyme that would cut the piece of DNA (either the mutant or the wild-type allele) to
allow discrimination between the two alleles. The piece of DNA is first amplified by PCR, the PCR
product is incubated with the restriction enzyme and the reaction is analyzed by gel electrophoresis.
The difference in the restriction pattern between the mutant and the wild-type alleles will be visible
on the gel (Figure 3.5). This is referred as the dCAPS method (differential cleaved amplified
polymorphic sequence). If the mutation does not create a differential restriction pattern, mismatches
are included in one or the primers to create one linked to the mutation.
Detection of T-DNA
When its position is known, like in insertion line collection, the presence of the T-DNA can be detected
by PCR amplification, using two sets of primers, followed by gel electrophoresis. One set would detect
the presence of the wild-type (WT) allele (LP + RP) in wild-type homozygote plant and in heterozygote
plant for the presence of the T-DNA. The second set detects the presence of the T-DNA, by amplifying
on of the border of the T-DNA with a T-DNA border primer (BP) and one gene specific primer (in Figure
3.6, RP). In that case, the electrophoresis gel will show a band when the T-DNA is present in
heterozygote and homozygote plants for the insertion. Comparison of the two results (gene and border
amplifications) will tell you if the T-DNA is present in the plant, as homozygote or heterozygote.
Figure 3.5 - CAPS assays
from https://www.ncbi.nlm.nih.gov/probe/docs/techcaps/
Unique sequence primers are used to amplify a DNA sequence
from two related individuals, A/A and B/B, and from the
heterozygote A/B. The amplified fragments from A/A and B/B
contain two and three RE recognition sites, respectively. In
the case of the heterozygote A/B, two different PCR products
will be obtained, one which is cleaved three times and one
which is cleaved twice. When fractionated by gel
electrophoresis, the PCR products digested by the RE will give
readily distinguishable patterns. Some bands will appear as
doublets.
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 24
3.4. Forward and Reversed genetics
Forward genetics
Forward and reverse genetics are functional genetic methods. In forward genetics, the analysis starts
with a phenotype of interest with the goal to identify the mutated gene and correlate the function of
this gene to the altered development observed in the phenotype. In reverse genetics, the analysis
starts with the mutation, in a known gene, to analyze the function of this particular gene (Figure 3.7).
Typically, forward genetics starts with the wild-type genome, mutated randomly with a mutagen, and
systematically surveys it for mutations that share some common phenotype. This method has been
widely used in the 1980s and later and uncovered most of proteins involved in the production and
signalling of hormones, in the development of flower (ABC model), and many others. This method is
called genetic screens. When a plant with a phenotype of interest is identified, the position of the
mutation needs to be identified. First the mutant is “cleaned” of unlinked mutations, mutations
induced by the mutagen but not of interesting for the phenotype of interest, by backcrossing it to the
original wild-type plant. Then, several methods are available, by methodically screening for SNPs after
crossing the mutant plant with the wild-type plant of a different ecotype or cultivar. The goal is to link
on of the SNPs to the phenotype, to identify the genomic region where the mutation may have
Figure 3.6 - Detection of the presence of a T-DNA
Figure 3.7 - Forward and reverse genetics
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 25
occurred. When identified, the genes located in this region are identified and sequenced for the
presence of the mutation.
Modern methods involved NGS methods where the full genome of the backcrossed mutant is
sequenced, and the sequence compare to the wild-type. SNPs are identified. The ones located in genes,
creating missense, nonsense and frameshift are selected. Further studies will try to validate these
mutations as the ones involved in the phenotypes of interest.
If the mutation is recessive, the mutant is complemented with the wild-type version of the allele. If the
phenotype is restored, the mutant allele was identified. If the mutation is dominant, the mutant allele
is cloned and introduced (using T-DNA technology) to the wild-type plant. If the wild-type plant with
the mutant allele mimics the phenotype of the mutant, the mutant allele is identified. The the function
of the gene can be evaluated by various methods.
Reverse genetics
Reverse genetic analysis starts with a known molecule (DNA sequence, mRNA, protein) and attempts
to disrupt this molecule in order to investigate the function of the wild-type allele. This starts with the
search or the creation of the mutant. An insertional mutant can be identified in the different collection.
A mutant can be created by novel methods such as CRISPR-Cas9 protocols. The gene can be silenced
using other techniques such as RNA interference. Alternatively, the experimenter can over-express the
wild-type allele or some altered version of this allele. Then the line is studied for phenotypes at the
tissue level for developmental defects (form of the leaves, of the flower, growth of the root, …), at the
cell level for defects such as cell division, differentiation, protein trafficking. The line can be also
analyzed at the metabolic level for changes in the composition of targeted metabolites (hormones,
lipids, sugars, secondary metabolites), at the transcriptomic level for changes in expression levels of
targeted genes. All these data aim to provide information on the function of the protein of interest.
