Bacterial replisomes
Zhi-Qiang Xu and Nicholas E Dixon
Bacterial replisomes are dynamic multiprotein DNA replication
machines that are inherently difficult for structural studies.
However, breakthroughs continue to come. The structures of
Escherichia coli DNA polymerase III (core)–clamp–DNA
subcomplexes solved by single-particle cryo-electron
microscopy in both polymerization and proofreading modes
and the discovery of the stochastic nature of the bacterial
replisomes represent notable progress. The structures reveal
an intricate interaction network in the polymerase–clamp
subassembly, providing insights on how replisomes may work.
Meantime, ensemble and single-molecule functional assays
and fluorescence microscopy show that the bacterial
replisomes can work in a decoupled and uncoordinated way,
with polymerases quickly exchanging and both leading-strand
and lagging-strand polymerases and the helicase working
independently, contradictory to the elegant textbook view of a
highly coordinated machine.
Address
Molecular Horizons and School of Chemistry and Molecular Bioscience,
University of Wollongong, and Illawarra Health and Medical Research
Institute, Wollongong, New South Wales 2522, Australia
Corresponding author: Dixon, Nicholas E (nickd@uow.edu.au)
Current Opinion in Structural Biology 2018, 53:159–168
This review comes from a themed issue on Catalysis and regulation
Edited by Alice Vrielink and Hazel M Holdenc
For a complete overview see the Issue and the Editorial
Available online 4th October 2018
https://doi.org/10.1016/j.sbi.2018.09.006
0959-440X/ã 2018 The Authors. Published by Elsevier Ltd. This is an
open access article under the CC BY-NC-ND license (http://creative-
commons.org/licenses/by-nc-nd/4.0/).
Introduction
Genetic information of living organisms is stored in
chromosomal DNA. To faithfully pass it on to the next
generation, it is essential that DNA be copied with high
efficiency and fidelity. All organisms from bacteria to
humans use complex multi-protein molecular
machines, called the replisomes, to achieve this feat.
Although general functions and mechanisms of replisomes
from different domains of life are similar, the
components and mechanistic details can be distinct.
Here, we focus on bacterial replisomes, particularly that
from Escherichia coli.
Bacterial DNA replication can be divided into three
stages: initiation, elongation and termination. Each stage
requires a different set of proteins with highly coordinated
activities [1]. The details of each stage as well as
recent insights into the structures and functions of
protein components or subcomplexes are discussed
separately.
Initiation of DNA replication
Initiation of bacterial DNA replication is tightly controlled
to ensure that the chromosome is duplicated
once every cell division. Bacterial chromosomes are
usually circular doubled-stranded (ds) DNA molecules
with a single initiation locus called the replication origin,
oriC. The E. coli chromosome is 4.6 Mb in size with
a 250-bp oriC. Although there are significant variations
in the length and organization of origins in different
bacterial species, they are generally comprised of an
array of ‘DnaA boxes’ for origin recognition by the
initiator protein DnaA, together with an adjacent ATrich
DNA unwinding element (DUE) for strand separation
[2] (Figure 1a). Recently, a string of repeating
trinucleotides (5’-TAG
/A) in the DNA unwinding
region, termed DnaA-trio, was identified as an important
element [3
].
DnaA has four domains (Figure 1b). The protein interaction
domain 1 interacts with protein partners, including
the replicative helicase DnaB, and domain 2 is a flexible
linker. Domain 3 is the AAA+ ATPase domain, which
mediates DnaA oligomerization and binding to singlestranded
(ss) DNA [4]. Domain 4 is the dsDNA-recognition
domain that binds to DnaA boxes via a helix-turnhelix
motif [5] (Figure 1c). Both ATP-bound and ADPbound
DnaA can bind to high-affinity DnaA boxes, but
only ATP-DnaA binds to lower affinity boxes and oligomerizes
to form a helical filament on oriC [6,7] (Figure 1a,
c). DNA wrapping around the DnaA filament causes
torsional strain in the DUE, contributing to DNA melting
[8,9]. The DnaA filament then extends beyond the DnaA
boxes with the AAA+ domain interacting with DnaA-trio.
This sequesters and stretches one strand of the DUE,
facilitating DNA melting and bubble formation for helicase
loading [4] (Figure 1c).
After forming a DNA bubble, two DnaB helicase hexamers
are recruited and loaded onto each of the separated
ssDNA strands as DnaB6–(DnaC)6 complexes. Binding of
the helicase loader DnaC inhibits the ATPase and helicase
activities of DnaB and traps it like an open righthanded
lockwasher, ready to be loaded onto ssDNA
[10,11]. DnaC is a homolog of DnaA. Its AAA+ domain
interacts with the AAA+ domain of DnaA at the end of the
filament and serves as an adaptor to load one DnaB–DnaC
Available online at www.sciencedirect.com
ScienceDirect
www.sciencedirect.com Current Opinion in Structural Biology 2018, 53:159–168
complex onto the strand that DnaA is stretching [12].
Domain I of DnaA interacts with DnaB of the other
DnaB–DnaC complex, helping to load it on the complementary
strand [2] (Figure 1c).
In Gram-positive bacteria, such as Bacillus subtilis, the
hexameric replicative helicase DnaC (counterpart of
DnaB) is believed to be assembled from individual subunits
with the assistance of the helicase loader DnaI and
two others proteins, DnaD and DnaB [6]. In Helicobacter
pylori, a bacterium with no identified helicase loader,
DnaB assembles as a head-to-head double hexamer,
which later separates into two hexameric helicases [13].
Next, the DnaG primase interacts with the N-terminal
collar of DnaB6, stimulating DnaC dissociation [14]. The
two DnaB hexamers later move to the apices of the
bubble to form two replication forks moving in opposite
directions. DnaG recognizes specific priming sites (preferentially
5’-CTG) to produce a leading-strand RNA
primer for DNA elongation, and to repeatedly prime
Okazaki-fragment (OF) synthesis on the lagging strand.
Elongation stage of DNA replication
DNA contains two antiparallel strands that have been
thought to be replicated simultaneously by the same
replisome. The leading strand is replicated continuously,
while the lagging strand is synthesized as short Okazaki
fragments. RNA primers of OFs are replaced by DNA by
gap filling and nick translation by DNA polymerase I, and
the nicks are sealed by DNA ligase.
In E. coli, the major replicative polymerase is the Pol III
holoenzyme (HE) comprised of 10 different proteins
organized into three functionally distinct but physically
interconnected assemblies: the aeu polymerase core, the
b2 sliding clamp and the dtng3–nd’cx clamp loader complex
[1] (Figure 2a). In the polymerase core, a is the
polymerase subunit, e the 3’–5’ proofreading exonuclease
and u is a small subunit that stabilizes e. After a RNA
primer is made by DnaG, the b2 clamp is loaded onto the
primer terminus by the clamp loader. The a and e
subunits separately bind the clamp, each via a short linear
clamp-binding motif (CBM) to the two symmetrically
related CBM-binding pockets of b2. Tethered to the
clamp, Pol III is able to synthesize DNA at high speed
(1000 Nt/s) and with much higher processivity
(>150 kb) [1,15].
Bacterial replisomes are highly flexible and mobile
machines, their dynamics being mediated and controlled
by a network of protein–protein interactions of different
strengths. Many of the replication proteins are either
conformationally flexible or contain flexible or unstructured
regions, making structural studies by X-ray crystallography
or NMR difficult. However, through decades of
efforts, structures of all E. coli replication proteins or their
160 Catalysis and regulation
Figure 1
Lo
lower affinity DnaA boxeshigh affinity DnaA boxes
linker dsDNA-bindingAAA+
protein
interaction
III IVIII
374135871
DUE
467
E. coli oriC(a)
(c) DNA melting and helicase loading at oriC
DnaA Domain I
DnaC DnaB
Domain III
Domain IV
Domain IV
Domain III
Domain IVssDNA
Domain organization of E. coli DnaA(b)
Current Opinion in Structural Biology
direction of DnaB movement during replication
Schematic representation of the initiation of bacterial DNA replication.
(a) E. coli oriC, showing DnaA boxes and the AT-rich DNA unwinding
element (DUE). The DnaA boxes contain 9 base pairs with consensus
sequence 5’-TTATNCACA (6). The high-affinity DnaA boxes are
colored in dark blue and lower affinity boxes in light blue. (b) Domain
organization of E. coli DnaA replication initiator protein. (c) DNA
melting at oriC and loading of the DnaB6–(DnaC)6 helicase–loader
complex onto the DNA bubble. Lower schematic: ATP-bound DnaA
binds to DnaA-boxes via Domain IV, thereby promoting dsDNA to
wrap around the DnaA filament, causing torsional strain to the dsDNA
[8,9]. Meantime, Domain III of DnaA binds to one of the two ssDNA
strands of DUE and stretches the strand. These interactions cause the
AT-rich DUE to melt, forming a bubble [4]. At the same time, binding
of DnaC traps DnaB like an open lockwasher, to enable its loading
onto ssDNA [10]. DnaC interacts with DnaA at the end of the filament
and serves as an adaptor to load one DnaB–DnaC complex [12]. It is
not known if closing of DnaB around ssDNA to form a hexameric ring
occurs before or concomitantly with dissociation of DnaC. Domain I of
DnaA interacts with the N-terminal domain of DnaB, helping to load
another DnaB–DnaC on the complementary strand [2]. Upper insets:
The helical filament of DnaA formed by Domains III (light orange) and
IV (pale green) of Aquifex aeolicus DnaA (PDB: 3R8F [4]) and Domain
IV of E. coli DnaA (pale green) bound to dsDNA (PDB: 1J1V [5]). The
ssDNA binds in the middle of the DnaA filament via interactions with
the AAA+ Domain III of DnaA.
Current Opinion in Structural Biology 2018, 53:159–168 www.sciencedirect.com
bacterial homologs have been solved as complexes, whole
proteins or domains [1]. Recent breakthroughs in singleparticle
cryo-electron microscopy (cryo-EM) have seen
structures determined of large replisome subassemblies,
even the whole bacteriophage T7 replisome, though so
far only at modest resolution [16
,17
,18
].
Cryo-EM structures of the E. coli Pol III core–clamp–tC
(C-terminal domain of the t subunit of the clamp-loader)
complexes on primer–template DNA in both polymerization
and proofreading modes were recently solved at
8 and 6.7 A˚ , respectively, along with structures of a DNAfree
complex [16
,17
] (Figure 3). These structures
resemble previously proposed structural models
[15,19,20], with some surprises. For example, in the
DNA-bound polymerization complex, the b2 clamp
becomes almost perpendicular to the DNA strands
(Figure 3a,b), in contrast to its tilted configuration in
the crystal structure of DNA-bound b2 [21]. While the
Pol III a polymerase subunit binds to DNA in a conformation
similar to the crystal structure of DNA-bound
Thermus aquaticus (Taq) a, the locations of C-terminal
domains (aCTD, comprising the OB and the t-binding,
TBD, domains) are different [22,23]. In the Taq a structure
and the DNA-free complex, the aCTD is close to the
polymerase active site with the OB domain positioned to
bind and deliver the ssDNA template into the active site
(Figure 3c,d). In the DNA-bound cryo-EM structures,
these domains are shifted toward the little finger domain
of a, the domain that directly contacts the b2 clamp; they
are therefore far away from the template strand entering
the active site (Figure 3e). The OB domain contacts both
the little finger and thumb domains of a as well as the b2
clamp and e. The face of the OB domain that had been
thought to be involved in ssDNA template binding
[24,25] now directly faces and is relatively close to the
dsDNA. Additionally, e wedges between the a thumb
domain and the clamp. This previously unappreciated
interaction network apparently stabilizes the whole
complex.