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 26
4. Practical 1 – Genotype to Phenotype: case studies of PIN1 and
MONOPTEROS
You will analyze the relationship between phenotype and genotype using two mutant lines in auxin
transport and signalling. PIN1 is one auxin efflux carrier and MONOPTEROS (MP) is a transcription
factor in the signalling pathway.
Experimental objective
This experiment will give you an understanding of how mutation affects plant development and
how to detect such mutation, using a model plant Arabidopsis thaliana (Arabidopsis).
4.1. Materials
Seeds
Seeds were sterilized for you by chlorine gas method
- pin1 (salk line salk_047613)
- mp (mp-B4149)
- Col wild-type
Material
Petri dishes
Micropore tape
Aluminum foil
Stereomicroscope
Toothpicks
Marker pen
Tubes for the seeds
Tips
Tubes
Blue pestles
PCR strips
Electrophoresis material
Gloves
Pipettes (1000, 200, 10, 2ul)
Thermomixer
Solutions
1/2 strength MS for growing the seeds (will be prepared for you)
for 1 Liter
10 g Sucrose
2,3 g MS Salts
0,5 g MES
adjust pH to 5,9 (KOH)
8 g Agar (add separately to each bottle, 4 g per 500 ml bottle!)
CTAB (DNA extraction) (will be prepared for you)
2% (w/v) Cetyltrimethylammoniumbromid (CTAB)
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 27
100 mM TrisHCl pH 8,0
20 mM EDTA pH 8,0
1,4 M NaCl
1% (w/v) Polyvinylpyrolidone (PVP 40) Mr 40000.
Autoclave it!
chloroform
isopropanol
ethanol
MQ
primers
MP_1498S CTCTCAGCGGATAGTATGCACATCGG
MP_2082AS ATGGATGGAGCTGACGTTTGAGTTC
pin1-201 RP AATCATCACAGCCACTGATCC
pin1-201 LP CAAAAACACCCCCAAAATTTC
LBaI TGGTTCACGTAGTGGGCCATCG
enzymes
MseI (with reaction buffer)
Taq polymerase (with reaction buffer)
dNTP mix
Agarose
TAE buffer
Ethidium bromide
4.2. Experiment
Timetable
This experiment is designed to take ±fifteen days. We will start the experiment on Friday 11th,
October
and then remove the petri dishes from cold treatment on Monday 14th
. The seeds will grow for 9 days.
Phenotype will be scored. Individual seedling will be collected, and its genomic DNA extracted by the
CTAB method. Genotype will be performed by PCR (and restriction for mp) and analyzed by gel
electrophoresis. The two mutants have different types of mutations (point mutation induced by EMS,
T-DNA insertion). You will learn how to genotype both and how they are different.
Timetable
mutants Prep Day
1
Prep Day
2-4)
Day 1 Day 2 Day 2 Day 3
pin1 Plants are
in soil
Score
the phenotypes; Label
the plants; DNA extraction
PCR
Gel
electrophoresis
Analysis
mp Sow the
seeds
Cold
treatment
Score the phenotypes; DNA
extraction
PCR
Restriction
Gel
electrophoresis
Analysis
Sowing
All this work is done in sterile conditions under flow benches in room 1S26
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 28
• You will be given 2 plates of MS medium
• Label your plates with the name of the seeds that will be sown (Col, mp)
• You may draw two lines with the marker pen at the back of the plate
• Take a toothpick and wet its tip by tapping it in the corner of the plate. 1 Toothpick per genotype
to avoid mixing the seeds.
• Using the wet tip of the toothpick pick up one seed at a time from the tube and put it in its
corresponding place on the Petri dish.
• Place 20 seeds for each genotype on the Petri dishes, following the lines you draw. Separate nicely
the seeds along the line.
• Place the lid on the Petri dishes and wrap the edges of each Petri dish with Micropore tape
completely sealing them shut.
• Wrap their stack completely with aluminum foil so that no light reaches the seeds.
• Label the wrapped Petri dishes using marker tape, with your name and date.
• Put the wrapped Petri dishes in the fridge (room 1S16) at 4°C-6°C. This process is called
stratification (or vernalization). Stratification is important for breaking seed dormancy and
synchronizing the germination of the seeds. Be extremely careful when preparing, transferring or
working on Petri dishes with seeds. Rough handling can cause seeds to shift from their intended
position and ruin the experiment.
• All Petri dishes should be kept in cold treatment until Monday 14th
, October.
Data collection – mp part
• After the cold treatment is complete, remove Petri dishes from the fridge, remove the aluminum
foil
• Place these dishes upright on one shelf on the cultivation room
• On Tuesday 22nd
, score the phenotype of the seedlings. You will scan the plates for record in room
1S29. You may use the binocular microscopes in room A26, 2.08 for counting and observing the
phenotypes.