The proofreading complex is fairly similar to the polymerization
complex, with small movements of individual
protein components [17
] (Figure 3a,b). The most significant
movements include a rotation and a tilt of duplex
DNA against the plane of b2, locking the DNA against
the inner surface of the b2 ring (Figure 3b). The polymerase
thumb domain and e also move towards the DNA.
The thumb domain wedges between two DNA strands
with unmatched base pairs, resulting in a highly distorted
and frayed DNA substrate. The newly synthesized strand
is therefore able to reach the nuclease active site of e for
editing. Considering that the proofreading complex is
fairly similar to the polymerization complexes and duplex
Bacterial replisomes Xu and Dixon 161
Figure 2
}}
}
(a)
RNA primer
Lagging
strand
SSB
DnaB helicase
DnaG primase
Leading
strand
Pol III core
}
clamp loader
(CLC)
α
β2
β2
ε
θ
τ
δʹ
χ
δ
α
ε
θ
τ
δʹ
δ
(b)
RNA primerLagging
strand
SSB
DnaB helicase
DnaG primase
Leading
strand
Pol III core
}
clamp loader
(CLC) χ
α
ε
θ
τδδʹ α
ε
θ
θ
ε
α
ψ
ψ
Current Opinion in Structural Biology
Schematic representation of the E. coli replisome adapted from Lewis et al. [1]. (a) Textbook model of the E. coli replisome with coupled and
highly coordinated leading-strand and lagging-strand synthesis. Pol III* is connected to DnaB via the t subunit of the clamp-loader complex and
two or three polymerase cores of the same Pol III* replicate both leading-strand and lagging-strand DNA. The ssDNA in the lagging-strand loop is
bound by ssDNA-binding protein, SSB. (b) Recent studies have shown that E. coli Pol III* is readily exchangeable at the fork [33
,34
,35
] and
that leading-strand and lagging-strand synthesis may not be tightly coupled, or may even be accomplished by different Pol III HEs. The DnaB
helicase can also be decoupled from polymerases and translocate ahead at the apex of the fork [36
].
www.sciencedirect.com Current Opinion in Structural Biology 2018, 53:159–168
162 Catalysis and regulation
Figure 3
(e) DNA-bound
TBD
OB
DNA-free(d)
TBD
OB
(a)
(b)
β2 β2
α
ττC
θ
α
ε
proofreading complexpolymerization complex
polymerization complex
ε
αTBD
thumb
ε
proofreading complex
(c)
little
ring
middle
index
thumb PHP
palmactive site
αOB
Current Opinion in Structural Biology
Structures of the E. coli polymerase–clamp-tC–DNA complexes. (a) Surface representations of the polymerization (left) and proofreading (right)
complexes [16
,17
]. The N-terminal domains of a (aNTD, residues 1–963, are colored in deep salmon), and the OB (964–1072) and t-binding
domains (TBD, 1173–1160) of aCTD in brown and dark salmon, respectively, e in yellow, b2 in aquamarine, u in orange and tC in slate. The
polymerization complex does not include u, and tC and the aCTD are missing from the proofreading complex. (b) Cartoon representations of
Current Opinion in Structural Biology 2018, 53:159–168 www.sciencedirect.com
DNA with two unmatched base-pairs tends to fray, it is
proposed that e works passively by waiting for DNA to
reach its nuclease active center when a wrong nucleotide
is incorporated rather than responding actively to the
misincorporation event [17
]. In a complementary single-molecule
biophysical study [26], the clamp-bound Pol
III core has been shown to be remarkably stable and
processive in the proofreading mode in the absence of
incoming dNTPs.
A low-resolution (13.8 A˚ ) cryo-EM structure of the whole
bacteriophage T7 replisome, a simpler system functionally
similar to the bacterial replisomes, has been reported
[18
]. In the structure, leading-strand and lagging-strand
gp5 polymerases are placed in asymmetric positions and
their conformations and interactions with the gp4
helicase–primase protein are also significantly different.
The leading-strand polymerase is in a closed conformation,
interacting with both helicase and primase domains
of gp4 through its finger and exonuclease domains. On the
other hand, the lagging-strand polymerase is in an open
conformation and interacts exclusively with two other
primase domains of adjacent gp4 subunits using a similar
region of the exonuclease domain. The two polymerases
also interact with each other through the palm domain of
the leading-strand polymerase and the finger domain of
the lagging-strand polymerase. The structure provides
insights into how the two polymerases are organized
within the T7 replisome, which may in future be
extended to the host bacterial replisomes.
Coordination of leading-strand and
lagging-strand synthesis
While structures of bacterial replisomes and their subassemblies
continue to be elucidated, shedding light on their
flexibility and dynamics, views of how they work are also
undergoing paradigm-shifting changes. It was already
known that the bacteriophage T7 replisome, which is far
simpler to that from E. coli, is highly dynamic, with the
replicating polymerases quickly exchanging with external
polymerasesatforks.Perhapsanewpolymerasecanbeused
for every OF and more than one polymerase can simultaneously
synthesize different OFs [27]. Polymerases may
alsobe leftbehindtosynthesizeOFsbehindtheforks[28
].
Nevertheless, the bacterial replisomes have long been
believed to be highly coordinated, highly processive
machines capable of copying the whole chromosome
without dissociation. Two or three polymerase cores of
the same E. coli Pol III HE were believed to synthesize
both DNA strands, with the lagging strand polymerase
repeatedly being recycled for new OF synthesis. Lagging-strand
polymerase recycling has been debated to be
triggered by various collision or signaling mechanisms in a
well-controlled manner [1,29–31]. However, this elegant
textbook view has now been challenged [32]. Recent
studies find that bacterial polymerases also readily
exchange at replication forks and leading-strand and
lagging-strand DNA synthesis may not be tightly
coupled.
First, Yuan et al. [33
] showed that the E. coli Pol III a
D403E mutant, which can bind to primed DNA but not
extend it, can exchange with replicating polymerases.
The exchange happens only when the mutant polymerase
is attached to a clamp loader containing at least one t
subunit. Core polymerase itself is unable to exchange.
Soon polymerase exchange was reported inside E. coli
cells and in single-molecule in vitro assays. Using fluorescence
microscopy to track replisome components
inside cells, Beattie et al. [34
] were able to show that
several components of Pol III* (Pol III holoenzyme
lacking b2), including a, e, t, d and x, all resided at
the forks for about 10 s, only long enough for synthesis of
a few OFs. Meanwhile, b2 stayed for 47 s and the DnaB
helicase for 15 min. The very similar exchange times of
a, e, t, d and x suggest that it is Pol III* itself rather than
individual polymerase components that quickly
exchange, while the DnaB helicase in contrast serves
as a stable platform for reassembly of replisomes. Using
in vitro single-molecule assays, Lewis et al. [35
] demonstrated
that Pol III* exchanges in a concentrationdependent
manner; Pol III* is a stable complex that
exchanges as a single entity when it is present in excess
in solution, but remains bound and highly processive
when no spare Pol III* is available. These studies
suggest that E. coli DNA replication is not as processive
as it had been thought, and leading-strand and laggingstrand
synthesis is not necessary tightly coupled, considering
there is excess of Pol III* in cells. A more recent
in vitro single-molecule study showed that leadingstrand
and lagging-strand DNA synthesis by the E. coli
replisome can indeed be carried out in a decoupled and
stochastic way, in which both polymerases and helicase
work independently [36
].
Bacterial replisomes Xu and Dixon 163
(Figure 3 Legend Continued) complexes showing the differences in the primer–template DNA. In the polymerization complex (left), the DNA has
B-form structure, while in the proofreading complex, the primer DNA is frayed with the end of the newly synthesized strand in the active center of
e. The proofreading complex is rotated slightly to show DNA in the active center of e and the u subunit is omitted for clarity. (c) Surface
representation of aNTD from the DNA-bound polymerization complex ([16
], PDB: 5FKV), showing the thumb, palm, fingers, and PHP domains.
(d) Positioning of the aCTD in the DNA-free complexes (PDB: 5FKU). (e) Positioning of the aCTD in the DNA-bound polymerization complex (PDB:
5FKV) [16
]. While the OB domain in the DNA-free complex is close to the active site of Pol III a, it is far away in the DNA-bound complex. The
OB domain is colored in marine and the TBD in magenta. The aNTD (gray) in the two complexes shows relatively minor changes compared to
aCTD.
www.sciencedirect.com Current Opinion in Structural Biology 2018, 53:159–168
Considering the exchange of active polymerases at replication
forks, perhaps new Pol III* can be utilized to
synthesize new OFs at, or even behind, the replication
fork, as happens with the T7 replisome [27,28
]
(Figure 2b). Excess Pol III* can wait or scan for a
new primer and start to synthesize an OF once a new
primer is available. This may render unnecessary the
various mechanisms proposed to signal polymerase recycling
during or at conclusion of OF synthesis. Simultaneous
synthesis of more than one OF using different Pol
III*s is also possible, so the lagging-strand polymerase
does not need to synthesize faster than that making the
leading strand.
It is instructive briefly to explore how we came to
believe in the textbook view of fully coordinated replication
by the E. coli replisome. After many years of bulk
(ensemble) replication assays that defined the importance
and roles of the many protein components, it was
realized that (initiation) complexes could be assembled
on primer–template DNA that could progress, for
example on addition of nucleotides, to fast and processive
DNA elongation, implying retention of the components
of the (initiation) complex within replisomes.
Omission of some faster-exchanging components in the
elongation stage, like b2 and DnaG primase, reduced
processivity, so these components were routinely added
in that stage. The b2 clamp was subsequently shown
also to be capable of recycling from one lagging-strand
primer terminus to the next, but to a limited extent,
likely governed by whether the clamp-loader complex
had already bound a new b2 clamp from solution [37].
More recent studies, now using single-molecule
approaches that reveal alternate pathways for the first
time, show that other replisomal components like Pol
III* can also exchange when present in excess in
solution. Pol III* exchange involves a multipoint competitive
interaction mechanism that relies on the hierarchy
of strong and weak protein–protein and protein–
nucleic acid interactions in the replisome [27,35
,38],
and similar mechanisms have now been uncovered in
other multiprotein complexes [39–45] and have been
mathematically modeled [46–49]. These observations
are consistent with the basic principles of chemistry,
where multiple pathways can exist in parallel, governed
by thermodynamics and kinetics [32]. This redundancy
of potential pathways presumably enables timely completion
of chromosome duplication in the face of impediments
and makes the replisome more resilient to
mistakes.
Termination of DNA replication
Proper termination of DNA replication is important for
genome stability. E. coli replication terminates in the
region opposite oriC. There are ten 23-bp termination
(Ter) sites in the region with some sequence variations
that determine their binding affinities for the monomeric
termination protein Tus [50] (Figure 4a). Tus binds to Ter
with high affinity in 1:1 ratio, and Tus–Ter can further
form a very stable ‘lock’ complex if cytosine-6 of the
strictly conserved G–C(6) base pair of Ter is flipped out of
the DNA duplex and bound in a preformed cytosinebinding
pocket of Tus [51] (Figure 4b). The Tus–Ter lock
complex is polar with a permissive face that allows the
replisome to pass unhindered and a non-permissive face
that can block the replisome. The ten Ter sites are
organized as two oppositely orientated groups of five,
allowing the replisome to pass the first group and be
blocked at the second. This ensures that the two replication
forks converge in the terminus region for proper
chromosome segregation. However, the blockage efficiency
at any single Ter site never exceeds 50% in vivo
[52], a phenomenon that was recently explained. An in
vitro single-molecule study shows that the proportion of
replisomes passing or stalled at a Tus–Ter barrier is
determined by the speed of the advancing replisome
[53
]. Comparison of crystal structures of Tus in complex
with different Ter variants revealed that the a6/L3/a7
region of Tus undergoes the most significant conformational
changes, with residue Arg198 interacting extensively,
but differently, with the lagging-strand template
before and after lock formation (Figure 4c). It is suggested
that competition between the rates of Tus displacement
and rearrangement of the Arg198 interaction is critical for
lock formation. At high speed, Tus–Ter interactions cannot
rearrange quickly enough, resulting in Tus dissociation.