DNA extraction
• Use a full seedling (mp) as starting material and transfer it to a 1.5 ml eppis
• Use 20 seedlings of mp and 4 seedlings of Col. Distribute the samples among you (8 per person).
• Grind the seedlings with a blue pestle. Change of pestle between each sample. DON’T TRASH
THEM. They are washed and reused.
• Add 200 µl of CTAB buffer. Vortex briefly and spin down.
• Incubate at 65o
C for at least 30 minutes using a thermomixer.
• Cool down the mixture to room temperature for about 10 minutes.
• Add 200 chloroform and vortex at maximum rotation for 15 seconds. WORK UNDER THE
CHEMICAL BENCH
• Centrifuge for 5 minutes
• Transfer 150 µl of the upper aqueous phase into a new tube. Do not include the interphase.
• Add 150 µl isopropanol and mix well. Incubate for 5 minutes at room temperature.
• Centrifuge for 30 minutes at 13,000 rpm at 4o
C.
• Discard the liquid.
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 29
• Add 200 µl 70% ethanol
• Centrifuge for 15 minutes at 4o
C.
• Discard the liquid.
• Air dry the pellet for at least 30 minutes (usually at 37o
C or higher).
• Add 30 µl MQ water
Genotyping
The mp mutant has a point mutation induced by EMS. We will prepare one type of PCR reaction. The
DNA fragment amplified by PCR will then be cut by the MseI restriction enzyme. MseI will cut the
mutant allele but not the wild-type one. The mp-B4149 allele has a G to A mutation in its coding
sequence at the splice acceptor site of the tenth exon. This mutation creates a T/TAA restriction site
that can be cut by MseI. Because you have 20 + 4 samples. You will prepare 1 master mixes for 30
samples. You do more volume to compensate for pipetting inaccuracy.
You need:
- PCR buffer (10x concentrated)
- 10 mM dNTPs
- 10 uM oligo MP_1498S CTCTCAGCGGATAGTATGCACATCGG
- 10 uM oligo MP_2082AS ATGGATGGAGCTGACGTTTGAGTTC
- Taq polymerase (take out of the freezer at the last moment and keep it cold in one of the cold
block)
- Genomic DNA
The master mix will be:
reagents/ Nr. of samples 1 10 30
MQ 5,5 55 165
10x Reaction Buffer 1,25 12,5 37,5
10mM dNTPs 0,25 2,5 7,5
10uM F Primer 0,25 2,5 7,5
10uM R Primer 0,25 2,5 7,5
Taq Polymerase 0,06 0,6 1,8
total 12 120 360
• Mark the PCR strip at the beginning to recognize where the sample 1 will be. You need three
strips, labeled with 1, 9, 17 in one extremity.
• The master mix is distributed in PCR strips, 7,5 ul per tube. Then add 5 ul of DNA, one sample per
tube.
• DNA and mix are well mixed, and tubes are spin down.
• In room 2.21, there are the PCR machines. One machine has been booked for you. Put the three
strips in the block of the machine. Start the machine.
• The program will be: 1x 95o
C, 3’; 30x (95o
C, 20”; 55o
C, 20”; 72o
C, 45”); 72o
C, 5’
• We will stop the reactions for you and keep the samples in the fridge overnight.
• The PCR reactions will be used as template for a restriction analysis with MseI. Each of you will
prepare a master mix for one strip as follow:
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 30
o MQ – 20 ul
o 10x CutSmart buffer – 2.5 ul
o MseI – 2.5 ul
• Mix 3 ul of the RE is added to 5 ul of PCR product in new PCR strips. Incubation for 30 minutes at
37o
C in a PCR machine
• During the reaction time, you will prepare an electrophoresis gel. You wish to differentiate PCR
fragments of 585 bp (uncut, wild type) and of 379 + 207 bp (mp). You need to prepare a 2%
agarose gel.
• When working in the elfo room (2.18/2.19), wear lab coat and gloves
• Weight 4g of agarose and pour it an Erlenmeyer/bottle containing 200 ml TAE buffer. Pour the TAE
from the barrel and measure it with one of the available cylinders.
• The agarose is melt using the micro-wave. Stay put to avoid over boiling. Be careful to not burn
yourself (use the carry-over glove). All the agarose should be melted.
• Work in the chemical bench, prepare a chamber (you will be provided the one, the combs and the
casting chamber). When the agarose cools a bit, add 3 ul of ethidium bromide, mix well and pour
the agarose in the chamber. Let it solidify under the chemical flow.
• In the meantime, the restriction reaction finished. Get the strips from the machine, switch off
properly according to instructions.
• To load the samples in the elfo gel, you will need to add loading buffer. It has two purposes: the
blue color helps to visualize the progress of the migration; the glycerol renders the solution heavier
and helps the solution to go down the wells. The loading buffer is 6x concentrated, meaning 1 ul
for 5 ul of solution. Add 2 ul per sample.