At lower speeds, the Tus–Ter interactions are able to
rearrange and the lock forms, permanently blocking the
replisome.
Another question concerning Tus–Ter is whether specific
interactions of Tus with the DnaB helicase are
required for replisome blockage. Using magnetic tweezers,
Berghuis et al. [54
] neatly demonstrated that forceinduced,
rather than DnaB-induced, separation of
duplex DNA is sufficient for Tus–Ter lock formation,
ruling out the obligate requirement of specific Tus–
DnaB interaction for replication fork blockage. The
results are consistent with the model that strand separation
itself leads to lock formation. This study also
identifies three Tus–Ter states with different lock dwell
times, with the longest-lived state corresponding to the
lock and two shorter-lived states likely the intermediates
before lock formation [54
,55]. Another study using
the T7 replisome showed that the replisome was
blocked at the non-permissive face, but T7 polymerase
alone proceeds to remove Tus unless the C(6) lock is
pre-formed. In contrast, the isolated T7 polymerase
approaching from the permissive face is arrested while
the replisome and helicase can pass. This suggests that
the Tus–Ter complex is also sensitive to the translocation
polarity of molecular motors, and further argues
against the significance of a specific interaction of Tus
with DnaB [56
].
164 Catalysis and regulation
Current Opinion in Structural Biology 2018, 53:159–168 www.sciencedirect.com
Conclusions
Bacterial DNA replication and the replisomes that mediate
it have been studied extensively for decades. Nevertheless,
our understanding continues to develop, and the
replisomes are still among the best experimental systems
to probe the ‘design principles’ that determine function of
highly dynamic multiprotein machines. Current insights
are primarily driven by use of single-particle cryo-EM to
probe structures and single-molecule biophysics to probe
dynamics. Recent progress includes the cryo-EM structures
of E. coli polymerase–clamp subassemblies in both
polymerization and proofreading modes and the whole
phage T7 replisome, coupled with changing views of
function driven by single-molecule biochemical studies
of the extent of coordination of leading-strand and lagging-strand
DNA synthesis by prokaryotic replisomes.
Biophysical studies reveal an intricate interaction network
in the polymerase core–clamp–clamp loader assemblies,
providing functional and structural insights into
replisomes. Meantime, ensemble and single-molecule
functional assays and fluorescence microscopy show that
the bacterial replisomes can work in a decoupled and
uncoordinated way, with polymerases able to quickly
exchange. Both leading and lagging-polymerases and
the replicative helicase appear to be able to work independently,
which is contradictory to the textbook view of
a highly coordinated machine.
Acknowledgements
The authors thank Slobodan Jergic, Jacob Lewis, Lisanne Spenkelink,
Samir Hamdan and Antoine van Oijen for lively discussions. This work was
supported in part by the Australian Research Council (DP150100956 and
Bacterial replisomes Xu and Dixon 165
Figure 4
oriC
oriC
TerJ
TerG
TerF
TerB
TerC
TerH
TerI
TerE
TerD
dif
HH L3
C(6)
α6 α7
DnaB
Pol III
Non-permissivePermissive
5’ TTAGTTACAACAT
3’ ATCAATGTTGTATAGT
ACC
T
(a) (b)
(c)
dsTerA (wt)
G6
A5
C6T5
R198
3’3’ ATCAATGTTGTATTCAATGTTGTATGATT
5’5’TTAGTTACAACATATAGTTACAACATACT
UGLC
G6
A5
C6
T5
R198
3’3’ ATCAATGTTGTATTCAATGTTGTATCATT
5’5’TTAGTTACAACATATAGTTACAACATAGT
Current Opinion in Structural Biology
Mechanisms of replisome blockage by Tus–Ter replication termination complexes. (a) Schematic representation of the E. coli chromosome,
showing positions of oriC and Ter sites. The clockwise moving fork passes through the permissive sites shown in green and is arrested at the
non-permissive sites shown in red. (b) Schematic representation of structure of the ‘locked’ Tus-Ter complex (PDB: 2I06), showing cytosine-6 in
its binding pocket in Tus. (c) Interactions of residue Arg198 of Tus with both strands of Ter in complexes with double-stranded wild-type Ter
(PDB: 2I05, left) and the Tus–Ter UGLC complex (GC(6) base pair inverted; PDB: 4XR3, right) [53
].
www.sciencedirect.com Current Opinion in Structural Biology 2018, 53:159–168
DP180100858) and King Abdullah University of Science and Technology,
Saudi Arabia (OSR-2015-CRG4-2644).
References and recommended reading
Papers of particular interest, published within the period of review,
have been highlighted as:
 of special interest
 of outstanding interest
1. Lewis JS, Jergic S, Dixon NE: The E. coli DNA replication fork.
Enzymes 2016, 39:31-88.
2. Chodavarapu S, Kaguni JM: Replication initiation in bacteria.
Enzymes 2016, 39:1-30.
3.

Richardson TT, Harran O, Murray H: The bacterial DnaA-Trio
replication origin element specifies single-stranded DNA
initiator binding. Nature 2016, 534:412-416.
This study identifies a repeating trinucleotide motif, 3’-G
/AAT-5’, in the
DNA unwinding region as a critical element of the bacterial DNA
replication origin. The AAA+ domains of the initiation protein DnaA bind
to these motifs and form a filament on the ssDNA, facilitating duplex
DNA melting.