• In the elfo room, place the gel in the appropriate running chamber. Make sure the buffer is clean
and in the proper amount. You are ready to load the samples in the gel. One sample per well. Keep
one well at one extremity to load a ladder. The ladder will indicate the size of DNA bands in the
gel.
• Plug the cap, switch on the power supply. Set the voltage to 100, the timer to 30 minutes. Start.
• After 30 minutes, you collect the gel to take a picture using the BioRad machine. You will be
instructed how to proceed.
• Print the gel picture.
• Analyze the size of the DNA fragments for each sample and interpret the results – what seedling is
wild-type, heterozygous or homozygous for the mutation.
Data collection – pin1 part
• The pin1 plants are growing in the phytotron, room 1S08/1S09. We will perform the phenotyping
of pin1 mutant plants between November 13th
and November 15th
as you need flowering plants to
access the phenotype.
• Follow carefully the instructions for manipulating the plants. Wear only the lab coat available in
the phytotron corridor (not yours). The plants will be available on the tables in the corridor.
• Label properly the pin1 plants with the white labels (plant 1, 2, 3 …)
• Collect a piece of leaf per plant in a labeled 1,5 ml tube (1, 2, 3…)
• Score the phenotype (eventually take a picture for your record) of each plant
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 31
DNA extraction
• The procedure is the same as previously performed for mp
• Use the collected piece of leaf as starting material and transfer it to a 1.5 ml eppis
• We will use the already prepared DNA from Col as control
• Distribute the samples among you
• Grind the seedlings with a blue pestle. Change of pestle between each sample. DON’T TRASH
THEM. They are washed and reused.
• Add 200 µl of CTAB buffer. Vortex briefly and spin down.
• Incubate at 65o
C for at least 30 minutes using a thermomixer.
• Cool down the mixture to room temperature for about 10 minutes.
• Add 200 chloroform and vortex at maximum rotation for 15 seconds. WORK UNDER THE
CHEMICAL BENCH
• Centrifuge for 5 minutes
• Transfer 150 µl of the upper aqueous phase into a new tube. Do not include the interphase.
• Add 150 µl isopropanol and mix well. Incubate for 5 minutes at room temperature.
• Centrifuge for 30 minutes at 13,000 rpm at 4o
C.
• Discard the liquid.
• Add 200 µl 70% ethanol
• Centrifuge for 15 minutes at 4o
C.
• Discard the liquid.
• Air dry the pellet for at least 30 minutes (usually at 37o
C or higher).
• Add 30 µl MQ water
Genotyping
We will prepare two types of PCR reactions, one to amplify the wild-type allele, one to amplify the
mutant allele from the T-DNA border. Because you have 10 + 4 samples. You will prepare 2 master
mixes for 20 samples.
You need:
- PCR buffer (10x concentrated)
- 10 mM dNTPs
- 10 uM oligo pin1-201 RP AATCATCACAGCCACTGATCC
- 10 uM oligo pin1-201 LP CAAAAACACCCCCAAAATTTC
- 10 uM oligo LBaI TGGTTCACGTAGTGGGCCATCG
- Taq polymerase
- Genomic DNA
Each of the master mixes will be
reagents/ Nr. of samples 1 20
MQ 5,5 110
10x Reaction Buffer 1,25 25
10mM dNTPs 0,25 5
10uM F Primer 0,25 5
10uM R Primer 0,25 5
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 32
Taq Polymerase 0,06 1,2
total 12 240
The WT mix is with pin1-201 RP and pin1-201 LP primers.
The T-DNA mix is with pin1-201 RP and LBaI primers.
• Mark the PCR strip at the beginning to recognize where the sample 1 will be. You need four
strips, labeled with 1, 9, 17, 25 in one extremity (1, 9 for WT mix, 17, 25 for TDNA mix)
• The master mixes are distributed in PCR strips, 7,5 ul per tube. Then add 5 ul of DNA, one sample
per tube.
• DNA and mix are well mixed, and tubes are spin down.
• In room 2.21, there are the PCR machines. One machine has been booked for you. Put the three
strips in the block of the machine. Start the machine.
• The program will be: 1x 95o
C, 3’; 30x (95o
C, 20”; 55o
C, 20”; 72o
C, 1’); 72o
C, 5’
• We will stop the reactions for you and keep the samples in the fridge overnight.
• You will prepare an electrophoresis gel. We wish to differentiate PCR fragments of ±1200 bp. We
need to prepare a 1.2% agarose gel.
• When working in the elfo room (2.18/2.19), wear lab coat and gloves
• Weight 2.4g of agarose and pour it an Erlenmeyer/bottle containing 200 ml TAE buffer. Pour the
TAE from the barrel and measure it with one of the available cylinders.
• The agarose is melt using the micro-wave. Stay put to avoid over boiling. Be careful to not burn
yourself (use the carry-over glove). All the agarose should be melted.
• Work in the chemical bench, prepare a chamber (you will be provided the one, the combs and the
casting chamber). When the agarose cools a bit, add 3 ul of ethidium bromide, mix well and pour
the agarose in the chamber. Let it solidify under the chemical flow.
• To load the samples in the elfo gel, you will need to add loading buffer. It has two purposes: the
blue color helps to visualize the progress of the migration; the glycerol renders the solution heavier
and helps the solution to go down the wells. The loading buffer is 6x concentrated, meaning 1 ul
for 5 ul of solution. Add 3 ul per sample.
• In the elfo room, place the gel in the appropriate running chamber. Make sure the buffer is clean
and in the proper amount. You are ready to load the samples in the gel. One sample per well. Keep
one well at one extremity to load a ladder. The ladder will indicate the size of DNA bands in the
gel.
• Plug the cap, switch on the power supply. Set the voltage to 100, the timer to 30 minutes. Start.
• After 30 minutes, you collect the gel to take a picture using the BioRad machine. You will be
instructed how to proceed.
• Print the gel picture.
• Analyze the size of the DNA fragments for each sample and interpret the results – what seedling is
wild-type, heterozygous or homozygous for the mutation.
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 33
5. Root development
5.1. Root system architecture
Plants are fixed in soil and need to access soil resources such as water and nutrients to survive in
environments that are continually changing. To do so, plants have evolved extensive and highly plastic
root systems to forage in the surrounding heterogenous soil. Therefore, roots are considered as a
central component of plant productivity (e.g. biomass production). The root system architecture is
flexible as dependent of the local growth conditions and type of soil. Its structure (physiology)
correlates with nutrient uptake efficiency and stress (drought) resilience. However, the relative
inaccessibility of the root system has caused root research to lag behind research into shoot
development, physiology and architecture.
Root architecture correlates with soil composition
Root system development is an iterative process based on the repetition of four fundamental
processes: (1) the production of roots, (2) their growth, (3) their growth direction in the soil domain
(tropisms), and (4) their capacity to produce other roots (branching). The first organ to emerge from
the seed is the primary (or tap) root. The primary root grows and changes direction in the soil in
response to various stimuli (e.g., gravity, moisture, or mechanical impedance). After a certain time, it
forms branches (or lateral roots); the primary root gives rise to secondary roots, which give rise to
tertiary roots etc. These branch roots are known as “higher order” roots. For a given species (or
genotype), lateral roots emerge from their parent at a fixed time interval. As a consequence, the
distance between two lateral roots (or interbranch distance) is a function of that time interval and of
the parent root’s growth rate. The newly formed lateral roots emerge at a given angle with respect to
their parent roots, called the insertion angle.
Once emerged, laterals extend into the soil and have the ability to change directions. Lateral roots can
also form higher order branches, often with a different density than their bearing parent. This leads to
the formation of a complex tree-like structure described as the root system architecture (Fig. 5.1). A
direct consequence of these dynamics is that the root system as a whole is composed of a large range
of root ages, types, and developmental stages, which leads to a great heterogeneity in functional
properties within each root system.
Figure 5.1 - Various root architecture
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 34
The vertical placement of soil resources, such as water and nutrients, affects root form and function.
In many soils, most organic matter and nutrients are found in the topsoil, or about the first 20 cm of
soil. As plants grow and eventually die, nutrients are extracted from the whole soil profile but
deposited on the top where shoot debris eventually decomposes and becomes incorporated into the
soil, which serves to enrich the topsoil over time. In agricultural fields, fertilizers such as nitrogen,
phosphorus, and potassium are also applied to the topsoil. However, during dry periods, water can
often be found deeper in the soil.
The spatial distribution of roots in soil largely determines their ability to forage for soil resources. For
example, roots with shallow growth angles (closer to horizontal) will preferentially explore the topsoil
where many nutrients are available. On the other hand, roots that grow steeper may be able, in certain
environments, to reach deeper water pools during drought conditions.
Water uptake by the plant is a passive process, driven by differences in water potential along the soil,
plant and atmosphere continuum. Water flows from areas of high potential (wet, low osmotic content)
to low potential (dry, high osmotic content). Water evaporates from the leaves to air through pores
called stomata. This process, called transpiration, creates a suction that pulls water from the soil, into
the roots, up the stem, and out the leaves. The uptake capacity of a root segment (a short section of
root) is influenced by its radial (from the soil to the xylem, across the root’s width) and axial (along its
length) hydraulic conductivities.
The radial conductivity is mainly influenced by the root diameter, or the number of cell layers water
has to cross before reaching the xylem poles, the presence of hydrophobic barriers (endodermis and
exodermis), and the presence and activation of aquaporins, a large family of water channel proteins.