4. Duderstadt KE, Chuang K, Berger JM: DNA stretching by
bacterial initiators promotes replication origin opening. Nature
2011, 478:209-213.
5. Fujikawa N, Kurumizaka H, Nureki O, Terada T, Shirouzu M,
Katayama T, Yokoyama S: Structural basis of replication origin
recognition by the DnaA protein. Nucleic Acids Res 2003,
31:2077-2086.
6. Jameson KH, Wilkinson AJ: Control of initiation of DNA
replication in Bacillus subtilis and Escherichia coli. Genes
2017, 8:E22.
7. Shimizu M, Noguchi Y, Sakiyama Y, Kawakami H, Katayama T,
Takada S: Near-atomic structural model for bacterial DNA
replication initiation complex and its functional insights. Proc
Natl Acad Sci U S A 2016, 113:E8021-E8030.
8. Bleichert F, Botchan MR, Berger JM: Mechanisms for initiating
cellular DNA replication. Science 2017, 355:eaah6317.
9. Erzberger JP, Mott ML, Berger JM: Structural basis for ATPdependent
DnaA assembly and replication-origin remodeling.
Nat Struct Mol Biol 2006, 13:676-683.
10. Arias-Palomo E, O’Shea VL, Hood IV, Berger JM: The bacterial
DnaC helicase loader is a DnaB ring breaker. Cell 2013,
153:438-448.
11. Chodavarapu S, Jones AD, Feig M, Kaguni JM: DnaC traps DnaB
as an open ring and remodels the domain that binds primase.
Nucleic Acids Res 2016, 44:210-220.
12. Mott ML, Erzberger JP, Coons MM, Berger JM: Structural
synergy and molecular crosstalk between bacterial helicase
loaders and replication initiators. Cell 2008, 135:623-634.
13. Stelter M, Gutsche I, Kapp U, Bazin A, Bajic G, Goret G, Jamin M,
Timmins J, Terradot L: Architecture of a dodecameric bacterial
replicative helicase. Structure 2012, 20:554-564.
14. Makowska-Grzyska M, Kaguni JM: Primase directs the release
of DnaC from DnaB. Mol Cell 2010, 37:90-101.
15. Jergic S, Horan NP, Elshenawy MM, Mason CE, Urathamakul T,
Ozawa K, Robinson A, Goudsmits JMH, Wang Y, Pan X et al.: A
direct proofreader–clamp interaction stabilizes the Pol III
replicase in the polymerization mode. EMBO J 2013, 32:1322-
1333.
16.

Fernandez-Leiro R, Conrad J, Scheres SHW, Lamers MH: CryoEM
structures of the E. coli replicative DNA polymerase reveal
its dynamic interactions with the DNA sliding clamp,
exonuclease and t. eLife 2015, 4:e11134.
The authors report cryo-EM structures of DNA-bound and DNA-freeE.
coli ae–b2–tC complexes at 8 A˚ . In both complexes, e bridges the a
thumb domain and the clamp. In the DNA-bound complex, the b2 clamp
rotates and becomes almost perpendicular to the DNA. The polymerase a
subunit binds to DNA in a conformation similar to the DNA-bound Taq a.
However, the C-terminal domains of a undergo significant movements
with an 35
rotation enabling the OB domain to contact the clamp, e and
finger and thumb domains of a, rather than being near the polymerase
active site.
17.

Fernandez-Leiro R, Conrad J, Yang JC, Freund SMV,
Scheres SHW, Lamers MH: Self-correcting mismatches during
high-fidelity DNA replication. Nat Struct Mol Biol 2017, 24:140-
143.
The authors present a cryo-EM structure of theE. coli aeu–b2–tC–DNA
complex in the proofreading mode. In the structure, the duplex DNA
rotates and tilts against the plane of b2, locking the DNA against the inner
surface of the b2 ring that stabilizes the complex. The polymerase thumb
domain wedges between two DNA strands near the polymerase active
center, resulting in a highly distorted and flayed DNA substrate, enabling
the newly synthesized strand to reach the nuclease active site of e for
editing. It is proposed that e works passively by waiting for DNA to reach
its active site after an incorrect nucleotide is incorporated.
18.

Kulczyk AW, Moeller A, Meyer P, Sliz P, Richardson CC: Cryo-EM
structure of the replisome reveals multiple interactions
coordinating DNA synthesis. Proc Natl Acad Sci U S A 2017, 114:
E1848-E1856.
This study presents a cryo-EM structure of the whole T7 replisome, in
which the leading-strand and lagging-strand polymerases are in asymmetrical
positions. Their conformations and interactions with the gp4
helicase–primase protein are different. The leading-strand polymerase is
in a closed conformation and interacts with both helicase and primase
domains of gp4, while the lagging-strand polymerase is in an open
conformation and interacts exclusively with two other primase domains
of adjacent gp4 subunits. The two polymerases also interact with each
other.
19. Ozawa K, Horan NP, Robinson A, Yagi H, Hill FR, Jergic S, Xu Z-Q,
Loscha KV, Li N, Tehei M et al.: Proofreading exonuclease on a
tether: the complex between the E. coli DNA polymerase III
subunits a, e, u and b reveals a highly flexible arrangement of
the proofreading domain. Nucleic Acids Res 2013, 41:5354-
5367.
20. Toste Reˆ go A, Holding AN, Kent H, Lamers MH: Architecture of
the Pol III–clamp–exonuclease complex reveals key roles of
the exonuclease subunit in processive DNA synthesis and
repair. EMBO J 2013, 32:1334-1343.
21. Georgescu RE, Kim SS, Yurieva O, Kuriyan J, Kong X-P,
O’Donnell M: Structure of a sliding clamp on DNA. Cell 2008,
132:43-54.