Root diameter is usually variable among different root types and, for dicots, increases as the root ages
due to radial growth. Hydrophobic barriers are tissue-specific secondary structures that impede the
passage of water through the apoplast (the space between cells), forcing it to flow through the
symplast (the space within cells). These barriers form dynamically and degrade in response to
environmental stresses. Aquaporins greatly facilitate the radial movement of water across roots by
providing channels for water movement across membranes. Knocking down the production of certain
aquaporins can reduce the uptake capacity of a plant by 60%. Aquaporins are not expressed uniformly
within the root system, but rather their abundance depends on the root type, the root age, and the
surrounding soil conditions. The root radial conductivity is then the combination of these three factors:
root diameter, hydrophobic barriers, and aquaporins.
The axial conductivity, on the other hand, is mainly a function of xylem development, which is also
highly related to root age, root type, and root diameter. Generally, thicker and older roots have larger
and more numerous xylem poles, leading to a greater capacity to transport water.
Monocots versus dicots
Monocots and dicots have distinct root system architectures. In dicot root systems, the primary root
and first order laterals generally form the backbone of the structure. In addition, some dicot species
form basal roots that originate from the hypocotyl and can represent an important proportion of the
total root system. Monocot root systems can also form basal roots, also known as seminal roots. In
addition to the primary and seminal roots, monocots usually form nodal roots (also known as
adventitious or shoot-borne roots) that originate from the stem. As a monocot plant develops, nodal
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 35
roots emerge from successive shoot nodes, both from the main stem and from the tillers (shoot
branches, if present). Through this process, in monocot root systems, nodal roots generally constitute
the majority of first order (or axile) roots. Adventitious roots are also observed in some dicot species,
but in a less systematic fashion. Nodal and seminal roots follow roughly the same developmental
program as the primary root, although, in some species, some specific genetic determinisms have been
identified. The primary and basal (seminal) roots are sometimes referred to as the embryonic root
system, while the nodal roots are referred to as the postembryonic root system.
The second difference between monocots and dicots is that dicot roots undergo secondary growth,
but monocot roots do not. Secondary growth involves cell divisions in mature root tissues that leads
to a thickening of the older roots in the root system, sometimes accompanied by the deposition of
water-impermeable suberin. The absence of secondary growth in monocots limits their water
transport capacity through the xylem because there is no increase in size of the xylem vessels with
increasing numbers of lateral branches. That limitation is overcome by the continuous production of
new nodal roots that tend to be thicker than their predecessors.
Root structure
The structure of the Arabidopsis root is simple. A small number of stem cells at the tip of the root
generate all of the cell types through stereotyped divisions followed by cell differentiation and
regulated cell expansion (Fig. 5.2). Because root growth is indeterminate, these processes are
continual, resulting in all developmental stages being present at all times.
The radial symmetry of the root combined with a lack of cell movement means that clonally related
cells are frequently found in cell files. These cell files can be traced back to their origins, which are four
types of stem cells (or initial cells) at the root tip. The epidermal/lateral root cap initials give rise to the
epidermis and the outer portion of the root cap known as the lateral root cap (Fig. 5.2). The central
portion of the root cap, the columella, has its own set of initials. The ground tissue cells, the cortex and
endodermis, are generated by division of the cortex/endodermal initials. Finally, the vascular tissue
and pericycle have their own initials. Internal to and contacting all the initials is a small number of
central cells that are mitotically inactive and are known as the quiescent center (QC). The loss of QC
cells leads to the loss of stem cell status and progression toward differentiation of the contacting initial
cells.
The radial organization of the root is generated by division of initial cells and subsequent acquisition
Figure 5.2 - Cell types in Arabidopsis root meristem
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 36
of cell fate. In a transverse root section, there are four radially symmetric layers (from outside in,
epidermis, cortex, endodermis, pericycle) that surround the bilaterally symmetric vascular tissue
(consisting of phloem, xylem and procambium) (Fig 5-3). The vascular tissue and surrounding pericycle
are termed the stele.
The root epidermis is composed of two cell types whose identity is regulated by positional information.
Trichoblasts develop into hair cells and are located in the cleft between underlying cortical cells when
(viewed in transverse section in Fig 5.3) while atrichoblasts remain hairless and are located over single
cortical cells.
Upon germination, cells of the meristem begin to divide, and the root expands axially as a result of cell
expansion. As the root continues to grow, the number of cells in the meristem increases and the rate
of cell production increases. This increase in the number of cells can account for the doubling in the
rate of root elongation between 6 and 10 days after germination. Cell expansion is also a strong
Figure 5.3 - Root anatomy
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 37
contributor to root growth. In the root region distal to the meristem (meristematic zone), cell division
displace the progeny cells of the initial cells upward in the cell file, while cell expansion is limited. Then
longitudinal expansion occurs in the elongation zone. In this zone, cell division is almost stopped. When
cells are fully elongated, differentiation occurs as visible by the appearance of root hairs (Fig. 5.3).