22. Bailey S, Wing RA, Steitz TA: The structure of T. aquaticus DNA
polymerase III is distinct from eukaryotic replicative DNA
polymerases. Cell 2006, 126:893-904.
23. Wing RA, Bailey S, Steitz TA: Insights into the replisome from
the structure of a ternary complex of the DNA polymerase III
a-subunit. J Mol Biol 2008, 382:859-869.
24. Theobald DL, Mitton-Fry RM, Wuttke DS: Nucleic acid
recognition by OB-fold proteins. Annu Rev Biophys Biomol
Struct 2003, 32:115-133.
25. Georgescu RE, Kurth I, Yao NY, Stewart J, Yurieva O, O’Donnell M:
Mechanism of polymerase collision release from sliding
clamps on the lagging strand. EMBO J 2009, 28:2981-2991.
26. Park J, Jergic S, Jeon Y, Cho W-K, Dixon NE, Lee J-B: Dynamics
of proofreading by the E. coli Pol III replicase. Cell Chem Biol
2018, 25:57-66.e4.
27. Geertsema HJ, van Oijen AM: A single-molecule view of DNA
replication: the dynamic nature of multi-protein complexes
revealed. Curr Opin Struct Biol 2013, 23:788-793.
28.

Duderstadt KE, Geertsema HJ, Stratmann SA, Punter CM,
Kulczyk AW, Richardson CC, van Oijen AM: Simultaneous realtime
imaging of leading and lagging strand synthesis reveals
the coordination dynamics of single replisomes. Mol Cell 2016,
64:1035-1047.
The authors use multidimensional single-molecule tethered-bead assays
to simultaneously image leading-strand and lagging-strand DNA synthesis
by the T7 replisome. They observe that most DNA loops form during
primer synthesis. The study also suggests that the majority of polymerases
loaded onto the new primers are left behind the replisome to
complete Okazaki fragment synthesis.
166 Catalysis and regulation
Current Opinion in Structural Biology 2018, 53:159–168 www.sciencedirect.com
29. Dohrmann PR, Manhart CM, Downey CD, McHenry CS: The rate
of polymerase release upon filling the gap between Okazaki
fragments is inadequate to support cycling during lagging
strand synthesis. J Mol Biol 2011, 414:15-27.
30. Yuan Q, McHenry CS: Cycling of the E. coli lagging strand
polymerase is triggered exclusively by the availability of a new
primer at the replication fork. Nucleic Acids Res 2014, 42:1747-
1756.
31. Spiering MM, Hanoian P, Gannavaram S, Benkovic SJ: RNA
primer–primase complexes serve as the signal for polymerase
recycling and Okazaki fragment initiation in T4 phage DNA
replication. Proc Natl Acad Sci U S A 2017, 114:5635-5640.
32. van Oijen AM, Dixon NE: Probing molecular choreography
through single-molecule biochemistry. Nat Struct Mol Biol
2015, 22:948-952.
33.

Yuan Q, Dohrmann PR, Sutton MD, McHenry CS: DNA
polymerase III, but not polymerase IV, must be bound to a
t-containing DnaX complex to enable exchange into
replication forks. J Biol Chem 2016, 291:11727-11735.
TheE. coli Pol III a D430E mutant, which can bind to primed DNA but is
incapable of nucleotide incorporation, inhibits DNA synthesis by preassembled
replisomes containing wild-type a. The inhibition only occurs
when the mutant polymerase core is attached to a clamp loader containing
at least one t subunit. The mutant polymerase core itself does not
inhibit, suggesting that Pol III*, and only Pol III*, can exchange with a
replicating polymerase.
34.

Beattie TR, Kapadia N, Nicolas E, Uphoff S, Wollman AJM,
Leake MC, Reyes-Lamothe R: Frequent exchange of the DNA
polymerase during bacterial chromosome replication. eLife
2017, 6:e21763.
The authors study the behavior of replication proteins inE. coli live cells
using fluorescence microscopy. Their results suggest that Pol III* in the
replisome exchanges on a 10 s timescale with free Pol III* from solution.
Meanwhile, the DnaB helicase stays bound to the replication fork for
much longer, providing a platform for reassembly of a new replisome.
Based on the results, it is proposed that both leading-strand and laggingstrand
synthesis can be discontinuous.
35.

Lewis JS, Spenkelink LM, Jergic S, Wood EA, Monachino E,
Horan NP, Duderstadt KE, Cox MM, Robinson A, Dixon NE et al.:
Single-molecule visualization of fast polymerase turnover in
the bacterial replisome. eLife 2017, 6:e23932.
Usingin vitro single-molecule assays with fluorescently labeled polymerases,
the authors demonstrate that replicating polymerases can
quickly exchange with excess Pol III* complex at replication forks in a
concentration-dependent manner. This exchange mechanism ensures a
balance between stability and plasticity of the replisome, allowing its
components to be replaced when necessary.
36.

Graham JE, Marians KJ, Kowalczykowski SC: Independent and
stochastic action of DNA polymerases in the replisome. Cell
2017, 169:1201-1213.
Using single-moleculein vitro assays, the authors show that DNA replication
by the E. coli replisome is kinetically discontinuous. The leadingstrand
and lagging-strand polymerases function independently and are
not coordinated. The DnaB helicase can continue to unwind dsDNA when
polymerases pause, but at a significantly reduced rate, allowing polymerases
to catch up. The authors suggest that the stochastic behavior of
individual components allows DNA to be replicated without coordination
of synthesis of both strands.
37. Tanner NA, Tolun G, Loparo JJ, Jergic S, Griffith JD, Dixon NE, van
Oijen AM: E. coli DNA replication in the absence of free b
clamps. EMBO J 2011, 30:1830-1840.
38. Geertsema HJ, Kulczyk AW, Richardson CC, van Oijen AM:
Single-molecule studies of polymerase dynamics and
stoichiometry at the bacteriophage T7 replication machinery.
Proc Natl Acad Sci U S A 2014, 111:4073-4078.
39. Delalez NJ, Wadhams GH, Rosser G, Xue Q, Brown MT,
Dobbie IM, Berry RM, Leake MC, Armitage JP: Signal-dependent
turnover of the bacterial flagellar switch protein FliM. Proc Natl
Acad Sci U S A 2010, 107:11347-11351.
40. Graham JS, Johnson RC, Marko JF: Concentration-dependent
exchange accelerates turnover of proteins bound to doublestranded
DNA. Nucleic Acids Res 2011, 39:2249-2259.
41. Paramanathan T, Reeves D, Friedman LJ, Kondev J, Gelles J: A
general mechanism for competitor-induced dissociation of
molecular complexes. Nat Commun 2014, 5:5207.
42. Gibb B, Ye LF, Gergoudis SC, Kwon Y, Niu H, Sung P, Greene EC:
Concentration-dependent exchange of replication protein A
on single-stranded DNA revealed by single-molecule imaging.
PLoS One 2014, 9:e87922.
43. Chen TY, Santiago AG, Jung W, Krzeminski Ł, Yang F, Martell DJ,
Helmann JD, Chen P: Concentration- and chromosomeorganization-dependent
regulator unbinding from DNA for
transcription regulation in living cells. Nat Commun 2015,
6:7445.
44. Ma CJ, Gibb B, Kwon Y, Sung P, Greene EC: Protein dynamics of
human RPA and RAD51 on ssDNA during assembly and
disassembly of the RAD51 filament. Nucleic Acids Res 2017,
45:749-761.
45. Chen T-Y, Cheng Y-S, Huang P-S, Chen P: Facilitated
unbinding via multivalency-enabled ternary complexes: new
paradigm for protein–DNA interactions. Acc Chem Res 2018,
51:860-868.
46. Sing CE, Olvera de la Cruz M, Marko JF: Multiple-binding-site
mechanism explains concentration-dependent unbinding
rates of DNA-binding proteins. Nucleic Acids Res 2014,
42:3783-3791.
47. A˚ berg C, Duderstadt KE, van Oijen AM: Stability versus
exchange: a paradox in DNA replication. Nucleic Acids Res
2016, 44:4846-4854.
48. Tsai MY, Zhang B, Zheng W, Wolynes PG: Molecular mechanism
of facilitated dissociation of Fis protein from DNA. J Am Chem
Soc 2016, 138:13497-13500.
49. Dahlke K, Sing CE: Facilitated dissociation kinetics of dimeric
nucleoid-associated proteins follow a universal curve. Biophys
J 2017, 112:543-551.
50. Neylon C, Kralicek AV, Hill TM, Dixon NE: Replication termination
in Escherichia coli: structure and antihelicase activity of the
Tus–Ter complex. Microbiol Mol Biol Rev 2005, 69:501-526.
51. Mulcair MD, Schaeffer PM, Oakley AJ, Cross HF, Neylon C,
Hill TM, Dixon NE: A molecular mousetrap determines polarity
of termination of DNA replication in E. coli. Cell 2006, 125:1309-
1319.
52. Duggin IG, Bell SD: Termination structures in the Escherichia
coli chromosome replication fork trap. J Mol Biol 2009,
387:532-539.
53.

Elshenawy MM, Jergic S, Xu Z-Q, Sobhy MA, Takahashi M,
Oakley AJ, Dixon NE, Hamdan SM: Replisome speed
determines the efficiency of the Tus–Ter replication
termination barrier. Nature 2015, 525:394-398.
This study shows that the proportion of replisome passing or stalled at
Tus–Ter barriers is determined by the speed at which the replisome is
advancing. Comparison with the crystal structures of Tus in complex with
Ter variants reveals that residue Arg198 of Tus has extensive, but
different, interactions with the lagging strand before and after lock
formation. It is therefore suggested that competition between rates of
Tus displacement and rearrangement of Tus–Ter interactions is critical for
lock formation.
54.

Berghuis BA, Dulin D, Xu Z-Q, Van Laar T, Cross B, Janissen R,
Jergic S, Dixon NE, Depken M, Dekker NH: Strand separation
establishes a sustained lock at the Tus–Ter replication fork
barrier. Nat Chem Biol 2015, 11:579-585.
The authors use magnetic tweezers to show that formation of a stable
Tus–Ter lock complex requires physical separation of duplex DNA but not
protein–protein interactions, excluding the possibility that a Tus–DnaB
interaction is required for replisome blockage. The study also identifies
three Tus–Ter states with different lock dwell times, with the longest-lived
state corresponding to the lock and the two shorter-lived states likely to
be intermediates before lock formation.
55. Berghuis BA, Raducanu V-S, Elshenawy MM, Jergic S, Depken M,
Dixon NE, Hamdan SM, Dekker NH: What is all this fuss about
Tus? Comparison of recent findings from biophysical and
biochemical experiments. Crit Rev Biochem Mol Biol 2018,
53:49-63.
Bacterial replisomes Xu and Dixon 167
www.sciencedirect.com Current Opinion in Structural Biology 2018, 53:159–168
56.

Pandey M, Elshenawy MM, Jergic S, Takahashi M, Dixon NE,
Hamdan SM, Patel SS: Two mechanisms coordinate replication
termination by the Escherichia coli Tus–Ter complex. Nucleic
Acids Res 2015, 43:5924-5935.
This study shows that the T7 replisome is blocked at the non-permissive
face of the Tus–Ter complex. Surprisingly, isolated T7 polymerase
can bypass the Tus–Ter barrier from the non-permissive end unless C
(6) is unpaired beforehand. In contrast, isolated T7 polymerase
approaching from the permissive face is arrested. This suggests that
the Tus–Ter complex is sensitive to the translocation polarity of
molecular motors.
168 Catalysis and regulation
Current Opinion in Structural Biology 2018, 53:159–168 www.sciencedirect.com