Embryonic origin of the Arabidopsis root
During Arabidopsis embryo development, cell division occurs in stereotyped patterns. This facilitates
the identification of founder cells for the primary root. The origin of the quiescent centre and the
columella root cap can be traced back to a single cell, the hypophysis. This cell in turn derives from the
basal daughter cell of the first zygotic division and is the only contribution of the basal cell to the
embryo proper (Fig. 5.4).
The remaining cells that will form the root in
the mature embryo derive from the apical
daughter cell of the zygote. Their radial
organization in protodermal, ground tissue
and procambial layers is very similar to that of
the entire embryo axis, except in the ground
tissue. The boundary between root and
hypocotyl is not evident from the anatomy of
the embryo although it is clearly marked postembryonically
by differentiation
characteristics of individual cell types such as
root hair formation and by the chlorophyll
content of ground tissue cells.
The radial arrangement of cells in the root is
set up in the heart stage and maintained
thereafter. The arrangement of initial cells
around the quiescent centre, which is maintained in the mature root has been called the promeristem.
Lateral root formation
Lateral root primordia arise from pericycle cells opposite xylem poles at some distance from the
primary root meristem. The initial cell division patterns that give rise to new primordia are very
different from those occurring during primary root formation. At later stages of lateral root formation,
the cellular organization becomes very similar to that of the primary root, although lateral roots display
more variability in cell numbers and precise cellular organization. Eight stages of lateral root
development were defined based on specific anatomical characteristics and cell divisions. Analysis of
the cell division patterns revealed that a remarkable amount of organization and cell differentiation
occur at very early stages of lateral root primordium development. In contrast, the lateral root
meristem does not become active until after the primordium emerges from the parent root, and
therefore does not appear to play a role in early pattern formation and organization. This is similar to
what is seen during embryogenesis.
Figure 5.4 - Embryonic origin of the Arabidopsis root
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 38
5.2. Root development and the role of auxin
Physiological experiments have demonstrated that the formation of entire root systems can be
stimulated by auxins. Auxin is also required for specification of the meristem. Mutations in genes
involved in auxin production, transport and signaling interfere with embryonic root formation.
monopteros (mp) mutants lack an embryonic root altogether (Practical 1 - Part 1). The MP gene
encodes a member of the AUXIN RESPONSE FACTOR (ARF) proteins that can mediate rapid
transcriptional responses to auxin. Several other mutants in auxin signaling display severe primary root
defects.
As the primary root development strongly depends on the phytohormone auxin, it is expected that a
similar important role for auxins in lateral root initiation. Indeed, genetic analysis of the formation of
lateral roots has also revealed numerous links to auxins. Exogenous auxin addition leads to
supernumerary roots.
Auxin is not homogenously distributed within tissues, notably in roots, due to the action of PIN proteins
as auxin efflux carriers (see above). An auxin gradient has been identified along the root longitudinal
axis both by quantification and by expression analysis of the response reporter, DR5. The DR5 reporter
is composed of an artificial promoter sequence made of inverted repeats of the DNA binding sequence
of the ARF proteins (TGTCTC) driving the expression of a reporter gene (GUS or fluorescent proteins).
The location and intensity of expression of the DR5 reporter is indicative of the intensity of the auxin
signaling.
Cell-specific auxin measurements were performed to map auxin concentrations in the Arabidopsis root
tip. This used cell sorting of fluorescent cells isolated from reporter lines with tissue-specific expression
pattern. Auxin (and its metabolites) quantification in those cells was performed by GC-MS. These
results indicated that auxin acts like a morphogen at the root apex. The highest concentrations were
found at the QC, cells that remain quiescent. Intermediate concentrations were found in cells of the
meristem, cells that divide frequently. Lower levels of auxin where found in cells of the elongation
zone.
Auxin is involved in post-embryonic growth, such as de novo organogenesis of lateral roots. Auxin firstly
accumulates at the location of organ initiation, and then an auxin gradient is established along the
growth axis of the developing primordia with the maximum at its tip. Once a lateral or primary root
meristem becomes functional, a stable auxin gradient form with its maximum at the quiescent center
and young columella cells, which is required to maintain the pattern of the root meristem. In case that
this maximum is lost, meristem cells start to differentiate, and the root tip is destroyed.
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 39
6. Practical 2 – The role of auxin in root development
In this practical we will test the effects of auxin on root growth.
We will use the seeds of the DR5::GUS line to monitor the effects of auxin application on auxin
signalling and correlate it to the root phenotypes. We will use two concentrations of NAA, Naphthalene
1-acetic acid, an artificial auxin. You remember from the lectures that depending its concentration,
auxin may have opposite effects: inhibiting cell elongation at high concentration, favoring cell
elongation at low concentration (Fig. 6.1). In this practical we will germinate seeds on 100nM and
100pM NAA.
6.1. Materials
Seeds
Seeds were sterilized for you by chlorine gas method
DR5::GUS
Material
Sterile 50 ml tube
Petri dishes
Micropore tape
Aluminum foil
Stereomicroscope
Toothpicks
Marker pen
Tubes for the seeds
Well plates
Gloves
Figure 6.1 - Effect of auxin concentration on cell elongation
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 40
Pipettes (1000, 200, 10, 2ul)
37o
C incubator
scanner
slides and cover-slides
microscope
Solutions
1/2 MS
10 mM NAA stock solution
GUS staining (solutions are prepared)
GUS wash buffer
50 mM NaPO4 pH7 (stock of 500 mM)
5 mM Ferro-cyanide (K4Fe(CN)6) (stock of 50 mM)
GUS staining buffer
50 mM NaPO4 pH7 (stock of 500 mM)
5 mM Ferro-cyanide (K4Fe(CN)6) (stock of 50 mM)
0.05% Triton X-100
X-Gluc added in the last moment in the required volume at 0.5 mg/ml final (stock 20 mg/ml in
DMSO)
20% lactic acid in 20% glycerol (in PBS)
6.2. Experiment
Timetable
This experiment is designed to take ±fifteen days. We will start the experiment on Wednesday 6th,
November and then move the petri dishes from cold treatment on Saturday 9th
. The seeds will grow
for 11 days. Phenotype will be scored at Day After Germination (DAG) 4, 6, and 11. Seedlings of each
treatment will be collected and stained for GUS on November 20th
. Microscopic observations will be
on Thursday 21th and analysis of the results on Friday 22th.
Sowing
All this work is done in sterile conditions under flow benches in room 1S26. You will have to calculate
the volume of NAA to add for one plate for the given final concentrations. You will be provided with
200 mL of 1/2MS and will have to prepare 3 plates: control (no NAA added), high NAA (100nM), low
NAA (100pM). One plate contains 50mL of medium.
• Calculate the volume of NAA to add for 50mL MS from a stock solution of 10mM for a final
concentration of 100nM and 100pM. Propose how to have an accurate pipetting with the given
stock solution.
• Label your plates with the treatment (control, 100pM NAA, 100nM NAA), the name of the seeds
that will be sown (DR5::GUS), your name and the date
• You may draw one line with the marker pen at the back of the plate
• Work under sterile flow, using the 50mL-tube, pour MS into the control plate, then the low
concentration NAA plate (by adding the proper volume of NAA into 50 mL MS in the falcon tube),
and then the high concentration NAA plate
• Leave the plate open under the flow for ± 30 minutes to solidify
Mendel’s laws in plant biology – S2012 – Autumn semester 2019 41
• Take a toothpick and wet its tip by tapping it in the corner of the plate.
• Using the wet tip of the toothpick pick up one seed at a time from the tube
• Place 20 seeds for each genotype on the Petri dishes, following the line you draw. Separate nicely
the seeds along the line.
• Place the lid on the Petri dishes and wrap the edges of each Petri dish with Micropore tape
completely sealing them shut.
• Wrap their stack completely with aluminum foil so that no light reaches the seeds.
• Label the wrapped Petri dishes using marker tape, with your name and date.
• Put the wrapped Petri dishes in the fridge (room 1S16) at 4°C-6°C. This process is called
stratification (or vernalization). Stratification is important for breaking seed dormancy and
synchronizing the germination of the seeds. Be extremely careful when preparing, transferring or
working on Petri dishes with seeds. Rough handling can cause seeds to shift from their intended
position and ruin the experiment.
• All Petri dishes should be kept in cold treatment until Saturday 9th
, November.
Data collection
• Scan the plates to follow the growth of the root at DAG = 4, 6 and 11
• The scans can be used to analyze the length of the roots, and roughly quantify emergence of the
lateral roots.
GUS staining
• Prepare a 12-well plate marked with your name, and in the lid, the name of the treatment in the
corresponding well
• Fill each well (=3) with 2 ml GUS wash buffer
• Collect ±10 seedlings per treatment per well
• Apply vacuum for 5 minutes
• Remove GUS wash buffer and replace by 1 mL of GUS staining buffer.
• Apply vacuum for 5 minutes
• Close the lid and wrap it in aluminum
• Incubate at 37o
C for 30 minutes. Monitor if the staining is enough. You may incubate longer if
necessary
• Remove the GUS staining buffer and replace by 2 ml of lactic acid solution
• Leave on the table to clear
• Mount on slides (1 slide per line per treatment)
• We will be looking at the microscope and take pictures. The manipulation of the microscope will
be performed under supervision following the instructions of the teacher.